JPH07508401A - Novel antibodies for treatment and prevention of respiratory syncytial virus infections in animals and humans - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] 32, encoding the protein under the control of regulatory sequences capable of replicating and expressing the protein; culturing a suitable cell line transformed with the nucleic acid sequence and The method for producing a fusion protein according to claim 1, which comprises obtaining the protein expressed from a cell system. .

33 From producing fusion proteins or antibodies in transgenic animals A method for producing the fusion protein according to claim 1 or the modified antibody according to claim 17.

Specification Novel antibodies for treatment and prevention of respiratory syncytial virus infections in animals and humans field of invention The present invention generally relates to monoclonal and recombinant humanized antibodies, and particularly to respiratory antibodies. Concerns the field of antibodies for epitopes on syncytial viruses.

Background of the invention Respiratory syncytial virus (R8V) iridae) and is a serious respiratory virus in children and calves during the first year of life. A major cause of low-functioning respiratory infections [Kim Qim et al., American Jar Nar of Epidemiorono (^1IerJ, Epidemio1.), 9 8: 216-225 (1973) Stott et al. Null of Hygene (J, Hygene), 85: 257-270 (1980): Edited by B.N. Fields et al. Virology Raven Press Ni New York (1990), Matskintrash (licIntosh) and Chi. Chanock]. Human and bovine R3V strains are antigenically different but closely related, two subspecies have been identified, both human and bovine. [Lerch et al. Journal of Virology (J, Virol) , 63:833-840 (1989): Underrun (Anderson) et al., Journal of Infectious Diseases (J, Infect, D. is, ), 151: 626 633 (1985)].

The use of anti-R3V antibodies for R3V therapy in murine and orchid species has been suggested. There is. However, treatments for non-rats and non-swine species are limited to non-native rodents and Potentially limited by the immunoreactivity of these species to human antibodies.

For example, human immunoreactivity to murine antibodies is determined by immunoglobulin abnormalities and This is seen in the variable region.

In the field, protective epitopes on the R3V protein and the immune system that protects against infection are known. Specific identification of R3V effector mechanisms and use for safe and effective R3V vaccines Producing and characterizing R3V antigens, epitopes and antibodies against them for There is a need to

Summary of the invention The present invention provides various forms of anti-R3V antibodies and functional fragments thereof, including CDRs. provide These antibodies and fragments are anti-RSV monoclonal antibodies (mAbs) A fusion protein characterized by the binding specificity and/or neutralizing activity of Useful for construction of chimeric and humanized antibodies. The present invention also provides human immunoglobulin Provides a novel humanized antibody containing a bovine antibody variable region linked to the backbone and constant regions of do. These further include therapeutic and pharmaceutical compositions for the treatment of RSV. A method of making the product is also disclosed.

Other aspects and advantages of the invention are described in the detailed description below.

Brief description of the drawing Figure 1 shows the C to 8 substitution cloned into the polylinker of pGEM4. cDNA of F glycoprotein of R3V long 5 train with FIG. 3 is a graph showing the isolation of the LF1/1298 recombinant plasmid with A. the group The replacement plasmid expresses the F protein in the selected host cell.

Figure 2 shows the hydrophobic region (1), proteolytic processing site (↓), and N-glyco Possible sites of norization (^), cysteine residues (・) and neutralization escapes Mutant strains (neutralization escape 5utants) This is a diagram of the primary structure of the F-sugar amount showing the amino acid residues (-) that have changed during the process. .

Figures 3A and 3B show a portion of the B4 antibody and the variable region antibodies of the B13/B14 antibody ( Compare the amino acid sequences of VL) [SEQ ID NO: 1 and 21]. B4 arrangement is above B13/B14 sequences and a comparison between the sequences is shown. During the array, “-” indicates a gap in the sequence that was introduced to improve the connectivity between sequences. vinegar. CDRs are shown in boxes. The underlined sequences represent the amplified sequences of these antibodies. Polymerase chain reaction (PCR) oligonucleotide primers used for Corresponds to an array.

Figures 4A and 4B show a portion of the B4 antibody and the variable region H of the B13/B14 antibody. The amino acid sequence of VH (SEQ ID NO: 3 and 4) was first converted into B13/B1. Compare with the B4 sequence reported for 4 sequences. Symbol r-J, CDR and PCR The oligonucleotide primer sequences are defined as in Figures 3A and 3B. , as shown.

Figure 5 shows the +xs1 labeled against RSV A2 strain when increasing the amount of unlabeled antibody. Bar diagram showing competitive binding of 10 anti-bovine mAbs identified. .

“Neutralization (Neut. J.) shows that mAb neutralizes RSV in plaque neutralization analysis. Show what you can do. “Fusion inhibition (Fr) J inhibits the fusion of multinucleated giant cells in analysis. Indicates the ability of the antibody to inhibit. “Protection J is in-vivo analysis We show whether the mAb can protect mice from RS■ infection.

Symbol: Binding rate at maximum amount of competitive antibody tested is 10% or less (■), 11 80% (diagonal line) 80% or more (b).

FIG. 6 is a bar diagram showing competitive binding of anti-F murine mAb.

``Neutralization (Neut) J, ``Fusion Inhibition (FI) J, ``Protecti on) J and symbols are also the same as defined in FIG.

Figure 7 shows RSV A2 strain and antibody escape mutant R8■. Bar diagram showing binding of anti-FmAb. . microtiter ELI SA using purified virus shown at the top of the figure to cover the rate The antibodies were tested. Symbol Adsorption value obtained for A2 strain is 20% or less (■) , 20 to 80% (diagonal line) 80% or more (b).

Figure 8. Binding of anti-FmAb to RSV light chain and antibody escape mutant R3V. This is a bar diagram showing. The antibodies tested are shown in Figure 7. Symbol: L chain If the adsorption value obtained is 25% or less (blank), 25 to 50% (hatched), 50 % or more (■).

Figure 9 shows numbers 266 to 27 of RSV F protein bound to a polyethylene bottle. The individual amino acids in the sequence corresponding to amino acid number 3 [SEQ ID NO: 19] are mAbB against a synthetic octamer peptide in which other amino acids (horizontal axis) are substituted. 8 bar diagram showing the combination of 4. of individual bar diagrams The amino acid sequences below indicate which amino acids were substituted (indicated by boxes surrounding the letters). vinegar. Antibody binding was tested by ELISA, black bars are for the original sequence of the peptide. The adsorption values obtained are shown, the gray bars are those obtained for peptides containing substituted amino acids. Indicates the closing price.

Figure 10 shows that bovine mAb B4 is the donor antibody [SEQ ID NO: 5]. Humanized VH region sequence B4HuVH. CDRs are indicated by boxes. in framework , underlined residues are the remaining murine regions.

Figure 11 shows the contiguous predicted human VH region sequences used to construct engineered antibodies. B4HuVK, in which B4 is the donor antibody [SEQ ID NO: 6].

CDRs are indicated by boxes.

Figures 12'A and 12B show adjacent predicted human antibodies used to construct engineered antibodies. ・VH region sequence B13/B14HuVH [sequence number near], among which, B13/B14 are donor antibodies. CDRs are indicated by boxes, remaining murine residues are underlined.

Figure 13 shows the predicted humanized constant region H region B13/B14HuVK [SEQ ID NO. 8], in which 813/B14 is the donor antibody. CDRs are indicated by boxes.

Figures 14A and 14B show adjacent DNA sequences for the VH domain of RSV19. and the corresponding amino acid sequences [SEQ ID NOs: 9 and 10 are shown. CDRs are shown in boxes. vinegar. Underlined sequences correspond to the primers used.

Figures 15A and 15B show adjacent DNA sequences and and the corresponding amino acid sequences [SEQ ID NO: 11 and 12]. CDR in box show. Underlined sequences correspond to the primers used.

Figure 16 shows human Ig (immunoglobulin) VH region structure and murine R3V1. Plasmid pHuR8V19VH consisting of CDRs from 9 is shown.

Figure 17 shows the structure of the human IgVLg region and the CDRs derived from murine R3V19. The plasmid pHuR3V19VK is shown.

Figure 18 shows the derivative encoded by murine R3V19VH [SEQ ID NO: 13]. Figure 2 shows the Ig variable region amino acid sequence.

Figure 19 shows the induced protein encoded by pHuR3V19VH [SEQ ID NO: 14]. The amino acid sequence of the Ig variable region is shown.

Figure 20 shows pHuRsV19VHFNs [SEQ ID NO: 15] 1n, k”J )-derived Ig variable region amino acid sequences.

Figure 21 is encoded by pHuRsV19VHNIK [SEQ ID NO: 16]. Figure 2 shows the derived Ig variable region amino acid sequences.

FIG. 22 shows pHuR9V19VK　C SEQ ID NO: 17]1. : more coded Figure 2 depicts the derived Ig variable region amino acid sequence.

Figure 23 shows the DNA encoding HuVL structure 4 [SEQ ID NOs: 20 and 21] and and amino acids, indicating possible cleavage sites. Underlined bases are substituted and pure J1 gene sequence [SEQ ID NO: 22] is provided.

Detailed description of the invention ■, Definition The term “first fusion partner” in this specification artner) J is an anti-antibody against the selected antibody, preferably an anti-R8V antibody. H chain variable region, L chain variable region, CDR, functional fragment thereof or A nucleic acid sequence encoding all or part of the amino acid sequence of that analog. Ru.

As used herein, the term "second fusion partner" er) J indicates that the first fusion partner is in the structure or in the desired conventional linker sequence. Another nucleotide sequence encoding the protein or peptide to which it is fused. Ru. Such a second fusion partner can be, for example, a suitable human constant or framework. may contain a nucleic acid sequence encoding a secondary antibody of interest, such as .

A "fusion molecule" is the product of a first fusion partner operably linked to a second binding partner. It is. The "operable linkage" of the fusion partner means that the anti-R3V sequence from the donor antibody ( Not only the antigen specificity of the first fusion partner) but also the desired properties of the second fusion partner defined as a meeting where For example, if a nucleic acid sequence encoding an amino acid linker is A second fusion phase may be used if desired, or alternatively via fusion in a frame. It may also be connected to the hand.

A "fusion protein" is the result of the expression of a fusion molecule. Such fusion proteins can be used, for example, as antibody, humanized antibody or immunoglobulin or non-immunogenic antibody identified in the present invention. Any region of an antibody that is fused to epiglobulin protein and similar proteins. It's okay.

As used herein, the term [donor antibody] J refers to a natural Antibodies (polyclonal, monoclonal or recombinant) derived from the nucleic acid sequence of ) or a modified variable region and/or a modified variable region, its CDR or first other functional fragments or analogs thereof to the fusion partner and of the donor antibody. A fusion molecule with characteristic antigen specificity or neutralizing activity and the resulting fusion protein. One example of a donor antibody suitable for use in the present invention is bovine mAb B4 or B13/B14.

As used herein, the term "acceptor antibody" refers to an antibody (polyclonal antibody) different from the donor antibody. monoclonal, monoclonal or recombinant), but the patient to be treated (human or or bovine), and the variable region H chain and/or L chain is homologous to the second fusion partner. chain framework and/or its heavy chain and/or light chain constant region. provide all or a major portion of the nucleic acid sequence being coded. Preferably, human antibodies Use as receptor antibody.

rcDRj is a large group of contact residues for antibody binding to an antigen or epitope. Complementarity determination of antibodies that provide large numbers of hypervariable regions of immunoglobulin heavy and light chains Defined as a region amino acid sequence. In the present invention, the target CDR is the donor antibody. derived from the body's heavy and light chain sequences, including functional fragments and analogs of natural CDRs. fragments and analogs are also identical to the donor antibody from which they are derived. Share or maintain antibody binding specificity and/or neutralizing ability . CDR references indicated by boxes in Figures 3A, 3B, 4A, 4B and 10 to 13. Light. “By virtue of sharing antibody binding specificity or neutralizing capacity, e.g. , mAb B13/B14 is characterized by a certain level of antigen affinity and In a structural environment, the CDRs encoded by the B13/B14 nucleic acid sequences are Even if the CDRs of B13/B14 have low affinity in such an environment, is expected to recognize B13/B14 as the same epitope. means.

“Functional fragment J has the same antigen-binding specificity and/or Partial CDR sequences or partial H chain or L chains that retain neutralizing ability It is a variable part array.

[Analog] means at least one amino acid substitution, amino acid modification or chemical An amino acid or peptide sequence that has been modified by a specific substitution; The acid sequence, for example, retains the antigen-specific biological properties of the unmodified sequence.

"Allelic variation or modification" refers to a nucleic acid sequence encoding an amino acid of the invention. sequence or peptide sequence. Such changes or modifications may result in a reduction in the genetic code. It may be due to heavy weight, or it may be intentionally created and exhibit desired properties. It may be. These changes or modifications are changes in the encoded amino acid sequence. It may or may not occur.

The term "modified antibody" as used herein refers to the L and/or selected receptor antibodies. or a portion of the variable domain of the heavy chain has specificity for a selected epitope. replaced by similar portions of the CDRs from one or more donor mAbs that have One form of fusion protein that has been antibodies). These engineered antibodies also have receptor mAb light and/or heavy chains. By minimal modification of the nucleic acid sequence encoding the variable domain framework characterized and retains donor mAb binding specificity. These antibodies globulin (Ig) constant regions and variable region frameworks from receptor mAbs. and one or more CDs from the anti-R3V donor antibodies described herein. It may consist of R.

A “chimeric antibody” is a non-human antibody that is associated with the L chain and H constant region derived from a human receptor antibody. Natural variable and heavy chains (both CDR and structure) derived from human donor antibodies This is one form of modified antibody that includes.

A "humanized antibody" refers to its CDRs and/or non-human donor immunoglobulin, i.e. residual immunoglobin derived from one or more human immunoglobulins. Light and/or heavy chain variable domain structure derived from part of a molecule derived from Robulin It is a modified antibody that has a part of. Such antibodies also target unmodified donor or acceptor Decorative chain or humanized H chain associated with chimeric LM or vice versa (donor or or the unmodified H chain of the receptor or the humanized chain associated with chimeric Ha). Contains a characteristically engineered antibody.

An "effector agent" is a fusion protein and/or a natural or synthetic agent. The donor antibody fragments or heavy chains or other fragments of the donor antibody are assembled in a conventional manner. It is a non-protein carrier molecule that can Such non-protein carriers include, for example, polystyrene or other Useful in plastic beads or in the medical field and can be administered to humans and animals. It includes conventional carriers useful in the diagnostic field, such as non-protein substances that are safe to administer.

Other effector agents include heavy metal atoms or toxic substances such as ricin. Macrocytes may be included for chelating. The effector agent is an amino acid. Useful for extending the half-life of anti-RSV derived sequences.

11 Anti-R3V antibody Non-human species can be used to construct antibodies, fragments and fusion proteins of the invention. haustorian syncytial virus (RSV) F protein or peptide epitope derived therefrom produce the desired immunoglobulin that provides the protein. conventional hybridoma hand hybridoma cells secreting non-human mAbs directed against the R3V peptide. Provides a cell system.

For example, some neutralizing, fusion-inhibiting (Fl) and highly protective bovine and Murine anti-R3V monoclonal antibodies (mAbs) are provided by the invention.

Fl proteins, B13 and B14 and herein designated B4, B7 to BIO. Other suitable bovine mAbs named and herein named 16 to 21 Generating and characterizing bovine antibodies capable of binding to Fuzumi mAbs Details are given in Examples 1 and 21 and FIGS. 5 and 6.

The resulting B13 and B14 anti-R3V antibodies were tested against R8 in a plaque reduction neutralization test. ■Characterize by neutralizing ability. Both B13 and B14 were potent in fusion inhibition assays. is observed and is protective in mice. Competitive studies have focused on F protein fragments and B13 and B13, along with studies of antibody escape mutants that bind to synthetic peptides. The epitope recognized by mAb RSV19 (mAb 19 or is similar to the epitope recognized by R3MU19 (known as R3MU19). Good, but suggests not the same. G2+ class immunoglucose specific for F protein Amino acids 417 to 438 of Robulin are prepared in Example 11 below and in the PCT patent. It is described in application no. PCT/GB91101554. After sequencing, B13 and B14 was found to be virtually identical, and in some cases B1 as a single antibody. It is called 3/B14. mAb B13 or B14 if antibodies are tested separately That's what it means.

The inventor discovered that the previously disclosed anti-RS VmAb, B4, was caused by Uso-RSV. It is effective not only in protecting calves from R8V infection, but also in protecting mice from human and R8V infection. I confirmed that there is. The ability of B4, a bovine mAb, to be administered to calves by the intratracheal route. When administered to patients, it is possible to prevent the development of low-grade respiratory tract infections and respiratory disorders caused by RSV. Protective potential of mAbs in controlling respiratory disease in calves It has been shown to be a targeted and therapeutic agent. B4 also inhibits fusion and It is also capable in virus neutralization assays (Examples 16 and 17).

These three mAbs B4, B13 and B14 are used for pharmaceutical or prophylactic purposes. It has been identified as a desirable antibody that can be modified for use. However, the present invention It is not limited to the use of these three mAbs or to the use of these hypervariable region sequences.

These mAbs may be included in any part of the description below that describes the products and methods of the invention. Even if the donor antibody is identified as B4, B13 or B14 in any other Suitable anti-R3V neutralizing antibodies and corresponding anti-RSV CDRs are substituted therefor. sell.

RSV F protein epitome from amino acid 266 to amino acid 273 developed for R3V epitopes as well as other R3V epitopes of interest herein. Other antibodies have been shown to be effective against RSV in mice, calves and humans, as well as in other species. It is anticipated that it may be useful in the therapeutic aspects of the invention. hybridoma An antibody library containing the product, or one or more antibodies as described in the Examples below. More bogus antibodies or conventional antibodies using the R8V epitope described herein. Search libraries from all species of immunoglobulins in competitive analysis By doing so, other anti-R3V antibodies can be developed. Neutralizing and protective mAbs B4 and B13/14 are particularly preferred for searching for additional antibodies.

Thus, the present invention is directed to the 266th position of F protein other than B4 or B13/14. R3V peptide or other related amino acid range ITNDQKKL at position 273 The present invention provides antibodies capable of binding to the epitope of interest. This antibody may also be a mAb. or modified antibodies or analogs of such antibodies, Fab fragments thereof, or F( ab')z fragment. generated against the desired R3V epitope and custom Such other mAbs prepared using commercial techniques include, without limitation, murine mAbs, human mAbs, Includes Abs and binding antibodies.

These anti-RSV antibodies may be used as pharmaceuticals for the treatment of RSV in humans or other animals. and therapeutic compositions.

IIl, antibody fragment The above anti-R3V antibody contains the antibody's main and heavy chain variable region sequences and CDR peptides. may be useful as a donor for desired functional fragments containing.

The present invention also uses RS as an in vivo protective agent against R8V infection and disease. Fab fragments or F(ab')x fragments derived from mAbs directed against epitopes of V. Contains a piece. The Fab fragment consists of half of the H chain and one L chain, F(ab' )s fragments are two Fab fragments joined by a nosulfide bond. mAb B 13/14 or other suitable RSV containing antibodies can provide the source for these fragments. Ru.

These raw materials include, for example, the appropriate proteolytic enzymes papain and/or Obtained by conventional methods such as cleavage of mAbs with psin.

These Fab and F(ab')z fragments are associated with RSV in humans and other animals. It is also useful as a donor for subchain sequences, CDRs, and other functional fragments.

IV Target RSV Fab protein epitope The above mAb is Certain protective epitopes on the RSV fusion (F) protein that are recognized by the host in Recognize taupe. Nucleic acid sequence of F mRNA and predicted F protein (fusion protein) protein sequence [SEQ ID NO: 19 was previously published by Collins et al. Seedings of Su/Yonal Academy of Science Ninis Knee (Proc, Natl^cad, Sci, tls^) 81: 76 83-7687 (1984). Amino acid numbers in this specification The numbering is the same as this latter document. The inventor discovered that the 266th to 2nd portions of the F protein Eight amino acids at position 73 [SEQ ID NO: 191 were selected as suitable for searching for neutralizing antibodies. as a valuable target and as a useful antigen for therapeutic agents for RSV, and in particular for RSV. A monoclonal antibody was identified for this purpose. Other epitopes of interest can be neutralized Epitope around amino acid position 429 recognized by antibodies B13 and B14 Including.

The neutralizing, fusion-inhibiting and highly protective bovine and murine mAbs of the present invention The corresponding region of F protein [SEQ ID NO: 19E] was determined by competitive binding analysis (Example 6). Antibody neutralizing escape mutants were isolated and sequenced (Examples 7 and 8) and peptides with sequences containing altered amino acids in escape mutants. Synthesis of peptides and evaluation of reactivity of these peptides using mAbs (Example 9) 11) was performed.

Sequence analysis of the F protein of the antibody escape mutant strain [SEQ ID NO: 19] shows that it is highly protective. allows identification of amino acid residues important for mAb binding. Similarly, synthetic peptides Information regarding the binding of protective mAbs to positioning.

Briefly, most bovine mAbs are recognized by murine mAbs. A protective antibody site (site II in Figure 8) that recognizes epitopes similar to But by both bovine and murine mAbs, which are natural R5V hosts! I! recognized Ru.

Epitopes recognized by protective bovine mAbs B13 and B14 may be the same as any epitope recognized by the murine mAb. Seem. B13 and B14 are regions near the 429th amino acid of F protein join to. This epitope is similar, but murine mAb R8V1 9 (PCT Patent Application No. PCT/GB91101554 and Example 11) This is different from the Fab that is recognized by other manufacturers. For example, mAb B13/B14 has SEQ ID NO. 417th to 438th, 417th to 432nd and It does not recognize all peptides in the range of amino acids 422nd to 438th. , they are recognized by mAb R8V19. Neutralizing, defensive rat・m The second antigenic site on the F protein recognized by Abs R3V19 and 20 (Fig. The C region of 5 and 6 and the IV region of FIG. 8 are the carboxine terminal of the F1 subunit. It is located in the direction and described in the above-mentioned PCT application.

The RSV epitope recognized by B4 is the 255th epitope of SEQ ID NO: 19. and is reproduced by the RSV F peptide in the sequence within the 275th amino acid range. It will be done. The inventor used the Geysen pepscan method. B4 is the 266th to 273rd amino acid range of F protein [SEQ ID NO: 19 ] was confirmed to recognize the epitope. This F protein functional fragment or a inducing enhanced binding with respect to the same antibody. It may be designed to mAbs directed against this epitope can be used to target RSV in vivo. It has been shown to protect mice and/or cattle from infection.

Substitutions of individual amino acids in the sequence may result in enhanced binding of B4 to the epitope of the mutant strain. made possible the discovery that 266.279 and 273rd amino Acid changes did not affect mAb B4 binding. Change in amino acid at position 267 reduced mAb B4 binding. 268.269 and 272nd amino Acid changes caused a decrease in overall binding. The substitution of the 271st amino acid is , caused significant binding enhancement (Example 10).

) The epitopes of these antibodies are determined by the above-mentioned search and development of further anti-R8V antibodies. Useful for development. Knowledge of these epitopes provides the skilled artisan with the ability to synthesize synthetic peptides. defined natural peptides suitable for vaccines against RSV, and identified natural peptides suitable for vaccines against RSV. has developed mAbs useful therapeutically and/or prophylactically for the treatment of R9V infection in other animals. Make it possible to manufacture.

IV, anti-R3V nucleic acid sequence of interest mAbs B4 and B13/14 or other anti-RSV murine described herein and bovine antibodies, variable region H and LM amino acid sequences and CDRs, first fusion The present invention includes functional fragments, analogs thereof, and chimeras useful for the development of partners. fusion molecules and resultant fusion proteins as well as humanized antibodies.

The present invention provides antibodies derived from anti-R8V antibodies characterized by the antigen-binding specificity of the donor antibody. Natural or synthetic variable region and variable heavy chain sequences are provided. example Nucleic acid sequences of interest were prepared using mAbs B4, B13 and B as described in the Examples below. Contains chain sequences of 14 heavy and light chain variable regions. Based on this variable region sequence data , B13 and B14 are considered to be substantially the same.

The natural 813/14 variable region is shown in Figure 3A and labeled as B13/14VL. 3B amino acid sequence C SEQ ID NO. 2]. Natural 813/14 The variable region H chain has the amino acid sequence shown in FIGS. 4A and 4B labeled B13VH [ It was characterized by SEQ ID NO: 54. These H and L compounds are described in Example 18. Ru.

Regarding B13/14, as mentioned above, the amino acid sequences of B4 VL and VH chains 4A and 4B [SEQ ID NO. 4] and 3A and 3B [SEQ ID NO. It is shown in No. 2, and putative CDR peptides are boxed. B13/14 and B The CDR3 peptides in all four VH chains are unusually long, each measuring 25 or and 20 amino acids. In contrast, humans and rodents The CDR3 of has no more than 20 amino acids.

Nucleic acid sequences encoding variable H and/or L chains, CDRs or functional fragments thereof The columns can be used in unmodified form or synthesized to introduce the desired modifications. desired These sequences can be defined, for example, in the framework region or on a suitable antibody. to a second fusion partner, such as a suitable nucleic acid sequence encoding a defined second fusion partner. It may contain restriction sites to facilitate insertion or ligation.

Considering the degeneracy of the genetic code, the amino acid sequences of VH and VH chains, and CDR sequences are columns (e.g., FIGS. 3A, 3B, 4A, 4B and 10-13) and donors Various antibodies encode functional fragments and analogs thereof that share the antigenic specificity of antibodies. Can construct cryptographic sequences.

These isolated or synthesized nucleic acid sequences or fragments thereof are then used in the first fusion. a fusion partner, and when effectively combined with a second fusion partner, the modified antibody of the invention can be used to produce fusion molecules and expressed fusion proteins, including. these The nucleic acid sequence of the CDR or structural region contains specific variations within the nucleic acid sequence encoding the region. for the insertion of mutagens causing modification and for expression vectors of modified nucleic acid sequences. It is useful for introduction to

Vl, the fusion molecules of the invention, the fusion proteins and the Ike protein fusion molecules are the first fusion partner. As a nucleic acid sequence derived from an anti-R5V donor mAb, the sequence may be natural or synthetic. Fragments or analogs encoding VH or VL, functional fragments or may include analogs. The first fusion partner is effectively connected to the second fusion partner If the resulting fusion molecule and expressed fusion protein are or are characterized by preventive properties.

Upon expression, the fusion molecule may be a modified, chimeric, humanized or partially humanized antibody. It is possible to produce a fusion protein that is an antibody derived from a specific antibody. Functional fragment or analyte of RSV Modified antibodies directed against the LOG are designed to induce enhanced binding compared to the donor counterpart. It may be designed to

The exemplified fusion molecules are peptides with antigen specificity of mAb B4 or B13/14. Synthetic VH and/or VH from a donor mAb encoding a peptide or protein strands of nucleic acid sequences. Yet another desirable fusion molecule is at least One, and preferably, the VH and and/or all CDRs of VLiJl, or functional fragments or analogs thereof. It may also include tags. The first fusion partner, the anti-R3V sequence, is assembled in the fusion molecule. The matching second fusion partner is defined in detail above.

the second fusion partner is heterologous to the nucleic acid sequence with anti-R3V antigen specificity If the nucleic acid sequence encodes a peptide, protein or fragment thereof, the resulting fusion The fusion molecule may express anti-R8V antigen specificity and characteristics of the second fusion partner.

Typical characteristics of the second fusion partner include functions such as secretion from the recombinant host. or therapeutic properties when the fusion partner is itself a therapeutic protein. characteristics or where the second fusion partner has its own antigenic specificity. It can be an antigenic feature.

For example, if the second fusion partner is of any isotype or class of immunoglobulin structure, derived from a human or invariant region (preferably human) or similar In some cases, the resulting fusion molecules of the invention provide modified antibodies. Therefore, expression In this case, the fusion molecule that generates the modified antibody contains the entire length of the H chain and L chain, or any portion thereof. fragment, Fab or F(ab':h fragment, L chain or H chain dimer, or FV or single chain antibody (SCA) or other antibody with the same specificity as the donor mAb. encodes a complete antibody molecule with some minimal fragment of it, such as a child It may consist of a nucleic acid sequence.

As an example, upon expression, a fusion molecule producing a modified antibody may act on a second fusion partner. Possibly linked amino acid range from 266th to 273rd of SEQ ID NO: 19 Anti-R directed against the F protein amino acid sequence ITNDQKKL and its analogs comprising a nucleic acid sequence encoding an amino acid sequence having antigen specificity of the 8V antibody. You can stay there. For example, the epitope is such that the 266th amino acid is alanine, Stain, aspartic acid, glutamic acid, phenylalanine, glycine, hiss Tidine, loin, proline, glutamine, arginine, serine, threonine, barium SEQ ID NO: 56 when substituted with phosphorus, tryptophan and thyronone; The 269th amino acid is glutamic acid, phenylalanine, isoleucine, ynone, methionine, arginine, serine, threonine, valine, tryptopha SEQ ID NO: 57. when substituted with mon and thironone. Or the 271st a Mino acids include aspartic acid, glutamic acid, phenylalanine, isoloinone, and ynone, methionine, ariginine, serine, methionine, valine, tryptopha SEQ ID NO: 58 or 27 when substituted with N, thyronone and glutamine The third amino acid is alanine, stein, aspartic acid, and glutamic acid. As shown in SEQ ID NO. 59 when substituted with (the epitope identified in the example) include.

Preferably, the source of the nucleic acid sequence is mAb B4.

Upon expression, the fusion molecule that produces the modified antibody has the variable heavy chain sequence of FIGS. 4A and 4B. Nucleic acid sequences encoding sequences and functional fragments or analogs thereof, FIGS. and 3B variable region sequences and functional fragments or analogs thereof, or one or more may contain more than 84 CDR peptides.

Another exemplary fusion molecule is an anti-R operably linked to a selected second fusion partner. Nucleic acid encoding an amino acid sequence having antigen specificity of 3V antibody B13/14 May contain arrays. For example, if the nucleic acid sequence is VH of FIGS. 4A and 48 Chain fragment sequence [SEQ ID NO: 4] and functional fragments or analogs thereof, Figure 3A and and 3B VH chain sequence [SEQ ID NO: 2] and functional fragments or analogs thereof , or encode one or more B13/14 CDR peptides. It's okay.

When the fusion protein obtained through research on fusion molecules is a modified antibody, the antibody at least one variable region and one from one or more donor monoclonal antibodies. VH and/or of a receptor mAb substituted with similar portions of the H chain and/or Contains VL fragment. These engineered antibodies contain immunoglobulin (Ig) constant portions and , a variable region framework from one source, such as a receptor antibody, and for example, one from a donor antibody such as the anti-R3V antibodies described herein or It may consist of more CDRs.

Modified antibodies can be modified to improve the amino acid content of the variable domain without affecting the specificity of the donor antibody. It may be further modified by substitution. H chain and L chain amino acids (e.g. 5%) in either the variable domain or CDR, or both. Therefore, it is expected that substitutions may be made with other amino acids. Such modified antibodies In addition, to preserve donor mAb binding specificity, the VH and/or It may or may not include the VL domain framework or the VL domain framework.

Moreover, these engineered antibodies also retain the antigen-binding specificity of the donor antibody. for example, deletions, substitutions or additions at the nucleic acid or amino acid level. a minimal VL and/or VH domain framework of the receptor-antigen mAb. may be characterized by limited modifications.

VH or V of selected anti-R8V mAbs (optionally modified as described) one or both of the heavy chains, or the heavy and/or light chain CDR amino acids identified above. such modification to use one or more of the nucleic acids and encoding nucleic acid sequences. Design mutant antibodies. As another example, the VL region of a receptor mAb encodes and at least a portion of the nucleic acid sequence of, for example, bovine mAb B13/14. The three CDRs of the VH inhibitor of selected anti-R3V antibodies such as The VL domain of the anti-RSV antibody selected in place of the nucleic acid sequence encoding the fragment. Three CDRs or functional fragments thereof, or receptors such as human antibodies in place of at least a portion of the nucleic acid sequence encoding the VH region of the mAb. By expressing a fusion molecule with a synthetic nucleic acid sequence encoding a functional fragment, a modified antibody can be produced. You may also generate a body.

The modified antibody is R8V in the amino acid range from 266th to 273rd of SEQ ID NO: 19. specific protein epitopes. Motors directed to this epitope Noclonal antibodies protect mice and/or cows from R8V infection in vivo It was shown that

Suitable receptor antibodies for supplying the nucleic acid sequence as a second fusion partner include, for example Kabat database, Los Alamos de database and Swiss Protein database. Nucleic acid and amino acid sequences of donor antibodies from conventional databases such as may be a human (or other animal) antibody selected for homology to stomach. Preferably, the donor antibody is a human antibody such as IgG or IgG2. shall be selected from IgG subspecies, such as +grV, q and IgA. Other 1g forms can also be used. For example, for the donor-opponent framework Human antibodies characterized by homology (on an amino acid basis) are provides a heavy chain constant region and/or a heavy chain variable region framework for It might be suitable for... Provides light chain constant or variable region framework Suitable receptor antibodies can be selected in a similar manner. The heavy chain of the receptor opponent and Note that the light chains do not have to be derived from the same receptor antibody! should pay Ru.

The receptor antibody does not necessarily have to be a human immunoglobulin nucleic acid sequence for the desired fusion molecule. Also, it is not necessary to contribute only to the resulting fusion protein. For example, human immunoglobulin The DNA sequence encoding part of the Robulin chain may be a polypeptide effector or or fused to a DNA sequence encoding the amino acid sequence of the reporter molecule. Fusion molecules may also be constructed.

Similarly, using bovine or other species immunoglobulins rather than human immunoglobulins For example, it may be used to prepare bovinized or other types of modified antibodies.

One example of a particularly desirable fusion protein is a humanized antibody. As used herein, "humanized antibody" whose CDR regions and/or their CDR regions are derived from immunoglobulins from non-human species. other parts of the VL and/or VH domain framework of a molecule, including the rest of the molecule. The immunoglobulin-derived portion of the protein is derived from human immunoglobulin.

Suitably, in these humanized antibodies, the VH and/or One or two or preferably three CDRs of the VL region are selected. inserted into the framework of a human antibody, and the native CD of the latter (human) antibody It shall be replaced with R. However, unmodified sedatives from bogus donor antibodies By using as the L chain, it is possible to replace the CDR only in human H. is possible. Alternatively, the chains can be used for both (as described above). donor antibodies. Chimeric L chains can also be used. Rest of engineered antibody The portion is derived from any suitable receptor human immunoglobulin.

Such modified antibodies according to the invention can be used in one or more CDR regions of a bovine antibody. This includes humanized antibodies that have human IgG frameworks with inserted regions. Kaka A humanized antibody is inserted into the heavy chain framework of a human antibody, and a bovine light chain or Tahatsu//VHCDR peptide of bovine mAb associated with human chimeric IJJI May contain. Such exemplary humanized antibodies are described in Example 20. alternative method Such a modified antibody may be associated with a desired human light chain. Similarly, texture fused with an anti-RSV antibody, preferably a mAb, Fab region. It may contain a human heavy chain constant region (preferably IgG). typical ki Mela antibodies are described in Example 19.

Preferably, the engineered antibody comprises a natural antibody and fragments thereof, and is mediated by a donor antibody. Effective prediction of desired conditions in animals or humans, depending on the antigenicity provided. It has a combination of properties necessary for prevention or treatment. Therefore, preferably modified A humanized antibody that has the structure of a naturally occurring human antibody or a fragment thereof and has the structure of a naturally occurring human antibody or a fragment thereof, It has the combination of properties required for therapeutic use. Such "humanized" antibodies are human Prevention and treatment of R9V infection in suitable animal models for R5Vg staining of and recognizes many types of clinical isolates of R3V. pull up Depending on the nature used, the bovine mAbs encode B4, B13 and B14. Nucleic acids can be used to generate humanized antibodies according to the invention that are capable of inducing a minimal immune response in humans. For the construction of expression-generated fusion molecules, the desired RSV epitope can be specifically identified. A different donor sequence (first fusion partner) is provided. For example, FIGS. 4A, 4B, 3A , 3B and 10-13, variable heavy chain and light chain.

The fusion protein, which is a chimeric antibody as defined above, contains human (or one) antibodies for both chains. If desired, a framework associated with IgG invariant regions (animals of other different species) By providing the entire variable regions of non-human donor antibody heavy and light chains, including This is different from humanized antibodies. Additional non-human antibodies compared to the humanized antibodies of the invention Chimeric antibodies with conserved sequence induce some desirable immune responses in humans. It is expected that this will be possible.

Preferred engineered antibodies are those directed against respiratory syncytial virus (R3V). , preferably one specific to the R3V fusion protein. Particularly preferred is this kind of resistance. 3A, 3B, 4A and 4B in its L and H chains, respectively. The entire amino acid sequence of the variable domain of 84 or B13/14 described above or has some parts. Figures 10-13 show potential acronyms suitable for use in "humanized" antibodies. The amino acid regions are shown and described in the Brief Description of the Figures above. Moreover, the present invention of one or more CDR peptides identified in the figures above. It may be characterized by:

In one example, the engineered antibody replaces at least a portion of the VLu region of the receptor mAb. The VL chain region shown in FIG. 11 or a functional fragment thereof, and at least a human antibody. In place of a part of the VH domain of the receptor antibody, the VH chain region shown in FIG. may also contain functional fragments. The resulting humanized antibody has the antigen-binding potential of mAb B4. characterized by specificity.

Yet another preferred modified antibody comprises the VL chain region of FIG. 13 or the VL a functional fragment thereof in place of at least a portion of the domain, and FIGS. 12A and 1 28 VH-regulating regions or at least a portion of the VH-regulating region of the receptor mAb. It may also contain functional fragments thereof. Thus, antigen binding of mAb B13/14 The engineered antibodies are characterized by their specificity.

Alternatively, the following array: 5YSVS (amino acids 3l-35 of SEQ ID NO: 3); DASNGGI IYY NPPALKS (SEQ ID NO: 3 amino acid 5O-65) C3VGDSGSYA CTXaaGXaaRKGEYVDA　C In the formula, Xaa is any amino acid or indicates the absence of amino acids] (amino acids 100-122 of SEQ ID NO: 3): 5GSS (S or D> NIG (R or I) (W or F) (G or A) V (N or G) (amino acids 22-34 of SEQ ID NO: 1); YESSRPS (sequence Sequence number: 1 amino acid 5O-56); ATGDYNIA (Sequence number: 1 amino acid 5O-56); amino acids 89-96); ATGDYNTAV (amino acids 89-97 of SEQ ID NO: 1); ); or the following sequence GNTKRPS (SEQ ID NO: 2 amino acids 5O-56); V CG E S K S A T P V ( DHNVG (amino acids 89-99 of SEQ ID NO: 2); DHNVG (amino acids 89-99 of SEQ ID NO: 4) 3l-35).

VIYKEGDKDYNPALKS (amino acids 5O-65 of SEQ ID NO: 4); LGCYPVEGVGYDCTYGLQHTTFXaaDA [wherein, Xaa is Contains a code indicating some amino acid (amino acids 98-122 of SEQ ID NO: 4) B Place the functional fragments of variable region sequences such as 13/14 into the longer variable region sequences in the diagram. May be used in place of columns.

Such engineered antibodies can inhibit respiratory syncytial virus (R3V) susceptibility in animals and humans. can be effective in preventing and treating infections.

Another class of therapeutic, diagnostic or pharmaceutical proteins of the invention may be described above. the protein or protein encoded by the first fusion partner associated with the effector reagent; Provided by Petide.

An example of such a protein is an anti-R3V amino acid sequence of the invention associated with a non-protein carrier molecule. Provide a column array. Another example is a preferred embodiment of the present invention in which a reporter molecule is attached. Contains strong anti-R3V sequences. Moreover, the entirety of the above fusion protein is an effector reagent. The meeting may take place at any time.

Using recombinant DNA engineering methods, Fc fragments of complete anti-R3V antibody molecules or Proteins of the present invention may be produced in which the CH3 domain is replaced with an enzyme or toxic molecule. .

Another example of a protein of the invention is a protein containing the anti-R3V amino acid sequence of the invention, Together with the spheres, they can chelate heavy metal atoms or toxins like ricin and bind them covalently. It is a protein that binds these together.

Generally, between the anti-R3V antibody nucleic acid sequence and a second fusion partner in the fusion molecule. fusion or linkage of the peptide and the peptide encoded by the first fusion partner. The association with the vector reagent may be carried out by any suitable conventional method. such idiomatic Methods include conventional covalent or ionic bonding, protein fusion, or e.g. Including crosslinking agents such as imides, glutaraldehyde and similar reagents. You may do so. For association of non-proteinaceous effector reagents, conventional chemical linkages can be used. Anti-R3V amino acid sequences may be fused or linked using reagents.

Furthermore, a desired size is defined between the first fusion partner and the second fusion partner in the fusion molecule. Conventional internal linker sequences can be built into the molecule to easily provide space for stomach. The design of such linkers is well known. Such techniques and products are often known and commonly described in conventional chemistry and biochemistry textbooks.

Production of Vll fusion proteins and modified antibodies preferably using genetic engineering methods. Fusion proteins and modified antibodies of the invention are prepared by DNA engineering. For example, or humanized antibodies, light and heavy chains, CDRs and their encoding Similar steps can be taken to realize other embodiments of the invention described above, such as the synthesis of nucleic acid sequences. You may also use the law.

Briefly, for example, producing an anti-R3V antibody such as bogus mAb B4 A hybridoma of the type is cloned by conventional methods, and its H chain and L chain variable regions are cloned using conventional methods. The cDNA of the region can be extracted using, for example, Sampurtsuk et al. ・Cloning (A Laboratory Manual) (Molecular C loning (A Laboratory lanual) 2nd edition, Cole Cold Spring Harbor Library or Library) by methods known to those skilled in the art. mAb The variable region of B4 was used for comparison with PCR primers and other antibodies, e.g. using known computer databases such as Kabat. obtained using the identified CDRs.

The homologous framework of the heavy chain variable region derived from human antibodies is homologous to anti-R3V donor antibodies identified using the same database as A certain human (or other desired animal) antibody is selected as the receptor antibody. human - Synthetic VH region sequences containing CDRs in the antibody framework with respect to restriction sites. defined by noting the desired nucleic acid substitutions in the framework. Then this The plotted sequence was synthesized using 1i multigene, and polymerase quenching reaction (PC R) to amplify and correct errors. Similar to suitable no chain variable region frameworks or may be selected from donor or acceptor antibodies. stomach. As mentioned above, the origin of the light chain is not a limiting factor of the invention.

These synthetic VL and/or VH chain sequences and CDs of anti-RS VmAb R and the nucleic acid sequences they encode are used to create fusion proteins and and for the construction of modified antibodies, preferably humanized antibodies. By conventional methods, non- The DNA sequence encoding the human donor antibody (e.g. B4, B13/14) obtain. In such a donor antibody, at least the CDR and donor mAb binding characteristics the light and/or heavy chain variable regions of their acceptor counterpart necessary to maintain isomerism; The immunoglobulin derivatives of the antibody chain as well as a minimal portion of the domain framework The part that retains the original part is derived from human immunoglobulin.

conventional regulatory sequences capable of controlling replication and its expression in host cells By placing these sequences in positions operatively related to the first idiomatic Prepare the current vector. Similarly, variable domains from non-human immunoglobulins D encoding at least the L chain or H chain of a complementary antibody from which CDRs are induced A second expression vector with the NA sequence is prepared. Preferably this second The current vector is identical to the first expression vector except for the coding sequence. and associate selectable markers to ensure that the polypeptide chains are expressed as equally as possible. Attach. Alternatively, a single vector of the invention may be utilized, which vector is L Contains sequences encoding polypeptides derived from both the heavy chain and the heavy chain. LtJ The DNA in the sequences encoding the l and heavy chains may be cDNA or genomic. It may consist of DNA or both.

The selected host cells are synchronized using conventional techniques using the first and second vectors. The present invention, which consists of recombinant or synthesized I, chain and H@, is transformed at the time of Create transformed host cells. The transformed cells are then cultured using conventional techniques. and prepare modified or humanized antibodies of the invention. Recombinant HIM and/or The humanized antibody containing the association of both light chains is prepared by an appropriate method such as ELI SA method. Search by culture. Construct other fusion molecules of the invention using similar conventional methods You may.

Thus, the invention also encompasses fusion molecules which, upon expression, produce the modified antibodies of the invention. Includes the resulting recombinant plasmid. Such vectors are prepared using conventional techniques and In fact, antibodies encoding modified antibodies operably linked to an appropriate promoter are used. The DNA sequence shall consist of the following DNA sequence. The present invention provides epitope 266-273 of F protein. A recombinant plasmid containing sequences encoding mAbs produced against the include.

Cloning and subcloning used in the method and compositions of the invention Vectors suitable for construction may be selected by those skilled in the art. For example, Amanyam ( Amersham) Ltd. (Backinghamsh, UK) ire)) or Phar's acia (Sweden) Conventional pUC printers available from vendors such as Uppsala Cloning vectors of different types may also be used.

Moreover, all vectors that replicate well have restriction sites and marker genes. Abundant and readily available for cloning operations. Therefore, cloning vector The choice of is not a limiting factor of the invention.

Similarly, vectors used in the expression of modified antibodies according to the present invention can be determined by those skilled in the art. It may be selected from any conventional vector. Expression vectors can also be used as immunoglobulins. It encodes the sequence of the Robulin region and, for example, the CMV promoter. and act upon DNA capable of replicating and expressing the heterologous DNA sequence in the selected host cell. It may also contain selected regulatory sequences that are associated with performance. Alternatively, the operation For simplicity, select immunoglobulins modified by inserting desired restriction sites. Robulin sequences may be incorporated into the vector.

The expression vector may be used, for example, to carry the mammalian dihydrofolate reductase gene (DHFR). ) or the expression of a heterologous DNA sequence such as the neomycin resistance gene (neo'). It may also be characterized by a marker gene suitable for amplification. Other preferred bases The vector is a growth hormone (BGH) and beta globulin promoter. Contains a polyA signal sequence from Betaglupro. Useful in the present invention Expression vectors may be synthesized by techniques well known to those skilled in the art.

For example, replicons, selection genes, enhancers, promoters and the like. The components for expression of the recombinant DNA in the host of choice are derived from nature. Alternatively, it may be obtained by known synthetic methods. Mammals, Bacteria, Insects, Yeasts and Molds Such other suitable expression vectors of various types known in the art of expression may be used for this purpose. may be selected for.

Such vectors are introduced into mammalian cells or other suitable cell lines using conventional techniques. Transfection. The invention also provides these described recombinant plasmids. It includes cell lines transformed by Preferably, modified antibodies or modified components The host cells used to express the offspring are eukaryotic cells, most preferably CH o Cells or mammalian cells such as bone marrow stem cells. For example, if the molecule is a human sugar Other primate cells, including human cells that can be modified with chains, as host cells May be used. Suitable mammalian host cells and methods for transformation, culture, Amplification, retrieval and product production and purification are known in the art. Ru. See Sampurtsuk et al. above.

Bacterial cells have been shown to be suitable cells for the expression of recombinant mAbs of the invention. . However, proteins expressed in bacterial cells do not have a folded structure. Bacteria tend to be About the antigen binding ability of any recombinant mAb produced in cells You'll need to search. For example, E. coli, Bacillus subtilis, Streptomyces, other subtilis Fungi and similar bacteria can be used in nature.

If desired, yeast cell lines known to those skilled in the art can be used as host cells. In addition to insect cell and virus expression systems, it is also possible to use expression systems. mirror( Miller et al., Genetic Engineering gineering) 8277-298, Blenheim Press (Plenum) See Press). Integrate cited references here.

General methods for constructing vectors of the present invention, necessary for constructing host cells of the present invention necessary transformation methods, and the fusion protein or modified antibody of the present invention from such host cells. All the culture methods necessary to produce are conventional. Similarly, the fusion protein of the present invention Once white or modified proteins are formed, ammonium sulfate precipitation, affinity Including column chromatography, column chromatography, gel electrophoresis, and methods dedicated to them. It may be purified from cell culture using standard methods in the art. Such methods are It is within the skill of the art and is not intended to limit the invention.

However, other methods for expressing humanized antibodies use expression in transgenic animals. can be done. For example, methods for expressing humanized antibodies of the present invention are described in, for example, US Pat. Expression in the milk of female transgenic animals as in No. 4.873.316 It may be based on This document is integrated here. For example, the present invention The DNA sequence for the humanized antibody can be linked to the milk-specific protein promoter or to the mammalian protein promoter. A signal that causes the secretion (and maturation, if necessary) of the desired protein in mammalian tissues. The DNA sequence encoding Bebutide allows it to be specifically activated in mammalian tissues. may be operably linked to an expression system for any promoter sequence. suitable Appropriate promoters and nognalbebutides can be readily selected by those skilled in the art.

For example, microinjection into the pronucleus of fertilized mammalian eggs. The expression system is introduced into the host genome using standard gene transfer methods. Bee Ho Hogan, B. et al. “Manipulating the Mouth Embryo” ;A Laboratory War Manual J (“Manipulating The Mouse Embryo:A Laboratory Manual”),: '-Led Spring 1 Harbor Laboratory (Q)ld SpringHa rbor Laboratory) (1986): R.L. Prince R, L, Brnster et al., Ceil, 27: 22 3-231 (1991).

As a result, one or more copies of the constructed vector or expression system Incorporate into the genome of a transgenic complemented mammal. The presence of the expression system is dependent on the mammalian species production and secretion of recombinant humanized antibodies into the milk of female females. This system is originally Produces high levels of bright humanized antibodies.

This latter expression method is particularly suitable for humanized antibodies containing two CDRs, especially This antibody is suitable for oral administration to bovine as well as human infants. Other gene transfer system can also be used.

Once expressed in the desired manner, the engineered antibody can then be expressed in vivo using appropriate assays. Test for activity. Immediately, conventional enzyme-linked immunosorbent assay (ELISA) method to assess quantitative and qualitative binding of engineered antibodies to R3V epitopes. (See Example 3.) Despite the existence of a normal excretory system, Demonstrate the efficiency of other assays prior to human therapeutic experiments to assess body maintenance. It may also be used to clarify.

Example 11 below is based on, for example, PCT related application specification (PCT/GB911015 54) HuRSV19VH/VK and HuRSV19VHFNS/Hu described Modified human derived murine monoclonal antibodies R3V19 such as R3V19VK The method of constructing a modified antibody is shown. Regarding humanized antibodies prepared from murine R3V19 Following the procedures described in Humanized antibodies can be constructed from sequences and CDR peptides (Example 19) and 20 11llI). potentially recognized as “self” by the modified antibody’s receptor. A modified antibody is produced with a variable region tilted framework. Variable region structure Small modifications of the receptor enhance antigen binding without appreciably increased mutagenicity to the receptor. Grants an effect that greatly increases the amount. Such engineered antibodies can prevent and eradicate infections. . Antibodies B4, B13 and B14 described herein are specific for humanized antibodies. Interesting. Such antibodies may be used therapeutically or prophylactically against R3V infection in humans. Useful for preventive treatment. Such antibodies are also useful as diagnostic reagents.

Vll, Therapeutic/Prophylactic Use of the Invention The present invention provides that one or more mAbs or fragments thereof described herein or for treating R3V infection in humans containing the engineered antibodies or other fusion proteins described herein. Human therapy in humans consists of administering an antibody effective for treatment to a human in need of treatment. The present invention relates to a therapeutic or prophylactic treatment method for R9V infection in humans. The present invention also , one or more mAbs or fragments thereof as described herein or as described herein or another fusion protein to treat R3V infection in cattle or other species. from administering antibodies that are effective in treating cattle or other animals in need of treatment. The present invention relates to therapeutic or prophylactic treatment methods for R3V infection in humans.

The fusion proteins, antibody-modified antibodies, or fragments thereof of the present invention may also be used with other antibodies, especially the present invention. Other markers (epitope ) may be used in conjunction with a human monoclonal antibody that reacts with Similarly, the present invention other markers reactive for disease in the selected animal to which the antibody is directed. monoclonal antibodies that react with - (epitopes) are used in veterinary pharmaceutical compositions. It's okay.

The fusion proteins or fragments thereof described herein may be combined with chemotherapeutic or immunosuppressive agents. It may also be used as a single formulated composition given as a single formulation. Examples of overcast combinations (7) HuR3V19VHFNS/HuR3V19VK described in Example 11 Alternatively, a similarly modified B4, B13 or B14 antibody can be used as antiviral agent. It may be given in conjunction with villin to facilitate treatment of R3V infections in humans.

One pharmaceutical composition of the invention is an immunotoxin, i.e. characterized by two components; The present invention in molecules useful for killing selected cells in vivo or ex vivo consists of the use of antibodies. When one component attaches or adsorbs to cells, it usually , is a cytotoxic reagent that causes cell death. The second component is the “transport carrier (d special cells such as cancerous Provides toxic reagents for cell forms. The two components are usually composed of various well-known compounds. chemically bonded by any chemical method. For example, if a cytotoxic reagent is If the second component is untreated immunoglobulin, for example, carbodiimide Heterogeneous bifunctional cross-linking agents such as glutaraldehyde, glutaraldehyde, and similar reagents. The connection is made by A variety of immunotoxins are well known in the art.

Various cytotoxic reagents are suitable as immunotoxins, as well as other types, i.e. radioactive nuclear, chemotherapeutic agents such as methotrexate, ribosome inhibitory proteins (e.g. ricin) ) may also contain proteins such as

The delivery component of the immunotoxin is one or more humanized immunoglobulins of the invention. Alternatively, it may contain bovine immunoglobulin. Preferably, untreated immunoglobulin Brin or its binding fragments such as Fab are used. Typically, immunotoxic Antibodies may be of human gM or IgG isotype and, if desired, of other mammalian A constant region may also be used.

The dosage form for the therapeutic agents of the present invention can be any suitable route for delivering the agent to the host. It's okay. The fusion proteins, antibodies, modified antibodies and fragments thereof of the present invention, and The pharmaceutical composition is particularly suitable for parenteral administration, i.e. subcutaneous, intramuscular or intravenous injection. It is for use. Compositions for parenteral administration typically include a solution of the modified antibody of the invention or an acceptable and preferably a cocktail thereof dissolved in an aqueous carrier. water The types of carriers include water, buffered water, 0.4% saline, 0.3% glycine and or something similar. These solutions must be sterile and free of particulates. Ru.

These solutions are sterilized using conventional, well-known sterilization techniques. The composition may include, for example If necessary, the pHI clause and buffers and other physiological conditions may It may also contain additives. The concentration of antibodies of the invention in such pharmaceutical formulations is May vary over a wide range, less than about 0.5% by weight, usually about 1% by weight or at least It also ranges from 1% to 15 or 20% by weight, mainly depending on the volume, viscosity, etc. of the liquid. Alternatively, the choice may be based on the particular dosage form chosen.

Thus, a pharmaceutical composition of the invention for intramuscular injection was prepared, adding 1 mL of sterile water, Add 50 mg of engineered antibody of the invention. Similarly, pharmaceutical compositions of the invention for intravenous injection Prepare a sample, add 250 mL of Ringer's solution, and add 150 mg of the modified antibody of the present invention. Add. The actual preparation of compositions that can be administered parenterally is well known to those skilled in the art. For example, Remington's Medicinal Chemistry 15th Edition, Masoku Publishing Co., Easton, Nia. (Re+cington's Pharm) aceutical 5science.

15th ed, Mack Publishing Company, Ea ston, Penn5ylvania) for more details. has been done.

To effectively prevent RSV infection in humans or other animals, the methods of the invention from about 1 mg/kg to about 20 mg/kg of the molecule or antibody per administration. Parenteral administration, preferably intravenous or intramuscular injection, or administration of such antibodies Administer intranasally at approximately 20 μg/kg per dose. The beginning of the R3V season from the beginning of the R3V season (October to November) until the end of the R3V season (March to April). Repeat the treatment every 6 weeks. Alternatively, at the beginning of the R3V season, antibodies of the invention About 5 mg/kg to about 100 mg/kg per dose intravenously or intramuscularly. or from about Q, 5 mg/kg to about 10 mg per administration of such antibody. /kg intranasally. If necessary, repeat at appropriate intervals until the R3V infection disappears. Such administration is then repeated.

To effectively prevent R3V infection in humans or other animals, antibodies of the present invention may be used. A single dose of about 2 mg/kg to about 20 mg/kg can be administered parenterally, preferably intravenously. Administered by intravenous or intramuscular injection, or from about 200 μg/kg to about 2 m gkg is administered intranasally. If necessary, such administration until R3V infection is eradicated. Repeat at appropriate intervals.

For example, in Example 16, when protecting the body from infection through the trachea, the necessary The fourth dose was 300 μg/kg body weight. This is passive immunity through the trachea. Cotton-rats and owl monkeys R3-r infection in monkeys [Hemming and Prince (tremm ing and Pr1nce), Reviews.

Reviews of Infecto ius Diseases), 12/5470-475 (1990) 300 compared to the amount of human IgG containing a high titer of R3V neutralizing antibody required to The amount is between 1000 and 1000 times lower.

Reduces virus shedding when administered by topical route compared to intravenous injection It has been shown that the amount of antibody required for e) and Hemming, (1990)]. Therefore, cow R8 Intravenous injection of 3 mg/kg of mAb B4 significantly reduced V outflow. It is estimated that this is necessary. This amount is necessary to protect mice from R5V infection. comparable to the required murine or “humanized” antibodies [Tempest ) et al., (1991)].

Compositions of the invention may also be administered by inhalation. "Inhalation" refers to intranasal and oral administration means. Formulation forms suitable for such administration include, for example, aerosol or metered dosage forms. It can be prepared by conventional methods. For example, for inhalation administration To make TA compositions, an aerosol container with a capacity of 15-20 ml is used. The antibody of the invention at +1QmH was incubated with polysorbate 85 or In a propeller mixer, Freon, preferably 1.2-Dichlorotetrafluoroethane and difluorochloromethane mixture Disperse in a container and fill into an aerosol container for intranasal or oral administration .

As a further example, for compositions for inhalation administration, a volume of 15 to 20 ml of aero Using a sol container, add 10 mg of the antibody of the present invention to ethanol (6-8 ml) 0.1-0.2% polysorbate 85 or oleic acid. Freon, preferably 1,2-dichlorothene, is mixed with a lubricant in a propeller mixer. dispersed in a mixture of trifluoroethane and difluorochloromethane; Fill into aerosol containers for intranasal or oral administration.

The antibodies of the invention, modified antibodies or fragments thereof are lyophilized for storage and prior to use. Can be reconstituted in a suitable carrier. This technique is effective for immunoglobulins It is shown. Lyophilization and reconstitution techniques known in the art can be used. Ru.

Depending on the intended result, the pharmaceutical compositions of the invention may be used for prophylactic and/or therapeutic treatment. Can be administered for treatment. When applied therapeutically, it treats or partially treats a disease. in patients already suffering from the disease, to halt the progression of the disease and prevent complications. be administered to patients who are When applied prophylactically, compositions comprising antibodies of the invention or is administering the cocktail to patients who are not yet at the disease stage to build up their resistance. Ru. single or multiple administrations of the pharmaceutical composition at dosage levels selected by the treating physician; It can be done in the form of With each administration, the pharmaceutical compositions of the present invention provide effective treatment to patients. The modified antibodies of the present invention are provided in sufficient quantities to treat.

The fusion proteins, antibodies, variable intersequence CDR peptides and epitopes of the present invention can be used in combination with antibodies. Peptide or non-peptide compounds (mimetics) that may be useful in the same treatment as ) can also be used for the design and synthesis of be. For example, Saragovi et al., Science , 253: 792-795 (1,991).

Natural R3V infections have also been reported in cattle, goats, sheep and chimpanzees. There is. Thus, for example, using the methodology described above, a suitable murine antibody can be can be modified, if necessary, by modifying appropriate framework residues to improve specific binding affinity. It can be recovered. Once a suitable mouse antibody has been created, one skilled in the art can Use conventional prescription methods to effectively treat and prevent R3V infection in selected animals. Easily determine prescription levels and prescriptions required for preventive or therapeutic treatment. You can decide.

The following examples illustrate various aspects of the invention and do not limit the scope of the invention. It is not configured as such. Unless otherwise noted, all amino acids are conventional 3-letter, 1-letter, or full name. All unless otherwise specified The necessary restriction enzymes, plasmids, and other reagents and materials are commercially available. Ta. All common reloning ligations and other recombinant DNA techniques are Molecular Cloning, A Laboratory Manual Cloning.

A Laboratory Manual”) (1982) M Maniate Cold Spring Harbor Lab, edited by M. Maniatis et al. Cold Spring Harbor Laboratory Publishing, Cold Spring Harbor, New York or its second edition (1989L) See Samprutsk (published by the same people).

The following examples illustrate typical engineered antibodies and antibodies in suitable vectors and host cells. Its expression is shown.

Example 1 - Preparation of monoclonal antibodies Murine monoclonal antibodies 1 to 14 were produced by Tiller (Ta), cited above. (1984) and are incorporated herein. these The antibody was developed by immunizing BALB/c mice with the bovine R3V127 strain. Prepared. The bovine R3V127 strain was purchased from Compton at 19 It was isolated from a cow with respiratory disease in 1973. Others of these antibodies are human R It was produced in cells continuously infected with the SV Long strain. [Fernie et al. For Experimental Biology and Medicine (Proc. Soc, Exp, Biol, Media, ) 167: 83-86 (1981)]. Murine monoclonal antibodies from 16 to 21 were tested twice in the nose. Prepared from intracavitary injected BAL B/c mice. Nasal injection is 1×10’ pfu human-R8V A2 strain grown in Hep-2 cells for 3 weeks. I went at intervals of Human RSV A2 strain subtype A was isolated from a child in Australia. separated [Levis et al. d.

J, Au5tr,). 48: 932-933 (1961) Ko. Four power moons After the interval, mice were injected intraperitoneally with 2 x 10'pfu of bovine strain 127.

Three days later, an additional inoculation was performed, and the spleen cells were inoculated with N5-1 myeloma cells [American type cancer cells]. Lucher Colleccidin (American Type Culture Co 11ection) It was fused with TI B18 strain. Resulting hybridoma was searched for antibodies against RSV using radioimmunoassay and immunofluorescence. and cloned twice on soft agar, and inoculated the cloned cells into BALB/c mice. and ascites was generated as described by Tiller et al., cited above.

Bovine monoclonal antibodies B1 to B6 were prepared by Iennedy et al. , Journal of General Virology (J, Gen, Virol, ) 69:3023 3032 (1988). Please refer to this document. Let's integrate this. At the same time, B7 to BIO1B13 and B14 bovine mA b was prepared from lymphocytes obtained from the same cow, but the lymphocytes were stored in liquid nitrogen. The cells were then fused with NSI cells at a later date. The resulting heterohybridoma was analyzed by ELISA. We searched for RSV antibodies/antibodies using the method, and at the same time also performed fusion inhibition analysis [Basic According to Kennedy et al. (1988) cited above), microtiter – No plates were used. Clones secreting bovine mAb against RSV The transformed heterohybridoma cells were treated with Prjstan-primed (Prjstan-primed). -Priced) Inoculate nude BALB/C7 mice to produce ascites or or serum-free DCCM-1 medium [BioL, Glasgow, UK]. Biological Industries Limited ries Ltd.]. Protein G Sepha 0-S 4 Fa Stoflow [Pharmanoa L.K.B. (PahrIIacia LKB) ) was used to purify the antibody from the cell culture supernatant. The bound antibody was 0. IM Glycine, pH 7,2-'t' elution, IM Tris-HCI (pH 9,0 ) and dialyzed against phosphate buffered saline (PBS).

Antibody AK13A2, which was generated against the lower Ronch protein, was produced in Malroyer, Belgium. Center d’Eco Transferred from Dr. P. Coppe of Nomie Rurale It was done. mAb IBCII (negative control antibody), 47F and 49F were Garcia-Barreno et al., Journal Rai oo/ - (J, 1liro1.), 63: 925 932 (1989) has been done. mAb 7C2 was described by Trudel et al., cited above. (1987). Antibodies 47F, AK13A2 and 49F Protein, hesepharose, purified from ascites using chromatography and labeled with peroxidase [Garn-Arbareno (1989) cited above]. .

mAb IBCll, 47F, 49FSAK13A2 and 7C2 excluded, this All murine and bovine mAbts described in the specification and the hives producing them The ridoma cell line was obtained from Compton RG, Near Newbury, Berkshire, UK. Geraldine Taylor of 16 ONN ) Laboratory of Dr. Institut for Animal Health, Copton Institute for: ^nimal l1eal th, CooIpton Laboratory, Compton, me ar　Newbury.

Berks, RG16ONN, England).

Example 2 - Characterization of Monoclonal Antibodies Kennedy et al. Journal of General Wiroronau, 69: 3023-3032 (1988) How to write: From! (5)-1 thionine or (3H )-F protein was determined by radioimmunoprecipitation of glucosamine-labeled RSV-infected cell lysates. The specificity of the mAb against the white virus pivoribebutide was determined. Tak eta) et al., Electrophoresis, 6 :492-497 (1985), reducing or non-reducing labeling is performed. Western plots (immunoplots) of RSV-infected cell lysates Decided on the opposite sex. The antigen used in immunoprecipitation was infected with human RSV A2 strain. Hep-2 cells or bovine kidney (CK) cells infected with bovine R5V127 strain. Either. Uninfected Hep-2 or CK cells were used as control antigens. there was.

mAb Bl, B4, B5 [see Kennedy et al. cited above] and mAb R3V19, B13 and B14 were fume-denatured in phthiothreitol. It reacted with F protein. mAbs Bl, B4 and B5 are Western plot mAb RSVI9 recognized fragments at 46 and 22 of the denatured F protein in , B13 and B14 only recognized fragments at 46. mAb 16 to 18. The properties of 20 and 21, R3V19, B7 to BIO, B13 and B14 are The analysis of the following description, which has not been previously described, is shown in Table 1 below. In these analyzes The properties of all other mAbs included are summarized in Figures 5 and 6.

The ability of the mAb to inhibit multinucleated macrobubble formation was demonstrated in RSV A2 strain [Kennedy et al. cited above]. See Reference, this document is incorporated herein] MA104 cells 24 hours post-infection [A. American Type Culture Collectidin Culture Collection) in Rockbilco, Maryland. It was measured. The results of this analysis are shown in the "Fusion inhibition" column of Table 1 and in Figures 5 and 6. Denoted as j. "+" indicates that m, yasu inhibited multinucleated cell production.

Four A, Zumi mAbs (11, 13, R3V19 and 20) and four U Shi mAbs (B4, B5, B13 and B14) inhibited multinucleated cell generation. .

The ability of the mAb to neutralize R3V was tested in a plaque reduction neutralization test as described by Kennedy et al. Measured at The results of this analysis are shown in the "neutralization titer" column of Table 1 and in Figures 5 and 6. Shown as "neutralized". In the figure, "-" indicates that neutralization did not occur; "10" indicates that the antibody indicates that neutralization has occurred. 7 murine mAbs and 12 bovine mAs b(1’) Four of them (i.e. B4, B5, B13 and B14) are responsible for RSV. Neutralized.

The ability of mAb (7) to protect against R3V infection was expressed in BALB/c mice as follows. I kept it and tested it. Five mice were injected intraperitoneally with 100 μl of ascites containing mAb. did. One day later, mice were intranasally administered with 10'pfu of A2 RSV strain. infection On the 5th, the mice were sacrificed, and Taylor et al. Infect, Immun, 43: 649-65 5 (1984), the lungs were cultured for RSV on a second CK monolayer. analyzed.

The results of this analysis are also included in the “Mouse Protection” column of Table 1 and the “Defense” column of Figures 5 and 6. show. The “-” in the figure indicates that the mAb did not protect immunized mice from RSV. show. “+” or r+10+” indicates the species degree at which the mAb protected the animal from RSV, respectively. indicates that it is small or large. Eight species that were effective in the fusion inhibition assay mAbs (i.e. murine mAbll, 13, R2M17 and 20, and mAbs B4, B5, B13 and B14) were administered 24 hours after i.p. When administered intranasally, it is highly effective in preventing R3V infection in BALB/c mice. It was a target.

Murine mAbs 9 and 10 [Tiller et al. (1984)) and bovine mAbs All antibodies specific to bovine RSV except B13 are specific to human RSV A2 and YoUhitoB Ai (8/60) strain [Common Cold Uni, Salisbury, UK] Manufactured by Coat Co., Ltd. (Coa+mon Co1d Unit, 5alisbury, En grand)] (both grown in Hep-2 cells) and the /R8v strain [ Tiller et al. (1984); Kennedy et al.]. These results indicate that non- The epitope recognized by consistently protective and fusion-inhibiting mAbs is unique between R5Nr strains. It is shown that it is very conservative in terms of

Table 1 Properties of mAb against RSV F protein ■^brg class ELISA titer (10g+o) Neutralization titer 1 Fusion inhibition Button lysis 2 Ma Protection of Us 3^2 8/60 BR5V 16 Gl 6.8 6.6 6.8 2.0 - 0 0.617 G2b 6.1 6.3 6.1 <1.0 - 59 1), 618 G2a 7.0 6.8 6.2 3.4 - 43 1.6R5V19G2a 6.4 6. 7 6.7 3.4 + '2 > 3.820 G2a > 6.0 8.6 7. 5 4.3 + 76 > 3.821 G2a 8.9 7.4 6.8 < 1 ．． 0 - 68 1.087 Gl 3.0 4.9 4.9 <1.0 - 6 0B8 cl <2.0 <2.0 4, O <1.0 - 8 0.289 Gt 5.1 5.4 4.9 <1.0 - 2 0.4 BIOGl 5. 1 5.4 6.0 <1.0 - 9 0.5813G1 6.05.15. 4 5.8 + 0 2.2B14 GI 5.6 5.2 5.6 5.4 + O > 2.2’ 50% plaque reduction titer expressed as logto 2 mAb and Percent specific efflux values for 100-fold dilution of rabbit complement 3. Decreased R3V titers in the lungs of passively immunized mice compared to control animals. 'Ogro value Example 3 - Enzyme-linked immunosorbent assay (ELISA) R3 to be tested in ELISA V antibodies were prepared separately from Hep-2 cells 3-4 days after infection. Cells in culture medium scraped, centrifuged at 500 g for 5 min, resuspended in distilled water, and concentrated at 0.5% (w/ v) Treatment with NP 40 surfactant to obtain cell lysate. Similarly, infected A control antigen was prepared using Hep-2 cells with no hemodialysis.

The ELISA was performed as follows: microtiter plates were or control antigen, diluted in distilled water, incubated overnight at 37°C, and incubated in PBS. and with a blocking buffer consisting of 5% normal pig serum in 0505% Twin 20. Incubated for 1 hour at room temperature and washed 5 times with PBS/Twin. mA continuously A 3-fold dilution of b was added to the wells and incubated for 11 hours at room temperature. pbs/ After washing 5 times with Twin, HRP-conjugated rabbit anti-cow/diluted at 1:4000. rgG (manufactured by Sigma) or HR diluted 1:2000 P-conjugated goat anti-mouse rgG (manufactured by Kp1, Maryland, USA) was added to each well. added to.

After the final wash, the group [3,3',5,5''-tetramethylbenzidine (TMB , Illinois Immunobiologicals (ICN, Imm. The bound complex was detected using a method (manufactured by Unobiological Co., Ltd.).

Example 4 - Purification of F glycoprotein and trypnone treatment falsh) et al., Sharnal of General Virology (J, Gen , Virol, ) 66: 409415 (1985); and cited above. Hep-2 cells infected with Gal/Armureno et al. (1989)] and purified by immunoaffinity chromatography. Several parts of purified protein Separate tubes (15 μm each) were added to 2 μg, 4 μg, 8 μg or 16 μg of tribut/ton. Both were incubated at 37°C for 4 hours for digestion. Electrophoresis specimen buffer Studier, Journal of Molecular Biology Mino (J, 11o1.Biol,), 79: 237-248 (197 2)] was added to stop the digestion reaction, and the sample was boiled for 3 minutes. 5DS - Samples were separated by PAGE. The sample was electrophoretically transferred to Imwobi (Imwobi). lon) was transferred to a membrane.

Example 5 - Epitope on F protein Antibody AK13A2.47F1 used for selection of mutant viruses in Example 7 below Determining the location of epitopes recognized by 7C2, R2M17.20 and B4 As the first Pj step, binding of the mAb to the trypnone fragment of the seminal IF protein is Stan Plott ``Tobin (Ding 0 Explosion) Mutter Pronodinges of... /Yonal Academy of Science Ninisny (Proc, Na t' 1^cad, Sci, LIS^)76: 4350-4354 ( 1976)]. Protein fragments are stained with Cuman blue or antibodies Developed with AK13A2 or 19.

As the amount of trib/n increases, the F1 subunit stained with Cuman blue increases. A smaller fragment of F1 on 30.20.5.19 and 15 The fragment was tKmed with AK13A2. Fragments at 205 and 19 are F1 sub Previously mapped at the NH, terminal end of the unit [Lopez ) et al., Journal of General Wisdom (J, Gen, Vir oL, ) 64: 927-930 (1990)]. Antibody B4.47F and 7C2 recognized the same fragment cents as did AKI3A2. mosquito( Therefore, the epitope recognized by these mAbs is the NH , this may be due to the amino acid sequence contained in the terminal third.

In contrast, Shaku5V19 reacted with a different set of F1 fragments. a small amount of trypsin The larger size fragments (26 and 22K) that were generated reacted with R2M17 ( mAb 20 reacted less efficiently with the same set of fragments). Therefore Therefore, epitopes 19 and 20 are regions covered by the fragment recognized by antibody B4. It has been shown that the NH2-terminal two-thirds of the Fl subunit (Fig. 2) exists outside the region. It has an experimentally known tryp/tone-sensitive amino acid sequence. tribunon Due to the low yield after treatment, the NH2 terminus of fragments 26 and 22 was directly inserted into the protein protein. Could not be determined by sequencing.

The diagram in Figure 2 shows the F glycoprotein primary structure showing the hydrophobic region, protein cleavage site, Potential N-glycol-noyone moieties, nosteine residues and neutralizing escapes The amino acid residues substituted in the mutant strains (see Tables 3A-3C below) are shown. different mAbs The positions of the trypnone fragments recognized by the following are shown in Table 2 below.

The region on the F protein recognized by mAbs B13 and B14 was extracted from the large +111 bacteria. The identification was made by examining the binding to the F protein fragment expressed in . Sequence number 19 Recombinant C protein (rC, F377-52.) and recombinant D protein of SEQ ID NO: 19. white (rD, F3H-sso) as an antigen in ELISA as shown in Example 3. It was used as These peptide sequences of F protein were converted into influenza nonstructural protein 1. Non-structure of influenza containing amino terminal amino acids 1-81 of (NS-1) The target protein fragment was inserted into an expression plasmid and expressed in E. coli.

Production of these fusion proteins involves conventional methods. mAb B13 instead of B4 , B14 and R8VI9 bound to these protein fragments. Table 2 below is ELISA Figure 2 shows binding of anti-F mAb to recombinant F protein in . These findings are B13 and the region of the F protein recognized by B14 is the region recognized by R3V19. The region is located in the carboquine-terminal third of the F1 subunit. suggests that.

Table 2 mAb rCrD RSV B13 5.7*>3.0 5.6 814 6.2 > 3.0 5.6 R5V19 5.3 > 3.0 7.4 B4 < 1.5 < 1.5 5.9 *E when rC is 2 μg/well and rD is 1 Mg/well as antigens. IOgto value of titer by LISA Example 6 - Identification of antigenic regions in F protein Epitope specificity of mAbs was analyzed for competitive binding using purified and labeled mAbs. . In summary, these competitive binding analyzes identified 12 antigenic sites on the F protein. , they overlapped extensively. Three epitope sites neutralize mAb and highly protective FImAs such as B4, B5, B13 and B14 Recognized by b. These findings are included in neutralization using murine mAbs. Similar to other mAbs that identified three antigenic sites on the F protein, two of which One had Fl activity [Walsh et al., Journal of Eneral Virolono (J, Gen, Virol, ) 68: 50 5-513 (1986) and Beeler et al., Journal O. Bu / Energy Virol (J, Gen, Virol,) 63: 29 41-2950 (1989)]. These findings have implications for virus adsorption, for example. Virus fusion is inhibited by a mechanism other than the inhibition of virus fusion by the cell wall, such as steric hindrance. suggesting that virus neutralization may occur.

A, mAb purification and labeling. IgG from ascites containing either murine or orchid mAbs was combined with protein A -Sepharose (Protein A-3 eoharose) or protein G-Sepharose Fast-Flo w) Purified by [Farmana LKB]. Add ascites to the same volume of 0.1M phosphorus Acid buffer le! , (+)H8) and protein A-Sepharose with the same buffer. passed through the column. The bound antibody was washed with O.1M citrate buffer 11T (pH 6.0 to 3.5) was eluted. The fraction eluted with a low pH buffer was collected using LM Tri. Collected in s-HCI (pH 9,0). IgG from tissue culture supernatant was converted to protein G- Purified by Sepharose Fast Flow and 0.1M glycine as above. It was eluted. Purified IgG was dialyzed against PBS and purified using chloramine T. 01 or conjugated to biotin.

B. Competitive binding analysis Approximately 10°0 in 90% of the maximum amount binding to R5V antigen in radioimmunoassay 1281-labeled or biotinylated mA determined to give 00 cpm dilutions of R9V anti-F protein from increasing amounts of various unlabeled mAbs to F protein. It reacted with Hara. For mAbs B13 and B14, R3V infected cell lysis to a dilution of biotinylated mAb determined to give 90% of the maximum binding of In contrast, the amount of unlabeled antibody was not increased and allowed to bind to the RSV antigen. for nuclear proteins Unlabeled mAb was used as a control.

The results of this analysis are shown in FIGS. 5 and 6. (Some mAbs decrease binding with dose) inhibited. However, other mAbs did not inhibit binding of the test antibodies. R8 An unlabeled mAb to the N protein of V inhibits the binding of any mAb to the F protein. It didn't interfere. These experiments have shown that groups of mAbs compete for spontaneous binding to antigen. Identified. The epitope recognized by the competing mAb is the same antigenic epitope of the F protein. It is thought that it exists functionally in the area. mAb competitive properties have a wide range of implications. (Figures 5 and 6).

Therefore, clustering of epitopes based on partial similarity and leucocytic Leucocyte typing database IV atabase IV) [Gilks, r leucosite type Leucocyte typing database IVJ (“Leucocyte typing data Base IV”) Ostford University Press (1990) was used for analysis.

These studies showed that 16 murine mAbs were used to target seven antigenic sites on the F protein [SEQ ID NO. No. 19 (Figure 6) was recognized. mAbs 2 and 5 are It competed with all other murine mAbs. Two highly protective mAbs 11 and 13 appeared to recognize the same epitope (site B), whereas Two other highly protective mAbs, R3V19 and 20, are similar to each other but It is different from mAbs 11 and 13 and was mapped to site C.

Most of the 12 mAbs were mapped to the same regions as the murine mAbs (Figure 5 and 6). Murine-mAbs 2 and 5 were derived from four run-mAbs (B2, B3, B4 and B6). Pine at site G in competition experiment with murine mAb The neutralizing murine mAb 14 that was pinged was compared with Uso mAbs B2, B3 and It showed similar competitive properties to Bihaku 6 and was therefore placed in group H (Figure 5). cormorant Binding of murine mAbs Bl and B7 is inhibited by any murine mAb. In fact, B7 appeared to recognize a different epitope. Two types of non- The epitopes recognized by the always protective lie mAbs B=4 and B5 are mutually exclusive. and two highly protective murine mAbs 11 and 13. Was. mAb 18 partially protective and non-protective in mice B]O was also mapped to this region (site B).

The binding of protective mAbs B13 and B14 is similar to that of protective murine mAb R3. V19 and 20 and the protective mAbs B4 and B5 to varying degrees. was inhibited until However, the competitive properties of mAbs B13 and B14 Antibodies manopiged to B and C are different, and they have different F proteins. This suggests that the brain recognizes the body part that was touched.

The murine mAb and the bovine mAb together recognize 12 antigenic regions; Most of them overlapped extensively. highly defensive and anti-fusogenic (Fl), and neutralizing mAbs have two or perhaps three sites (Fig. mapped to area BSC and L). Neutralizes viruses but has Fl activity No mAbs were mapped to three sites (regions BSD and H). but However, mAbs that are neither neutralizing nor have Fl activity also map to these sites. It was done.

Example 7 - Antibody escape mutants Patterns of reactivity of antibody escape mutants indicate protection inferred from competitive binding analysis The mapping of target epitopes was ensured. In summary, the two regions of the F primary structure The region identifies where the epitope recognized by the neutralizing mAb is located. Ta. The first region is located in the amino-terminal third of the trypsin-resistant F1 subunit. 7 = pinged. This region contains mAbs 47F, 49F17C2, AK13 Contains overlapping epitopes recognized by A2.11 and B4; (Figure 8) and area B (Figures 5 and 7). The antigenic regions E and B are are the same. Most amino acids found in mutants selected with these antibodies The acid change is SEQ ID NO: 19 amino l! l! concentrated around 262-272 there was. These antibodies detected protein content of the F1 subunit in Western blots. Because it reacts with the decomposed fragments, they form a “straight line” determined by a continuous amino acid sequence. It was originally thought that it would recognize a specific epitope.

However, the composition of certain epitopes has certain conformations. considered necessary. Because only some of them peptides, and amino acid substitutions at distant sites that are affected by the binding of certain antibodies. This is because it is reproduced by For example, resistance to mAb AK13A2 Substitution at amino acid 216 (aspartic acid or asparagine) also eliminates reactivity with antibodies 7C2 and B4 (no. 272). Resistance is also conferred by selected amino acid changes). 216th The change is away from peptides 255-275 and faithfully represents epitope B4. reproduce. Consequently, the v added to the F1 subunit by epitope B4 It is assumed that a somewhat longer range effect of amino acid 216 in Ra occurs.

Although the competitive properties of the mAbs in Figures 5 and 6 overlap extensively, the protective mAbs bll, 13, B4 and B5 are the same area (site B in Figures 5 and 7, site B in Figure 8) Mutant strains that are mapped to TI) and are resistant to these antibodies recognize site B. Only those antibodies that did not bind. mAbs 7C2 and 47F are also included in this section. Manping was done in the first place. R3 by antibodies that are mapped to site B (site II) The binding of mAbs R3M19 and 20 to V antigen was inhibited; Raster analysis suggested that they recognized different sites (site C). child The mutations selected for resistance to mAbs RSV19 and 20 This was demonstrated by the finding that the strain still reacted with mAb recognition site B. Similarly, R The binding of mAbs B13 and 14 to 3V is associated with site B (II) and site C. was inhibited by mAbs that were conjugated. However, B13 and B14 When mapped to a different site (site L), it will be confused, and this means that B13 and and B14 were selected by mAbs mapping to sites B (II) and C. This was confirmed by the finding that it binds to all selected mutant strains.

Neutralization of R8V by the mAb used to select for escape mutants has been theorized. have been linked to their ability to inhibit membrane fusion of the F-glycoprotein [cited above] Garcia-Barreno et al. (1989), Reference Tiller et al. (1984) cited above 1151゜Other rosemyxoviruses similarity with paramyxovirusS [e.g. Morris on), Virus Research (Re5), 10: 113-13 6 (1988)], the fusion activity of RSV is determined by prosenonone of the F protein precursor. It is assumed that the This modification represents a new NH2 terminus of the F1 subunit. It is thought to generate endpoints and interact with lipid membranes through short hydrophobic peptides.

The antigenic region of the F glycoprotein identified here is expressed by the fusion peptide in a linear map. However, other regions of the F protein interfere with the activity of the fusion peptide. There is a possibility that it may affect sex. In this regard, the red blood of the influenza virus A mutant strain in which the activity responsible for the fusion of globular a clusters has been changed [Daniels S) et al., Cell, 40: 431-439 (1985)] The A2 subunit was mapped to the outside of the fusion peptide.

Escape mutants were developed and evaluated as follows. Wild type and neutralized S.K. The mutant virus was grown in Hep-2 cells, and purified from the culture supernatant as described above. [Garcia-Barreno et al., Virus Reliance] Search (Virus Res,), 9: 307 322 (1988) . Human R5V long and A2 strains were plaque purified before use and mAb 47F 1AK13A2.7C2,11, B4, B5.19 or 20 and herein Viruses that were rendered resistant to neutralization by other mAbs against the F [proteins listed above were selected.

These were selected in two different ways. , to A2 strain escape mutant strain Highly protective mAb 11. One strain of B4, B5, RSV19 and 20 Plaque the antibody escape mutant strain of R5V A2 strain that is resistant to neutralization due to It was created using the reduction method. Primary CK cells for R3V2O, B4 and B5 confluent cell monolayers were infected with strain A2 at a multiplicity of infection of 02. infection begins Cultures were treated with 10% mAb 24 hours later and daily for an additional 3 to 5 days. The medium was replaced with fresh medium containing When the cytopathic effect (CPE) becomes apparent, Harvested virus.

The virus thus prepared was mixed with an equal volume of the mAb under test for 1 hour at room temperature. Then, a 35 mm diameter multi-well plate [Nunc] inoculated onto the CK monolayer in the medium. After incubating for 1 hour at 37°C, the same m Plate with 0.25% agarose-containing medium containing Ab at 1- to 10-fold dilutions. layered on the rate. Incubate the plate for 7 days at 37°C in air containing 5% CO2. 0.3% 3-(4,5-Tumethi) in 0.15M NaCl Vital dye containing luciazine-2)-2,5-phenyltetrazolium bromide A colored liquid was overlaid to visualize the virus plaques.

Take the estimated plaque from the agar plate estimated to contain a single plaque; Dilute in medium, mix with the same volume of mAb, then inoculate onto CK medium as above. did. The mutated virus creates plaques, picks them up again, and kills bullies, testicular cells, etc. or into test tubes containing strip cultures of Hep~2 cells. 4 to 6 days After 7 incubations, the coverslips were removed and placed together with the mAb under test. stained and then FITC-labeled rabbit anti-1 mouse IgGr Sigma (Sig ma) conjugated with Sigma Co. or FITC-labeled rabbit anti-cow/IgG [Sigma Co.] I set it. R3V was tested prior to subsequent testing with FITC-labeled rabbit anti-bullion IgG. A polyclonal bogus antibody was used as a positive control. mAb in the test R3V that did not react with the immunofluorescence method was classified as a mutant strain, and was described in Example 3 above. was used to generate antigen for ELISA.

Basically, a mutant virus resistant to mAb 11 was selected as described above. , no prior incubation of virus in cells with 10% mAb in the supernatant was performed.

In the presence of mAb 11, 5 types of mutant viruses from plaque-forming i&RsV A2 strain were isolated individually. Eight mutant strains were isolated individually after cultivation in the presence of R2M17. After culturing in the presence of mAb 20, the three mutant strains were cultured in the presence of B5. After culturing in the presence of B4, 6 mutant strains were isolated, and 10 mutant strains were isolated after culturing in the presence of B4.

After cloning, individual escape mutants were cloned into EL [SA in Example 3]. was used as an antigen and tested for reactivity with a series of anti-FmAbs (Figures 7 and 8 ).

The only mutant virus selected for resistance to mAb 11 was mAb 11. m, has lost the ability to bind to Ab 13, B4 and B5, and the parent strain R3 When compared with the ~'4 to 2 strain, binding to mAb 7C2 was also weaker (Figure 7).

All mutant viruses selected for their ability to bind to B4 or B5 Or, the binding ability to not only B5 but also 11 and 13 was lost. but However, some mutant strains selected for B4 (e.g. C494715) It bound to Naori 5, but the binding level was significantly reduced compared to the 2 to 4 strain. .

As seen in the mutant strains selected for resistance to mAb 11, The B4 and B5 mutants showed reduced binding to 7C2, whereas In this case, Ike's mutant strain (for example, C494715) did not react with 7C2. mAb In contrast to the mutants selected for B4 or B5, in contrast to the mutants selected for B4 or B5 (some mutant strains such as C494715, 6119, 6116, 6327 and and C5014/7) still reacted with mAb 18. The B4 and B5 mutant strains are Binding to the mAb, BIO, is the same or weaker when compared to the parental A2 strain It was either that or it wasn't there.

All mutant viruses selected for mAb R3M19 or 20 were It did not react only with R3M19 and 20 (Figure 7). mAbB shown in Figure 5 13 and 14 (Figure 7) and all other mAbs shown in Figure 5. Binding to the foreign strain is the same as that of the parent R3V A2 strain, i.e. the mutant virus , it would have retained the binding properties of mAbs derived from other mutagenic regions.

B Long stock escape mutant strain The long strain escape mutant was prepared as described above [Garnoarbareno et al. (1989)]. isolated. Briefly, the presence of selective antibodies 47F, 7C2 or AK13A2 The virus stock can be transformed into a mutated virus by serial passage 4 or 5 times in the presence of the virus. eutrophication in viruses.

The virus was then plaque purified in antibody containing agar plates. several viruses Plaques were isolated and their resistance to antibody neutralization confirmed. Virus A single plaque originating from each Jabuen Enomoto tok was selected for further analysis.

The epitope recognized by mAb B4.7C2 and AK13A2 is Based solely on their reactivity to Niscape mutants, the rules cited above It was included in antigenic region II described in the literature of N'Arbaleno et al. (1989). similarly , the epitopes recognized by mAbs R3M19 and 20 are based on the same criteria. According to the method, it was contained in antigen region IV (Fig. 8).

The selected mutations in the resistant virus are epitopes derived from the antigenic region containing the selected antibody. This affected only the loop. For example, mutant strain 4/4 has antibodies grouped in region II. On the other hand, the same antibodies (11/3.4.5 and The selected Ike mutants for 7) and 7) did not react with mAbs 7C2 and B4. However, it did not react with 47F, 49F or 8K13A2. similarly , mutants selected for mAb 19 or 20, except for mAb 52F. It did not bind to antibodies grouped in antigen region I). However, all In all cases, the mutant virus is unable to bind mAbs derived from other antigenic regions. was holding it.

The different reactivities of antibodies derived from antigenic region II towards escape mutants are due to their indicates that the epitopes may overlap on the F molecule, but are not identical. Ta. To further differentiate these epitopes, the corresponding mAbs were used in Example 3. saturation of individual unlabeled antibodies previously titrated against the long strain. Virus using peroxidase-labeled antibodies mixed with increasing amounts of We determined whether they compete for spontaneous binding to the base.

Anti-idiotypic rabbit antiserum raised against mAb 47F was R3V. The ability to inhibit mAb binding to El, ISA [Palomo et al., Nyanar of Willoronau (JJirol, ) 64:4199 4206 (1990)].

The results obtained showed extensive competition between these antibodies for virus binding. . However, antibody AK13A2 non-reciprocally interacts with mAbs 47F and 49F. inhibited virus binding. Moreover, the anti-idiotypic serum was mAb47 only inhibited virus binding of F and 49F, whereas AK13A2.7C2 and B4 binding was not inhibited.

Thus, the epitope contained in antigen region 0 can be determined according to at least one of the following criteria. Can be distinguished by: i) mAb reactivity with escape mutants, 11) virus competition of mAbs for binding to 111) by anti-idiotypic serum Inhibition of virus binding. Only epitopes 47F and 49F were selected according to the above criteria. Although they could not be distinguished, they differed in both their neutralizing ability and their sensitivity to denaturants. It was different.

Example 8 - Positional escape of selected amino acid changes in neutralizing escape mutants different viruses to identify selected amino acid changes in the sample mutants. Sequencing of F protein mRNA derived from cells infected with was performed as follows.

Infecting Hep-2 cells with different viruses causes cytopathic effects to produce fused cells. The cells were collected at 30 to 40 hours post-infection, when infection became apparent. Isothio/ Total RNA was isolated by the Anate-CsC1 method [Chirgwi (Kuchi) et al., Biochemistry (BiocheIIstry), 18: 5 294-5299 (1979)]), then] polyA″RN was oligod Selected by T-cellulose chromatography. These mRNA preparations were reverse transcriptase and 5'5zp-labeled oligonucleotide, followed by terminal Deoxynucleotidyl transferase [De Borda (1) e Bord e) et al., Analytical Biochemistry (^nal, Biochem, ) , 157: 275-282 (1986) (Sanger) et al., Pronordinges of the National Academy ・of Sai x’) Sue-x-Nisny (Proc, Nat’ 1^cad, Sci, LISA 74: 5463-5467 (1977)] used for sequencing. The primers used for sequencing were Sequence of the white gene [Lopez et al., Virus Research Res, ), 10: 249 262 (1988)].

Orients used for sequencing selected mutants for mAbs R3V19 and 20 The gonucleotide primer is in anti-RNA sense.

Sequence number 23 F1216+5°-ATCTGTTTTTGAAGTCA T sequence number: 24 F1300・5'-ACGATTTTATTGGATG C sequence number 25 F1339: 5° -TGCATAATCACACCCG T Sequence number 26 F1478: 5'-CAAATCATCAGAGGGG Sequence number 27 F1458・5°-AATTCATCGGATTTACG A sequence number 28 F1707 5'-CTCAGTTGATCCTTGCTT It is AG.

FmRN of viruses selected for mAbs AK13A2.7C2 and B4 A with those antibodies fX! encodes a trypnone-resistant fragment that The sequence was determined between nucleotides 420 and 920 (Figure 2). mAbll Place the F mRNA of the virus selected for 893 to 906 only. The row has been decided. Similarly, the F of the selected viruses for mAbs 19 and 20 mRNA was detected by the predicted 26 kDa target recognized by those antibodies. The sequence is located between 1100 and 1680, which encodes the lipsin-resistant fragment region. The row has been decided.

Table 3 shows the sequence changes selected in different neutralizing escape mutants, and the two species Robes et al. (1999) cited on mutant c for the previously reported mAb 47F. 90)] is also described. Nucleotides at the positions indicated (mRNA code ) and amino acid changes are shown compared to the Long and A2 strains. ND is a test Indicates that the test was not carried out.

Portions of Tables 3A, 3B, and 3C need to be compared with each other for individual antibodies. . For example, for antibody 47F, virus 4 is from A to U at position 797. The nucleotide change (Table 3A) is from Asn to Tyr at position 262. Table 3B) causing amino acid changes, resulting in 47F, 49F and AK1 The antibody binding ability in 3A2 has been lost (Table 3C).

Table 3A nucleotide position Antibody used for selection Virus 5836597867978168278281 298-Long and A2 CA U AA AA A C11U AK13A2 4/4 G U 12C 61:16/8 C 19C484f A C490915A C4909/6 A Table 3A (continued) nucleotide position C4902Wc A Table 3B amino acid position Antibody used for selection Virus 1902162582622682724290 and A2 Ser Asn Leu Asn Asn Lys Arg l　1　11e AK13A2 4/4 ^sp Tyr4゜ B4 61:16/7 Thr 61:16/8 Thr 19 C484f 5er C4909/55er C4909/6 Ser Table 3C (continued) Antibody used for selection Virus Binding loss related to antibody 20 C4902Wa 5 6F, 57F, 19.20C4902Wb 56F, 57F, 19.20C49 02Wc 56F, 57F, 19.20mAb 11 is the 816th nucleo Mutants with a single substitution (8 to U) in the tido were selected. Also, this location The alternative is to change Asn-262 to lie. -1, mAb 1 3, induced loss of epitopes recognized by B4 and B5. epitope is included in antigen region B in FIG. 5, and this change is included in all antigen regions II in FIG. Mutant 7 selected for mAb 47F, which induces loss of all epitopes. This is the same change that can be seen when

The four viruses selected for mAb AK13A2 are It has a single substitution in the otide (Yagagara U), and Asn-262 is Tyr It changed to This change is consistent with the results for antibodies 47F, 49F and AK13A2. In order to remove the binding site (Figure 8), in mutant strain 4 selected for mAb 47F. Same as observed changes. Moreover, we selected about mAb AK13A2. The fifth virus (4/4) is a 659 virus that changes Asn-216 to Asp. had a substitution (A to G) in the second nucleotide. This second ami Noic acid changes induced loss of all epitopes from antigenic region II (Figure 8).

The last mutant selected for mAb AK13A2 (4°) contained a single 8-G It has a substitution at the 8271st nucleotide, and Lys in Glu -272 and the loss of all epitopes from region II was induced.

All mutants selected for mAb 7C2, except mutant 4, were 827 or a single rIl substitution at nucleotide #828 (8 to G or 8 to C), with Lys-272 changed to Glu or Thr, respectively. There is. These changes reduce reactivity for all mAbs derived from antigenic region II. Removed. Mutant 4 has two nucleotide substitutions at position 583 (C-A) and It has amino acid at position 786 (U to C), and amino acid at position 190 (Ser to Ar g) and the 258th amino acid (Leu 5er) has been changed. Last The mutant loses only the binding site for mAb 7C2, but all other It maintained reactivity with anti-F antibody (FIG. 8).

The two mutant strains selected for mAb B4 contained a single nucleotide at position 828. It had a double substitution (A to C), and Lys-272 was changed to Thr.

Thus, all amino acid changes selected for mAbs derived from antigenic region II 258.2 is detected only in viruses with two amino acid substitutions. 262nd to 272nd of F protein excluding changes in amino acids 16 and 190 The th was aggregated into small segments.

All mutants selected for antibody R3V19 or 20 are numbered 1298298. It has a single C to A substitution in the eye reotide, with Arg-429 being Se It had changed to t. Carboxine end of nostein-rich region of F1 subunit This amino acid change located towards the terminus (Figure 2) , removed the reactivity of all mAbs grouped in the antigenic region TV. 42 The 9th amino acid (Ser) is therefore and 20. Synthetic peptide 41 of F protein [SEQ ID NO: 19] 7-432 and 422-438 are recognized by mA, b R5~'19 Reproducing at least a portion of the epitope. Sequencing results are shown in Figures 7 and 8. This confirms the finding that antigenic regions H and TV are non-overlapping.

Example 9 - Reactivity of antibodies with synthetic peptides used to select escape mutants The antibody tested was found to be a tryptic fragment of the F1 subunit in Western blots. The synthetic peptides reproduced the epitope recognized by these antibodies. We investigated whether it could be produced.

In summary, the results obtained with synthetic peptides also show that the epitope of antigenic region II This suggested constraints on conformation/yongion in the process. Epitope B4 is sequence number No. 55, peptide 255-275: However, other secretions No related peptides reacted with the antibody. Moreover, the peptides tested Of these, none reproduced epitopes in other antigenic regions TI (B). . Regions of the F1 subunit containing these epitopes resist large amounts of trypsin. may be preserved in Western plots, but synthetic This suggests a special three-dimensional structure that is not conserved in putids.

The peptides listed in Table 4 were prepared using the solid-phase method and t-Bac chemistry “Merrifield (M. errifield), Science, 232: 34 1 347 (1986)] using Applied Biosystems (^ppli It was synthesized using a cd (Biosystem) 430 device. trifle peptide cleaved with olomethylsulfonic acid and separated from the protecting group and terminating agent by Sephadec. It was purified by Sephadex G-25 chromatography. Individual The amino acid sequences of each peptide were analyzed using Applied Biofustem 4 Fufu Protein Sequencing. This was confirmed by automated Edman degradation in a standard apparatus.

mAbs derived from antigenic region II take an altered position in selected mutants. Surrounding F1 subunit [SEQ ID NO: 55 amino acids 250-273.255- Three peptides were synthesized with sequences corresponding to 275 or 258-271. .

Binding of mAbs to synthetic peptides was determined by ELI SA in Example 3. in a polyvinyl chloride microtiter plate coated with 2 μg of peptide. Tested overnight. PBS containing 5% pig serum was used as a blocking reagent. Multiplicative cross-reactivity was removed. The results are shown in Table 4 below.

Only antibody B4 and another bogus antibody B5 contain peptide 255-27 of SEQ ID NO: 55. 5 reacted. B4 titers for this peptide were obtained against purified virus. The titer was similar to that obtained. However, this antibody is based on the peptide of SEQ ID NO: 55. SEQ ID NO: 55, which includes almost the entire amino acid sequence contained in 255-275 It did not react with both peptides 250-273 and 258-271.

All pond antibodies from region II did not react with any antibodies.

Changes in selected escape mutants for mAb RSV19 and 20 Sequence of F1 subunit surrounding the 429th position [SEQ ID NO: 55] 4 17-432.3 other peps corresponding to 422-438 and 435-450 Tido was also tested in EL'ISA (Table 4). Antibodies R3V19, B13 and B1 4 only the first two peptides (417-432 and 422 of SEQ ID NO: 55) -438).

Thus, the F protein is recognized by neutralizing and protective mAbs. Two antigenic sites were identified. The first site is the trib/n resistance of the F1 subunit. amino acid 262-272 of SEQ ID NO: 55. Contains several overlapping epitopes clustered in close proximity. These epitopes Only one of the groups is recognized by B4 and is the amino acid 255-275 of Fl white. It was faithfully reproduced by a short synthetic peptide corresponding to [SEQ ID NO: 19]. 2 The th antigenic site is located in the terminal third of the carboxin of the F1 subunit, and Epitopes recognized by AbR3V19 and B13 and B14 The identified epitopes are 417-432 and 422-438 of SEQ ID NO: 55. were reproduced with synthetic peptides corresponding to the amino acids of the eye. However, mA bB13 and B14 are substituted at the 429th amino acid Arg (Figure 7) mAb that reacts with selected antibody escape mutants for RSV19 The epitopes recognized by mAbs RSV19, B13 and B14 are considered not to be the same. This means that the 429th amino acid Arg is Fl Shows that it is not essential for binding of mAbs B13 and B14 to white. Table 4 below The peptide fragment is taken from the F1 subunit of SEQ ID NO:55.

Table 4 Reactivity of monoclonal antibodies with synthetic peptides Monoclonal antibodies Hef +)' 7C247F AKI3A2 II B4 R5M19 20 B I3 B14250-273 <2. Q book　＜2.0　＜2.0　＜2.0　＜ 2.0 <2. OND ND255-275 <2.0 <2.0 <2.0 <2. (l δ 7 <2.0 <2.0 <2.0 <2.025g-271 <2.0 <2.0 <2.0 <2. (l<2.0<2.f)<2.0 ND N0417m432 <2.0 <2.0 gu2.0 <2.0 <2 ．． 0 2.111 gu 2.0 4.5 3.2422-438 <2.0 <2 ．． 0 (2,0<2.0<2.0 6.0<2.0 5.0 4.3435 -450　＜2.0　＜2.0　＜2.0　＜2.0　＜2.0　2゜3　＜2 ．． OND If DRSV 5 train^2g, 4 6.1 4.9 6.4 5.3 6.4 6.3 5.6 5.6 Synthetic peptide exhaled on wooden well Or IOg+o value of antibody binding titer against R8V antigen tested by ELISA I'm going to go to the top of the river, and I'm going to go to the middle of the day! Pepsca is back! ii sequence corresponding to amino acids 255-275 of F protein [SEQ ID NO: 19] A peptide with 7 overlapping amino acids and an extra 1 amino acid. Two octamers were synthesized, and Geyson et al., Journal of ・Immunocal Melins (J, Immun, Meth,), 102: 259-274 (1987). The peptides were attached to polyethylene bottles using heIIstry. Pe Software package, polyethylene pins and amino acids used for peptide generation. Noic acids were produced by the Cambridge Research Institute in Cheshire, UK. Iochemicals (Cambridge Re5earch Biochemic 1↓"t from als) company.

Place the peptide-binding bottle in a 96-well microtiter plate. Along with buffer M (PBS containing 0,05% Twin 2o and 2% Marvell), - Incubated on a Talene sneaker. Incubated for 1 hour at room temperature Afterwards, the bottles were incubated with mAb B4 and blocked with shaking at 4°C. Diluted to 11600 with buffer. PBS containing 0.05% Twin 20 (PBS /Tw) for 10 times for 5 minutes, then the pins were washed with horseradish beluoki/dase ( HRP)-rabbit anti-cow/IgG [/Guma Co.] to inhibit Diluted 1:4000 with buffer. After 1 hour and 45 minutes, wash the bottle 10 times for 5 minutes. , then 100 ml of 120 volumes of hydrogen peroxide at 0.3 μI/ml. In substrate buffer (01M disodium hydrogen phosphate: 0.08M citric acid) 150 μm/well of 5’ Ong of anonous 3-ethyl-ben dissolved in In the dark in a microtiter plate containing zuthiazinosulfonate E/gumaku. Incubate with stirring. After coloring enough, titer chick Multiscan (Titertech 1lultiscan) MCC34 OD was measured at 405 nm using a 0 plate reader. mAb B4 is sequence # , recognized a single peptide in the range of amino acids 266-273 of 19; A peptide with the sequence ITNDQKKL was attached to the pin.

It is attached to a pin and is represented by the sequence above, but the individual amino acids are made up of 20 naturally occurring 84 linkages to this octamer using peptides that have been replaced with one amino acid present. The combination was further studied. Synthesize two peptides as described above and convert them into peptides. Binding of mAb B4 was detected by ELI SA as shown in Figure 9. Number 266 All peptides in which amino acid 11e is replaced with all other amino acids in order 84 binds to B4, and binding of B4 to one peptide of SEQ ID NO: 266-273 It was shown that 266-11e is not essential. Similarly, 270-Glu and and 273-Lys substitutions also had no significant effect on B4 binding. in contrast , 268-, = λsn, 269-Asp and 272-Lys substitutions of B4 The binding is totally lost, and these amino acids are added to the peptide 266- of SEQ ID NO: 19. It was shown that the bond of 84 to 273 is y-su. These studies To ensure the knowledge obtained from distribution analysis of scape mutants (Example 8), In both prefectures, 268-Asn and 272-Lys bind B4 to F protein. showed that it is important. Substitution of 267-Thr weakens B4 binding and 27 Substitution of 1-Lys significantly enhanced binding to the peptide. 271-Lys is 1le l: the strongest link to peptides 266-273 of SEQ ID NO: 19 when ffi-transformed. The combination of was observed.

Example 11 - Humanized anti-R5V antibody The following examples are described in concurrently filed PCT Application No. PCT/GB91101554. , murine ig (g, mAb called R2M17 or R5MU19) was used as donor The preparation of representative engineered antibodies, used as variable chain sequences and CDRs, is described.

Similar assays using other anti-R'SV antibodies described herein for the development of engineered antibodies. You may follow the method.

R2M17 is specific for the fusion (F) protein of R5V. R3V19 hybrid The mammary cell system is described by Dr. Geraidine Taylor. I got it from a master. Hybridoma cells that secrete monoclonal antibodies specific to R3V The methodology for isolation of cell lines is described by Tiller et al., Immunology. , 52:137-142 (1984).

As described in the previous examples, cytoplasmic RNA was purified by Favalolo, cited above. Prepared from the R5VI9 hybridoma cell line by the method of Oro et al. (1980) Then, using Ig variable region primers, synthesize cDNA as follows. did. IgHH1g abnormal region t: Tsuiteha, R5V19VH (Figs. 15A, 15B and 19) and primer [SEQ ID NO: 33 VHIFOR5° TG AGGAGACGGTGACCGTGGTCCCTTGGCCCCΔG3' For the IgL chain variable region, R3V19VK (Figures 16A and 16 B#Target] and primer [SEQ ID NO: 34] VKIFOR5' GTTAG ATCTCCAGCTTGGTCCC3 was used.

cD The NA synthesis reaction system contained 20 ug of RNA and 0.4 μM in a total volume of 50 μj. Each dATP, dCTP, d of VHIFOR or ~’KIFOR1250μN1 GTP and dTTP, 50mM Tris-1-ICI pH 75, 75mM KCI, 10mM DTT, 3mM Njgc12 and 27 units of RN It consists of an ase inhibitor. Heat the sample at 70°C for 10 minutes and slowly increase to 42°C. It was cooled over 30 minutes. Then, 100 μM MLV reverse transcriptase was added, Incubation was continued for 1 hour at 42°C.

Next, VH and VK cDNAs were amplified using PCR. Used for PCR Tablei 7-i;! : VHIFOR: VKIFOR: VHIBACK ( described in Example 18) and [SEQ ID NO: 35] VKIBACK 5' GACA TTCAC;CTGACCCAGTCTCCA3°.

Primers VHIFORSVKIFOR, VHIBACK and VKIBACK and their use in PCR amplification of mouse Ig DNA, cited above. It is described by Orlandi et al. (1989).

For PCR amplification of VH, 5 μl of DNA/primer mixture RNA/cDNA Hybrid and 05μM VHIFOR and VHIBACK primers? It will be.

For PCR amplification of VK, 5 μl of DNA/primer mixture RNA/cDNA Hybrid and 05 μM VKIFOR and VKIBACK primers? It will be. To these mixtures were added 200 μM each of dATP, dCTP, dGTP and dTTP, 10mM Tr i 5-HCI pH 8, 3, 50mM KCI, 1゜5mM MgCl2.0.01% (w/v) Twin 20.0501% (v/ v) Nonidesoto P40 and 2-unit Taq DNA polymerase [Ohaha, USA] United Steso Biochemicals Cleveland, Io. ted 5tates Biochemicals-Dleveland) was added. 25 heating cycles of 94°C for 1 minute, 60°C for 1 minute, and 72°C for 2 minutes. The sample was subjected to PCH, which was then treated for 5 minutes at 72°C. cloning and For sequencing, the amplified VHD DNA was transferred to low melting point agarose scale and eleuthinol. Phage M1 was purified by Elutip-D column chromatography. It was cloned into 3. Common methods of low nipping and joining are cited above. As described in Maniatis et al.

Either ligate the VHD DNA directly into the Sma1 site of M13mp18/1.9, or Alternatively, after digestion with Pstl, M13tg131 [British Amanoyam I. Notanano B Naru Little Chalfont) was used to ligate into the Pst1 site. increase The widened VK was similarly purified by gel and cloned with the following changes (1) Ligation of PvuII digested fragment into M13mp19 (Sma 1 site); (2) P The vuII and BgI11 digested fragments were ligated into M13mp18/19 (Sma I-BamH1 site) + (3) PvuII and BgI IIM fragment Linked into M13tg131 (EcoRV-BglII site) + (4) BglI Ligation of the I digested fragment into M13tg131 (Smar-Bg I11 site). Conclusion The resulting duplicate clones were collected using Sequenase [Onozoo, USA]. United Sodo Stave Biochemical Zoo Cleveland (United States Biochemicals-Cleveland) Sequencing was performed using the nodeoxy method as cited in Sanger et al.

As shown in FIGS. 14A and 14B and 15A and 15B, respectively, R Sequencing the S~19 VH and VK domains, Kabat et al. No Quen of Proteins of Immunological Interest.” CSequences of Proteins of Immunolog ical Interest-), Ninis Department of Health ・And Human Services/US Dept of Health d Human Services), Ninis Government Printy Printing Of Other VH and site-specific mutations were performed according to the method of Fice) (1987). The murine RSV19 CDRs were transferred into the human framework by a method. for The primer that was [SEQ ID NO: 36] VHCDRI 5’ CTGTCTCACCCAGTGC ATATAGTAGTCGCTGAAGGTGAAGCCAGACACGGT3 '[Sequence number 37] VHCDR2 5' CATTGTCACTCTGCC CTGGAACTTCGGGGCATATGGAACATCATCATTCTC AGGATCAATCCA3' [SEQ ID NO: 38] VHCDR3 5'CCCTTG to CCCCAGTGGT CAAAGTCACTCCCCCATCTTGCACAATA3' [SEQ ID NO. 39 pieces VKCDRI 5° CTGC ding GGTACCATTCTAAAATAG GTGTTTCCATCAGTATGTACAAGGGTCTGACTAGAT CTACAGGTGATGGTCA3.

E sequence number 40] VKCDR2 5’GCTTGGCACACCAGAAA ATCGGTTGGAAAACTCTGTAGATCAGCAG3' [SEQ ID NO. 41 pieces VKCDR3 5" CCCTTGGCCGAACGTCCGAGGA AGATGTGAACCTTGAAAGCAGTAGTAGGT3.

It is.

The DNA templates for mutations were crystallographically dissolved protein, amino acid 27 separators, respectively. Replacement of phosphorus with phenylalanine [Riechmann, cited above] NEW [Saul et al., The Journal of Biology] Cal Chemistry (J.Biol.Chell.) 45: 513-52 4 (1974) and VH and (Epp) et al., European Journal of Biochemistry (Eur. j. Biochem. ), 45: 513 524 (1974)] It consists of a human framework. N113 consists of human structures unrelated to CDH A mold based on Leachman et al., Nature, 332 (1988).

Oligonucleotide site-directed mutations of human X'H and VK genes ＼akamaye et al., Nuclitsk Anons Research (Nucl.A) cid Res. Based on the method of ), 1 49679 9698 (1986) I followed him. \'H or jma\'Klii chain DN. in 5 μg of M13. Heni, 2 encoding three murine CDR (complementarily determined region) sequences Two-fold molar excess of three VH or VK phosphorylated oligonucleotides were added to each. The primer is attached to the template by heating to 70℃. The sample was annealed and gradually cooled to 37°C.

Add 6 units of 74 DNA ligase to the annealed DNA [British Pesley ( Paisley)'s Life Technology o/- (Life Technology y), each Q. 5mM of the following nucleotriphosphate (dATP.dGT P. dTTP and 2'-deoxynotinone 5'-〇-)1-thiotriphosph ate (thiodCTP)); 60mM Tris-HCI (pH 8.0); 6mM MgCL + 5mM DTT [Nogma Co., Poole, UK] and 10mM ATP were added to bring the reaction volume to 50μ. this mixture was incubated at 16°C for 15 hours.

The DNA was then ethanol precipitated and precipitated with 5 units of Ncil [from Pesley, UK]. Digested by If Chikunoronosha]. NjC+ cuts the parental DNA chain, but Cleavage of newly synthesized DNA III with unresolved thio-dCTP It is a restriction enzyme that is left untreated. Then, 50 μl of 60 mM Tr i s-HC I (pH 8.

0), 100 units in a solution of 0.66mM MgCl4 and 1mM DTT. Tuto's Exonuclease III [Milton Keynes, UK] Parental DNA Iti the chain? 'Hi, I removed this. Then, 60mM Tr of 50aI i s-HCI (pH 8.0), 6mM MgClx, 5mM DTT, 1 0mM ATP and Q. 5mM dATP, dCTPSdGTP and 3 units of DNA polymerase in a solution of aisley) Life Technology Co., Ltd. Repair the DNA by adding 2 units of T4 DNA ligase and 2 units of T4 DNA ligase. Recovered.

DNA was transformed into a competent large MflTG by the method of Maniatis et al. cited above. In one cell [manufactured by Amanyam Inno International Ltd., Noyalfont, UK] Transformed.

One-stack DNA was prepared from individual plaques, Messing, Methods in Enzy IIol The sequence was determined by the method of J. Ogy), 101: 20 7 8 (1983). . If only single or double mutants were obtained, triple CDR mutants were obtained. The mutation procedure was further repeated (using the above method) until the result was obtained.

The VH and VK genes with CDR1t changes were cloned into expression vectors. (according to the method of Niatis et al.), plasmids pHuRsV19VH and plasmids, respectively. pHuRSV19VK was obtained. For pHuRsV19VH, IgH chain pro- CD together with motor, appropriate cleavage site and/gunalbebutide sequence The R-substituted VH gene was digested with HidIII and BamHI. cut out from M2S and insert the murine H chain enhancer-1SV40 promoter, gpt gene for selection in human cells and replication and replication in large 1lIJ bacteria. and cloned into an expression vector containing the genes for selection. Its variable category The region amino acid sequence is shown in FIG. Next, the human IgG1 constant region was digested with BamH. Added as I fragment.

The construction of the pHuR3V19VK plasmid was carried out in such a way that the gpt gene was resistant to hygromains. gene and that the human kappa chain constant region was added. They are essentially the same, except that they are shown in Figures 17 and 22.

10 μg (7) pHuR5V19VH and 20 μg pHuR5V19VK. , digested with PvuI using conventional techniques. Mix the DNA and precipitate it with ethanol. It was sedimented and dissolved in 25 μm water. Approximately 10' YB210 cells [Marylan, USA] American Type Culture Collection, Rockville, DE can Type Culture Co11ection)] in a semi-concentrated manner. Grow it until it reaches 100 mL, collect it by centrifugation, and add 0.5 ml of DMEM [Besley, UK]. Gibco (manufactured by Gibco) and the digested DNA in a cuvette. It got cloudy. After 5 minutes of water cooling, a single pulse of 170V at 960μF (None-Pulser) (Gene-Pulser) American Californian Biolanodoli Sotimo (manufactured by Bio-Rad-Richmond) to the cells, and further added to the water. It was left for 20 minutes. The cells were then diluted with 20 ml of DME containing 10% bovine fetal serum. M and allowed to recover for 48 hours. After this, cells were placed in 24-well plates. and selective medium (DMEM, 10% fetal serum, 0.8 μg/ml mycofe Nolic acid and 250 μg/ml xanthine) were added. After 3-4 days, culture medium and dead cells were removed and replaced with fresh selection medium. The transferred clones are 10~ After 12 days, it could be seen with the naked eye.

The presence of human antibodies in the culture medium of wells containing transformed clones was determined by conventional EL. Confirmed by ISA method:. Goat anti-human ■gG at 1 μg/well overnight at 4°C. (comma chain specific) antibody [Crawley Down, UK] ) manufactured by Sera-Lab-Ltd. Covered the titer plate.

After washing with PBST (phosphate buffered saline containing 0.02% Twin 20x) , medium from wells containing 100 μm of transformed cells was added to individual wells; Incubate for 1 hour at 37°C. Then empty the wells and wash with PBST. and peroxidase-conjugated goat anti-human IgG or peroxidase-conjugated Goat anti-human Cuffpar constant region antibody at 1100 doses per well. n was added. The plates were then incubated at 37°C for 1 hour. Then, Wells were emptied and washed with PBST. 340μg/ml 50mM sodium citrate p-phenylenediamine and 50mM sodium phosphate in thorium (pH 5 ,0) and 0.003% (v/v) H,02, 200μ per well. It was set as m.

After 1-5 minutes, the reaction was stopped by adding 50 μl per well of 12.5% sulfuric acid. It was stopped and the absorbance at 492% m was measured with a spectrophotometer.

Cell lines co-transformed with pHuR3V19VH and pHuR3V19VK Humanized antibody HuR3V19VH/VK secreted from Protein-A agacous column [also known as Leves, England] Purified by Boehringer Mannheim , tested for binding to R3V virus in an ELISA assay. R3V Infected with A2 strain [Levis, Medi' Journal Australia] A (Med, J, Au5tralia), 48: 932-933 ( (1961) and treated with 05% (v/v) NP40 detergent to prepare cell lysates. The antigen was present in bovine kidney (CK) cells that gave rise to CK. uninfected CK cells A control cell lysate was prepared in a similar manner using . microtiter plate wells were covered with lysates of infected or control cells. A plate coated with antigen is Block with PBST for 1 hour at 37°C, wash with PBST, then apply humanized antibody. (i.e. HuR3V19VH/VK). Incubate for 1 hour at 37°C After washing, the wells were emptied, washed with PBST, and treated with goat anti-human IgG antibody [ Sage Love Limited from Crawley Down, UK (manufactured by Sera-Lab-Ltd)] was added in an amount of 200% per well.

After incubating for 1 hour at 37°C, the wells were emptied, washed with PBST, and incubated for 2 hours. 00 μl of HRP-conjugated rabbit anti-goat IgG antibody [Nombrebourg, UK] A 1.100000 dilution of A.

After incubation for 1 hour at 37°C, the wells were emptied and washed with PBST.

Each well contains 200 μl of substrate buffer (340 μl in 50 mM sodium citrate). g/ml p-phenylenediamine, 50mM sodium phosphate (pH 5.0) and 0.003% (v/v) H20z) were added. Add 125 sulfuric acid per well. The reaction was stopped by adding 50 μm of the same amount. Then at 492% m Absorbance was measured.

Human H-chain framework (REI and Kappa variable and invariant regions, respectively) generated by linear replacement of the R5V19 H chain and L chain CDRs in This humanized antibody HuRSV19VH/VK (R3H200) is a whole RSV preparation. but with a weaker affinity than the donor murine R3V19 antibody. with minimally variable region III structural modifications to produce high-affinity binding. A high affinity antibody specific for R5V was developed by a designed method. The method includes: Consists of the following modifications and tX test procedures: 1. Individual frameworks known to be important for interaction with CDRs The amino acid residues of the amino acids are compared in the primary antibody and the modified CDR-substituted antibody. for example , 94th amino acid of chain 14 (Kabato number - see Kabat et al. cited above) ) in the primary (donor) and modified antibodies. Arg residue at this position remains unchanged This is thought to interact with the Asp residue at position 101 of the CDR of the H chain.

The 94th amino acid is present in the framework of the primary antibody but not in the modified antibody. If the modified antibody consists of Arg94, another H chain residue containing Arg94 is used in the modified antibody. genes are produced. In the opposite situation, engineered antibody frameworks contains the Arg residue at position 94, but the framework of the primary antibody If it does not contain the g residue, another H chain gene with the original amino acid at position 94 occurs. Prior to any analysis, another plus prepared based on this theory Mids are tested for production of high affinity engineered antibodies.

2 The four CDRs defined by Kabat (see Kabat et al. cited above) framework amino acids in the primary and modified CDR-substituted antibodies. compare. Where there are differences, check each area (e.g. above VHCDRI). With respect to to obtain a small number of modified genes. Then, based on this theory, prepared Additional plasmids are tested for production of high affinity antibodies.

3. Compare the frameworks in the primary antibody and modified antibody, and check the size or hydrophobicity. Focus on residues with significant changes in gender. Based on this theory, the corresponding primary antibody Separate plasmids for each amino acid of interest indicated by Such other plasmids are prepared and tested for production of high affinity antibodies.

The method involves the use of a high-affinity modified antibody of HuR9V19VH/VK specific for R3V. This is exemplified by the production of conductors. Between R8V19VH and pHuR5V19VH The comparison of ~'H gene sequences of Three out of four amino acids are different, which makes them close to CDR3. This indicates that a framework array is defined.

Therefore, R3V19HIJICDR and the four amino acid sequences 91-94 By inserting the framework sequences into the human framework described in the previous example. From this, plasmid pHuR3-'19VHFNS (Figure 20) is prepared. mutation The next oligonucleotide is added to H in M13 using the Used for mutation of uR3V19VH gene.

[SEQ ID NO: 42 HuR3V19VHFNS-5'CTCCCCCATGA , toTTAC, AGAAAATAGACCG3'HuR3V19VHFNS and The cell line co-transformed with pHuR3V19VK (Figure 22) is a secondary human antibody, HuR3V19VHFNS/pHuR5V19VK (hereinafter referred to as R5Hz19 ). Detergent-extracted from virus-infected cells: J ! This antibody was tested for binding to the SV antibody produced by J.C. Ma’ys-R5 HvR8 for V19VH/VKI: 91st-94th v1 in Substitution of residue 4 partially restored antigen binding levels. HuFNS binding properties Additional analysis was performed using unaltered type A R3V (long strain) as the antigen. The test was carried out using ELISA. Data from such additional analysis may mAb R3 in its ability to bind to intact and undenatured RSV. Even if there are any differences between V19 and humanized R3H219 antibodies, This shows that there is very little. This additional analysis also shows that the virus remains unchanged. showed detectable binding of HuR3V19VH/VK, whereas R3V19 or R8) (Z19 shows a significantly weaker bond).

Therefore, the data from this further analysis (i.e., the affinity for the unchanged antigen suggests that it is restored in the R3Hz19 mAb. Against RSV F protein The specificity of RS HZ], 9 is due to the incomplete potential used in CHO cells. This was demonstrated by conventional Western blot analysis using soluble F protein structure.

Example 13-1: Potential of humanized antibodies specific for R3V In order to confirm the therapeutic usefulness of 24 types of clinically isolated RSV, Immunofluorescence analysis was performed for binding.

Bristol Public Health Laboratory ic) realhLaboratory) (Glastre, UK) 19 RSV was isolated from a child in the winter of 1983-1984 and classified as a major subspecies. did. ] Three isolates were classified into subspecies by serotype, and 11 isolates were classified into subspecies. . +4 e I a or MAlo infected with RS V isolate! l cell tissue Proliferated in culture. Once the cells showed cytopathic effects, in 20 ml of PBS. 0.02% (w/v) disodium ethylenediaminetetraacetic acid (EDTA) [UK Pool's BDH Chemicals Ltd. Ltd., Poolc, UK)] and 0 in 3 ml of PBS. ．． Added 25% (w/v) Tribuno, and the thin hat suspension was covered with PFTE. Slide glass (covered with polytetrafluoroethylene 1) Made by Hendley (Ilcndley, Es5eλ, UK)] dripped into the bottle. After incubating for 3 hours at 37°C, dry the slides. and fixed in 80% acetone. Monoclonal antibodies (i.e., human Either mouse antibody RS HZ 19 or murine antibody R5V19) was overlaid. , and left at room temperature for 1 hour. After thorough washing, fluorescein-conjugated rabbit anti- - Mouse IgG [Nordic, Tilburg, Netherlands] ・Co or film manufactured by Nordic Laboratories Luorescein-conjugated goat anti-human IgG1 [Alabama, USA (^labama) Southern Biotic Farm, Bringhac, State Add one of the products manufactured by Biotechnology) and incubate. repeated. After further washing, cells are placed in glycerol! under ultraviolet light Tested.

Comparative immunization for humanized antibody R5H219 and murine antibody R5V19 Fluorescence results show 100% of clinical isolates recognized by both humanized and murine antibodies These data show that humanized antibodies consist primarily of the R3V subspecies. It has been shown to have the ability to recognize most clinical isolates.

The humanized antibody R5H2], 9 was then tested for in vivo biology in fusion inhibition assays. tested for clinical activity. MA104 cell suspension was measured by the multiplicity of g staining per cell. (m, o, i,) Infection was performed at 0.01 PFU (plaque forming unit).

After an incubation period of 2 hours at 37°C, test 2 ml of the 10'/ml cell suspension. Distributed onto coverslips in test tubes. After incubation for 24 hours at 37°C, The culture was transferred to medium containing dilutions of humanized antibody R3H219. After 24 hours, hippo -Glass cultures were fixed in Nuknor for 10 minutes and prepared by May Grunwald (ila). y　Grunwald) staining 1ffl [manufactured by BDH Chemicals, Poole, UK] Stained. Increases RSH219 6If in inhibiting giant cell fusion frequency. The added effect is that human 1-1 in inhibiting cell fusion induced by type A R3-r. The biological activity observed in the modified antibody RS HZ19 was demonstrated. Further research is The fusion inhibition potency of 3V19 vs. R3H219 was shown to be equivalent, and The affinity for the virus antigen is fully restored in humanized R3H219. provided further evidence. Inhibiting cell fusion induced by type A R3V Using methods similar to those used above to demonstrate that the humanized antibody RS I -(Zl9 is also responsible for the fusion of giant cells induced by type B R8V (strain 8/60). It was shown that the inhibition of binding was dose-dependent.

Next, humanized antibody R3I (219) was used in vivo in an RSV-mouse infection model. It was tested for biological activity within. BALB/c mouse [Charles Riva Charles Riνers Inc. Categories where no specific pathogens exist Intranasally, a mouse of Leigh 4 Jun Enoki was injected into 2 strains of human R3V of 10″PFIJ. [Taylor et al., Infec/Yon and I. Munity (Infection and 1 Unity), 43.649- 655 (1984)]. Grouped mice were infected with the virus 1 day before or after infection. 4 days (25 μg of humanized antibody was administered on either barley).

Administration of antibodies was either intranasal or intraperitoneal. 5 days after R3V infection , mice were sacrificed and lungs were analyzed for RSV PFU [Tiller, cited above. Please refer to the literature. Data are shown for R3I-IZ at a single dose of 25 μg per mouse. No. 19 was shown to be extremely effective in preventing and treating Rsv infection.

Mice infected with type B R3V (strain 8/60) using the same method as above. Even when administered prophylactically, RS　HZ　,9 shows activity in vivo. Ta. Moreover, it was not possible to infect type B R3V (strain 8/60) using the same method as above. The humanized antibody HuR3V19VH/VK was also in vivo when administered prophylactically to It showed activity within.

Example 14 - Comparison of R3H219 blood levels after intravenous or intracavitary injection Five female BAL B/C mice (weight 20 g) were injected intraperitoneally. One animal was inoculated with 50 μg of R51 (zx9 (CHO), and another five animals were inoculated with 111ii injection. 50 μg of R8H219 (CHO) was inoculated by the following method. 2 hours, 1.4.7.1 4. After 21 and 46 days, blood was collected from the tail of the mouse and the level of R3H219 in the serum was measured. was measured by the following two different ELISAs.

(i) Lysis of ep-2 cells infected with RSV A2 strain or not infected lysate, then mouse serum and HRP-anti-human IgG. Diluted.

(ii) Overlay the plate with 200 ng of anti-IDI f type mAb B12. The cells were then diluted with mouse serum and HRP-anti-human IgG.

Both analyzes showed essentially the same results, whereas the B12 ELISA , were more sensitive. Two hours after inoculation, mouse serum levels of R3Hz19 were Compared to intraperitoneal injections, intravenous injections were 5 times higher. however , R3H219 titers were equal in both groups of mice 24 hours after inoculation. won. R5H219 levels were maintained for at least 4 days after inoculation and on day 7. started to decrease. After this, mouse R3H219 serum levels inoculated by intravenous injection were Bell decreased p, mt=, but R3H219 levels in mice injected i.p. decreased more slowly. These results are shown in Table 5.

Mouse serum levels of RS TI Z 19 after intravenous or intraperitoneal injection Comparison of ELISA titers in mice inoculated with 10 JLL.

O, 13.5 Sat 02 46±0.2 3.2±0.1 4.2±0.113.1 ±0242 soil 0.04 3.3±0.04 4.3±0.143.2±0142 ±0.1 3.3±0242±00473.1±0.2 3.7±0.3 3. 6±0.2 3.9±0.1M <1.5 <1.5 3.1±0.2 3.8 t0.12] <1.5 <1.5 2.3±1.3 3.5±0.246 N D　＜1.5　ND　3.3±0.1 Injected into mice intravenously injected, We will examine whether the rapid decrease in R3Hz Yu9 on the 14th day is due to an immune response. For this purpose, sera were tested for antibodies against R3Hz19 in an ELISA.

Cover the plate with 50 g of R5H219, then add D21 mouse serum and H Treated with RP-anti-mouse IgG.

Table b (two swords and γ two yotsu (Yu, Seikaku Sosha) (I denomination is l-Yi-soo is 21 Kyo-eup) RS) developed antibodies against fZ29, whereas mice injected intraperitoneally developed antibodies against R5H did not have any detectable antibodies against 219. These results are R3H219i! following intraperitoneal injection in ilitis occurred, but intravenous injection suggests that no resistance developed for this antibody. C) (○ cell again administered R8H219 prepared from bone marrow stem cells to mice by intraperitoneal or intravenous injection. to further confirm these results.

Table 6 50 μg of R3H219 (CHO) was inoculated by intravenous or intraperitoneal injection. Antibody response to R3Hz19 in serum of inoculated mice Dan↓-I SA Ka(i[1i(7)　I　Og　+o＊Intravenous injection 2.5±02 Intraperitoneal injection <1.5 *Example 15 - Clinical separation where plates were covered with 50 g of R3H219 (CHO) recognition of objects Biotin-labeled RSH219 (BOI, 2.5 Mg/ml; September 1992 obtained from SmithKline Beecham, Inc.) and FITC-Streptoa About R3V-infected and uninfected bovine testicular cells using Binone (Nogma). In the preliminary experiment, 1/401 vinyl TF-R3H219 was used with 1/80 amount of FI. Together with TC-streptavinon, it gave specific fluorescence to R3V-infected cells. .

Nine glass slides of nasopharyngeal aspirates from children hospitalized with RSV infection. A copy of the book was published by the Royal Victoria Infirmary, Newcastle-Ab-on-Tyne, UK. 71 Nonos and Research on Rapid Laboratory Vital Dies Agnonos (WHOCCo11abotatjn Center for Re ference and Re5aerch on Rapid Lab shield nitrogen≠ Shield Nitrogen Viral Diagnosis, the Royal Victoria Infirmary, Nyecastle-upon-T凾shi■A Engl and) Obtained from. Place the same sample in three parts of each glass slide. first part Samples were prepared using Imagen according to the instructions in their technical data. R3V (Novo Nordisk Diagnostics Limited (Nova) Nordisk Diagnostics Ltd), Camb ridge) C844WS, UK (υK)). Second part sample was stained with a 1·40 dilution of biotinylated R5H219 at room temperature for 1 hour and incubated in PBS. Wash 3 times with FITC-streptavidin and incubate for 1 hour at room temperature. I started. The third part of the sample was stained only with FITC-Stosib) and Avidin. did. Samples stained with FITC-streptavidin after washing three times with PBS were counterstained with 0.01% Evans Blue for 5 minutes. , washed and placed in 80% glycerol. IMAGENT''' ) A sample of R8V-infected cells in the nasopharyngeal aspirate stained with RSV was Discrete fluorescence typical of infected cells stained with mAb against the N protein of V showed intracytoplasmic inclusions. In contrast, biotinylated R5H219 and FIT Ill1 follicles in the nasopharyngeal aspirate stained with C-streptavidin are associated with F protein. Typical condyle-like intracellular staining was shown. FITC-streptavidin only The sample stained with did not show fluorescence.

The results are shown in Table 7. Biotinylated R5Hz19 was present in all nasopharyngeal aspirates tested. I recognized the R5V. The fluorescence intensity of the sample stained with biotinylated R5H219 is It was smaller than that stained with Imagen TI'R3V. However, staining The number of cells detected appeared to be similar in both samples.

Table 7 Binding of RSH219 to R5V in nasopharyngeal aspirate 651302102/88 ＾ ＋＋＋＋ ＋＋＋743015103/88 ＾ ＋＋＋＋＋9997　16 107/85 B +++++’ -++7920 22103/85 B + + +819520/11/91 Nl) +++++ +++8818 13/ 12/91 ND +++++ +++884514/12/91 ND ++ +9495 16101/92 tsD +++ ++9795 0g101/ 92 ND +++ 10 ÷ These studies are within the range tested by RSH219. indicates that a=i for all R3V of the nasopharyngeal aspirate.

15 mg of I to three 1- to 2-week-old germ-free calves weighing 43 to 55 kg. W>-mAb B4 was intratracheally inoculated, and the other three animals were intratracheally administered PBS. .

24 hours 1 oat, all calves approximately 10'pfu of cows - R5V Snook (Snook) strain intranasally and intratracheally. The lungs of a calf that died of pneumonia A Snook strain of Ratsudo R5V was isolated and published by Thomas et al., Pretty. Nonoyu Journal of Experimental Ba□yo/-(Brit, J , Exp, Patnol, ), 65: 19-28 (1984) 1.2 order CK cells were expanded. After infection, swab samples from the nasopharynx were obtained daily; Seven offspring were sacrificed on the seventh day of infection. The lungs were filled by filling them with 800 ml of PBS. A washing solution was obtained. The lung lavage fluid was centrifuged at 1300 g and the cell pellet was placed in 5 ml of culture medium. resuspended in soil. All samples were analyzed for RSV on secondary CK monolayers.

Treating calves with mAb B4 for 24 hours before infecting them with the bovine strain of RSV. has no effect on viral shedding from the nasopharynx over 7 days of infection. won. However, as shown in Table 8 below, treatment with B4 after R3V3V infection Very little or no virus was recovered from the lungs of calves exposed to Not much was recovered. Calves given mAb B4 did not develop liver damage, but , control animals developed liver damage.

Table 8 Preventive effect of bovine mAb B4 against R3V infection in offspring B4 d- 1* 1097 2.4 <0.7 <11230 3.5 0.7 0 1242 3.6 <0.7 <1 None 1098 2.2 3.2 9 1231 <0.7 3.2 6 24 hours before infection with Uno R3V (BR3V), 15 mg of 813 or Calves were treated intratracheally with 15 mg of B1. mAb Bl in mice It is a non-neutralizing and non-protective but complement-fixing anti-F antibody (Kennedy et al. (1988)). There was a decrease in virus titer in the lungs of calves fed B13. However, when compared to control calves fed PBS, the difference in virus titer was statistically insignificant. Yes! (p=0.07) (Figure 8). However, compared to controls There was a statistically significant decrease in the severity of liver damage in calves fed B13. was there. Compared to controls, the levels of virus in the lungs of calves fed B1 were There were no significant differences either in the severity of liver damage or in the severity of liver damage (Table 9).

These studies showed that B4 was more protective against R3V infection than B13 in offspring. to show that it is relevant. Furthermore, in calves it is not defensive; mAbs that fix complement do not worsen liver damage.

Table 9 Prophylactic effect of bovine mAb against R3V infection in calves B4d-135, 0±0 39±0.7 1<o, 7"<1"'B13 d-144,5±0 ．． 6 2.9”0.2 2 1.3”1.5’2±2.6eBid-144,8 ±05 32±0.7 4 2.6±1.8' 5.5±2.41PBS d- 194,4±1.2 3 leaves 0.5 9 3.1±1.5 10.5±70’PF log+o value of U/ml 5 Probability that passively immunized animals differ significantly from controls. p<Q, 1'p=0.07; ’NS: ’p<0.05 Example 18 - Croni of B4, B13 and B14 sequencing and sequencing of cellular fffRNA as described by Favaloro et al. Rinse in Enzymology (Meth, Enzymol), 65°71 B4, B13 and B14 hybrids by the method of 8-749 (1980) prepared from a horse cell line. 5” end of bovine γ-1 and γ-2 constant region genes Primer complementary to BCGIFOR・5゜TTGΔATTCAGACTT TCGGGGCTGTGGTGGAGG3' [SEQ ID NO: 29] and bovine Primer complementary to the 5° end of the constant region gene, BCLIFOR: 5' CCGAATTCGACCGAGGGTGGGGACTTGGGCTG3' [ SEQ ID NO: 30] respectively [gH chain (VH) and L chain (VL) variable region This was used for the synthesis of regional cDNA.

cDNA synthesis reaction system contains 20 μg of RNA and 0.4 μm in a total volume of 50 μm. M BCGIFOR or BCLIFOR, 250 μM each dATP, dCTP SdGTP and dTTP, 50mM Tris-ICI pH 7,5,10 mMDTT, 3mM MgCh and 27 units of RNase inhibitor [UK Mi Manufactured by Farmanoa from Lli 1 ton-Keynes] Consisting of Heat the sample at 700C for 10 minutes, then slowly heat over 30 minutes. Cool to 42°C. Then, 100μN1 of MLV reverse transcriptase [UK [manufactured by Life Technologies] was added and incubation was continued for 1 hour. .

The \゛H and VHC DNAs were then extracted from Sakai et al., Science ( Science), 239: 487-491 (1988) It was then amplified using polymerase chain reaction (PCR). Used ply for PCR Mar('!, BCGIFORSBCLIFOR.

1 Sequence number 31]■t118AcK・5°, AGGT (S) (N・1)( R) CTGCAG (S) AGTC (W) GG3' [SEQ ID NO: 32:~'L2 BACK 5゛　TTGACGCTCAGTCTGTGGTGAC(K)　CAG　(S) (M)GCCCTC3°.

VHIBACK is Orlandi, et al. Pronordinge National Academy of Sciences Ninnisny (Proc. Nat'　1^cad,　Sci,　.

86: 3833-3937 (1989) . The sequence of VL2B, 8CK is based on the human lambda variable region [cut excerpts cited above]. (1987)] on the basis of the nucleic acid sequence listed for the 5' end of Ru.

VH, DNA/Booyima-ij! A is 5μI of RNA/cDNA, \I":f') NoF and 05μ~10BCLIFOR and ~'H2BAC Consists of 1 K primer. Add 250 μN of each dATPSdCT to these mixtures. P, dGTP and dTTP, 10mM Tris-HCI pH 8,3,50 mM KCI, 1.5mM MgC12, 0.01% (w/v) gelatin, 0 , 01% (v/v) Twin 20.001% (V / V) Nonidenoto P40 and 5 units of AmbliTaq “Cetus” I added the company's co. Sample at 94°C for 30 seconds; 55°C for 30 seconds.

A heating cycle of 72°C for 45 seconds was applied, and the treatment was completed at 72°C for 5 minutes. claw Amplified VHD DNA was run on a low melting point agarose gel and for sequencing and sequencing. Elutip-d column chromatography [Germany] Purified with phage It was cloned into M13 [manufactured by Fuffleman, Milton Keynes, UK].

~'M13mp18 similarly digested HDDNA as a PstI-EcoR1 fragment /19 [manufactured by Farmana, Milton Keynes, UK].

~’L DNA was digested with the same enzyme as SstI-EcoRI fragment M1 3mp18/19. T7 DNA polymerase [Farmana [manufactured by Sanger et al.], using the nodeoxy method National Academy of Sciences Ninnisny (Proc. Nat”1. Acad, Sci, IIS^) 74:5463-54 67 (1977)], representative clones were sequenced.

The amino acid sequence obtained by translation of the variable region gene was translated into known VH and VL sequences. This allowed identification of the CDRs.

B4 and the VH and VL of the B13 and B14 antibodies that are substantially identical in appearance. The amino acid sequences are shown in Figures 3A and 38 (VL) and 4A and 4B (VH). Shown below. The B4 sequence was compared to the 813/B14 sequence to show the homology between them. To construct a vector expressing the chimeric H chain of upper B4, the B4VH gene was ~・113 clone (Example 18), oligonucleotide VHIBACK (Example] described in 8) and ~'HIFOR (5' TGAGGAGACGGTG Using ACCGTGGTCCCTTCGCCCCAG3' [SEQ ID NO: 43] Orlandi et al. Academy of Sciences Ninnisny (Proc, Nat' 1^ca d, Sci, USA) 86: 3833-3937 (1989) It was amplified by PCR as described in (1999). The PCR reaction mixture consisted of 5 05 μM M13 phage supernatant, 0.5 μM each dATPSd in a volume of 0 μM CTPSdGTP and dTTP, 10mM KCI, 20mM Tr i 5 -HCI pH 8, 8, 10mM (NH4)2S○4.2mM Mg504.0 ．． 1% Triton X-'100 and 1 unit of Vent DNA port. Limerase (:, --England Biology (New England) Biolabs). Sample at 94°C for 30 seconds, 506C for 30 seconds, 7 Heat cycle at 5°C for 1 minute] 5 times. & After that, heat at 75°C for 5 minutes and finish. Ta. The amplified DNA was transferred to a low melting point agarose gel and p) -d column chromatography [Njureich, Süsseldorf, Germany] It was purified using a Co., Ltd. manufactured by Jar & Tsuyunil. DNA Ps t l-Bs t M13VHPCRI similarly digested as II fragment (Orlandi, cited above) et al.). Verify the integrity of selected clones by nucleotide sequence. I confirmed it.

B4V except that the human IgG1 constant region is already present in the vector. H was cloned into an expression vector as described in Example 11. the plasmid was named psVgptB4BoVHHu1gG1.

To construct a vector expressing the chimeric L chain of B4, vector Ml3V KPCRI (Orlandi et al. cited above) is first modified and converted from kappa. Rather, a lambda chain variable region was introduced. This means that oligonucleotides, 5'　TGGGCTCTGGGTTAACACGGACTGGGAGTGGAC Using ACC3° [SEQ ID NO: 44], the 5′ end of the existing VK gene was R and oligonucleotide 5° ATTCTACTCACGAC CCATGGCCACCACCTTGGT3° [SEQ ID NO: 45] This was achieved by mutating the 3' end of 1, Hpal and Ncol restriction regions. Each position was introduced. The presence of the Nco1 site in the vector is confirmed by oligonucleotide 5゛CTCCATCCCATGCTGAGGTCCTGTG3' [sequence No. 46].

M13VKPCR1 was grown in E. coli RZ1032, (dut-ung-) This produced a single-layer template DNA having uracil instead of thymine. 0. 5 μg of DNA was added to 1 pmol of each of the above oligonucleotide triphosphates, and an lpmo I oligo that anneals to the M13 template downstream of the insert DNA. Nucleotide VKPCRFOR (5° GCGGGCCTCTTCGCTATT ACGC3゛) [SEQ ID NO: 47 was mixed. 50mM Tr i of 20μm with 25mM MgCh, 63mM NaC in 5-HCI pH 7.5 Anneal the oligonucleotide to the template by incubating at 80°C for 5 minutes. I let it happen. dATP, dCTPSdGTP and dTTP at a final concentration of 250 μM. Add 0.5 units of T7 DNA polymerase (USB) and and 0.5 units of T4 DNA ligase (BRL) in the same buffer. 7mM DTT.

ATP was added to 1 m. Incubate a 30 μm reaction solution for 1 hour at room temperature. and the DNA was ethanol precipitated.

To make a nick in the parental DNAH, 1mM EDTA, 1. m 11 mg/ml containing MDTT, and 1 unit of uranol DNA glycosylase. 50μm of 60mM Trjs-HCI containing m1BsA D to pH 8,0 Dissolve the NA and incubate for 1 hour at 37°C, then add 0.2M NaOH and incubated for 5 minutes at room temperature. Ethanol precipitation of DNA and dissolved in 20 μm TE, and the inserted fragment was amplified by PCR. The reaction mixture consists of 2 μm of mutant DNA, 05 μM each of VKPCRFOR and VKPCRBACK ( 5' CTGTCTCAGGGCCAGGCGGTGA3') [SEQ ID NO: 4 8], 250 μM each dATP, dCTP, dGTP and dTTP, 10 mM Tris-HCI pH 8, 3, 50mM KCI, 1.5mM MgC1z , 0.01% twin 20.0.01% gelatin, 0.01% NP40 and 2 units Thermalase (manufactured by IBI) was contained in 50 μl. Amplification at 94℃ 30 seconds, 500C 30 seconds near 2℃ 1 minute for 15 cycles, finished at 726C for 5 minutes did.

The generated DNA was cloned into M13mp19 as a HindllI-BamHI fragment. I turned it into a loan. Representative clones were sequenced and clonal variations in three parts were determined. A different strain was selected and named M13VLPCR1.

Oligonucleotide VL3BACK (5° TCTGTGTTAACGCAG GCGCCCTCCGTG3°) [SEQ ID NO: 49 and VLIFOR (GG CTGACCCATGGCGATCAGTGTGGTC3') [SEQ ID NO: 5 0] and using the bent DNA polymerase described above for B4VH. By amplifying DNA from M13 clone (Example 8), B4VL Hpal and Ncol restriction sites were introduced at the ends. Purify the generated DNA, M13VL PCRI digested with Hpal and Nco+ and similarly digested Cloned into RFDNA. Clones carrying B4VL were identified by sequencing. The HindlII-BamHI insert fragment of such clone was The <R current vector 9-psVhygB4BoVLHuVK was constructed as described.

The expression vector was co-transformed into 'l'B210 bone marrow stem cells and the transformants were isolated. The chimeric antibody B4BoVH/BoVL was isolated as described in Example 11. Specially refined. Chimeric antibodies were added to RSV-infected cell lysates in an ELISA. Comparison was made with B4 regarding binding. The method uses RSV-infected and uninfected Hep2 The procedure was basically the same as in Example 11 except that a cell lysate was used. reporter anti The body produces HRPO-conjugated Yaki anti-human IgG antibodies (Frawley Down, UK). Crawley-Down, U):) Theta Lab Limited (Sera- Lab Ltd.) and HRPO-conjugated rabbit anti-ura IgG Use an antibody (manufactured by Gutu from Poole, UK) diluted at a ratio of 1:1000. there was.

Ura and chimeric (BoVH/Bo~rL) 4 antibodies were added to infected cell lysates. bound, but an unrelated humanized antibody did not. Antibodies reacting with control lysates There was no body. Due to the use of different reporter antibodies, this experiment and cannot perform comparisons of the chimeric antibodies.

? ! To obtain the same OD reading in separate experiments comparing the human antibody Approximately 25 times more antibodies were required. Therefore, the back and chimeric antibodies are They are almost equivalent.

Example 20 - Human B4 A, B4 humanized H-chin Using site-directed mutagenesis, the 7 CDRs were cloned onto the human NEWM VH framework. B4VH was humanized by transferring it to (Saul et al., 1987, cited above). Literature) Ura-Solemwork residues below e (in Kabat et al. (1987) cited above) (numbering) was incorporated into the humanized VH next to its CDR (see Figure 10) .

Phe27.5er28 and Leu29 are not present in the hypervariable region. , these residues are part of the structural ring part of CDRI (flathead and resk (Chotika and Lesk), Glossy of Molecular Biology (J, Mo1. Biol,), 196: 901 917 ( 1987)).

Leu48 is adjacent to CDR2, and this residue is also present in other newly constructed antibodies. Affected binding.

Arg71 was shown to be important in other newly constructed examples, and CDR1 and included in the backing of 2 (Terawoto et al., Journa Le of Mole Biology (J, Mo11.Biol,), 21 5, 175-182 (1990)).

At this position, L y s 94 connects the CDR3 cocoon by forming a salt bridge. (Kochiriki and Lesk (1987) cited above) literature).

The template DNA is based on Ni13mp19 and the NEWM framework and It contains a VH gene consisting of CDRs and unrelated CDRs, and contains a VH gene consisting of n) et al., Fuichi+-(Nature), 332: 323-327 (1 988) is similar to that described. As described above regarding the construction of 5i13VL PCR1. I made the mutation as shown.

The oligonucleotide used was VHCDRI: 5’ CTGTCTCACCCAGCTTACAGAATA GCTGCTCAATGAGAAGCCAGACAC3' [SEQ ID NO. 51 V) (CDR2: 5° CATTGTCACTCTGGATTTCAGGGCT GGG T T AT A A T A T A T CCG CCA T T G CT T G CG T CT To CC, To GCC, To CT CA A G A CC3° [Sequence number 52] VHCDR3: 5° 　CAAGGACCCTTGGCCCCAGGCGTCGACATACTCGC CCTTGCGTCCAGTACAAGCATAACTTCCCACTATTCAC CAACAGAACACTTTGCACAATAATAGACCGC3° [Arrangement Row number: 53 and generic M13/pUC-20 primer, 5° GTAAAACGAC GGCCAGT3° [SEQ ID NO: 54].

Cut the DNA encoding VH containing all three B4 CDRs from M13. and the expression vectors described for chimeric VH in Examples 11 and 19. pSVgptB4HuV'HHu1gG1 was obtained.

psVgptB4HuVHHu1gG1 was chimerized as described in Example 11. I) Co-transformation with SVhygB4BoVLHHuVK I changed it. Therefore, the resulting partially humanized antibody B4HuVH/BoVL Humanized B4 H chain (B4HuVH) with chimeric L chain 4BoVLHuVK including. Cells secreting B4HuVH/BoVL antibodies were cultured, and the antibodies were incubated at 400 m Purified from conditioned medium of 1.

Regarding binding to cell lysis infected with R3V strain A2 in ELI SA, B4 The HuVH/BoVL antibody and the chimeric antibody B4BoVH/BoVL were compared. this The comparison allowed evaluation of the relative binding capacities of chimeric and humanized heavy chains.

Humanized heavy chain HuVH binds to RSV-infected cell lysates, whereas chimeric heavy chain B Compared to oVH, binding capacity is 2 to 3 times poorer.

We attempted to incorporate additional murine-derived residues to increase binding ability. HuV For NSV, the H gene was mutated to encode the following changes, and the 73rd T, N at position 76, Fo at position 78 These residues are located in the fourth ring of the antibody binding surface. It is a part of the β-turn that forms a shaped structure.

Prepare HuVHNS~'/BoVL antibody and use ELISA to inoculate RSV. Binding to lysates of cells infected with the Nook strain was tested. Remains of RSV Incorporation of the group did not result in any advantage over the original HuV8.

One other difference between BoVH and HuVH that may affect binding is This is the 67th to 70th amino acid region. Bovine B4 residue L at position 67 , l at the 69th position means that those side chains fill the inside of the domain. Therefore, it is expected that it will be more likely to affect antigen interactions. Moreover, 6 7th is L168th is G, 69th is 1 and 70th is T Changes are also expected to be beneficial.

B, B4 Humanized Chin The humanized form of B4Lia's B4Hu'v'L was transformed into a bovine B4VL humanized form. Constructed by site-directed mutagenesis of the framework, human/KOL lambda is available. (see variable range region 11). gp found on heavy chain expression vectors Cells were selected for the presence of the t gene.

Use Northern blotting to determine whether the HuVL RNA is the correct size or not. I looked into the squid. Total RNA was converted to BoVH/HuVL and BoVH/HuVL FR 4 transformants, BoVH/BoVL transformants and uninfected YB210 served as a positive and negative control. BoVL and HuVL probes The first results used showed bands of approximately the same size. In a similar experiment, cDNA was prepared from each cell line, and constant region primers and VL3BACK were PCR was performed using For all three L chains, the products are again of the same size. obtained, showing no significant splining problems.

Two additional humanized chain constructs - forms based on the human REI kappa structure of the light chain and linked to the CDRs with the framework of the human KIM46L lambda chain. The KIM46L VL gene (Cairns et al., Tsuyana) Le of Immunolono〇, Immun, ), 143: 685 691 (1989)).

This is believed to be the first example of a humanized bovine antibody. database The lack of bovine variable region sequences in the DNA for designing and initial cloning and sequencing This means that it is difficult to isolate.

Effect of VO4 Groups of five mice were inoculated intranasally with approximately 10' PFu of the A2 strain of RSV; On day 4 of infection, different amounts of R3BVO4 were administered alone or as shown in Table 10 below. Either in combination with 0.5 mg/kg R3H219 was injected intraperitoneally. R.S. ■Five infected mice were sacrificed and virus levels in the lungs were measured on CK cells. .

The results are shown in Table 10 and show the efficacy of treatment using R3H219 and R5BVO4 simultaneously. The effects have been shown to be additive rather than synergistic.

Table 10 Dose (mg/kg)' R3V titer group in lung R3H219R3BVO4 IOgt of PFU/g.

A 0.5 -- 3.6±07 B O, 50, 52, 2±06 CO,50,252,3±08 D　O,50,1252,6±09 E--1,0' 2.1±08 F--0,752,3±06 Ci--0,6252,6±07 Various modifications and variations of the present invention are encompassed by the above identified specification and will be apparent to those skilled in the art. Considered to be self-evident. Such modifications and changes are included within the scope of the claims. It is believed that it will be done.

Sequence list (1) General information/ (1) Applicants: Tiller, Noeraldinstott, Nidward Noei (11. Title of the invention: For the treatment of respiratory syncytial virus infection in animals and humans. and novel antibodies for prophylaxis. (iii) Number of arrays, 59 (iv) Contact information (A) Address: SmithKline Beecham Corporation 7-Corporate Patten (B) Street name: Swedenland Road (C) City name: King of Prono A(D) State name: Bennorbania (E) Country name: United States of America (F) ZIP 119406-2799 (V) Combinator readable format (A) Media format: Floppy disk (B) Computer: IBM PC Compatible (C) operating system PC-DO8/Ms-DO5 ( D) Software Patent-in-Release e) (A) Application number W 0 (B) Application date (C) Classification (vii) f Forfeiture data (to) Application number GB 9207479.8CB) Application date April 6, 1992 (viii) Patent attorney/agent information.

(8) Name, Tsuyabis, Barbato H (B) Registration number: 31.171 (C) Processing number for agents, etc. + P50153 (2) Regarding distribution 11 number/l information (2) Array characteristics (A) Sequence length: 112 amino acids (B) Sequence type/amino acid (D) Topology/Unknown (11) Molecular form/protein (xl) Sequence description: Sequence number 1. (2) Information regarding array number 2 (i) Features of array (A) Sequence length: 116 amino acids (B) Sequence type/amino acid (D) Topology/Unknown (11) Molecular form protein (xi) Sequence description Sequence number 2 (2) Information regarding array number 3 (i) Characteristics of array・ (A) Sequence length: 137 amino acids (B) Sequence type, amino acid (D) Topology, unknown (ii) Molecular form protein (xl) Sequence description Sequence number 3 (2) Information regarding array number 4 (1) Characteristics of array (A) Sequence length: 141 amino acids (B) Sequence type Amino acid (D) Topology. not clear (IJ) Molecular form protein (xl) Sequence description Sequence number 4゜ (2) Information regarding array number 5 (1) Characteristics of array (A) Sequence length: 129 amino acids (B) Sequence type Amino acid (D) l-porono unknown (11) Molecular form protein (xl) Sequence description Sequence number 5 (2) Information regarding array number 6 (1) Characteristics of array (A) Sequence length: 109 amino acids (B) Sequence type Amino acid (D) Topology unknown (11) Molecular form, protein (X]) Sequence description Sequence number 6 (2) Information regarding array number 7 (1) Characteristics of array (Go to 4) Sequence length: 133 amino acids (B) Sequence type Amino acid (D) Topology unknown (ii) Molecular form Q protein (xi) Sequence description/Sequence number/7. (2) Information regarding array number 8 (i) Features of array (A) Sequence length: 111 amino acids (B) Sequence type diamino acid (D) Topology unknown (+1) Molecular form protein (xi) Sequence description/Sequence number 8゜ (2) Information regarding array number 9 (1) Features of array.

(A) Sequence length: 348 base pairs (B) Sequence type Nucleic acid (C) Number of M double strands (D) Topology unknown (11) Molecular form: Geno++ic DNA (Xl) Sequence description: SEQ ID NO. ;9・ (2) Information regarding array number 10 (1) Characteristics of array (A) Sequence length: 116 amino acids (B) Sequence type Amino acid (D) Topolon - unknown (ii) Molecular form protein (]X) Features (A) Symbol representing characteristics Modified-site (B) Existence location 6 (D) Other information Even if the amino acid at the 6th position is replaced with Glu or Gln good.

(Xl) Sequence description Sequence number 10 (2) Information regarding SEQ ID NO: 11.

(i) Characteristics of array・ (A) Sequence length: 337 base pairs (B) Sequence type Nucleic acid (C) Number of strands: double strands (D) Topology/Unknown (+1) Molecular form A to D (genome) (xi) Features (A) Symbol representing array CD5 (B) Existence location 1. , 333 (xi) Sequence description Sequence number 11 (2) Information regarding sequence number 12.

(1) Characteristics of array.

(A) Sequence length: 111 amino acids (B) Sequence type Amino acid CD) Topology unknown (11) Molecular form protein (xi) Sequence description Sequence number 12 (2) Information regarding array number 13 (i) Features of array (A) Sequence length: 116 amino acids (B) Sequence type Amino acid (D) Topology unknown (11) Molecular form protein (xl) Sequence description Sequence number: 13 (2) Information regarding sequence number 15 (B) Sequence type diamino acid (Xl) Sequence description, SEQ ID NO: 15・(xi) Sequence description SEQ ID NO: 16゜ (2) Information regarding sequence number 17 (A) Sequence length: 112 amino acids (B) Sequence type Amino acid (D) Toborono unknown (1x) Features (A) Symbol representing characteristics CD5 (B) Location: 14. ．． 1735 (Xl) Sequence description: Sequence number: 18: ACTATCTGCT CATAGAC AACCCATCTGTCA TTGGATTTTCTTAAAATCTG 1 825TAGATTCCTA GTTτATAGTT ATAT 1899 (2 ) Information regarding sequence number 19: (1) Characteristics of array・ (A) Sequence length: 574 amino acids (B) Sequence type Amino acid (D) Topology linear (11) Molecular form, protein (xi) Sequence description/Sequence number, 19 Glu Leu Leu Ser Leu Ile Asn Asp Me Pro Ile Thr Asn Asp G1nTyr Ser Engineering 1e M et Sar Ile IIs Lys Glu Glu Val Leu A la Tyr Va1Ala Phe Ser Asn (2) Information regarding array number 20 (i) Features of array (A) Sequence length, 42 base pairs (B) Sequence type Nucleic acid (C) Number of strands: double strands (D) Topology/Unknown (ii) Molecular form DNA (genome) (ix) Characteristics (A) Symbol representing characteristics: CD5 (B) Existence position 1t:1. ．． 39 (X]) Sequence description, sequence number 20 (2) Information regarding array number 21 (]) Characteristics of arrays・ (A) Sequence length: 13 amino acids (B) Sequence type, amino acid (D) Topology linear (11) Molecular form, protein (xi) Sequence description, Sequence number 21 phe Gly Thr Gly Thr Lys Valτhr Val L eu Gly Arg Glu (2) Information regarding sequence number 22 (1) Characteristics of array (A) Sequence length: 39 base pairs (B) Sequence type/nucleic acid (C) Number of chains/unknown (D) Topolono, unknown (A) Sequence length, 20 base pairs (B) Sequence type/nucleic acid (C) Number of chains: one chain (D) Topology unknown (+1) Molecular form DNA (genome) (xi) Sequence description SEQ ID NO: 28 CTCAGττωτCCττGCTTAG (2) Information regarding sequence number 29.

(1) Characteristics of array.

(A) Sequence length: 32 base pairs (B) Sequence type, nucleic acid (C) Number of chains: one chain (D) Topology unknown (11) Molecular form Q: DNA (genome) (Xl) Sequence description Sequence number 29 TTGAATTCAG ACTTTCGGGGG CTGTGGTGGA GG ( 2) Information regarding sequence number 30 (i) Features of array (A) Sequence length: 32 base pairs (B) Sequence type Nucleic acid (C) Number of chains: one chain (D) Topology unknown (11) Molecular form DNA (genome) (X]) Sequence description SEQ ID NO: 30 CCGAATTCGA CCGAGGGTGG GGACTTGGGCTG (2 ) Information regarding array number 31 (]) Characteristics of arrays (A) Sequence length: 21 base pairs (B) Dari type 4 nucleic acid (Number of C chains, one chain (D) Topology unknown (ii) Molecular form DNA (genome) (Xl) Sequence description, SEQ ID NO. 31 Regarding AGGTSMRCTG CAGSAGTCW G(2) Sequence number 32 information (1) Characteristics of array (A) Sequence length: 34 base pairs (B) Sequence type Nucleic acid (C) Number of chains: one chain (D) Topology unknown (ii) Molecular form Q: DNA (genome) (xi) Sequence description Sequence number, 32 TTGACGCTCA GTCTGTGGTG ACKCAGSMGCCTC (2) Information regarding sequence number 33 (1) Characteristics of array (A) Sequence length: 34 base pairs (B) Sequence type, nucleic acid (C) Number of chains - terminal chain (D) Topology/Unknown (11) Molecular form: DNA (genome) (xi) Sequence description, Sequence number 33 (B) Sequence type/nucleic acid (C) Number of chains, -terminal chain (D) Topology/Unknown (11) Molecular form DNA (, genome) (xi) Sequence description SEQ ID NO: 39 (2) Information regarding array number 40 (1) Characteristics of array (A) Sequence length: 45 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology unknown (ii) Molecular form DNA (genome) (xl) Sequence description Sequence number. 40 GCTTCGCACA CCAGAAM, TCGGTTGGMACTCTGTA Information regarding GATCAGCAG 45(2) Sequence number 41 (i) Features of array (A) Sequence length: 51 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology unknown (11) Molecular shape tube D and A (genome) (xi) Sequence description Sequence number 41 CCCTTGGCCCAACGTCCGAG GAAGATGTGA ACCT TGAAAG CA to TAGTAG T51(2) Regarding sequence number 42 information (]) Characteristics of arrays・ (A) Sequence length: 28 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology. not clear (ii) Molecular form/DNA (genome) (Xl) Sequence description SEQ ID NO: 42゜ CTCCCCCATG AATTACAGAA ATAGACCG 2[1(2 ) Information regarding array number 43 (1) Characteristics of array (A) Sequence length: 34 bases (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Toboronow, unknown (1]) Molecular tube DNA (genome) (Xl) Sequence description SEQ ID NO: 43 TGAGGAGAC GTGACCGTGG TCCCTTGGCCCCAG 34(2) Information regarding sequence number 44 (i) Features of array (A) Sequence length: 36 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topolo/-unknown (11) Molecular form DNA (genome) (xi) Sequence description Sequence number, 44: TGGGCTCTGG GTTMCACGG ACTGGGAGTG GACA Information regarding CC36(2) sequence number, 45.

(Characteristics of array: (A) Array length 133tj! base pair (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology/Unknown (11) Molecular form DNA (genome) (xi) Sequence description SEQ ID NO: 45 ATTCTACTCA CGACCCATGG CCACCACCTT GGT 33(2) Information regarding array number 46 (1) Characteristics of array (A) Sequence length: 25 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology unknown (11) Molecular form DNA (genome) (xi) Sequence description SEQ ID NO: 46 CTCCATCCCA TGCTGAGGTCCTGTG 25 (2) Sequence number Information regarding 47 (1) Characteristics of array (A) Sequence length: 22 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology unknown (ii) Molecular form: DNA (genome) (Xl) Sequence description/Sequence number 47 (2) Information regarding sequence number 48 (1) Characteristics of array・ (A) Sequence length: 22 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology. not clear (ii) Molecular form DNA (genome) (Xl) Sequence description SEQ ID NO: 48 ・TCTCAGG GCCAGGCGGT GA 22 (2) Sequence number in CT Information about 49 (i) Features of array (A) Sequence length: 27 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology unknown (11) Molecular form DNA (genome) (Xl) Sequence description Sequence number 49 TCTGTGTTAA CGCAGGCGCCCTCCGTG 27(2) sequence Information regarding number 50 (1) Characteristics of array (A) Sequence length: 27 base pairs (B) Sequence type Nucleic acid (C) Number of chains, -terminal chain (D) Topology unknown (11) Molecular form: DNA (genome) (Xl) Sequence description/Sequence number 50/ACCCA to GGCT AT to TGGC Information regarding CAG TGTGGTC27(2) Sequence number 51 (1) Characteristics of array (,A) Sequence length: 48 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology unknown (11) Molecular form DNA (genome) (Xl) Sequence description SEQ ID NO: 51: CTGTCTCACCCAGCTTACAG AATAGCTGCT CAAT Information regarding GAGAAG CCAGACAC4B (2) SEQ ID NO: 52.

(i) Features of array (A) Sequence length: 78 base pairs (B) Sequence type Nucleic acid (C) Number of chains - terminal chain (D) Topology unknown (11) Molecular form DNA (genome) (xi) Sequence description Sequence number 52 (2) Information regarding array number 53 (i) Sequence characteristics.

(A) Sequence length: 102 base pairs (B) Sequence type 8 nucleic acid (C) Number of chains - terminal chain (D) Topology unknown (+1) Molecular form DNA (genome) (xi) Sequence description, SEQ ID NO: 53 (2) Information regarding array number 54 (i) Features of array (A) Sequence length: 17 base pairs (B) Sequence type Nucleic acid CC) Number of chains - terminal chain (D) Topology, unknown (11) Molecular form DNA (genome) (xi) Sequence description SEQ ID NO: 54 GTMAACGACGGCCAGT (2) Information regarding array number 55 (1) Characteristics of array・ (A) Sequence length: 438 amino acids (B) Sequence type Amino acid (D) Topology unknown (11) Molecular form, protein (xi) Sequence description Sequence number 55Val Ala Val Ser Ly s Val Leu Hls Leu Glu Gly Glu Val As n　LysSer　Asn　k! :q Val Phe CyS Asp Th r Met Asn Ser Leu Thr Leu Pr.

11e Ala Val Gly Leu Leu Tyr Cys Lys Ala Arg Ser Thr Pr.

410, 415, 420 Val Thr Leu Ser Lys Asp Gin Leu Ser Gly Engineering 1e Asn Asn Ile Ala? he Ser Asn (2) Sequence number 56 (i) Features of array (A) Sequence length: 8 amino acids (B) Sequence type, amino acid (D) Topology unknown (ii) Molecular form protein (ix) Features (A) Symbol representing characteristics Modified-site (B) Existence location 1 (D) Other information X is Ala, CysSAsp, Glu, PheSGly.

His, LeuXProSGlnSArgSSer+Thr, Va l, Tr It may be p or Tyr.

(xi) Sequence description Sequence number 56 (2) Information regarding array number 57 (1) Characteristics of array (A) Sequence length: 8 amino acids (B) Sequence type Amino acid (D) Topology unknown (11) Molecular form protein (IX) Features (A) Symbol representing characteristics %4odified-site (B) Existence location 5 (D) Pond information X is 1. Hesp, Glu, Phe, Ile, Leu, Me t.

, Herg, Ser, Thr, Val or Trp.

(XI) Sequence description Sequence number 57 (2) Information regarding array number 58 (1) Characteristics of array (A) Sequence length: 8 amino acids (B) Sequence type Amino acid (D) Toborono unknown (II) Molecular form protein (IX) Features (A) Symbol that does not represent characteristics Modified-site (B) Existence location 6 (D) Other information X is 1. Hesp, GluSPhe, He, Leu, Met.

Can be Arg, Ser, Thr, Val, Trp, Tyr or Gln .

(Xl) Sequence description Sequence number 58 (2) Information regarding array number 59 (1) Characteristics of array.

(, to) Sequence length: 8 amino acids (B) Sequence type Amino acid (D) Toborono unknown (11) Molecular form protein (ix) Features (, to) Symbol representing characteristics Modified-site (B) Location 8 (D) Other information X may be Ala, Cys, Asp, or Glu.

(xi) Sequence description Sequence number 59 11e Thr Asn Asp Gin Lys Lys XaaFIGII RE 3A Part of B1 antibody variable region light chain T57 acid distribution Wll 1 number 711 11'Xl: 3,, 131.1 anti+ 4"i'11: part of light chain, acid sequence SEQ ID NO: 2 FIGURE 3B FIGURE 4A Some of the B4 antibody variable region heavyweights Amino acid sequence SEQ ID NO: 3 Partial amino acid sequence of B13/Bl, 4 antibody variable region single chain SEQ ID NO: 4 B13VH: Gin Val Xaa Leu Gln Gln Ser G I Pro Ser Leu Val Lys Pr.

B13VH: Ser Gin 'I'hr Leu Ser Leu Thr Cys Thr Val Ser Gly Leu Ee■ FIGURE 4B B4VH: Arg Asp Asn Ser Lys Ser Gin Va l Ser　Leu　Ser　Leu　Asn　ThrB13VH:　Lys　 Asp Asn Ser Lys Ser Gln Val Ser Leu Ser　Leu　Ser　5erB4VH:　-Cys　Ser　Val　Gl y Asp Ser Gly Ser Tyr Ala Cys Thr -R Antibody of 8-' - Binding of F mAb to escape mutant strain F engineering GURE 10 ``Correct Tominaku Trp Gly Gln Gly Thr Thr Val Th r　Val　5erFIGURE　11 B4 HuVK Sequence number 6 F Engineering GURE 12A B13/B14 HuVHt'u11'y: 7Gln Val Gin Leu Gin Glu Ser Gly Pro Gly Leu Val Arg Pro Ser G1nThr Leu Ser Leu Thr C ys Thr Val Ser GIY Leu Ser Leu Ser M FIGURE 12B Val Thr Val Ser Ser F GURE 13 B13/B14 HuVK iE row 1 8Asp Ile Gin Leu T hr　Gin　Ser　Pro　Ser　Ser　Leu　Ser　Ala　S er　Val　Gly 厘正四]Trp　Tyr　Gin　Gin　Lys　Pr o Gly Lys Ala Pro Lys LeuSer Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu [Tsukasa1Phe Gly Gln Gly T hr Lys Leu Glu Ile Lysloo 105 110 FIGURE 14A DNA sequence of R5-'19 heavy chain variable region Sequence number, 9 Amino acid sequence of RSV19 heavy chain variable region Sequence number, 10 CAG GTCCAG CTG CAG SAG TCW GGG ACA G AG CTT GAG AGG TCA GGGGln Val Gln Le u Gln Xaa Ser Gly Thr Glu Leu Glu Ar g Ser GlyGCCTCA GTCAAG TTG TCCTGCACA GCT TCT GGCTTCAAACATT AAAAla Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe Asn Engineering 1e LysHGURE 14B TCCAAACACA GCCTACCTG CAG CTCACCAGCCTG ACA TTT GAG GAC3=r Asn Thr Ala Tyr Leu Gln Leu Thr Ser Leu Thr Phe Glu AspFIGURE 15A R5-'19 light chain variable region I) NA sequence SEQ ID NO: 11 Amino acid sequence of RS V 19 light chain variable region SEQ ID NO: 12 GAC#, GG TTCAGT GGCAGT GGA TCA GGG AC A GAT TTCACA CTCAAG ATCAsp Arg PheSe r Gly Ser Gly Ser Gly Thr Asp Phe Th r Leu Lys Engineering 1eFIGURE 15B 1. G, Human [9G1 Constant part V4Q promoter “Human” constant part vLQ FIGURE 18 R3V19VHEWlli’ff: 13Gin Val Gln Leu Gln Glu Ser Gly Thr Glu Leu Glu Arg Ser　GlyAla　Ser　Val　Lys　Leu　Ser　Cys　T hr Ala Ser Gly Phe Asn Engineering 1e LysSD Tvr T r Met His Trp) let Lys Gln Arg Pr o Asp Gln Gly LeuGlu Trp Engineering 1e Gly rp Ile Asp Pro Glu Asn As Asp Val Gin T rAla Pro Lvs Phe G 7Lys Ala Thr Met Thr Ala Asp Thr 5erSer Asn Thr Ala Tyr Leu Gln Leu Thr Ser Leu Thr Phe Glu　AspThrAlaValTyrPheCysAsnSer　r　GI 5erAslheAs HisTrp Gly Gln Gly Thr T hr Val Thr Val Ser Ser E’GURE 19 pHuP, 5V19VH SEQ ID NO., 14Gin Val Gln Leu G ln Glu Ser Gly Pro Gly Leu Val Arg P ro Ser GlnThr Leu Ser Leu Thr Cys Th r Val Ser Gly Phe Thr Phe Ser proof 1Trp Val Arq Gin Pro Pro Gly Arg Gly Leu Glu Trp Ile resistance Arg Val Thr Asn Leu Val Asp Thr Ser Lys Asn Gin Phe 5erLeu Arg Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr CysAlaArg Trp GI Ser Asp Phe As His Trp GlyGln GlyTh r　Thr　Va1Thr　Val　Ser　5er FIGURE 20 pHuR3V19VHFNs, , , , , , .

Gin Val Gin Leu Gln Glu Ser Gly Pro Gly Leu Val Arg Pro Ser GlnThr Leu S er　Leu　Thr　Cys　Thr　Val　Ser　Gly　Phe　T hr Phe Ser Regeneration E TomTrp Val Arg Gin Pro Pro Gly Arg Gly Leu Glu Trp IlepArg Val Thr Met Leu Val Asp Thr Ser Lys Asn　Gin　Phe　5erLeu　Arg　Leu　Ser　V al Thr Ala Ala Asp Thr Ala Val Tyr P he CysAsn Ser Trp Glv Ser ASD Phe As p His Trp Gly Gln Gly Thr Thr Va1Thr Val Ser 5er FIGURE 21 pHuR3V19VHNIK Sequence a No.: 16Gln Val Gin L eu Gln Glu Ser Gly Pro Gly Leu Val A rg Pro Ser GlnThr Leu Ser Leu Thr Cy s Thr Val Ser Gly Phe Asn Ile Lys i Kiku Trp Val Arg Gln Pro Pro Gly Arg Gl y Leu Glu Trp Ile] Arg Val Thr 1let L eu Val Asp Thr Ser Lys Asn Gln Phe 5 erLeuAra Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Phe Cysμ, sn Ssr Trp Glv Ssr Asp Phs ASD His Trp Gly Gln Gly Thr Thr VaP Thr　Val　Ser　5er FIGURE 22 Asp Glv Asn Thr Tvr Leu Glu Trp Tyr Gin Gin Lys Pro Gly Lys AlaPro Lys L eu Leu Ile Tyr Ara Val Ser Asn Ar Ph e　Se　Gly　Val　Pr.

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr　Asp　Phe　Thr　Phe　Thr　l1eSer　Ssr　L eu Gin Pro Glu Asp Ile Ala Thr Tyr T yr Cys 1F Engineering GURE 23 HuVL framework 4 Original nucleotide sequence Sequence number: 20 Human lambda J1 genetic sequence sequence SEQ ID NO. , 22 Takumi Singing Tribunal Report lmm1laejl Am1cm+1w N@ρCT/GB 9310072 5 International Search Report Continuation of front page (51) Int, C1,' Identification symbol Internal office reference number C07K 14/11 5 8318-4HC12N 5/10 15109 ZNA //(C12P 21108 C12R1:91) 9455-4C (72) Inventor Stott, Nidward James Berkshire, UK R.G. 16.8 T.N., Seabury, Down End, Moffetts Le. New Henrietta Farm (no street address shown) I A61K 37102 ADY

Claims (1)

[Claims] 1. Anti-RSV antibody antigen fused to a selected second peptide or protein sequence A fusion protein consisting of a specific amino acid sequence. 2. Claim that said second sequence is heterologous to said sequence having anti-RSV antigen specificity. The protein according to item 1. 3. The antigen specificity is determined by amino acids 266 to 273 of the fusion protein of SEQ ID NO: 19. 2. A protein according to claim 1, which is directed against a amino acid sequence or an analog thereof. 4. The protein according to claim 1, wherein said antibody is a bovine antibody. 5. The antibodies include bovine monoclonal antibody B4 and bovine anti-RSV antibody B1. 5. The protein according to claim 4, which is selected from the group consisting of 3/14. 6. The amino acid sequence corresponds to the variable region H chain of the antibody, the variable region L chain of the antibody, the variable region H chain of the antibody, at least one CDR from the variable region light chain; at least one CDR from the variable region light chain; , a functional fragment or analog thereof. . 7. The amino acid sequence is (a) X is Ala, Cys, Asp, Glu, Phe, Gly, His, Leu , Pro, Glm, Arg, Ser, Thr, Val, Trp and Tyr Sequence number selected from the amino acids: 56: [Sequence exists], (b) Y is Asp, Glu, Phe, He, Leu, Met, Arg, Ser, Thr, SEQ ID NO: 57 selected from the amino acids consisting of Val, Trp and Tyr: [There is an array], (c) Z is Asp, Glu, Phe, Ile, Leu, Met, Arg, Ser , Thr, Val, Trp, Tyr and Gln. Array number: 58: [There is an array] ,and (d) W is selected from the amino acids consisting of Ala, Cys, Asp and Glu; Sequence number: 59: A request having an expression selected from the group consisting of [There is an array] The protein according to claim 1. 8. The amino acid sequence corresponds to (a) the variable region heavy chain sequence of SEQ ID NO: 3 in FIGS. 4A and 4B. (b) From the variable region light chain sequence of SEQ ID NO: 4 in Figures 3A and 3B. and (c) a functional fragment or analog of (a) or (b). The protein according to claim 1, which is selected from the group consisting of: 9. The amino acid sequence is (a) 31st to 35th amino acids of SEQ ID NO: 3: [Sequence exists]; ( b) 50th to 65th amino acid of SEQ ID NO: 3: [Sequence exists]; (c ) where X is any amino acid or the absence of an amino acid, such as 100 of SEQ ID NO: 3. Amino acid number 122: [Sequence available]; (d) SEQ ID NO: 1 and 2 22nd to 34th amino acids: Ser-Gly-Ser-Ser-(Ser or Asp)-Asn-Ile-Gly-(Arg or Ile)-(Trp or Phe)-(Gly or Ala)-Val-(Asn or Gly); (e) 50th to 56th amino acids of SEQ ID NO: 1: [Sequence exists]; ( f) 89th to 96th amino acids of SEQ ID NO: 1: [Sequence exists]; (g ) 89th to 97th amino acids of SEQ ID NO: 1: [Sequence exists]; (h) 50th to 56th amino acid of SEQ ID NO: 2: [Sequence exists]; (j) Column number: 89th to 99th amino acids of 2: [Sequence available]; (j) Sequence Number: 4, 31st to 35th amino acid: [Sequence available]; (k) Sequence number No.: 4, 50th to 65th amino acid: [Sequence available]; and (1) The 98th to 122nd amino acids of SEQ ID NO: 4, where Y is any amino acid. Mino acid: [There is a sequence] Is it a group consisting of The protein according to claim 1, consisting of one or more CDR peptides selected from . 10. an anti-RSV operably linked to the selected second fusion partner nucleic acid sequence; a first fusion partner nucleic acid encoding an amino acid sequence having the antigenic specificity of the antibody; A fusion molecule consisting of a sequence. 11. (a) to (1) of claim 9 and (m) any of the above peptides. an antibody selected from its fragments or analogs thereof characterized by antigenic specificity; -RSVCDR peptide. 12. Variable region L chain amino acid sequence of isolated bovine anti-RSV antibody, - A fragment or analog thereof that shares RSV antigen specificity. 13. In the antibody, the light chain sequence is naturally occurring or modified. SEQ ID NO: 1 and 2 in FIGS. 3A and 3B, SEQ ID NO: 1 in FIG. 6 and the sequence SEQ ID NO: 8 of FIG. 13. Antibodies listed above. 14. Variable region H chain amino acid sequence of isolated bovine anti-RSV antibody, - A fragment or analog thereof that shares RSV antigen specificity. 15. In the antibody, the H chain sequence is naturally occurring or modified. SEQ ID NO: 3 and 4 in FIGS. 4A and 4B, SEQ ID NO: 4 in FIG. 15. The sequence of claim 14 is selected from the group consisting of the sequence SEQ ID NO: 5 and SEQ ID NO: 7 of FIG. 12. antibodies. 16. the variable H chain or variable L chain amino acid sequence of the selected anti-RSV antibody; encodes a functional fragment or analog thereof in the desired antibody framework. optionally to facilitate insertion into or fusion with a chosen fusion partner. An isolated nucleic acid sequence that may have restriction sites. 17. At least a portion of the H chain variable region of the receptor antibody is specific to respiratory syncytial virus. substituted by a similar portion of the heavy chain variable region of at least one antibody having isomerism. A modified antibody consisting of an amino acid sequence and a suitable L chain sequence, which The antibody is heterologous to the donor antibody. 18. The variable H chain region of the donor antibody is untreated and the variable H chain region of the acceptor antibody 17. The antibody of claim 16, wherein the antibody is fused to. 19. The variable region H chain CDR fragment of the donor antibody is replaced with the H chain CDR fragment of the acceptor antibody. 18. The antibody according to claim 17, wherein the antibody has been changed. 20. The L chain is (a) Variable L chain region of donor antibody fused to L chain constant region of acceptor antibody (b) L chain CDR of the donor antibody replacing the L chain CDR fragment of the acceptor antibody. L chain consisting of fragments (c) donor antibody L chain, and (d) Heterologous receptor antibody L chain 18. The antibody according to claim 17, which is selected from the group consisting of: 21. The variable region L chain region of the donor antibody is that of SEQ ID NO: 1 in FIGS. 3A and 3B. or a functional fragment thereof, and the variable heavy chain region of the donor antibody is shown in Figures 4A and 4A. and SEQ ID NO: 3 in Figure 4B, or a functional fragment thereof, and produced 17. The modified antibody is characterized by antigen binding specificity for mAb B4. Antibodies described. 22. The variable heavy chain region of the donor antibody is that of SEQ ID NO: 2 in Figures 3A and 3B. or a functional fragment thereof, and the variable heavy chain region of the donor antibody is shown in Figures 4A and 4A. and SEQ ID NO: 4 in Figure 4B, or a functional fragment thereof, and produced The engineered antibody is characterized by antigen binding specificity for mAb B13/B14. 18. The antibody according to claim 17. 23. At least a part of the sequence of the heavy chain variable region of the human receptor antibody is at least Replacement with a similar portion of the amino acid sequence of the heavy chain variable region of one bovine donor antibody A humanized antibody consisting of an amino acid sequence and a suitable L chain sequence, which Humanized antibodies are characterized by antigenic specificity for bovine donor antibodies. 24. 24. The antibody according to claim 23, wherein the antigen specificity is binding to an epitope of RSV. The antibody has the sequence SEQ ID NO: 5 in FIG. 10 and the sequence SEQ ID NO: 7 in FIG. 12. a humanized heavy chain variable region sequence selected from the group consisting of sequences consisting of humanized heavy chain variable region sequences; 25. Humanized chain sequence of SEQ ID NO: 6 in Figure 11, humanized chain sequence of SEQ ID NO: 8 in Figure 13 Sequence, characterized by the light chain variable region sequence of SEQ ID NO: 1 in Figures 3A and 3B Naturally occurring bovine monoclonal antibody light chain and the sequences of Figures 3A and 3B Characterized by the L chain variable region sequence number: 1, the L chain constant region of a human receptor antibody by a light chain selected from the group consisting of chimeric bovine/human light chains fused to the region 25. The antibody according to claim 24, which is characterized. 26. SEQ ID NO: 19 F protein amino acid sequence 266th to 273rd and its fragment, its Fab fragment, or its F(ab')2 fragment as an essential component An antibody other than B4 capable of binding to an RSV peptide, the antibody being a monoclonal antibody. null antibody or modified humanized antibody. 27. Antibody library consisting of hybridoma products and B4 and B13 /B14 along with one or more antibodies selected from the group consisting of Antibiotics generated by searching a library of immunoglobulins from species. - RSV antibody, Fab fragment or F(ab)2 fragment thereof. 28. one or more fusion proteins according to claims 1 to 9; C according to claim 11; DR peptide, biologically active sequence or claim according to claims 12-15 A pharmaceutical composition comprising the antibody described in 17 to 27 and a pharmaceutically acceptable carrier or diluent. A product. 29. An effective amount of the pharmaceutical composition according to claim 28 to a human in need of prophylaxis or treatment. A method for preventing or treating human RSV infection, which comprises administering. 30. The nucleic acid sequence according to claim 16 or the nucleic acid sequence of the fusion molecule according to claim 10 A recombinant plasmid consisting of 31. A mammalian cell line transformed with the recombinant plasmid of claim 30. . 32. encodes the protein under the control of regulatory sequences capable of replicating and expressing the protein; culturing a suitable cell line transformed with the nucleic acid sequence and The method for producing a fusion protein according to claim 1, which comprises obtaining the protein expressed from a cell system. . 33. From producing fusion proteins or antibodies in transgenic animals A method for producing the fusion protein according to claim 1 or the modified antibody according to claim 17.