JPH07506251A - Novel plant virus sequences - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Novel plant virus sequences field of invention The present invention relates to novel plant virus sequences, including novel amino acid sequences, new a novel nucleotide sequence, a vector comprising the novel nucleotide sequence, a vector comprising the novel nucleotide sequence; plants into which regulatory sequences have been introduced; methods for increasing plant resistance to diseases; and transgenic plants with improved resistance to diseases.

Background of the invention Neo-wheat yellow spot is the most important disease of winter barley in Central Europe and Asian countries. It is one of the spirit (Inoue & 5aito, 1975 Descripti ons of Plant Viruses, No. 143) Recently, this disease barley yellowmosaic virus ; BaYMV) and barley mild mosaic virus (barley m1l) By two types of viruses called dmosaic virus; BaMMV) It was confirmed that this was caused (Kashiwazaki et al., 1989 An nals Phytopathology Journal of Phytop athology Kodandan, 249-259).

BaMMV was previously thought to be a mechanically transmissible isolate of BaYMV It is.

These two types of viruses have the same particle morphology, approximately 275 nm and 550 nm. Consists of two flexible rod-shaped bodies with a length of nm and causes similar disease symptoms (Hutb (&1984 Phytopathology Z1 top 1.37-5 4) These virus particles are similar in size to bisegmented boria demofluoride. The double-stranded RNA genome is wrapped in a capsid (approximately 8 kb and 4 kb; Hu tb et al., 1984; Prols et al.

1990). However, the results of cross-hybridization experiments and restriction enzyme analysis The results show that these two viruses differ considerably at the nucleotide sequence level. It has been suggested that (Batista et al., 1989 Plant Pathol ogy 3dan, 226-229 and Prols et al., 1990). Also, serology No cross-reactivity was observed in standard experiments (Jianping and Adams, 1991 Plant Pathology40.226-231; Kas hiwazaki et al., 1989a).

These two barley mosaic viruses are both Polymyxa graminis ( It is transmitted by a soil fungus called Polymyxa graminis). , chemical control measures are ineffective, and reduced yields can be reduced by cultivating resistant varieties. This can only be prevented. The resistance of many European varieties to neo-wheat yellow spot is , "A recessive gene (ym4) derived from spring barley called Ragusa J" (Kaiser & Fr1edt, 1989. Th eor, Appl.

Genetics 77.241-245) o However, the effect of such 7m4 gene In recent years, resistant strains of aYMV have been reported in Germany and the UK, overwhelming the population. and, as a result, spread the basis of resistance to the neo-wheat macular disease complex. A need has arisen. Apart from this, there are at least three types of germplasm in Asian barley. It has been reported that there are resistance genes (Gotz et al., 1991, Proce. edings of the 5ixth International Bar ley Genetics Symposium; Kashiwazaki et al. 1989a), and is actively incorporated into landrace breeding programs in Europe. .

Currently, complementary methods of gene transfer to cereals are being developed. The goal is to create resistance through genetic engineering means. against certain viruses Coat protein-mediated interference (coat protein-mediated interference) can be used to generate resistant plants. -proteinmediated cross-protection) Various molecular techniques have been used for this purpose.

Coat protein-mediated interference was first reported by Powe l 1-Ab e 1 et al. (1986, 5science 232.738-743), they disease symptoms in transgenic tobacco expressing TMV coat protein. I found that it was much slower. Kono-like resistance 1;! AIMV, CM V, TRV, TSV, PVX, PVY.

It has been demonstrated with many different viruses such as PVS (“GeneticEn gineering of Crop Plants” (Lycett & Gri published by Reed International PLC) Review of Nelson et al., 1990; Beachy et al., 1990 Ann, R. ev.

Phytopathology 28.451-474), RNA Will It has been proven to be a common method for creating resistance to It is no exaggeration to say that.

Furthermore, it is presumed to be a replicase complex of the tobacco mosaic virus (TMV) genome. Tobacco transformed with the part encoding the component to be infected with tobacco mosaic virus Golemboski et al. showed that it is resistant to infection by closely related strains of It has been reported (1990. PNAS Dane, 6311-6315). therefore , expressing virus-derived nonstructural protein sequences other than the coat protein. Transgenic plants can also be grown against that particular virus or its closely related strains. There is a possibility that it may show resistance.

Additionally, to make the transgenic host plant resistant, It has been found that the introduced viral genes do not necessarily need to be translated.

In fact, mere transcription of virus-derived sequences is sufficient to confer resistance. obtain. This has been demonstrated in transgenic tobacco and in Tomato Subotedou. tomato 5potted virus; TSWV) (de Haan et al., 1992 Bio/T technology Kodan, 1133-1137L and Botivirus (pot Tobacco etch virus (tobacco etch virus) belonging to irus; TEV) (Lindbo and Dou gherty, 1992 Virology Upper Dandan.

725-733) are made. Transcription (no translation) of such viral genes ) is another type of potyvirus. Regarding potato virus Y (PVY), (van der Vlugt et al.; 1992 Plan tMolecular In one aspect, the present invention provides a method for modifying residues 1 to 123 in FIG. An amino acid sequence comprising the amino acid sequence (SEQ ID NO: 1) or a functional equivalent thereof. provide.

This sequence is the C-terminus of the BaMMV polypeptide and is the putative replicase of TMV. The ingredients are similar. Therefore, this sequence corresponds to the Golemboski et al. report ( It is expected to protect plants in a manner similar to that described in (1990).

In one embodiment, the present invention provides the amino acid sequence of residues 124-374 of FIG. No. 2) or a functional equivalent thereof.

This sequence encompasses the coat polypeptide of BaMMV. Prior art (e.g. , Power et al., 1986), it is known that plants If the coat protein of the virus is expressed, it will not be caused by the virus. can increase the plant's resistance to certain diseases.

In certain embodiments, the invention provides the amino acid sequence of residues 1-374 of FIG. 3) or a functional equivalent thereof.

In another aspect of the present invention, the amino acid sequence of amino acids 124 to 374 in FIG. provide a nucleotide sequence comprising a coding sequence or a functional equivalent thereof; .

Preferably, a nuclease encoding the amino acid sequence of amino acids 124 to 374 in FIG. The octide sequence has an in-frame (reading frame matched) AT at the 5' end of the sequence. Contains a G translation initiation codon and an appropriate initiation consensus sequence.

However, as would be obvious to those skilled in the art, translation signals (such as the ATG start codon) It is not essential to ensure the usefulness of the nucleotide sequence of the present invention. aforementioned As mentioned above, in order to confer resistance to plants containing viral sequences, the viral sequences must be transferred. A copy is sufficient; translation is not essential.

In certain embodiments, the nucleotide sequences of the invention correspond to the nucleotide sequences of FIG. Comprising the nucleotide sequence of nucleotides 370-1122 (SEQ ID NO: 4) .

In a preferred embodiment, the nucleotide sequence of the invention is the nucleotide sequence of FIG. The sequence of nucleotides 1123 to 1462 of the code sequence (SEQ ID NO: 25) or its function further comprising equivalents.

Therefore, in a preferred embodiment, the present invention provides that the nucleotide sequence of FIG. The sequence of nucleotides 370 to 1462 of the sequence (SEQ ID NO: 26) or its functional equivalent provide something.

In yet another aspect, the invention provides a method that encodes the amino acid sequence of amino acids 1-123 of FIG. or a functional equivalent thereof.

Preferably, the nucleotide sequence in this aspect of the invention is the nucleotide sequence of FIG. 1 to 369 (sequence number near).

More preferably, the nucleotide sequence of the invention comprises a 3' poly(A) tail. stomach.

In another aspect, the invention provides a method comprising one or more nucleotide sequences of the invention. We provide vectors that

Preferably, the vector described above contains a promoter suitable for the intended host. , a polypeptide encoded by one or more nucleotide sequences of the invention It is something that has the ability to express feelings.

The term "functional equivalent" refers to nucleotides that are essentially identical to the sequence shown in Figure 4. (RNA and DNA) sequences and amino acid sequences, provided that they are protein code (for nucleotide sequences) or displayed (for amino acid sequences); Nucleotides that contain minor sequence changes that do not significantly change their quality properties used to mean sequences as well as amino acid sequences. Such functional equivalents An example is given in Example 1 (and FIG. 7), and in that example, the Several clones differed in their nucleotide sequences, resulting in the predicted amino acid The acid sequences are also different.

In particular, the term "functional equivalent" refers to the nucleotide sequence shown in Figure 4 under standard conditions. It is used to include sequences that hybridize with the complementary strand of the sequence. this Such functional equivalents typically have a difference of 80% or more, preferably 90% or more, from the sequence shown in Figure 4. expected to show nucleotide sequence homology to the above. and other functional equivalents. Deletion mutants or truncations of the nucleotide and amino acid sequences of the invention on.

These can be determined by those skilled in the art based on the disclosure in this specification. should be easy to prepare. This type of truncation can also be prevented. Molecular Plant-Microbe Inter actions 5゜144-153).

In a further aspect, the present invention provides that the nucleotide sequence of the present invention is artificially introduced. provided with a plant or a part thereof.

As has already been shown by other researchers, A transgenic plant containing a viral sequence of If it is simply transcribed or transcribed and translated into a virus, They become more resistant to the diseases they cause. Therefore, the original Plants that transcribe or translate light sequences are infected by barley mild mosaic virus. It would be expected by those skilled in the art to exhibit greater resistance to the disease caused. Resistance This increase may be due to general immunity to the virus or a delay in the onset of disease symptoms , or by an intermediate step between these two extremes (e.g., reducing the severity of the disease). It can be expressed as

Therefore, in another aspect, the present invention provides for barley mild mosaic virus The nucleotides of the present invention can be used as a method for increasing the resistance of plants to diseases caused by Transforming a host plant or a portion thereof with a vector comprising the code sequence, A method comprising causing the above-described sequences of the invention to be transcribed in a main plant. provide.

In certain embodiments, the nucleotide sequences of the invention include Therefore, a promoter sequence recognized by the plant is turned on so that it can be translated. Connected as possible.

In another aspect, the present invention provides Tweets that have been genetically engineered to have increased resistance to the diseases they cause Provide transgenic plants.

Therefore, in certain embodiments, the present invention provides barley mild mosaic as a way to increase plant resistance to diseases caused by viruses, The nucleotide sequence encoding the amino acid sequence of amino acids 124 to 374 in Figure 4 is A method comprising transforming a host plant or a part thereof with a vector comprising ,I will provide a.

Preferably, such vectors contain the nucleotides 370-1122 of FIG. It contains a tide sequence.

Research results elsewhere have shown that expression of virus-derived nonstructural protein sequences by host plants It has been shown that the severity of disease symptoms exhibited by virus-infected plants is also reduced by Golemboski et al., 1990).

Therefore, in another embodiment, the present invention provides barley mild mosaic as a way to increase plant resistance to diseases caused by viruses, Contains a nucleotide sequence encoding the amino acid sequence of amino acids 1 to 123 in Figure 4. a method comprising transforming a host plant or a part thereof with a vector comprising provide.

Preferably, such vectors contain the nucleotide sequence from nucleotides 1 to 369 of FIG. Contains columns.

In certain embodiments, the invention provides a nucleic acid sequence encoding the amino acid sequence of FIG. Transgenic plants in which the otid sequence or its functional equivalent has been artificially introduced against the disease caused by barley mild mosaic virus. The present invention provides transgenic plants with increased resistance to

A better understanding of the invention may be obtained by reference to the following illustrative examples and drawings. Dew.

The drawings will be explained below.

Figure 1 shows the BaMMV coat protein polypeptide obtained from purified virus particles. It is a photograph showing the results of 5DS-PAGE analysis.

Figure 2 shows the results of detection using a radiolabeled oligonucleotide probe as a probe. Northern blotting analysis of RNA extracted from manufactured BaMMV virus particles This photo shows the results.

Figure 3 shows the sequencing strategy used to determine the DNA sequence of BaMMV coat protein. It is a diagram showing an outline.

Figure 4 shows the 1462 nucleotides at the 3′ end of BaMMV RNA1. The nucleotide sequence and poly(A) tail are shown.

Figure 5 shows the deduced amino acid sequence of the 3' end of RNA1 of BaMMV and the R of BaYMV. Differences from the predicted amino acid sequence of the 3' end of NA1 are shown.

Figure 6 shows BaMMV, BaYMVSPVY and PPV (7) each': FIG.

Figure 7 shows sequence variations detected among partially sequenced cDNA clones. change.

Example I For the Streetley strain of BaMMV, the original sample was M, J, Ad Obtained from Dr. Ams (Rothamsted, UK), Hordeum pulgare (Hordeum vu±1 to 2) cultivar Maris O Maris Otter was mechanically inoculated using a painter's airbrush. (Adams et al., 1986 Annals of Applied Biology 1 Dandan, 561-572). Virus Huth other methods (1 984). However, at this time, 1mM phenyl was added to prevent decomposition. Methylsulfonyl fluoride (PMSF) was added. From this purified virus, B. aMMV RNA was added to 0.1% SD containing 0.1 mg/ml proteinase K. Phenol/chloroform extraction after incubation in S solution for 20 min at room temperature and ethanol precipitation.

The virus preparation (protein content 120 μg) purified by the above method was 70% formic acid solution containing 2.5 mg/ml cyanogen bromide, dried in an ap concentrator. Resuspend in 0 μl. Incubate this in the dark for 16 hours at room temperature with continuous stirring. I bet.

Plotting of cyanogen bromide degraded peptides on PVDF membrane ( Matsudaira, 1987 Journal of Biologica lChemistry 262, 10035-10038) or Brownle eAquapore C8RP300 cartridge column (2, I Separated either by HPLC using 2 mm). 0.1% trifluoroacetic acid (T F A) When overlaying the HPLC column that has been equilibrated with the solution, The sample was previously diluted 10 times with distilled water. 90% acetonitrile 10. O8 Samples were run over 70 minutes using a 0-70% linear gradient of 5% TFA in water. eluted. Some selected peaks from the eluted peaks were re-produced using the same column. 90% acetonitrile 10.1%T as before. Elution was performed by a linear gradient of FA solution. However, the slope of the concentration gradient at this time is is three times the slope of the concentration gradient portion from which the peak eluted during the first HPLC run. I adjusted it so that it was gentle. N-terminal protein sequencing was performed using Applied Performed using a Biosystems model 470 protein sequencer. Ta. 5DS-PAGE is the method of Laemmli (1970 Nature 227. 680-685).

SDS polyacrylamide gel electrophoresis of purified BaMMV shows 32.5 kDa.

Three polypeptide bands of 26 kDa and 25 kDa appeared. The obtained coo A massy blue stained gel is shown in Figure 1 (molecular weight markers and molecular weight (Mr) are in kilograms. (denoted in Dalton). The ratio of these three bands varies depending on the individual virus preparation. became. In some experiments, all three bands were present in approximately equal proportions. However, in other experiments, the top band dominated. these three All bands were purified with affinity purified antibody against the 32.5 kDa band. Cross-reacted. Combining these experimental results, the 32.5 kDa band is the main one. Coat protein polypeptide, the other two minor bands are degradation products It seems to be.

Attempts to sequence the N-termini of three types of coat protein bands were unsuccessful. Therefore, I decided to use the cyanogen bromide decomposition method. Peptide degradation products are gel fractions. They were separated by analysis and PVDF blotting or HPLC. There are 3 types of pens in total. peptide sequences were obtained (see Figure 4), and the degeneracy (of codons) determined from these sequences. The area where 2 is the least heavy is covered with an oligonucleotide protein for the coat protein gene. selected for the synthesis of the tube.

Since BaMMV consists of two RNA components of approximately 8 kb and 4 kb (Usugj et al. .

1989 Annals Phytopathology 5ociety J apandan 5.26-31; Batista et al., 1989), :I-) The location of the coat protein gene is determined by radiolabeled coat protein oligonucleotide CP. -1, and CP-2 as probes by Northern blotting method ( Figure 2).

BaMMV total RNA prepared as described above was analyzed on a formaldehyde agarose gel. Separate on a Hybond N nylon filter (manufactured by Amersham). Blotting was performed according to the manufacturer's instructions. (codon) 14m with less degeneracy er oligonucleotides CP-1 and CP-2 (5'-GGRTCXGGYTC YTC-3' and 5'-GTRAAYTGRTCXGG-3', respectively, Row number = 8 and sequence number = 9゜where R = A or G, X = A or C or G or T , Y=C or T).

These oligonucleotides target coat protein regions whose amino acid sequences have been determined. is complementary to the RNA of BaMMV. using T4 polynucleotide kinase CP-1 and CP-2 were radiolabeled with 32p and the plots were prepared according to Sambrook et al. Method (1990 Molecular Clonjng, a 1 aborator y manual 2ndedition, United States Cold Spring Ha 5 lower than the expected Tm (melting temperature) according to rbor (published by Press) Probe was carried out at ℃.

Although a slight cross-reactivity was observed between CP-2 and RNA2, Both oligonucleotides hybridized primarily with RNA1 (Figure 2: RNA Positions of standards (Mr) are given in kb). This result is This suggests that the protein is encoded by the long chain component of the two RNA components. Ru. The cross-reactivity observed between CP-2 and RNA2 was due to the RNA marker and As can be seen from the fact that nosobridization was also observed, hybridization This is thought to be due to the mild oxidation conditions.

To clone the BaMMV coat protein gene, a cDNA clone was used. A sample was synthesized and probed with CP-1 and CP-2.

To give an overview, cDNA 5ynthesis System Plus (manufactured by Amersham International 1) according to the instructions for use. cDNA was extracted from BaMMV total RNA using oligo dT as a primer. Synthesized. However, the synthesis of the first chain is controlled by Moloney murine leukemia virus (Mo lonemurine leukemia virus) RNase H-1 The instructions for use and the use of reverse transcriptase and buffer solution manufactured by GIBCOBRL were used. was different.

cDNA synthesis involves the incorporation of [α-32P]CTP into the first and second strands. monitored by. EcoRr restriction site methylation protection method (Sambrook An EcoRI linker was ligated to the cDNA according to the following method (M. et al., 1990). cDNA Fractionation was performed by sucrose density gradient centrifugation. Sucrose density gradient centrifugation fraction is 0.1M NaCl, 20mM Tr i 5-HCI (pH 8), 10mM EDTA Using a freeze-thaw tube containing a 20% w/v sucrose solution containing Va l l l AH6500-Turn at 3500 Orpm for 16 hours at 20°C. I went with great care. Separate aliquots of each fraction on a 1% agarose gel and dry the gel. After exposure to autoradiographic film. A break larger than 500bp Fractions containing the fragments were pooled and ligated into EcoRI-digested pUc13 and isolated from E. coli (Dan).

co1) DH5α strain (GIBCOBRL) was transformed. ampicilli Plasmid DNA from resistant colonies was collected using the Holmes and Quigley method. (1981Ana1.Bjochem, 114, 193-197) and controlled Screening was done by creating a limit map. You can also apply the gel to Southern Broth. and probed with cp-i and CP-2.

By using CP-1 and CP-2 as probes, the code can be detected as shown in Figure 3. Four overlapping cDNA clones containing sequences homologous to the protein gene (p BM-217, pBM-55, pBM-249 and pBM-322) are the same determined. In Figure 3, a region containing an open reading frame (ORF) is shown. The area is indicated by a square mesh, and the estimated cleavage site is marked with an arrow. 4 clones Both strands of the duplex were completely sequenced for all. Other 8 cDNs A region of partial single-stranded sequence data was also obtained from the A clone (Fig. 7), and at least Two independent clones generated the entire 3' 1462 nucleotide region of RNA1. Made it covered. A recombinant clone containing the coat protein gene is United 5tates 5equena manufactured by Biochemicals Using the se Kit, the dideoxy method of Sanger et al. (1977 PNAS 7 4.5463-5467). pBM-21,7, -55, -24 Determine the 1elJ of the entire strand from both strands of the duplex of each clone 9 and -322. However, a combination of exonuclease deletion mutants (Sambrook et al., 1 990), subcloning and specially prepared oligonucleotide primers was used.

The DNA sequence was compiled using the DNA5TARI Inc. computer package. Pile and analyze. Amtno Ac1d Align (AANW) Program Using Ram version 1.68, gap penalty of 2, deletion penalty The sequences of each protein were compared using 12.

The sequence of 1462 nucleotides on the 3' end of R, NA1 of BaMMV was FIG. 4 shows the amino acid sequence encoded by the sequence. Arrow indicates mature coatta The putative cleavage site resulting in protein is shown. Purified pillions (complete virus particles) The peptide sequences obtained by direct sequencing are underlined. Third array (LGF TVPID; SEQ ID NO: 10) is any of the sequences that may exist in the above sequence. Not located within the ORF and derived from host components purified together with the virus preparation It seems like it will. Two amino acid sequence models conserved among the genus Botiuvirus I circled the chief. Numerous sequence changes occur, especially in partially sequenced clones. (such as pBM616). The strategy used for sequencing is shown in Figure 3. and shown in Figure 7. Four clones (pBM-217, -322, -55 and -2 49), the sequence has been completely determined. Furthermore, eight clones (pBM- 627, -621, -609, -616, -604, -608, -614 and - 624) was partially sequenced. Sequence data obtained from these eight clones The direction and length of the data are indicated by arrows. Nucleotides that differ from the common sequence (shown in Figure 4) Also displayed.

As a result of computer analysis, the termination is 340 nucleotides upstream from the poly(A) tail. One large ORF of 1122 nucleotides terminating with a codon was found with (+) chain pyrion polarity. Ori for the coat protein probe described above. The two peptide sequences used to obtain the oligonucleotide are shown in the diagram. was identified within the above ORF (Fig. 4). Amino acid sequence of AGHEEPDP (W The peptide starting with iJS number: 11) is usually located before the cyanogen bromide degradation site. is not located after a methionine residue (Alien, 1981) (i.e. (not cleaved by cyanogen bromide decomposition), the coat protein N It is most likely the end. Furthermore, a putative LQ/A cleavage site exists; LQ/A cleavage sites such as those of several potyviruses as well as BaYM It is characteristic of the polyprotein cleavage site of V (Kashiwazaki et al.

1989b Journal of General Virology, 3015-3023; 5hukla et al., 1991 Canadian Jou rnal of Plant Pathology 13.178-191).

The estimated molecular weight of BaMMV coat protein calculated from the DNA sequence is 28.5 kDa, which is smaller than the estimate from 5DS-PAGE (Fig. 1). This is a regular This may be due to unusual migration or post-translational modification of the coat protein. That's probably why.

Sequence of BaMMV coat protein and relatedness to coat proteins of other viruses To assess the relationship, a computer search was performed using the predicted amino acid sequences. . The highest homology (36% overall identity) is to the coat protein of BaYMV. The homology was lowest at the N-terminus (Figures 5 and 6a).

Figure 5 shows the predicted amino acid sequences of the 3' end of RNA1 of BaMMV and BaYMV. are arranged. The upper row is the RNAI sequence of BaMMV, and the lower row is the sequence of B. This is the sequence of RNA1 of aYMV, and the middle column shows the homologous region. Gap (− ) were introduced to maximize homology.

Figure 6 shows a) BaMMV coat protein (BMCP, PRO) and BaYMV coat protein (BYCP, PRO), b) coat protein of BaMMV and potato Y virus (PvY) coat protein (PVYCP, PRO) , C) BaMMV+7) foot protein and plum pox virus (plu mpox virus; PPV) coat protein (PPVCP, PRO ) is a dot plot comparison diagram of predicted amino acid sequences.

The homology with botyviruses such as PVY and PPV is not very high (20- 22% identity), and for these as well, the homology was lowest on the N-terminal side (Fig. 6b and 6c). The N-terminal sequences of coat proteins of various Botyvirus species are conserved. It has already been reported that this has not been done (Shukla and Ward, 1 988 Archives of Virology, 171-200), Sequence models known to be conserved between Poteivirus and BaYMV Chief NGTS and FDF (K, ashiwazaki et al., 1989b; T immerman et al., 1990 Journal of General Vir ology, 1869-1872゜Niblett et al., 1991 Jour nal of General Virology 72.499-504) is It was also conserved between BaMMV and boteivirus (Fig. 4).

A computer calculation of the hydrophilicity of BaMMV coat protein revealed that N 60 amino acids on the terminal side and 25 amino acids on the C-terminal side are hydrophilic. There was found. This result shows that potyvirus, BaYMV, and BaMMV have a corresponding range. This suggests that the regions are located at similar surface positions (Kashiwazaki et al., 1 989b.

5hukla et al., 1988 Journal of General Viro logy69.1497-1508).

The predicted amino acid sequence upstream of the coat protein of the BaMMV ORF (BaMMV ~55% homology between amino acids 1-123) of BaYMV and the putative Nib product of BaYMV. Although Nib of BaYMV was also observed to have a similar effect on the coat protein gene, RNA-dependent RNA polymer of positive-strand RNA viruses located immediately upstream (Kashjwazaki et al., 1990 Jour nal of General Virology, 2781-2790).

Considering the results of Golemboski et al. (1990), this sequence When expressed by a genetic plant (independently of coat protein expression), B It is expected that the plant's resistance to aMMV will be increased. However, 3′ non-translation No significant homology was observed between BaMMV and BaYMV in the translation region. . The 3' untranslated region (340 nucleotides) of BaMMV is the 3' untranslated region of BaYMV. Approximately 1 with a palindromic sequence that is longer and shorter than the translation region (231 nucleotides) Contains a direct repeat of 20 nucleotides. Repeats within the 3′ untranslated region are similar to other It has also been observed in potyviruses (Doughherty et al., 1985V irolog)'146, 282-291; Hay et al., 1989 Archi vesof Virology 107, 1l-122), and poly(A) There is a potential polyadenylation motif (UAUGU) 85 nucleotides upstream of the tail. (Fig. 4), but such polyadenylation motifs are present in various poteyviruses. (Marss et al., 1989 Journal of Gen BaMMV coat protein for expression in aral Virology plants The coat protein of BaMMV is a larger precursor protein. It is generated by hydrolytic cleavage, so the code encoding the N-terminal amino acid sequence is It is necessary to add a translation start codon before the translation. This is the PCR method described below. Achieved using.

The forward primer (Bam3; SEQ ID NO: 12) contains a BamHI site, a plant opening origin consensus sequence (Lutcke et al., 1987 EMBO Journal 6 , 43-48), the ATG initiation codon, and the 5′ end of the coat protein gene. designed to contain homologous sequences.

B a mHl Bam3: 5'-CGCGGATCCAACA ATG GCA GGG C AT GAG GAA CCA4 reverse primer (BMCP-1; SEQ ID NO: 13) is homologous to BaMMV coat protein from nucleotides 842 to 858. It was designed to

BMCP-1: 5'-GGAATAACAGCGGAAGA-:? PCR is c Bam3 and BMCP-1 are used for DNA, and the product is BamHI -BglII fragment (BglI present at nucleotide 821 of coat protein) [Using parts], Bluescript (manufactured by Stratagene) was cloned into the BamHI site of.

Completely sequence the clone to determine if additional sequences have been added and perform PCR. It was confirmed that no base changes were introduced. Obtained clone The coat protein region of (pMP-5) is identical in sequence to the same region of pBM-217. 1, and the additional case at the 5' end was added correctly.

Clone pBM-217 (containing the entire coat protein sequence) was cloned into Mlul (null). cleotide 637) and 5ail (pUc at the 3' end of the coat protein gene) The resulting coat was digested using the 5all site present in the polylinker of A fragment containing the 3' region (nucleotides 637 to 1462) of the protein gene. The pieces were gel purified.

Clone pMP-5 was also digested with MlUI and 5all (polylinker), The large fragment (containing plasmid sequences and the 5' end of the coat protein) was gel purified. . This fragment was ligated with the Mlul-3all fragment obtained in the previous step to create a modified 5′ The full chain length coat protein with the ends was re-formed.

In addition to the methods mentioned above, there are a number of other methods for conferring resistance to viral pathogens. A method has been developed (Gadani et al., 1990 Archives of Vi (see 5.1-21 onboard). These methods also work with certain viruses. or viral pathogens or related factors to provide control over related viruses. It uses genetic information about.

virus to provide control over a wide range of pathogens, including fungi and nematodes. Another method using vectors containing sequence sequences is shown. The method is cultivar resistance It is based on Cultivar resistance is defined as the resistance of some cultivars (but not others). hostage, which occurs when a species (excluding viruses) becomes resistant to infection by certain virus strains. Found in the main species.

This tolerance is generally due to hypersensitive responses. e; abbreviated as HR), resulting in localized lesions and localization of the pathogen. . This reaction is common and can be induced by fungi, nematodes, bacteria and viruses. (Bowles, 1990 Ann, Rev, Bi ochem, 59° 873-907). certain viral pathogens A host species that possesses resistance genes for the virus (or a portion of the virus) ) under the control of an inducible promoter, Upon induction of its promoter, local HR can occur. promo The target can be selected so that the virus is expressed only at the site of infection of the invading pathogen. can. Virus expression triggers HR and transmission of viruses and invading pathogens. impede transportation.

Sequence list (1) General information (i) Applicant (A) Name: Unilever eBLC (B) Street address: Black Flyers, Unilever House (C) City name: London (E) Country name: United Kingdom (F) Postal code (ZIP): EC4B 4PQ (G) Phone number: (071) 822 5252 (Ill) Fax number: (071) 822 5954 (^) Name: Unilever NV (B) Street address: 455 VK (C) City name 2 Rotterdam (E) Country name: Netherlands (F) Postal code (ZIP): 3013 AL (ii) Name of invention: Novel plant Virus sequence (iii) Number of sequences: 13 (iv) Computer readable format: (A) Recording medium: Floppy disk (B) Computer: IBM PC Compatible (C) Operation L/-Sign System (O8): PC-DO8/MS- DO8(D) Software: PatentIn Re1ease #1. (L Guarjon 11.25 (EPO) (2) Information regarding sequence number: 1: (i) Array characteristics: (A) Sequence length: 123 amino acids (B) Sequence type, amino acid (C) Number of chains: unknown (D) Topology unknown (ii) Type of sequence: peptide (iii) Hypothetical sequence: N0 (iii) Antisense = NO (V) Fragment type: middle part (xl) Array: Sequence number = 1: Glu Phe Asp Glu Ala Thr Glu Asp Ile Cys Glu Asn Pro Tyr Met 5erLeu Thr M et Val Arg Thr Ser Phe Gly Ile Gly P he Ser Leu Ser l1eGlu Arg Ile Val Al a　Ile　Leu　Gin　Trp　Ser　Arg　Ala　Gly　Gl y Val LeuHis Ala Tyr Leu Ser Gly Ile Ala Ala Leu Phe Glu Ser Phe Asn Thr Pro Lys Leu Phe Asn Leu Val [lis Thr 　Tyr　Leu　Leu　Trp　Leu　Ile　Th■ Glu flis Glu Glu Glu Leu Phe Ser Met Met Glu Leu Lys Asp Met Ph■ Met Pro Leu Pro Thr Lys Glu Gln Ile Ala Leu Leu His Tyr Val Glyloo 105 1 10 Thr Glu Pro Ile Val Glu Asp Thr Phe Information regarding Leu G1n (2) sequence number: 2: (i) Array characteristics: (A) Sequence length = 251 amino acids (B) Sequence type diamino acid (C) Number of chains: unknown (D) Topology: unknown (ii) Type of sequence: peptide (iii) Hypothetical sequence = NO (iii) Antisense = NO (v) Fragment type: middle part (xi) Sequence: Sequence number: 2: Ala Gly His Glu Glu Pro Asp Pro Ile Val Pro Pro Ala Ser Asp Thrl 5 10 15 Asp Leu Thr Asn Met Ala Ala Pro Pro＾sp　Asn　Lys　Arg　Ser　ArgAla　Val　Il e Pro Arg Gly Thr Ser Asp Trp Ser Me t Pro Glu Pro Thr Met Arg Thr Leu Gly Phe Lys Ser Lys Ile Lys Ile Glu Thr Leu Ala^sp Val Pro Glu Gly Tyr Met Asn Thr Phe Ala Ser Val Ala Thr Glu6 5 TO7580 Ser Gin Arg Arg Lys Trp Glu Glu Ala Thr　Arg　Gly　Asp　Phe　Gly　l1eThr　Asp　A sp Glu Lys Trp Glu Lys Leu Leu Ile A la Ala Cys Ile Tyrloo 105 110 Phe Ala Asp Asn Gly Thr Ser Pro Asn Phe Asp Glu Glu Leu Thr MetGlu Val A sn Ser Gly Leu Asn Ser Ile Lys Glu T yr　Pro　Vat　Arg　Pr.

Phe Val Val Arg Ala Lys Lys Ile Ser Thr　Leu　Arg　Arg　Ile　Phe　ArgCys　Tyr　S er　Ile　Glu　Thr　Lys　Leu　Met　Phe　Val　L ys Leu Arg Arg Va1Pro His Trp Ala Il e Lys tlis Gly Cys Leu Asp Glu Ile V al　Phe　As■ Phe Met Ile Pro Asp Gin Phe Thr Ser Arg Thr Ala Leu Glu Thr LeuLys Gin T hr Lys Leu Ala Ala Ile Gly Val Gly T hr Ser Asn Ser LeuLeu Thr Ser Glu Gl n Thr Asn Met Arg Thr Thr Glu Thr Ar g　Arg　Arg225　’ 230 235 240 ^sn Asp Tyr Asp Gly His Glu^la Leu L Information regarding eu Arg (2) SEQ ID NO: 3: (i) Array characteristics: (A) Sequence length = 374 amino acids (B) Sequence type diamino acid (C) Number of chains: unknown (D) Topology: unknown (ii) Type of sequence: peptide (iii) Hypothetical sequence = NO (iii) Antisense 2N0 (V) Fragment type: middle part (xi) Sequence: Sequence number, 3: Glu Phe Asp Glu Ala Thr Glu Asp Ile Cys Glu Asn Pro Tyr 1let 5e■ Leu Thr Met Val Arg Thr Ser Phe Gly Ile Gly Phe Ser Leu Ser l1eGlu Arg I le Val Ala Ile Leu Gin Trp Ser Arg^l a Gly Gly Val LeuHis Ala Tyr Leu Ser Gly Ile Ala Ala Leu Phe Glu Ser Phe Asn ThrPro Lys Leu Phe Asn Leu Val■ is Thr Tyr Leu Leu Trp Leu Ile ThrGl u Ir1s Glu Glu Glu Leu Phe Ser 1let Met Glu Leu Lys Asp 1iet ohe Met Pro Leu Pro Thr Lys Glu Gin Ile Ala Leu Leu His Tyr Val Glyloo 105 1 10 Thr Glu Pro Ile Val Glu Asp Thr Phe Leu Gin Ala Gly His Glu GluPro Asp P ro Ile Val Pro Pro Ala Ser Asp Tbr A sp Leu Thr Asn 1le■ 130　’　135　140 Ala Ala Ala Pro Pro Asp Asn Lys Arg Ser Arg Ala Val Ile Pro ArgGly Thr S er Asp Trp Ser Met Pro Glu Pro Thr M et Arg Thr Leu GlyPhe Lys Ser Lys Il e Lys Ile Glu Thr Leu Ala Asp Vat Pr o Glu GlyTyr 1let Asn Thr Phe Ala Se r Val Ala Thr Glu Ser Gin Arg Arg Ly ■ Trp Glu Glu Ala Thr Arg Gly Asp Phe Gly Ile Thr Asp Asp Glu LysTrp Glu L ys Leu Leu Ile Ala Ala Cys Ile Tyr P he Ala Asp Asn GlyThr Ser Pro Asn Ph e Asp Glu Glu Leu Thr Met Glu Val As n Ser GlyLeu Asn Ser Ile Lys Glu Tyr Pro Val Arg Pro Phe Val Val Arg Ala Lys Lys Ile Ser Thr Leu Arg Arg Ile Phe Arg Cys Tyr Ser Ile GluThr Lys L eu Met Phe Val Lys Leu Arg Arg Val P ro　His　Trp　Ala　l1eLys　His　Gly　Cys　Le u Asp Glu Ile Val Phe Asp Phe Met Il e Pro AspGin Phe Thr Ser Arg Thr Ala Leu Glu Thr Leu Lys Gin Thr Lys Leu Ala　Ala　Ile　Gly　Val　Gly　Thr　Ser　Asn　 Ser　Leu　Leu　Thr　Ser　Glu　G1nThr　Asn　l 1et Arg Thr Thr Glu Thr Arg Arg Arg Asn Asp Tyr Asp Gl■ His Glu Ala Leu Leu Arg (2) Regarding sequence number = 4 information: (i) Array characteristics: (A) Sequence length near 64 base pairs (B) Sequence type: Nucleic acid (C) Number of chains/-heavy chain (D) Topology/linear (ii) Sequence type: RNA (genomic) (iii) Hyposeti Cull array: N.

(iii) Antisense 2N.

(xi) Sequence: Sequence number: 4: GCAGGGCAUG　AGGAACCAGA　UCCCAUAGUU　CCA CCAGCUU CCGACACCGA tlclIGAc`AAc 60 AUGGCUGCAG CACCACCGGA CAACAAAGG UCA CGUGCCG UCAIICCCCG UGGCACU`GU 120 GAIJUGGAGCA LIGCCCGAACCCACAAUGCGA AC ACUGGGIII UUAAGUCCAA GAUCA`AAUC180 GAAACACUUG CUGALIGUCCCCGAAGGGUAU AUG AAUACCU UUGCGUCCGtl UGCAACUfAG 240 UCGCAACGUA GGAAGUGGGA AGAGGCCACG CGU GGCGAUU LIUGGCAtlCACCGACGACfAG 300 AAAUGGGAAA AAAtlUGCUCAU UGCUGCCUGU AU AUACtlUUG CAGACAAUGG CACCUC`CCA 360 ＾AUIIUUGAUG　AGGAACUCACUAUGGAAGUU　AAI IAGCGGUCUCAACUCCAU CAAAGAGU`U 420 CCCGUUCGCCCUUUCGUCGU CAGGGCCAAG AAGA [1CUCCA CACUGCGCAG GAUCUUCCfC480 UGUUAUUCCA UCGAAACGAA ACUGA[1GUUCGUA AAGCUGA GGCGCGUGCCGCAUUGGGCb540 UCCAGGACUG CAUAAAGCACGGAUGCCUUG AUGA AAUCGU　CUtlUGAIIIUUCAUGAUCCCbG　600 ACCAGUUCACCLICCAGGACUGCACUGGAAACAC UG^^GCA GACCAAGCUU GCCGCCAUtG 660 GUGUUGGCACAAGCAAUUCU CUUCUCACCU CUGA GCAGACGAACAUGAGGG ACCACUGAAA@720 CCCGAAGGCG CAAUGACUACGAUGGUCACG AGGC Information regarding GCUUCU CCGG 764 (2) Sequence number = 5: (1) Characteristics of array: (^) Sequence length: 354 base pairs (B) Sequence type: Nucleic acid (C) Number of chains: knee heavy chain (D) Topology: linear (11) Sequence type: RNA (genomi c) (iii) Hybocete tical sequence = NO (iii) antisense 2N0 (xi) Sequence; Sequence number: 5: LIAGAtlCLIC1] CAt1GCAGtllllllCAIIUUCCU UUCAAGCAGtlGCA UUUAAAAUACG Ct[IUIIAAt lUA 60 CAUC^^GCGU CAAGAAUUCCUCCCGCUUGCAGCGA AUCCLI　UAAAGGGUGG　CACUUUGIIfU　120 UAUGCAAUGG AAAAUUCAGtl GACGCAAUCA AC CAUCAUUG　GUUGGUGACA　ACGCAGU`CU　180 UllCUU[ICULIU CACAtlCAAGCGACCAGCACA UCGCCCGCtltl ACAGCtlAALICC1PACC1lGAG G 240 GLIGGCAC1lC1l GtlGtllllALIGIIA AυGGAA tlGLIG　CUAIICIICGCA　ACCAACCf[ICAUUGG UUGAU 300 GGUGCGGCUA ACACCCGCGCUCLIUGUAUACCGGA AAGGUU AAAAAAAAA^^AAAA 354 (2) Regarding sequence number 6 information; (i) Array characteristics: (A) Sequence length: 1118 base pairs (B) Sequence type; nucleic acid (C) Number of chains: knee heavy chain (D) Topology: linear (ii) Type of sequence: RNA (genomic) (iii) Hyboceti Cal sequence = NO (iii) Antisense 2N.

(xi) Sequence: Sequence number 26: GCAGGGCAIIG AGGAACCAGA UCCCAUAGUU CC ACCAGCUU CCGACACCGA IJCUGAC`AAC60 AUGGCUGCAG CACCACCGGA CAACAAAGG LIC ACGIJGCCG tlcAtlccccG tlGGMo`cllAGtl 120 GAtlllGGAGCA tlGcccGAAcc CACAALIGCGA ACACIIGGGUUUUAAGtlCCAAGAtCAAALIC 180 GAAACACUUG CUGAUGUCCCCGAAGGGUAtl AII G^^UACC [I [IUGCGUCCGU UGCAAbUGAG 240 uccc＾＾CGUA　GGAAGUGGGG＾＾GAGGCCACCG　CGUG GCGA[IU　UUGGCAUCACCGACGACGAf　300 AAAIIGGGAAA AAUUGCUCAU IIGCllGCCUGLI 　AIJAIJACULltlG　CAGACAIIGG@CACCllCA CCA 360 AAtltltltlGAllG AGGAACllCACtlAIIGGAA Gl]υAAAAGCGGUCUCAACUCCAU CA`AGAGUAυ 420 CCCGLIUCGCCCIIUtlCGUCGU CAGGGCCAAG A AGAUCLICCA CACUGCGCAG GAUCUtCCGC480 UGUUAUIICCA UCGAAACGAA ACUGAUGUUCGUA AAGCIIGA GGCGCGUGCCGCAUUGGGbC540 UCCAGGACUG　CAU^^AGCACGGA[IGCCUtlG　AU GAAALICGIJ CtlUUGAtltltlCA[hGALICCCCC G 600 ACCAGtlllCACCLICCAGGACIJ GCACtlGGAAA 　CACllGAAGCA　GACCAAAGCLIII　GbCGCCAUUG 660 GLIGIIIGGCACAAGCAAUUCU CUUCUCACCll CUGAGCAGACGAACAUGAGGGACCACUfAAA 720 CCCGAAGGCG CAAtlGACUACGAIIGGUCACG AG GCGCllUCLI CCGGUAGAUCUCUCAIhGCAG 780 tlUUcAUUUcc　UU[lC^^GCAG　UGCAIItl[l^^ A　UACGCUIItlUA　AUUACAIICAA　fCGUCAAGA ＾　840 UIICCCIICCCGCUIIGCAGCGAAυCCUUAAAGG GI IGGCACUUU GUGUUAUGCA AUGGAA`AtlU 900 CAGtlGACGCA ALICAACCAtlCAIJtlGGtlLIG Gtl　GACAACGCAG　tlActlLIllctattack@Cut ltlCACAυC960AAGCGACCAG CACAUCGCCCGCU LIACAGCLI AAUCCUACCU GAGGGUGGCA CUCU GUGtUA 1020 UCU^^UGGAA UGUGCUAUCU CGCAACCAACCGUC AUUGGU UGAUGGUGCG GCUAACACCb1080 GCGCUCUIIGU AUACCGGA^^ GGUUAAAA^ person AA AAAAAA＾　1118(2) Information regarding sequence number Nia: (i) Array characteristics: CA) Sequence length = 369 base pairs (B) Sequence type: Nucleic acid (C) Number of chains: knee heavy chain (D) Topology: linear (ii) Sequence type: RNA (genomj c) (iii) Hypocete Ical sequence-NO (iii) Antisense 2NO (S1) Sequence: Sequence number; 7: GAAUUCGACG AAGCCACUGA AGACAUUUGCGAAA ACCCCU ACAUGUCCU [I GACGAUGGtC60 CGCACCUCGU　UUGGGGAUCGG　[IUUCIICCCCUCUC CAUAGAGCGCAUCGUUGCAAIICUUGC`A 120 υGGAGCCGCG CUGGCGGAGU CCUGCAUGCCUACC UCUCUG　GCAUUGCCGCUCIIUUUCG＾O　180 11ccUUcAAcA CACCCAAGCU CUUUAAUCUCGUG CACACAU ACCUCCUCUG GCUCAUCAb＾　240 GAGCACGAGG AGG^^CUCUU CUCUAUGAUG GAA CUCAAAG ACAUGUtlCAU GCCCCtlfCCC300 ACtlAAGGAACAGAIIIAGCClltl Gl]tlGcActl Ac　GtlCGGGACllG　AGCCCAtlCGIh　GGAGGAC ACll 360 UUCCUGCAA 369 (2) Information regarding SEQ ID NO: 28: (i) Array characteristics: (A) Sequence length: 14 base pairs (B) Sequence type; nucleic acid (C) Number of chains: knee heavy chain (D) Topology: linear (ii) Sequence type: DNA (genomic) (iii) Hypothesis Cal sequence = NO (iii) Antisense: Yes (xi) Sequence: Sequence number 28: GGRTCNGGYT CYTC14 (2) Information regarding array number = 9: (i) Array characteristics: (A) Sequence length: 14 base pairs (B) Sequence type: Nucleic acid (C) Number of chains: knee heavy chain (D) Topology: linear (it) Type of sequence: DNA (genomic) (iii) Hyposeti Cal sequence = NO (ii i) Antisense: Yes (xi) Sequence: Sequence number: 9: Information regarding GTRAAYTGRT CNGG 14(2) Sequence number: 10: (i) Array characteristics: (A) Sequence length: 8 amino acids (B) Sequence type diamino acid (C) Number of chains: knee heavy chain (D) Topology unknown (if) Type of sequence: peptide (iii) Hybothetical sequence 2N0 (iii) Antisense 2N0 (v) Fragment type: middle part (xl) Sequence: Sequence number: 10: Leu Gly Phe Thr Val Pro Ile Asp (2) sequence Information regarding number: 11: (1) Characteristics of array: (A) Sequence length: 8 amino acids (B) Sequence type diamino acid (C) Number of chains: knee heavy chain (D) Topology unknown (ii) Type of sequence: peptide (iii) Hypothetical sequence: N.

(iii) Antisense 2N.

(V) Fragment type: middle part (xi) Sequence: Sequence number: 11: ^1a Gly His Glu Glu Pro Asp Pr.

(2) Information regarding sequence number: 12: (i) Array characteristics: (A) Sequence length = 34 base pairs (B) Sequence type: Nucleic acid (C) Number of chains: knee heavy chain (D) Topology: linear (ii) Sequence type: DNA (genomic) (iii) Hyposeti Cal array 2N.

(iv) Antisense: Yes (xi) Sequence: Sequence number: 12: CGCGGATCC^^CAATGGCAG GGCATGAGGA ACCA 34(2) Information regarding array number = 13: (i) Array characteristics: (A) Sequence length = 17 base pairs (B) Sequence type: Nucleic acid (C) Number of chains: knee heavy chain (D) Topology: linear (ii) Sequence type: DNA (genomic) (iii) Hyposeti Cal array 2N.

(iv) Antisense: Yes (xi) Sequence: Sequence number: 13: 1′ p BM-322-[Aln Fig, 3 1＋＋＋＋＋－My Mu, PCT/GB93100910 front page continuation (51) Int, C1, 6 identification symbol Internal office reference number C12N 5/10 //Cl2Q 1/68 A 9453-4BV70 9453-4B (CI2N 15109 C12R1:92) (72) Inventor Falls, Ian Jeffrey UK, PE 17.2 Day 1, Lessie Green Road, Houghton, Cambridgeshire (72) Inventor Jack, Beater Liam UK, SeaBeef 2DP -, Cambridge, Durnford Way 6 (72) Inventor: James, Christopher ° Michael, UK, CB 5.8 RT, Cambridge, Newmarket Road I (C12N 15100A CI 2 R1:92) (72) Inventor C.Vincent John UK, C.V. 2.5AN, K.A. Bridge, Great Shelf Ord, Tonton Way, Foxhill Wing (no house number) (72) Inventor Sidebottom, Christopher Michael UK, NK40 ・3 Peekew, Bedford, Waterloo Road 35 (72) Invention Person: Slaybas, Antoni Liszard, UK, D.H.I.L., D. Rum, Het Village, Grove Court Continued from front page (72) Inventor: Stratford, Rebetzka UK, CB 2.2 NNN , 56 Bishop's Court, Trambington, Cambridge

Claims (15)

[Claims] 1. does not contain the amino acid sequence of residues 124-374 of Figure 4 or a functional equivalent thereof. Amino acid sequence. 2. An amino acid sequence comprising the amino acid sequence of residues 1 to 123 of FIG. 4 or a functional equivalent thereof. amino acid sequence. 3. An amino acid sequence comprising the amino acid sequence of residues 1 to 374 of FIG. 4 or a functional equivalent thereof. amino acid sequence. 4. A nucleic acid encoding the amino acid sequence according to any one of claims 1 to 3. Reotide sequence or its functional equivalent. 5. The nucleotide sequence according to claim 4, with an in-flank at the 5' end of the sequence. further comprising a genome ATG translation initiation codon and an appropriate initiation consensus sequence. A nucleotide sequence characterized by: 6. The nucleotide sequence according to claim 4 or claim 5, wherein the 3' poly(A) tail A nucleotide sequence further comprising: 7. The nucleotide sequence according to any one of claims 4 to 6, and FIG. A nucleotide sequence comprising the sequence. 8. The nucleotide sequence according to any one of claims 4 to 6, and FIG. A nucleotide sequence characterized in that it comprises a sequence of nucleotides 1 to 369 of Column. 9. The nucleotide sequence according to any one of claims 4 to 6, and FIG. A nucleo comprising a sequence from nucleotides 370 to 1122 of Tido arrangement. 10. does not contain the nucleotide sequence according to any one of claims 4 to 9. vector. 11. The vector according to claim 10, comprising a polypeptide having the amino acid sequence shown in FIG. 1. A vector characterized in that it has the ability to express a vector or a functional equivalent thereof. 12. Increased resistance to diseases caused by barley mild mosaic virus This is a way of imparting sex to a plant, using a promoter sequence that is recognized by the plant. The neck according to any one of claims 4 to 9, which is operably connected. Transforming a host plant or a portion thereof with a vector comprising a leotide sequence, The transformed host can carry out RNA transcription of the sequence according to any one of claims 4 to 9. A method comprising causing to produce an image. 13. 13. The method of claim 12, wherein at least one of said RNA transcripts is isolated in a host plant. A method characterized in that a portion of the amino acid sequence is also translated into an amino acid sequence. 14. Against diseases caused by barley mild mosaic virus Transgenic plants that have been genetically engineered to increase resistance. 15. The transgenic plant according to claim 14, 14. A transgenic plant produced by the method described in 13.