JPH07505524A - IFN receptor recognition factor, its protein sequence and method of use - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] [Publications related to FN receptor recognition factor, its protein sequence and usage method The applicant is the author or co-author of several documents relating to the subject matter of the present invention. a (1) “Interferon-Dependen” by Darnell et al. t Transcriptional Activati Mr. F Activator Induced by! interferon a, C on5ists of Multiple Interac 狽奄獅■@Po- 1ypeptideChains''PROC, NATL, ACAD, SCr, USA, 87:8555-8559 (+990): (R) D, S, Kessler et al., “[FN a Regulations Nuclear Traislocation and DNA-Bind Amashi■ Ru.

Technical field of invention The present invention generally relates to intracellular receptor recognition proteins or factors (i.e., groups of proteins). ), as well as in assays and for diagnosing, preventing cellular weakness, disorders or malfunctions. methods for preventing and/or treating such factors or against them; The present invention relates to compositions containing reactive antibodies or analogs thereof. More specifically, the present invention was identified, sequenced, and liganded on the cell surface (liga nd-ed) A wide range of intracellular events ranging from interaction with receptors to transcription in the nucleus Special FN-dependent receptor recognition molecules, and antibodies or and other entities specific to it (these are thereby associated with such entities in mammalian cells) activity can be selectively modulated).

Signals that can follow after a polypeptide ligand binds to its cognate cell surface receptor There are several possible routes for nulltransduction. Gantt like this Within minutes of receptor interaction, genes that were already quiescent are rapidly transcribed (Murdoch et al., 1982; Larner et al., 1984: Prjedm an et al., 1984: Greenberg and Ziff.

1984; Greenberg et al. +985). still poorly understood The characteristics of these immediate transcriptional responses, which are among the most physiologically important, are , are their peculiarities. For example, activated by platelet-derived growth factor (PDGF) The set of genes that have been encoded are either nerve growth factor (NGP) or tumor necrosis factor ('INF). ) do not completely overlap with genes activated by (Cochran et al., 198 3; Greenberg et al., 1985: Almendral et al., 198 8: Lee et al., 1990). Interferon (IFtJ) is a genetically Fully activate the child pair.

IFNα and [FNγ (their presence slows cell growth and protects against viruses) (Rain et al., 1987) do not activate exactly the same set of children (Larner et al., 1984: Frie dman et al., 1984 + Celis et al., 1987.1985; Larne r et al.

1986).

Current hypotheses regarding signal transduction pathways in the cytoplasm are does not fully explain the high degree of specificity observed in the cell-dependent transcriptional response.

The most commonly described pathway of signal transduction that can ultimately lead to the nucleus are cell surface receptors that contain tyrosine kinase domains [e.g., PDGP, epidermal Growth factor (EGF), colony stimulating factor (C3F), insulin-like growth factor F-I ([GF-1); G11l.

+990: property of [see Hunter, 1990] or G-temperature depends on the nature of the receptor (Gilman, 1987) that interacts with the protein. Receiving These two groups of cells mediate changes in the intracellular concentration of the second metsenger, The metsenger in turn activates a series of protein phosphokinases. and the cascade of phosphorylation (or dephosphorylation) of cytoplasmic proteins. bring.

A phosphorylation cascade secondary to changes in the levels of second methsengers within the cell. It has been widely speculated that depressants cause changes in the rate of transcription of specific genes. (Bourne, 1988.1990; Berridge, 1987: G111.1990; Hunter, 1990), However, the overall changes in the second messenger are due to polypeptide ligands. involves a chain of events leading to specific transcriptional responses that depend on specific receptor occupancy There are at least two reasons to doubt this suggestion.

First, a limited number of second metsengers (cAl(P, diacylglycerol) ole, phosphoinosidide, and Ca″″ are the most extensively described. ), while the only known cell surface of tyrosine kinase and G protein variants is The number of face receptor-ligand pairs is already larger than the list of second messengers, for example. can easily reach hundreds of widths (Gill, 1990: Hunter, 1990). In addition, many different receptors are shared in one cell type in every case. Since each cell may have an individual specific transcriptional response involving a different set of target genes, may be required to respond to two or more different ligands simultaneously. Second, chi It does not have a rosine kinase domain and has a structure that suggests interaction with G proteins. Several receptors for polypeptide ligands that have no structure are currently known. this as interleukin-2 (IL-2) (Leonard et al., 1985) , IFN aCIJze et al., 1990), IPN 7 (Aguet et al., + 988), NGF Qohnson et al. +986), and growth hormone (Leung et al., 1987). A specific guide to Gantt Binding of each of these receptors has been demonstrated to stimulate transcription of a specific set of genes. It was For these reasons, the entirety of the restricted set of second metsengers intracellular fluctuations pave the way for specific polypeptide ligand-dependent immediate transcriptional responses. It is unlikely that it is essential.

Applicant's PCT International Publication No. 1W0921 published on May 29, 1992 No. 08740, the above analysis was presented and one or more receptor recognition factors A type of direct messenger between liganded receptors on the cell surface and in the cell nucleus. It has been discovered and proposed that it can be used in the capacity of a species consisting of: receptor recognition One of the properties that is unique to the sensitizer is that it It clearly lacks the requirements for Interferon IFNα and [F The continued search for receptor recognition factors by studying the effects of Nγ has led to the initial discovery mentioned above. The properties and structure of the interferon-related factor 15GF-3 have been and, more broadly, further elucidated the properties and structure of receptor recognition factors. Therefore , the disclosure herein is based on this latest characterization of receptor recognition factors as well as the corresponding Concerning the presentation of both diagnostic and therapeutic substances and methods.

Summary of the invention According to the invention, receptor recognition factors are It is further characterized in that it is clear that it interacts directly with the receptors These, in turn, become active transcription factors, or enter the nucleus of the cell and carry out a given One barrier binds specifically to a site and thereby activates a transcription factor that activates a gene. will meet in person. Receptor recognition proteins thus have many properties, among them But 1) recognizes, and is activated during such recognition by receptors and 2) inhibits translocated to the nucleus by processes (e.g., NaF inhibits translocation) 3) Binds to transcription activation protein or activates transcription by itself It has the property of acting as a protein, and all of these properties It should be noted that the proteins described herein have .

Receptor recognition factors are proteins in composition and are thought to reside in the cytoplasm. Ru. The recognition factor is clearly not affected by the concentration of the second metsenger, but direct interaction with the synkinase domain, but it is clear that it interacts with G proteins. does not show any interaction. More specifically, the factor represented by SEQ ID NO: 2 is Phosphate was acquired at a tyrosine located near position 690 of the amino acid sequence. It later interacts directly with DNA.

The recognition factor includes several protein substituents in the case of IFNα and [FNγ This is now known. In particular, three proteins derived from the factor [5GF-3] were successfully sequenced and their sequences are shown in Figures 1, 2 and 3, with SEQ ID NO. Corresponds to items 1, 2 and 3. The protein sequence in Figure 1 and the tag in Figures 2 and 3 It is particularly important to note that each protein sequence is derived from two different but related genes. Worth seeing. that a family of genes exists and that additional family members It is clear from this discovery that the same exists. Therefore, hybridization Additional such family members may be seen with the use of tion techniques. . Furthermore, such family members may be used as receptor recognition factors such as those disclosed herein. The ability of a ligand to function is measured to result in phosphorylation of a special family member. It can be evaluated by

In its broadest aspects, the invention provides the ability to target specific polypeptides to cellular receptors in target cells. receptors involved in stimulating transcription of genes in target cells in response to binding of peptide ligands. The present invention relates to a receptor recognition factor, and the receptor recognition factor has the following characteristics.

a) apparent direct interaction with ligand-binding receptor complexes and with specific genes; Activation of one or more transcription factors capable of binding: b) the presence of a second messenger or Activity not clearly affected by concentration.

C) direct interaction with the tyrosine kinase domain; and d) G protein Perceived absence of interaction.

Fourth, in detail, the receptor recognition factor represented by SEQ ID NO: 2 is a translated protein and as a DNA-binding protein/bacterium, especially in response to interferon-γ stimulation. It has the added ability to act. This discovery suggests that this nuclear protein, and Factors such as other proteins (these have traditionally been characterized as receptor recognition factor T) predicted an expanded role for Therefore, a single factor can be activated at the cell surface. Linkage between gunned receptors and direct involvement in DNA transcriptional activity in the nucleus It is clear that this can actually be achieved. This winter type (pleiotypie) factor has the following characteristics.

a) interacts with the interferon-gamma binding receptor kinase complex; b) it is a tyrosine kinase substrate, and C) when phosphorylated, it can be used as a DNA binding protein.

Further details indicate that the factor represented by SEQ ID NO: 2 has an interface in its activity. interferon-stimulated, especially interferon-gamma Responsive to stimuli.

In yet another aspect, the present invention is capable of interacting with a ligated interferon receptor. The receptor recognition factor has the following characteristics: has.

a) it is present in the cytoplasm; b) It reduces tyrosine phosphorylation after treatment of cells with IFt4α or IFNγ I9 C) it activates the transcription of interferon-stimulated genes and d) it activates in vivo stimulating l5RE-dependent transcription or gamma activation site (GAS)-dependent transcription; e) it interacts with [FN cell receptors, and f) it interacts with rF′N by 1 undergoes nuclear translocation after stimulation of cellular receptors.

The factor of the present invention represented by SEQ ID NO: 2 is interferon-γ dependent. , a previously determined site-specific DNA termed γ-activating factor (GAF). It appears that it acts in a similar manner to binding proteins. For more details, see Interferon-γ-dependent activation of offspring occurs without new protein synthesis. Stiffness appears within minutes of interferon-gamma treatment and peaks within 15 to 30 minutes thereafter. degree and then disappears after 2-3 hours. Further identification and action of these properties of the agents of the invention for applications of both diagnostic and therapeutic importance. Help with evaluation.

The present invention also has a molecular weight of about 113 kD and a DNA sequence shown in FIG. No. 1), a molecular weight of approximately 91 kD and the DNA sequence shown in FIG. ), and a molecular weight of approximately 84 kD and the DNA sequence shown in FIG. ) having a molecular weight and rJ′ DNA sequence selected from a recombinant DNA molecule or cloned gene encoding its 7 fragments; concerns its degenerate variants.

The human DNA sequence or part thereof of the receptor recognition factor of the present invention can be used in homologous or heterologous species. The complementary sequence of It can be manufactured. The present invention utilizes cDNA and genomic libraries of receptor recognition factors. The present invention relates to probes thus prepared which can be provided for cleaning. for example , probes can be prepared in a variety of known vectors, such as phage vectors.

The present invention also relates to the preparation of a plasmid containing such a vector, as well as to the preparation of a plasmid containing such a vector. 2 and any or all of the DNA sequences shown in Figure 3. To construct a vector expressing antisense RNA or ribozyme such as including the use of DNA sequences. Therefore, preparation of antisense RNA and ribozyme The invention includes manufacturing.

Furthermore, the present invention has the activity noted herein and is described above, and has SEQ ID NO: 1. , a receptor recognition factor having an amino acid sequence selected from SEQ ID NO: 2 and SEQ ID NO: 3 Contains protein.

In yet another embodiment of the invention, the recombinant DNA molecules or The complete DNA sequence of the cloned gene includes expression control sequences that can be introduced into a suitable host. can be operatively linked to. Therefore, the present invention provides that one or more receptor recognition agents of the present invention DNA sequences encoding children, more particularly as described above, SEQ ID NO: 1, SEQ ID NO: 2 and a clone containing the complete DNA sequence determined from the sequence shown in SEQ ID NO: 3. unicellular host transformed with a recombinant gene or recombinant DNA molecule.

According to other preferred features of preferred embodiments of the invention, the kinetics of biological activity Recombinant expression systems for producing human receptor recognition factors are provided.

The concept of receptor recognition factors refers to the fact that a particular factor has a corresponding specific ligand, e.g. Tumor necrosis factor, nerve growth factor, etc. as described above are intended to be present. that Therefore, the precise structure of each receptor recognition factor determines its ligand and activity specificity. It will change so that it can be understood as it is. Broad spectrum diagnosis and treatment It is this specificity and the events leading to gene activation that give the above promise of practicality. Direct involvement of receptor recognition factors in the vent chain.

The present invention provides methods for the preparation of recognition factors involving known recombinant techniques as described herein. Naturally, the present invention contemplates several means for such synthetic preparations. is intended to include within its scope. The eDNA amino acids disclosed herein Isolation of the acid sequence facilitates regeneration of the recognition factor by such recombinant techniques and therefore , the present invention utilizes the disclosed DNA for expression in a host system by recombinant DNA technology. It relates to expression vectors prepared from the sequences and the resulting transformed hosts.

The present invention targets mammalian cells by disrupting or enhancing one or more recognition factors. Assay for screening potential drugs effective in modulating the transcriptional activity of Including A-type. the test agent is a ligand that activates the receptor recognition factor. , or administered to a cell sample together with an extract containing activated recognition factors to provide a control The binding of recognition factors to chemical samples (including DNA) or test agents is determined by comparison with Its effect on synthetic activity can be determined.

More importantly, the assay system detects receptor recognition and/or or bind to transcription factors or proteins, thereby suppressing or enhancing transcriptional activity may be suitable for identifying potential agents or other entities. Such an assay is , drugs that are specific for particular cellular activities, or time or activity levels. It would be beneficial to develop such drugs that enhance such activity in terms of B. for example , such drugs modulate cellular responses to shock, or for example against cancer. It can also be used to treat other diseases, such as to create more potent IFN. obtain.

One of the properties of the receptor recognition factors of the present invention is that during the course of their activity and their Their role in rapid phosphorylation and dephosphorylation as active moieties It's about involvement. Importantly, such phosphorylation is interferon-dependent in a manner, and within minutes in the case of the l5GF-3 protein identified here. Occurs for tyrosine residues formed on it. This is disclosed herein. The receptor recognition factor was the first true substrate (its intracellular function is poorly understood, and its Strong evidence that intracellular activity is dependent on tyrosine kinase phosphorylation It is based on In particular, the addition of phosphate to tyrosine of transcription factors is novel. child This is because tyrosine kinases act directly in transmitting intracellular signals to the nucleus, and currently A protein of serine and/or serine kinase activity, as previously theorized. It further suggests that it cannot simply be used as a promoter or mediator. Also, The role of the factor represented by SEQ ID NO: 2 in the activated phosphorylated form is to Suggests possible independent therapeutic uses for each form. Similarly, tyrosine kinase substrates and Apart from the complex observed here, the role of that factor as a suggesting its interaction with kinases in

The diagnostic utility of the present invention is to screen for tyrosine kinase inhibitors. The present invention relates to the use of the receptor recognition factor of the present invention in assays such as described herein The activity of receptor recognition-transcriptional activating proteins maintains tyrosine phosphorylation. They are probably dephosphorized by specific tyrosine phosphatases. Can be sphorylated. Therefore, blocking of specific phosphatases is important for receptor-recognizing proteins. It is a means of pharmacological intervention that enhances the activity of macrophages.

Similarly, the present invention covers naturally produced and recombinantly prepared antibodies. The invention relates to the development of antibodies against one or more receptor recognition factors, including. For example, antibodies , screen expression libraries to encode one or more receptor recognition factors. can be used to obtain one or more genes. As such antibodies, known genetic Both polyclonal and monoclonal antibodies prepared by secondary techniques as well as bispecific (chimeric) antibodies, and modulate transcriptional activity. Their capabilities and joint with other features make it suitable for additional diagnostic applications. Antibodies that include the ability to

In particular, antibodies against factors that are specifically phosphorylated can be selected, and the following activation They are included within the scope of the invention because of their special ability in proteins. instructor specific polypeptides thought to be causally related to the activity of the recognition factor. The activity of the recognition factor is therefore determined by the presence of appropriately labeled amounts of the recognition factor or its antibodies or can be followed directly by the assay techniques described below.

Thus, receptor recognition factors, their analogs, and the antibodies that can be produced against them. body or antagonist, e.g. by radioactivity, sodium borohydride. Labeled by reduction or radioiodination Immunoassays such as radioimmunoassays using antibodies for receptor recognition factors It can be used in conjunction with a variety of diagnostic techniques, including diagnostic tests.

In immunoassays, controlled amounts of the antagonist or its antibodies, etc. are prepared. is labeled with an enzyme, a specific binding partner and/or a radioactive element, and then can be introduced into a cell sample. If the labeled substance or one or more of its binding partners is present in the sample. After the resulting substance has had a chance to react with the sites of (which may vary depending on the nature of the label used). For example, specifically Antibodies of the lylated factors are selected and used to track the activated proteins mentioned above. It can be used suitably in a typical assay protocol.

Radioactivity 6Pl, e.g. Eva, radioactive isotope 3H1"C%"Ps"S"C I, "Cr, l7CO1"C011*pe, #@Y, ItS[, 11, o If +1@Re is used, the known and currently available counting operations are available. If the label is an enzyme, detection is performed using techniques known in the art. Currently used colorimetric, spectrophotometric, fluorometric, amperometric or This can be done by any of the gas metering techniques.

The present invention is useful for qualitative analysis of the extent of the presence of recognition factors or for simulating their activity. prepared in the form of a test kit to identify drugs or other agents that can Contains assay systems that can be manufactured. The system or test kit combines the label with a recognition agent, agonists and/or antagonists, and one or more additional immunizations. chemical reagents, at least one of which is a labeled component, its binding partner-1 to be measured a free ligand capable of binding to one or more of their binding partners; or immobilized ligand) as described herein. May contain labeled components prepared by one of radioactive and/or enzymatic techniques .

In yet another embodiment, the invention provides one or more recognition factors, the ) subunits, or active fragments thereof, or the same activity. Relates to therapeutic methods based on drugs or other drugs that have been determined to have

The first treatment method is causally related to the binding activity of the recognition factor or its subunits. or associated with preventing the development of symptoms resulting from its activity; the recognition factor or its subunits in an amount effective to prevent the occurrence of these symptoms. Agents capable of modulating the production and/or activity of including administering. For example, drugs to receptor recognition/transcription factors or proteins or other binding partners, such as enhancing interferon in cancer therapy. They can also be administered to suppress or enhance transcriptional activity. Also, activation (phosphorus Lilization) 2! Specific titers in dephosphorylation of transcription factors or proteins Blocking the action of rosine phosphatase is based on receptor recognition factors/protein activation. How to enhance the activity of receptor recognition factors or proteins that simultaneously enhance treatment provide law.

More specifically, the methods of treatment generally described herein can be used, for example, in other embodiments of the present invention. The drug screening assays prepared and used according to the In addition, effective inhibitors or effects of activation of the recognition factor or its subunits may be used. Enhancer-1 or an equally effective agent. May include methods of treating diseases or other cellular dysfunctions and disorders. For example, Drugs against receptor recognition 1 transcription factors or proteins as represented by column number 2 agents or other binding partners that enhance interferon in cancer treatment. may be administered to suppress or enhance transcriptional activity, as the case may be. Also, activation (phosphorylation) Specificity in the dephosphorylation of recognized 1 transcription factors or proteins Blocking the action of target tyrosine phosphatases is important for receptor recognition factor/protein activation. Enhancement of activity of receptor recognition factors or proteins that simultaneously enhances therapy based on provide a method for Therefore, suppression or blocking of activation or binding of recognition/transcription factors rupture may affect MHC class II expression and, as a result, promote immunosuppression. Probably. This activity, as described later herein by staurosporine, Substances that indicate autoimmune disease and graft rejection (in this case, a degree of immunosuppression) may be beneficial in cases such as the treatment of

In particular, the proteins of l5GF-3 (whose sequences are herein referred to as SEQ ID NOS: 1-3) ), their antibodies, agonists, antagonists, or their activities. Sexual fragments may be used in cases where interferon therapy is appropriate, e.g. For the treatment of viral hepatitis, hairy cell leukemia, and as an adjuvant therapy. Interferon may be prepared in pharmaceutical formulations for administration for use in medicine. the Receptor protein specificity improves aftereffects of current interferon treatments thus making it possible to apply interferon as a general antiviral agent. will enable you to do so.

Therefore, the main object of the present invention is to identify the properties of species associated with the transcriptional promotion of cellular activity and By providing active receptor recognition factors and their subunits in pure form, be.

Another object of the present invention is to provide antibodies and combinations of receptor recognition factors and their subunits. The object of the present invention is to provide methods for their preparation, including alternative means.

Yet another object of the invention is to Method for detecting the presence of receptor recognition factors and their subunits in mammals The goal is to provide the following.

Another object of the invention is to determine the activity of the recognition factor and/or its subunits in mammals. drugs, drugs, etc. potentially effective in simulating sex or treating their side effects methods and related assay systems for screening substances such as It is to provide.

Yet another object of the present invention is the presence or absence of receptor recognition factors or subunits thereof. to alter the negative consequences of an activity, or to enhance such activity where it is beneficial. modulating the amount or activity of the receptor recognition factor or its subunits to An object of the present invention is to provide a method for treating a mammal.

Yet another object of the invention is to treat the adverse consequences of invasive, spontaneous, or idiopathic pathologies. the amount or activity of the receptor recognition factor or its subunits to treat or prevent It is an object of the present invention to provide a method of treating mammals for regulating sex.

Yet another object of the present invention is to binding partner 1 or its production, or mimics or mimics the activity of a recognition factor. contains antagonistic drugs or drugs, or is used in therapeutic methods based on them. It is an object of the present invention to provide a pharmaceutical composition for

Other objects and advantages may be found in view of the following description which proceeds with reference to the drawings below. It will be clear to those skilled in the art.

Brief description of the drawing Figure 1 shows the complete receptor recognition factor nucleic acid sequence and the forming 113 kD protein. Figure 2 shows the amino acid sequence derived from the 15GF-3α gene. Nucleotide is 1 -2553, and the amino acids are numbered 1-851.

This arrangement is 37C, F, R, 1,821 enacted on October 1, 1990. -825, identically shown in the Sequence Listing hereinafter, cumulatively and separately. It is referred to as SEQ ID NO. l.

Figure 2 forms the complete receptor recognition factor nucleic acid sequence and 91 kD protein. [5GF-3α gene-derived amino acid sequence is shown. The nucleotide is 1- It is numbered 2217 and the amino acids are numbered 1-739. child The sequence is 37C,P,R,1,821-, which was established on October 1, 1990. 825, identically shown in the Sequence Listing hereinbelow, cumulatively and separately It is designated as SEQ ID NO: 2.

Figure 3 forms the complete receptor recognition factor nucleic acid sequence and 84 kD protein. Figure 2 shows the amino acid sequence derived from the l5GF-3α gene. Nucleotides are 1~ It is numbered 2103 and the amino acids are numbered 1-701. child Arrangement of 37C, P, R, 1,821- enacted on October 1, 1990 825, identically shown in the Sequence Listing hereinbelow, cumulatively and separately It is designated as SEQ ID NO: 3.

Figure 4 shows the purification of 15GF-3. The left part of the diagram shows the first oligonucleotide. polypeptide present after the affinity column (lane 3) and the final column. 15G showing two different formulations (lanes 1 and 2) after one step of chromatography. Shows the purification of P-3. The leftmost lane contains protein size markers (high molecular weight, Sigma). [5GF-3 component protein is 113 kD, 91 kD] , 84 kD, and 48 kD [Kessler et al., G ENES & DEV, 4 (1990): L- et al., T) IEEMBO, J. , 9 (1990)].

The right part of the figure shows that formulations 1 and 2 (lanes 1 and 2) are pooled and Separated on 7.5% SDS polyacrylamide gel and then transferred to nitrocellulose. 15GP-3 purified from 2-3X 10" cells electroplotted. . [5GF-3 component proteins are shown. The two lanes on the right are protein maps. Marker (high molecular weight prestained marker, Sigma) is shown.

Figure 5 generally shows the results of Northern blot analysis for 91/84 kD peptides. shows.

Figure 5a shows radiolabeled DNA fragments as probes (probes A-D). for cDNA clones E4 (upper map) and E3 (lower map), showing Shows the restriction map. Figure 5b shows cells hybridized with the indicated probes. Contains a Northern plot of cytosolic HeLa RNA. 4.4KB type and 3.1KB type Not only 28s rF? HAt<nd and 18S rRNA bands are shown. It will be done.

Figure 6 shows the 91 kD and 84 kD proteins of [5GF-3]. The conjoint protein sequence is shown. The one-letter amino acid code is The open reading frame from E4 (encoding a 91 kD protein) is shown. Ru. The 84 kD protein encoded by different cDNA (E3) has the same sequence. sequence, but ends after amino acid 701 as shown. 91 kD Tryptic peptides t19, t13a, and t13b from protein are shown. Ru. Peptide, the only tryptic peptide recovered from the 84 kD protein Dot27 is completely contained within peptide tlQ as shown.

Figure 7 shows the results of Western blot analysis and antibody shift analysis.

a) Highly purified l fractionated on a 7.0% SOS polyacrylamide gel 5GF-3 was detected by Western blot analysis using antibody a42 (amino acids 597-703). ): a55 (amino acids 2-59): and a57 (amino acids 705-739 ) was explored. The silver-stained portion of the gel (lanes a, b and C) shows the 15GF-3 product. The location of the fractional proteins and the purity of the materials used for Western Pro-Soto are shown.

Lane a) Tanks used for all Western blot experiments (immune and pre-immune) Silver staining lane b) of protein sample +5GF-3 More clear identification of protein for a substance of purity equal to that shown in Figure 4. Lane C) Sizes indicated protein marker.

b) Antibody interference of TSGF-3 shift complex, lane a) complete [5GF-3 and Free l5GF-37 component shift by partially purified l5GF-3 was marked. Lane b) Competition with a 100-fold excess of cold 15RE oligonucleotide. lane c) Shift complex after addition of 1 ml pre-immune serum to 12.5 μl shift reaction . Lanes d and e) 1:10 dilution of a42 antiserum into a 12.5 μl shift reaction. Shift complex after addition of 1 μl diluted solution or 1 ml undiluted solution.

Mutual: anti-Ka42, a55 and a57, Ga4-3X vector-CSm1th et al. GENE, 67 (1988)] in E. col. The fusion protein was prepared by injecting the 50-ml fusion protein. After the first nibboost Blood was collected from the heron and serum was prepared.

For Western plots, highly produced [5GF-3 was added to 7% SDS. Separated on a lyacrylamide gel and electroplotted against nitrocellulose. So filters were incubated in blocking buffer (“plot”), Specific and pre-immune antisera cut into strips and diluted 1:500 It was explored.

The immune complexes were purified with the help of an ECL kit (Amersham). Visualized.

Shift analysis was performed in 4.5% polyacrylamide gels as previously described. [Levy et al., GENES & DEV, 2 (1988): Lev y et al., GENES & DEV, 3 (1989)].

Figure 8 shows the full-length amino acid sequence of the 113kD protein component of l5GP-3α and Conserved amino acid sequence between 113 kD protein and 91/84 kD protein Indicates an array.

A, tm-produced 113 kD protein (see attached paper). Polypeptide sequences derived by protein microsequencing (A-E) are underlined. It has been subjected.

Based on peptide E, we developed a degenerate oligonucleotide, AAT/C Design ACIGAA/GCCIATGGAA/GATr/CATr I7, this Used 1, essentially as described [Norman et al., CELL.

55 (1988), cDN library [Pine et al., MOL, CBL L., BIOL, 10 (1990)] was screened. Simply put , degenerate oligonucleotides are converted to 32P-γ-AT by polynucleotide kinase. Salmon sperm DNA spermatozoa 100 mg/m l and 10x Denhardt's solution [ManiatiS et al., MOLECULAR CLONING;A LABORATORY & BIJAL (Cold Sp ring) larhor Lah, 1982)] at 40'C 6 x 5STE (0.9M NaCl, 60mM Tris-○CI [pH 7,9],] EDTA), 0.1% SDS, 2mM N82P The test was carried out overnight in iOt, -○KH, PO,. Then Nitrocell The same hybrid without labeled probe and salmon sperm DNA was added to the sample filter. Washed 4 times for 10 minutes under Daizene 1 condition. Autoradiography- 48 hours were performed using sensitized screening at 8°C. Later, the PCR product , polypeptides D and E. The 91/84 kD sequence was obtained by the same method as described above. child The sequence of the PCR product was identical to the region in clone flll. 113 kD The full length of the protein is 851 amino acids! Contains acid. Three major groups in the N-terminal region Chou and Fasman [Chl et al., ANN.

REV, BIOCHEM, 47 (+978)] and Garnier et al. [Garnier et al., J, MOL, B [OL. , 1Q (1978)] and are shown in shaded boxes. At the C-terminus, Highly negatively charged domains were seen. All negatively charged residues are black Stop! Residues that have been changed are shaded. Protein microscreening [Aeb-ersold et al., PI! QC, NATL, ACAD, SC1, USA, 87 (1987)], five polypeptides are underlined. has been done.

B) Amino acid sequences of 113 kD protein and 91/84 kD protein A comparison of 42% identical amino acids among the 715 overlapping amino acid sequences shown Indicates acid residue. In the central helical region, four leucine and one valine Butara repeat! ! 3 kD protein and 91/84 kD protein was identical in both proteins (the last leucine in 91/84 kD was (not stored accurately during repeat repeat).

If a heligram structure is adopted, this helix is amphipathic (not shown). Other salient features of this comparison are that their terminal There are several tyrosine residues that are conserved in both proteins in the vicinity.

Figure 9 shows in vitro transcription and translation of 113 kD and 91 kD cDNAs. and Western blot analysis with a 113 kD cDNA probe.

a) Full-length cDNA clones of 113 kD protein and 91 kD protein RNA was transcribed in vitro, and the transcribed RNA was transferred to a rabbit lenticule. e) Lysate (Promega (P“-omega): described in the Promega protocol) Translated in vitro under conditions similar to those described above.

Simultaneously translates the internal mRNA (Promega) as a protein size marker. Ta.

The 113 cDNA yields a translation product of approximately 105 kD, and the 91 cDNA yields a translation product of approximately 8 kD. A 6kD product was generated.

b) Complete cytoplasm isolated from hyperinduced HeLa cells [when using 11 RNA; A single 4,8 KB mRNA band was detected by Northern blot analysis [N1elsc h et al., The EMBO, J., 10 (1991)] +13kI This was observed with a cDNA probe encoding the C-terminus of the l protein.

Figure 10(A) is a Western plot confirming the identity of the 113kD protein. Show the results of the analysis. +13 kD protein amino acid ■Pore from O~650 Ripeptide segment [Harlow et al., ANTIBOD [ES; A LA BORATORY MANUAL (Cold Spring Harbo■ Lab. Antiserum raised against the protein Western Plot analysis specifically recognized a 113 kD protein. The antiserum was DN Highly purified [5GF-3 fraction from A affinity chromatography (>10.000x), and γIFN and αlFN-treated HeLa cells [Fu et al., PROC, NATL, ACAD, SC [, USA, 87 (199 Bands were recognized in both crude extracts prepared from [0)]. The antiserum is Synthetic protein [cDNA fragment encoding part of the 113 kD protein] Is it E.coli [S+n1th et al., GEN8.67 (1988)]? pGEX-2T [Sm 1th et al., PROC, NATL, ACAD, SC1, USA, 83 ( 1986)]. Freining a female NZW rabbit Immunizations were made with fusion protein 1 in adjuvant. Two consecutive sessions 2 weeks apart A test was performed with 500 mg of the fusion protein. Western plot already described [Pine et al., MOL, CBLL, B10L, 10. (1990 )].

Figure 10(B) shows that anti-113 antiserum affects the l5GF-3 shift complex. The results of the mobility shift assay shown are shown. Preimmune serum or ++3 kD antiserum as described [Fu et al., PROC, NATL, ACAD, SC1 , USA, 87 (+990): Kessler et al., GENES & DEu ,.

4, (1990)] to a shift reaction carried out for 20 minutes at room temperature, and then the reactants One-third of the sample was loaded onto a 5% polyacrylamide gel. In addition, labeled 0 None) probes were included in one reaction to demonstrate the specificity of the gel-shifted complex.

Figure 11 shows 113 kD, 91 kD and 84 kD tamps - Shows the results of an experiment examining α-dependent phospho-1-norization. 60 minutes to “PO4-” Protein samples from cells treated with various methods after exposure to 113 kD It was precipitated with protein antiserum. Lane l, untreated cells: lane 2.1F Thin 114,200kD (kilodal l・n') treated with N-α for 7 minutes, 97.5 kD, ratio of 69 kD and 46 kD to labeled marker proteins By comparison, the po,-' labeled proteins in the precipitate were 113 kD and 91 kD. cells treated overnight with IFN-γ, lane 3 (phosphoryl cells treated with IF'N-α for 7 minutes (lane 4) showed severe phosphorylation of 113 kD, 91 kD and 84 kD. show.

Figure 12 is a chromatogram showing the identification of phosphoamino acids. 113 kD, Hydrolysis of 91 kD or 84 kD size phosphate-labeled proteins , chromatography revealed newly labeled phosphotyrosine. . [Cells not treated with FN showed only phosphoserine labeling (PSer= Phosphoserine; P Thr = Phosphothreonine: P Tyr = Phosphotyrosy hmm).

Figure 13 shows the characterization of GAP by gel mobility shift assay.

Panel A) GAF is specific for GAS oligonucleotides in response to IFN-γ (This is combined.

Mobility shift assay of IP-labeled GAS was performed on untreated F32 fibroblast cells (lane l): Nuclear extract from F32 fibroblasts (lane 2) treated with IFN-α for 15 min. I went by Su.

Extracts from cells treated with IFN-γ for 15 minutes were added to other gel mobility shift doors. ・Used for soy sauce (lanes 3-5). l5RE (oligo O15, literature 5; A 50-fold excess of labeled oligonucleotide over unlabeled oligonucleotide representing sample 5). The GAS mononucleotide (Lane 4) was used for competition.

Panel B) Induction of GAP is independent of protein synthesis. Untreated cells (leaf) lane 1), cells treated with IFN-γ for 15 minutes (lane 2), and cells treated with cycloheximide for 15 minutes. Nuclear extract from cells treated with IFN-γ for 15 min (lane 3) in the presence of Shift assay using 1kGAs.

Panel C) Time course of GAF activation. treated with IFN-γ for the indicated times. Nuclear extracts from cells were subjected to gel mobility shift assay using sap-labeled GAS. used.

Method: The following double-stranded GAS oligonucleo from the GBP promoter (15) was used for gel mobility shift assays.

The oligonucleotides were converted to ``PdCTP'' using Klenow DNA polymerase. , dATP, dGTP, and dTrP. labeled oligonucleotide ln g, 20 mM HEPES (pi(7,9), 4% Ficoll, 1 side Mg Gel containing C1*, 40-KCI, 0.1-EGTA, 0.5-0 Mixed with 2 mg of poly(didC) in 5 ml of mobility shift buffer. Nuclear 1 ml of Kiss was added to the sample and the binding reaction was carried out for 20 minutes at room temperature. reaction mixture 5m 1 was analyzed on a 4% polyacrylamide gel. Nuclear extract to FS2 human diploid fiber Prepared from fibroblast cells (14). Human recombinant IFIi-γ (Amgen Nori, V Dr. Apnek's gift) was added to a final concentration of 5 ng/ml. [FN- α()loffman La Roche's P, 5orter's gift) to 5 00 antiviral units/ml. Cycloheximide (50mg/ml) [Added before addition of FH.

Figure 14 shows the identification of a 91 kD protein in the GAP shift complex.

Panel A) Seki cross-linking analysis of GAF. Using N1dLrrP replacement oligonucleotide A stone bridge analysis using the method was described (25). Simply put, oligonucleotides 5-N, dUTP and “Pd” using Klenow DNA polymerase. Labeled with ATP, dGTP, and dCTP. N, dtJTP replacement oligonucleotide Otide was used in nuclear extracts from IFN-γ-treated cells for mobility shift assays ( (same as in the case of FIG. 13). Autoradiograph while the gel is wet. I went to The gel was then treated with Stratagene UV rinsing. After irradiating with W for 5 minutes in a car, the gel slice corresponding to the GAF complex was cut, and 7% Analyzed with SDS PAGIE. Lane LI4C-protein marker (American - jam): lane 2, GAF-DNA complex: lane 3. 100-fold excess cold S oligonucleotide was added to the shift reaction mixture: lane 4, protein was shifted was not included in the reaction mixture.

Panel B) The GAP shift complex was characterized by antiserum to the 91 kD protein. be affected differently. Using nuclear extract from cells treated with IFN-γ for 15 minutes Perform the mobility shift gel assay as described in Figure 13 using various conditions. So I went. Lane 1, no addition; lane 2. 50-fold excess of unlabeled GA S oligonucleotide; lanes and 5, pre-immune serum; lane 4.91 kD Antiserum for the C-terminal 36 amino acids (91C) of the protein; lane 6.91k D protein antiserum (91m, amino acids 591-703). all serum 1 Added at a final dilution of /120.

Panel C) A 91 kD protein is present in the GAF gel shift complex.

Proteins in the GAP shift complex were analyzed by two-dimensional gel mobility shift-5DS electrophoresis. and then analyzed by immunoblotting. Partially purified GAP (hereinafter referred to as ), 1! Gel mobility simulation using P-labeled AS oligonucleotides used in the foot assay (left panel, lanes 1-3). In lane 2, the pro (A); lane 3, identifying the specificity of the GAP shift band. 50 times excess for? Competition with NAS oligonucleotides. electrophoresis and After traradiography, cut lanes 1 and 2 and rotate as shown. , 7% 5OS-PAGE analysis (upper right panel and lower right panel, respectively). panel). The gel was then electroblotted against nitrocellulose and ECL Detected with antiserum of 91 kD protein using kit (Ame-Jam) The protein was detected. The second gel corresponds to the GAS shift complex in the first gel. The position of in the gel is indicated by an arrow.

Panel D) Analysis of ``S-labeled GAF.'' Fibroblast cells (FS2 strain) were treated with ``S-methionine''. Labeled for 14 hours and treated with IFN-γ for 15 minutes. Prepare nuclear extract 6S-labeled proteins, including GAP, were added to biotinyl (EG) bound to beads. Recovered with AS oligonucleotide. After elution, the affinity prepared sample is The two-dimensional gel mobility shift described in Figure 14C using -3DS PAGε min OS protein was analyzed by analysis.

Left panel a) Gel migration using SS-labeled affinity purified samples (lanes 1-3). Preimmunization with 91 kD protein (lane 2 ) or immune serum (lane 3) was added. Disconnect lanes 2 and 3 and SOS Further analysis by PAGE followed by autoradiography reveals 1S-labeled proteins. exposed his dark qualities.

The location of the 91 kD protein is indicated by a dashed arrow.

Method: Purification of GAP using biotinylated IJAS oligonucleotide was performed. It was carried out qualitatively as described in (18). 5'-biotinylated double HiG AS oligonucleotide (American Synthesis) in gel mobility shift buffer (Figure 13) and incubated for 4 minutes at room temperature. Then that The reaction mixture was incubated with streptavidin-agarose beads (Sigma). and rotated at 40°C for 2 hours. Collect beads and gel mobility shift buffer Washed 4 times with liquid. Proteins bound to beads were first dissolved in 50mM Tris ( pH 7,6), 1-DTT, 10% glycerol, 0. NaC of chuu 1,0, Elute with E(0,2) buffer containing 5-EDTA and then 0.8 NaCl. It was eluted with E(0,8) buffer which is the same as E(0-2) except that E(0,8 ) contained GAP activity and was used for subsequent analysis.

Human fibroblasts were grown in Dulbecco's modified Eagle's medium (GI) containing 10% bovine serum. Buco). cells lacking L-methionine and cysteine O, I mCi/ml in the medium! Labeled with sS-labeled methionine. labeled medium It was removed by washing twice with water-cold saline phosphate buffer (PBS). Nuclear Kisses were prepared as in FIG.

Figure 15 shows that [FN-γ produces nuclear localization of a 91 kD protein, but human It is shown that the 113 kD protein does not occur in fibroblast FS2 cells. untreated Cells (A and C) and IFN-γ treated cells (B and D) were treated with anti-91 kD Protein antibody (91c, A and B) or anti-113 kD protein antibody (C and D). Cells were grown in 8 μl as described (Figure 14). Cultured in tissue culture chamber slides.

Twenty minutes before fixation, cells were treated with IFN-γ (5% g/ml) and incubated twice in PBS. Rinsed and fixed in a methanol acetone solution for 2 minutes. TBST(+On’ jil Tris-C1pl(s, o, 100 bars of NaCl, 0°02% to After washing twice in T*een 20), cells were added to TBST + 3% B Blocked in SA for 40 minutes. - Next antibody in blocking buffer for 2.5 hours (anti-113 or anti-91; 1/100 final dilution). TBST After washing three times in (1/200 dilution final concentration) over 70 minutes. Wash 3 times in TBST After cleaning, cells were washed with 0.1X PBS, 90% glycerol, 0.1% P- Phenylenediamine pHs, rinsed in O and dried.

Figure 16 shows activation of GAF by phosphorylation.

Panel A) Time course of IFN-γ induction analyzed by immunoplotting. shown Nuclear extracts were prepared from cells treated with IFN-γ for a specified time. Each sample? Western blot (7% 5DS-PAGE1 nitro Electrical plotting for cellulose, ECL, 91k by Amerjam Detection of a 91 kD protein using an antiserum specific for the D protein. A protein of 91 kD was analyzed. Slow-moving forms and fast-moving forms The form is indicated.

Panel B) Inhibitor of phosphorylation and enzymatic signature of 91 kD protein Due.

Lane l-3: Crude cell extract similar to panel A of cells treated as indicated. Immune plot of. Staurosporine treatment was 0.5-, [FN-γ induction was 1 It was 5 minutes. Lanes 4-6 Bipartially purified GAFC As in Figure 14, 6) or bovine intestinal phosphatase (C[P; 1.8 units/ml; 30' , 30°) treated GAF (lane 5). lane 4 was an incubation control lacking CIP. Panel C) Gel mobility Staurosporine on GAF DNA binding analyzed by shift assay and the effect of phosphatase treatment. As in panel B, the sample is shown in Figure 13. Analyzed by gel mobility shift assay as described.

Figure 17 shows IFN-γ-dependent tyrosine phosphorylation of a 91 kD protein. vinegar.

Panel A) “S-labeled 91 kD protein and” P-labeled 91 kD protein quality immunoprecipitation. Cells were grown in the "S" mode for 4 hours as described in Figure 14. Labeled with thionine or jtp for 1.5 hours [other 1 in a medium lacking sphate! P-orthophosphate (Ame-Jam) 0.5mci/ml]. The labeling medium was removed, the cells were washed twice with PBS, and the lysis slowed. buffer solution (50% Tris, pH 8, 0.280-NaCl, 0.05% NP- 40,0,2mM EDTA, 2mM EGTA, 10% glycerol, 1 orchid. DTT-10, 5mM PMSF, 0.5mg/ml O leupeptin, 3m g/ml abroteinin, 1/ml pepstatin, 0.1mM N, VO 2) Extracted inside. The extract was added to pre-immune serum and protein A-G agarose. (Oncogene Science).

The 91 kD protein was then immunoprecipitated with the 91 kD antiserum. Then S S-labeled immunoprecipitates (lanes l-3) and j'P-labeled immunoprecipitates (lanes 4-7) were Analyzed by 7% SDS” PAGE followed by autoradiography. lane 11 untreated; lane 2, treated with [FN-γ for 15 minutes; lane 3, staurospore Pretreatment with phosphorus for 10 min, followed by 15 min of [FN-γ treatment: lane 4, [FN- Treated with γ for 7 minutes: lane 5, untreated: lane 6, [treated with FN-γ for 15 minutes; Case 7, 10 min pretreatment with staurosporine followed by 15 min IFN-γ treatment . Slow and fast travel modes are shown.

Panel B) Phosphoamino acid analysis of the 91 kD protein. “P-labeled 91 kD Tan Proteins were analyzed on a 5O3-PAGE gel (see Figure 17A, lanes 4 and 5). It was cut off. -5tp-labeled proteins were incubated at 110°C for 1.5 hours. (digested with CI. Phosphoamino acids were analyzed as described (26). Ta. Phosphoserine (p-ser), phosphothreonine (p-thr) and phosphorus Transfer of sulfotyrosine (p-tyr) is shown.

Figure 18 shows the phosphopeptide Matupi of a thermolysin digest of a 91 kD protein. Indicates the Peptide mapping was performed as described (26).

Simply put, ′! P-labeled 91 kD protein was immunoprecipitated and 5O3-PA Separated by GE gel, eluted and digested with thermolysin (100 mg/ml). Ta.

detailed description According to the present invention, conventional molecular biology techniques, microbiology techniques within the skill of a person skilled in the art , and recombinant DNA technology may be used. Such techniques are not fully explained in the literature. It is. For example, 1Janiatis, Fr1tsch & 5ajIlbr ook,’1locular Cloning: ALaboratory 1 January’ (1982): “DNA Cloning: A Pra ctical Approach, “@I volume and Volume 11 (edited by D, N, Glover 1985); “01 igonucl eotide 5ynthesis” (Edit IJ, J, Ga Weir@ 1984) ; “Nucleic Ac1d) lybridization” [B, D, Hames & S, J, Higgins W (1985) : Translation” [B, D, Edited by Hames & S. J. Higgins (1984)]@; 'Animal Ce1ls Cu1ture' [R, [, Freshney Edit (1986)]: “Immobile-ized C ■ Strike ■ AndEnzymes” [lRL Press, (1986)]: B, P erba1. -A Practical Guide TB See Molecular Cloning' (1984).

Therefore, when appearing herein, the following terms should have the definitions below.

“receptor recognition factor”, “receptor recognition tyrosine kinase factor”, “receptor recognition factor” ``Tyrosine Kinase Substrate'', ``Receptor Recognition 1 Transcription Factor'', ``Recognition Factor'', and - The term “one or more recognition factor proteins” and variants not specified include: Interchangeably used in this specification and in the present application and claims. represents a proteinaceous substance containing single or multiple proteins, as in 1 (SEQ ID NO: I), FIG. 2 (SEQ ID NO: 2) and FIG. The DNA sequence and amino acid sequence data shown in 3 (SEQ ID NO: 3), and the present invention for proteins having the activity profile indicated in the specification and claims. Ru.

Therefore, proteins exhibiting substantially equivalent or altered activity are likewise contemplated. There is. These modifications, e.g. those obtained by site-directed mutagenesis, are or the producers of the complex or its designated subunits. It may also be accidental, such as a modification obtained by mutation in a given host. Ma "receptor recognition factor", "recognition factor" and "one or more recognition factor proteins" The term “in addition to the proteins specified herein (within their scope) , is intended to include all substantially homologous analogs and allelic variants. There is.

It is preferred that the amino acid residues described herein are in the "L" isomer.

However, the residues of the "D" isomer may not have the desired functionality of immunoglobulin binding. L-amino acids may be substituted as long as they are retained by the repeptide. The mark is polypep Represents the free amino group present at the amino terminus of tide. C0OH is the polypeptide Represents a free carboxy group present at the carboxy terminus. Usual polypeptide nomenclature , J. Biol, Chea, 243:3552-59 (1969). Accordingly, the abbreviations of amino acid residues are shown in the correspondence table below.

Correspondence table F　Phe　Phenylalanine M Met Methionine P Pro Proline K Lys Lysine HHis Histidine Q Gin Glutamine E　G1. u Glutamic acid W　Trp　) Ributofan RArg Arginine D Asp Aspartic acid N Asn Asparagine CCys Steinstein All amino acid residue sequences have a left-right orientation, usually amino-terminus to carboxy-terminus. It should be noted that the direction of is denoted herein by the equation. Furthermore, A dash at the beginning or end of an amino acid residue sequence indicates the presence of one or more amino acid residues. It should be noted that the peptide is shown attached to another sequence. The above table is To correlate three-letter and one-letter notations that may appear alternately herein: shown.

A “replicon” functions as an autonomous unit of DNA replication in an organism, i.e. Any genetic element that can replicate under the control of the t1 host (e.g., plasmid, chromosomes, viruses).

“Vector” means a replicon, such as a plasmid, phage or cosmid ( These have another DNA segment attached to them so as to bring about replication of the joining segment. ).

“I) NA molecule’ can be a single-stranded molecule or a double-stranded helical deoxyribonucleonucleotide. Represents a polymeric form of tide (adenine, guanine, thymine, or cytosine). child The term refers only to the primary and secondary structure of the molecule and does not include any special tertiary structure. 9 to the next form! Not determined. :Thus, the second term specifically refers to linear DNA, found in offspring (e.g. restriction fragments), viruses, plasmids, and chromosomes. Contains double-stranded DNA. When explaining the structure of a special two-strand 11 DNA molecule, The sequence is not transcribed from DNA! ! (i.e., has a sequence homologous to mRNA) In accordance with the conventional practice of indicating only the alignment in the 5' to 3' direction along the chain It can be written in the book.

"Source of replication" refers to DNA sequences involved in DNA synthesis.

DNA “coding sequences” are transcribed when placed under the control of appropriate regulatory sequences. It is a double-stranded DNA sequence that is translated into a polypeptide in vivo. code sequence The boundaries are the start codon at the 5′ (amino) end and the start codon at the 3′ (carboxy) end. determined by the translation stop codon. The coding sequence may be a prokaryotic sequence, a eukaryotic m cDNA from RNA, genomic DNA from eukaryotic (e.g. mammalian) DNA A sequences may include, but are not limited to, synthetic NA sequences. Po Readenylation signals and transcription termination sequences are usually located 3' to the coding sequence. It will be.

Transcriptional and translational regulatory sequences include DNA regulatory sequences, such as promoters, enhancer, polyadenylation signal, terminator 1, etc., and these are Provides for expression of the coding sequence in the host cell.

A “promoter sequence” is a sequence that can bind RNA polymerase in a cell and (3° direction) This is the 11-node region of DNA where transcription of the coding sequence can begin. present invention The promoter sequence is bound by the transcription start site at its 3° end to identify and extends upstream (in the 5° direction) to a detectable level above background. Contains the minimum number of bases or elements necessary to initiate transcription at the base. promoter Within the sequence, a transcription start site (usually identified by mapping with nuclease S1) protein that is responsible for the binding of RNA polymerase. A protein binding domain (consensus sequence) will be seen. eukaryote promo The controller often includes a GoATA” box and a CAT” box, but this It may not necessarily include these. Prokaryotic promoters have approximately 10 and 3 In addition to the consensus sequence of 5, it contains the Shine-Dalgarno sequence.

"Expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. This is A array. The coding sequence is processed by RNA polymerase, which converts the coding sequence into mRNA. when this is transcribed and then translated into the protein encoded by this or the coding sequence In addition, it is under the control of transcriptional and translational regulatory sequences in cells.

A "signal sequence" may be included before the coding sequence. This sequence is a polypeptide The polypeptide encodes a signal peptide at the N-terminus (which communicates with the host cell). directing the peptide to the cell surface or secreting the polypeptide into the culture medium; Gnar peptides are cleaved by the host cell before the protein leaves the host cell. Ru. Signal sequences are mixed with various proteins native to prokaryotes and eukaryotes. It can be seen as

As used herein with respect to the probes of the present invention, referred to as "oligonucleotide 1" The term is defined as a molecule containing two or more, preferably three or more ribonucleotides. It will be done. Its exact size depends on many factors, and these factors, in turn, It will depend on the ultimate function and use of the nucleotide.

As used herein, the term "primer" refers to an oligonucleotide (m be naturally occurring, as in the case of restricted digests, or synthetically produced. refers to the primer extension product (which is complementary to the nucleic acid strand); for example, the synthesis of nucleotides and an inducing agent, e.g. When placed under conditions such as inducing at appropriate temperature and pH in the presence of In some cases, it can act as a starting point for synthesis. Primers can be single-stranded or double-stranded. and sufficient to initiate synthesis of the desired extension product in the presence of the inducing agent. It needs to be long. The exact length of the primer will depend on temperature, the source of the primer and its It will depend on many factors including the use of the method. For example, for diagnostic applications, Depending on the complexity of the target sequence, oligonucleotide primers typically contain between 15 and Contains 25 or more nucleotides, but it contains even fewer nucleotides May contain.

The primers of the invention are "substantially" complementary to different strands of a particular target DNA sequence. chosen to be. This means that the primers hybridize with their respective strands. This means that they must be sufficiently complementary to form a Therefore, ply The mer sequence need not reflect the exact sequence of the template. For example, non-complementary nuclei The otide fragment can be attached to the 5' end of the primer and The remainder is complementary to the strand. Also, non-complementary bases or longer sequences may the immer sequence has sufficient complementarity with the strand sequence to form a hybrid with it; in the primer, provided that it thereby forms the template for the synthesis of the extension product. May be scattered.

The terms “restriction endonuclease” and “restriction enzyme” as used herein represent bacterial enzymes, each of which has two chains near a specific nucleotide sequence. Cut the stranded DNA.

Cells do this when exogenous or foreign DNA is introduced into the cell. The transforming DNA constitutes the genome of the cell. may be integrated (covalently linked) into the chromosomal DNA of It doesn't have to be. For example, in prokaryotes, yeast, and mammalian cells, transformation DNA may be maintained in ebisomal elements such as plasmids. to eukaryotic cells Regarding stably transformed cells, the transforming DNA is integrated into the chromosome. so that it is inherited by daughter cells through chromosome replication. It is a cell.

This stability is due to the fact that eukaryotic cells contain a population of daughter cells containing the transforming DNA. or demonstrated by the ability to establish clones. “Closure is caused by mitosis. A single cell or a population of cells derived from a common ancestor. “Cell line” refers to multiple A primary cell clone that can grow stably in vitro for many generations.

The two DNA sequences have at least about π% (preferably at least about 80%, most preferably at least about 90 or 95%) of the DNA sequence. "Substantially similar" if they match over a defined length. substantially Sequences that are homologous can be identified using the usual software available in sequence data banks. or by comparing the sequences, e.g. Southern hybridization experiments under stringent conditions such as obtain. Identification of appropriate hybridization conditions is within the skill of those skilled in the art. Ru. For example, the above-mentioned document by Maniatis et al.: DNA Cloning, Volumes I and 11, above-mentioned literature; Nuc-Ieic Ac1d Hybrid ization, see above-mentioned document.

"Heterogenous" regions of DNA construction are large molecules that are not seen in association with large molecules in reality. A is an identifiable segment of DNA in a molecule. In this way, the heterologous region becomes mammalian. When encoding a gene, the gene is usually found in the mammalian genome in the protozoan genome. will be flanked by DNA that is not adjacent to the mu DNA. That of a heterologous coding sequence Other examples are constructs where the coding sequence itself is not found in reality (e.g. If the gene coding sequence has introns or different codons than the native gene, cDNA that contains the original sequence). allelic variation or naturally occurring suddenness Mutation events do not result in heterologous regions of NA as defined herein.

“Antibodies 2 include antibodies and fragments thereof that bind specific epitopes. It is an immunoglobulin. The terms are polyclonal antibodies, monoclonal antibodies , and chimeric antibodies, the last mentioned antibody being disclosed in U.S. Patent No. 4.816.3. No. 97 and No. 4.816.567.

“Antibody combining site” refers to the variable region of the H chain and L chain that specifically binds the antigen and The structural portion of an antibody molecule that contains the hyperacceptable region.

As used herein, the expression "antibody molecule" in its various grammatical forms includes: of intact immunoglobulin molecules and immunologically active portions of immunoglobulin molecules. Both are intended.

Examples of antibody molecules include intact immunoglobulin molecules, substantially intact immunoglobulin molecules. children, and portions of immunoglobulin molecules [these are referred to in the art as Fab, Pab ’, F(ab’)t and fi(v) (these parts are Balatope (preferably used in the treatment methods described herein) including].

The Fab part and F(ab') part of the antibody molecule are prepared by known methods. Protein fractions of papain and pepsin, respectively, on substantially intact antibody molecules. Prepared by decomposition reaction. For example, the United States of Theofiopolous et al. See patent no. 4.342.566. In addition, Fab' antibody molecular parts are known Then, from F(ab') part, as with mercaptoethanol, Reduction of the disulfide bond linking the two heavy chain moieties followed by iodoacetamide produced by alkylation of the resulting protein mercaptan with reagents such as Ru. Antibodies comprising intact antibody molecules are preferred herein.

The expression “monoclonal antibody” in its various grammatical forms refers to a specific antigen. represents an antibody that has only one species of antibody combining site that can immunoreact with the antibody. In this way, things A clonal antibody typically has a single binding affinity for the antigen with which it is immunoreactive. Show your gender. Therefore, monoclonal antibodies, e.g. bispecific (chimeric) monoclonal Local antibodies have multiple antibody binding sites, each immunospecific for different antigens. may include antibody molecules that

The expression “medicinally controlled” refers to a drug that is physiologically tolerated and typically used in humans. allergic reactions or similar untoward reactions, e.g. gastric abnormalities, when administered. Refers to molecular entities and compositions that do not cause dizziness, dizziness, etc.

The expression "therapeutically effective amount" refers to a clinically significant change in S-phase activity of target cellular material. or other characteristics of the disease, such as hypertension, fever or its presence and activity. Take care to prevent white blood cell counts, preferably at least about 30 %, more preferably by at least 50%, most preferably by at least 90%. As used herein to mean an amount sufficient to reduce.

A DNA sequence has an expression control sequence that controls the transcription and translation of that DNA sequence. "operably linked" to an expression control sequence when “Connected by operation ” refers to the presence of a suitable initiation signal (e.g. , ATG) and the expression of the DNA sequence under the control of expression control sequences and the DNA the correct reading frame to allow production of the desired product encoded by the A sequence. Including maintaining. Is the gene desired to be inserted into the recombinant DNA molecule? If it does not contain a suitable start signal, such a start signal will precede the gene. can be inserted into

The term “normal hybridization conditions” refers to Salt and water substantially equal to 5 x SSC and 65°C for both cleaning and cleaning. and temperature conditions.

The present invention, in its main aspects, involves the identification of receptor recognition factors and the identification of special receptor recognition factors. body recognition factor protein (which is thought to be present in the cytoplasm and is associated with Among specialized cellular receptors with equally specific polypeptide ligands combined can be used as signal transducers), and fairly specific transcription factors progeny (which enters the nucleus of the cell and binds to specific DNA binding sites for gene activation) a specific polypeptide (that interacts with a specific polypeptide to promote a given response to a stimulus) related to separation and sequencing. This disclosure describes specific and individual responses to known stimuli. receptor recognition factors, such as tumor necrosis factor, nerve growth factor, platelet-derived growth factor, etc. exist. This particular proof is that interferon alpha and gamma (IFNα and IFNγ).

Similarly, the receptor recognition factors of the invention may be used to increase the activity and concentration of second messengers. It is noteworthy that it is clearly not affected significantly by variations in temperature.

Receptor recognition factor proteins act as substrates for tyrosine kinase domains However, it is clear that it does not interact with G protein; Therefore, it is clear that it is not the second Metsusenger.

The particular receptor recognition factor identified herein by SEQ ID NO: 2 resides in the cytoplasm. exists and enters the nucleus of the cell! Signal transduction in response to FN γ stimulation specific transcription factors and specific for gene activation. directly interacts with the DNA binding site of the polypeptide to produce a defined response to a specific polypeptide stimulus. It was measured that the answer was facilitation. This special factor also acts as a translated protein. , and specifically as a DNA-binding protein that responds to interferon-γ stimulation. It works. Similarly, this factor is notable in that it has the following characteristics: be.

a) It interacts with the interferon-gamma binding receptor kinase complex: b ) it is a tyrosine kinase substrate; and C) when phosphorylated, its This can be used as a DNA binding protein.

More specifically, the factor of SEQ ID NO: 2 is located near position 690 of its amino acid sequence. After acquiring the phosphate for each tyrosine, it directly interacts with DNA.

Mat7, this factor-inter:noting [J-γ-dependent activation is a new protein It occurs in the absence of protein synthesis, appears within minutes of interferon-γ treatment, and It reaches its highest level after 15 to 30 minutes, then disappears after 2 to 3 hours.

As shown in FIG. &’, sequence (SEQ ID NO: l), molecular weight of approximately 91 kD and shown in Figure 2? , 2DN A sequence (sequence, column 1 no. 2), and a molecular weight of approximately 84 kD and D shown in FIG. A receptor recognition agent having a molecular weight and an nNA sequence selected from the NA sequence (SEQ ID NO: 3). A recombinant DNA molecule or clone encoding an identification factor, or a fragment thereof. Concerning a transgenic gene or its degenerate mutant.

Both diagnostic and therapeutic possibilities arise from the presence of one or more receptor recognition factors. , the factor interacts directly with the receptor occupied by its ligand and subsequently with the gene. A direct link between factors that carry out transcription, transcription, and gene activation. It is clear that it is involved in protein interactions that are one of the causes. Derived from fact. As previously suggested herein and as detailed hereinafter, the present invention receptor recognition factors modulate activity initiated by stimuli bound to cell receptors It is intended for pharmaceutical intervention in the cascade of reactions involved in

thus reducing or suppressing gene activity caused by a particular stimulus or factor If desired, an appropriate inhibitor of the receptor recognition factor is introduced to Interactions between body recognition factors and factors causally related to gene activation can be blocked.

Therefore, if there appears to be insufficient gene activation, additional amounts of receptor recognition may be necessary. Derivatives of identification agents or their chemical or pharmaceutical congeners, analogs, fragments, etc. This can be alleviated by adding water.

As explained above, recognition factors or their binding partners or recognition factors Others exhibiting mimetic or antagonistic effects on f or control over their production. The ligand or drug for which the treatment targets specific transcripts associated with adverse medical conditions. Suitable carriers and drugs that are effective for administration by a variety of means to patients experiencing irritation. It can be prepared in pharmaceutical compositions in various concentrations. Various administration techniques, among them subcutaneous Parenteral techniques such as intravenous and intraperitoneal injections, catheterization, etc. may be used. Ru. The average amount of receptor recognition factors or their subunits may vary. , especially on the recommendation and prescription of a competent physician or veterinarian.

Furthermore, antibodies and recognition agents, including both polyclonal and monoclonal antibodies, Agents that modulate the production or activity of molecules and/or their subunits may be useful in certain diagnostic For example, it can be used to detect and/or measure symptoms such as viral infections. I can stay. For example, the recognition factor or its subunits can be fused together: By known techniques such as hybridoma technology using lymphocytes and myeloma cells, Polyclonal and monoclonal antibodies against them in various cell culture media used to produce both. Similarly, the activity of the receptor recognition factor of the present invention Small molecules that resemble or antagonize sex are discovered or synthesized, diagnostic and/or therapeutic professionals) Used for calls.

The general method of making monoclonal antibodies by hybridomas is well known. infinite anti Somatic cell lines also involve direct transformation of B lymphocytes by oncogenic DNA. tion or transfection with Epstein-Barr virus. It can also be created using techniques other than fusion. For example, M, 5ehreier and others.

“Toridoma Techniques” (1980): HajIITI erling et al., “1 Jonoclonal Antib Shield р奄■ Sword@And T- Cell Hybridomas” (1981) + Kennett et al., IJ onoclonal Antibodies” (1980) Q Teru: Masaru U.S. Patent No. 4.341.761: U.S. Patent No. 4.399.121: U.S. Patent No. 4.42 No. 7.783: No. 4, No. 444.887: No. 4.451.570: No. 4. 466, 917; Same No. 4.472.500: Same No. 4, 491.632: Same No. 4.493.890 Monoclonal produced against Sansho recognition factor peptide Antibody panels screen for various properties, i.e. isotype, epitope, affinity, etc. can be turned on. Monochromes that neutralize the activity of recognition factors or their subunits Local antibodies are of particular interest. This monoclonal antibody was tested in recognition factor activity assays. Can be easily identified. Immune affinity of native or recombinant recognition factors – High affinity antibodies are also effective if purification is possible.

The anti-recognition factor antibody used in the diagnostic method of the present invention is an affinity-purified polyclonal antibody. Preferably, the antibody is a null antibody. The antibody is a monoclonal antibody (mAb) is even more preferable. Furthermore, the anti-recognition factor antibody molecules used herein are whole antibody molecules. Must be in the form of child Fab, Fab', F (ab') = or F (v) part is preferred.

As indicated earlier, the diagnostic method of the invention uses an anti-recognition factor antibody, preferably an affinity antibody. a purified polyclonal antibody, more preferably a receptor recognition agent such as a mAb. cell samples or cultures by analysis containing an effective amount of antagonists to the bacterial cells/infections. This includes testing the liquid. Furthermore, the anti-recognition factor antibody component used herein The child is the Fab%Fab', F(ab')* or F(v) portion of the whole antibody molecule. It is preferable that it is a shape. As mentioned earlier, one can benefit from this method. Patients - (= suffering from cancer, precancerous lesions, viral infections or other similar pathological disorders) I can name some people who do. Method for isolating recognition factor and inducing anti-recognition factor antibodies and methods for determining and optimizing the ability of anti-recognition factor antibodies to participate in testing target cells. are all well known in the art.

Methods for producing polyclonal anti-polypeptide antibodies are well known in the art. . U.S. Pat. No. 4,493,795 by Ne5tor et al. Typical monoclonal antibodies containing Fab and/or F(ab') moieties include: Ant 1bodies-A laboratory l1ianual, Har low, Lane, eds, cold Spring Harbor Lab orat shield nitful ANNew It can be prepared using hybridoma technology as described in York (1988). This document is incorporated herein by reference. In short, monoclonal myeloma or other self-immortal cells to generate hybridomas producing the same antibody composition. Cell lines and their rI! recognition factor binding moiety or recognition factor or ultra-thickness specific DNA binding moiety Lymphocytes obtained from the spleen of a hyperimmunized mammal are fused.

Pile cells are typically isolated from bone marrow using polyethylene glycol (PEG) 6ooo. fused with tumor cells. Fusion hybrids are selected for their susceptibility to HAT. be done. Hybrids that produce monoclonal antibodies useful in carrying out the invention The tumor has the ability to immunoreact with this recognition factor and the ability to inhibit specific transcriptional activity in target cells. Identified by

Monoclonal antibodies useful in carrying out the invention have appropriate antigen specificity. A monoclonal culture medium containing a nutrient medium containing hybridomas secreting antibody molecules. It can be produced by starting a hybridoma culture. Culture hive The ridoma is maintained under conditions and for a time sufficient to secrete antibody molecules into the medium.

The antibody-containing medium is then collected. Further antibody molecules are then isolated using well-known methods. Ru.

Media useful for preparing these compositions are well known in the art and commercially available. Examples include synthetic culture media and inbred mice. An example of a synthetic medium is 4.5 gm /1 glucose, 20ff [11 supplemented with glutamine and 20% fetal bovine serum] Dulbacco's minimum essential culture medium (D!a: Dulbacco et al., Virol, 8 :396 (1959)). An example of a modern mouse strain is B-alb/c. .

Methods for producing monoclonal anti-recognition factor antibodies are also well known in the art.

Niman et al., Proc, Natl, Acad, Set, USA, 80:4949-4953 (1983). Typically, the recognition factor or peptide Tide analogs can be used alone or in combination with previously described anti-recognition factor monoclonal antibodies. conjugated to immunogenic carriers in the body's production methods. High recognition factor peptides hybridomas for their ability to produce antibodies that immunoreact with this recognition factor. screen.

The present invention further contemplates therapeutic compositions useful in practicing the therapeutic methods of the present invention. It is something that The therapeutic composition contains a pharmaceutically acceptable excipient (carrier) and an effective one or more receptor recognition factors described herein as a component, polypeptides thereof; tide analogs or fragments thereof are included as a mixture. In a preferred embodiment , this composition contains an antigen that can modulate the specific binding of this recognition factor within target cells. Contains.

Preparation of therapeutic compositions containing polypeptides, analogs or active fragments as active ingredients , is well understood in the art. Typically, the composition is in a solution or It is prepared as an injectable solution such as a suspension, but it must be dissolved as a liquid before being injected. Solid forms suitable for liquids or suspensions can also be prepared. Emulsifying the preparation You can also do it. Therapeutic active ingredients are usually pharmaceutically acceptable and compatible with the active ingredient. mixed with excipients. Suitable excipients are, for example, water, saline, dextrose, Glycerol, ethanol, etc. and combinations thereof. Furthermore, in some cases, books The composition may contain adjuvants such as wetting or emulsifying agents, pH buffering agents, which enhance the effectiveness of the active ingredients. May contain small amounts of substances.

Polypeptides, analogs or active fragments may be present as neutralized pharmaceutically acceptable salts. Can be formulated into therapeutic compositions. Acid addition salts are pharmaceutically acceptable salts. (formed by free amino groups of polypeptide or antibody molecules), these are hydrochloric acid or inorganic acids such as phosphoric acid or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. is formed. Salts formed from free carboxyl groups are sodium, potassium, Inorganic bases such as ammonium, calcium or ferric hydroxide and isopropylene triamine, trimethylamine, 2-ethylaminoethanol, histidine, pro- It can also be derived from organic bases such as hydrin.

Therapeutic compositions containing polypeptides, analogs or active fragments are conventionally prepared, e.g. Administered intravenously as an injection. used for the therapeutic composition of the present invention. The term “unit dose” refers to physically separated doses that are suitable as unit dosages for humans. means the units in which each unit is placed together with the required diluent, i.e. carrier or excipient. Contains a predetermined amount of active substance calculated to produce the desired therapeutic effect.

The compositions will be administered in a manner compatible with the dosage regimen and in a therapeutically effective amount.

The amount to be administered depends on the patient to be treated, the availability of the active ingredient to the patient's immune system and It depends on the degree of inhibition or neutralization of recognition factor binding ability desired. should be administered The precise amount of active ingredient required is peculiar to each individual based on the judgment of the practitioner.

However, a suitable dose is approximately 0 sips of active ingredient per kilogram of body weight of the individual. ．． 1 to 20 milligrams, preferably about 0.5 to about lθ milligrams, more preferably ranges from 1 to several milligrams, depending on the route of administration. First dose and booster dose Although the appropriate dosing regimen varies, repeated injections or Repeated administration with other administrations is typical. In addition, the blood concentration lO nanomol ~ 10 my Continuous intravenous infusion sufficient to maintain cromol is also contemplated.

Therapeutic compositions may further include factor/factor synthesis promoter antagonists or analogs thereof. Effective amounts and one or more of the following active ingredients may be included: antibiotics, steroids. prescription An example is shown below: prescription Cefotaxime 250.0 Receptor recognition factor 10.0 Dextrose [ISP 45.0 Sodium bisulfite tJsP 3.2 Edetate disodium USP Q, 3 Water for injection Appropriate amount Total volume 1.0ml Ampicillin 250.0 Receptor recognition factor 10.0 Sodium Bisulfite USP 3.2 Edetate disodium USP 0.1 Water for injection Appropriate amount Total amount 1.0ml Gentamicin (packed as sulfate) 40.0 Receptor recognition factor 10.0 Sodium bisulfite υSP 3.2 Edetate disodium USP 0.1 Water for injection Appropriate amount Total amount 1.0ml Recognition factor 10.0 Dextro-x USP 45. .

Bisulfite sl/gram USP 3.2 Disodium edetate USP O, I Water for injection Appropriate amount Total amount! , Oml Recognition factor antagonist 5.0 Sodium bisulfite IJSP 3.2 Edetate disodium USP 0.1 "ug" or "μg" means microgram, "mg" means milligram, " operably linked to the U or current regulatory sequences and transformed into a suitable unicellular host. In the case of an expression vector, the initiation code is placed upstream of the DNA sequence in the correct reading frame. using AT vectors, such as phage DNA or other expression control sequences. a sequence that regulates the expression of a DNA sequence to which it is operatively linked. is used. This effective expression control sequence includes, for example, the early stage of SV40 or late promoter, CMv, vaccinia, polyoma or adenovirus, Ia Main operators of c system, trp system, TAC system, TRC system, LTR system, phage λ - and promoter region, regulatory region of fd coat protein, 3-phosphoglyceride promoters of rate kinases or other glycolytic enzymes, promoters of acid phosphatase promoter (e.g. Pbo2), promoter of yeast alpha mating factor and prokaryotic or Other sequences known to regulate gene expression in eukaryotic cells or their viruses. and various combinations thereof.

A variety of unicellular host cells are also useful in expressing the DNA sequences of the invention.

These hosts include well-known eukaryotic and prokaryotic hosts such as E. coli, Pseudomonas , Bacillus, Streptomyces strains, fungi such as yeast and animal cells, such as CHO, R1, I, B-W and LM cells, African green monkey kidney cells (e.g. CO3l, CO37, BSC1, B5C40 and BMTl 0), Included are insect cells (eg 5f9) and tissue cultured human and plant cells.

The vector, expression control sequence and host all express the DNA sequence of the invention. It will be understood that they do not function equally well. All hosts are the same It does not function equally well using expression systems.

However, one of ordinary skill in the art can easily determine the appropriate vector, expression control sequence, etc. without undue experimentation. and the host to achieve the desired expression without departing from the scope of the invention. You will be able to do that. For example, when selecting a vector, the vector is Since it has to function, the host must be considered. Copy vector number, the ability to control its copy number and the expression of other proteins encoded by the vector, For example, antibiotic markers are also considered.

Various factors are typically considered when selecting expression control sequences. These include e.g. For example, the relative strength of the system, its constraint and especially the individual characteristics to be expressed in terms of secondary structure. Including its compatibility with a DNA sequence or gene. Suitable unicellular hosts are e.g. compatibility with the selected vector, secretion properties, ability to properly fold the protein and Fermentation requirements and toxicity of the product encoded by the DNA sequence to be expressed to the host and ease of purification of the expression product.

Considering these and other factors, one skilled in the art will be able to utilize the present invention in fermentation or animal mass culture. Construct various vector/expression control sequence/host combinations to express the DNA sequence. can be done.

Receptor recognition factor analogs further include derived protein complexes within the scope of the present invention. It is contemplated that the nucleotide sequence of the body/subunit may be prepared from the body/subunit nucleotide sequence. of fragments Such analogs can be obtained by, for example, pepsin digestion of receptor recognition factor substances. will be produced. Other analogues, such as mutant proteins, can be generated by standard site-directed mutagenesis of coding sequences. Professional ``Receptor recognition factor activity'' such as small molecules that function as motors or inhibitors. Analogs exhibiting "sex" are identified by known in vivo and/or in vitro assays.

As mentioned above, the DNA sequence encoding the receptor recognition factor has been cloned. It is prepared synthetically rather than directly. The DNA sequence is the receptor recognition factor amino acid sequence. sequences can be designed with appropriate codons. Usually the sequence is used for expression If so, codons preferred for the intended host are selected. Full array is standard The complete code is constructed from overlapping oligonucleotides prepared by constructed into a ding array. For example, Edge, Nature, 292+6 31 [1981); Nambair et al., 5science, 223:1299 (+ 984); Iay et al., J. Biol. Chem., 259:631 [1 984) Reference.

Synthetic NA sequences generate receptor recognition factor analogs or “mutant proteins.” It is possible to conveniently construct genes that express Additionally, the mutant protein can be encoded. The DNA to be coded is a site-directed mutation of the native receptor recognition factor gene or cDNA. Can be created by metagenesis, and muteins are produced using conventional polypeptide synthesis. can be created directly using the configuration.

A general method for site-specific incorporation of unnatural amino acids into proteins is described by Christopher er　J.

Noren, 5pencer J, Anthony-Cahill, Michael el　C,Griffith,Peter　G,5chul狽噤B 5science, 244:182-188 (April 1989). It is. This method is used to create analogs using unnatural amino acids. Ru.

The present invention can be used to interfere with the expression of receptor recognition proteins at the transcriptional level. This includes the preparation of antisense and bozymes. This method Using a sense nucleic acid or bozyme to mask the mRNA with an antisense nucleic acid or blocks the translation of specific mRNA by cleaving it with a ribozyme. .

Antisense nucleic acids are complementary to at least a portion of a specific mRNA molecule. It is an RNA molecule. (Weintraub, 1990; imrcus-3e kura, 1988 o) hybridization to its mRNA in the cell to form a double-stranded molecule. Cells do not translate mRNA in this double-stranded form. stomach. Therefore, antisense nucleic acids do not interfere with the expression of mRNA into protein.

An oligomer of approximately 15 nucleotides and a hybrid form for the AUG start codon. This molecule is easy to synthesize and easy to introduce into receptor recognition factor producing cells. This is particularly useful since it appears to pose fewer problems than larger molecules. anti The sense method has been used to block the expression of many genes in vitro ( Marcus-3ekura, 1988; HaIIIbor et al., +988 ).

Ribozymes are enzymes that react with other enzymes in a manner somewhat similar to DNA restriction endonucleases. It is an RNA molecule that has the ability to specifically cleave RNA molecules. Ribozyme is Discovered from the observation that certain mRNAs have the ability to remove their own introns. It was. By modifying the nucleotide sequences of these RNAs, the researchers Manipulate molecules that recognize specific nucleotide sequences in NA molecules and cleave them. (Cech, 1988). Being sequence-specific, Only mRNAs that contain the sequence are inactivated.

Two types of gluebozymes have been identified, the Tetrahymena type and the “hammerhead” type. (Hasselhoff, Gerlach, 1988) Tetrahymena Overbozyme recognizes 4 base sequences, but “Hammerhead” pears recognize 11-18 base sequences. Recognize base arrays. The longer the recognition sequence, the more likely it is to be present only in the target mRNA species. It is. Therefore, hammer-type subozymes are tetamines that inactivate specific mRNA species. Lahimena type is preferred, and 18 base recognition sequences are preferred over short recognition sequences.

That is, the DNA sequences described herein are suitable for receptor recognition factor proteins and Antisense molecules against the ligand and mRNA-cleaving or bozymes are prepared. used for manufacturing.

The present invention also relates to the ability to induce activity mediated by the present receptor recognition factor. mentioned earlier and encompasses methods for detecting the presence of stimuli such as polypeptide ligands. and various diagnostic applications including. As mentioned above, receptor recognition factors can be used to produce antibodies against it by various known techniques. The antibody is then isolated and the specific transcriptional activity detected in the suspected target cell. Used in tests for existence.

As detailed above, antibodies against the i-nocebuter recognition factor are It can be produced and isolated by standard methods such as bridomoma technology. For convenience, Antibodies against receptor recognition factors are called Ab, and antibodies generated in different types are A. b.

Reference is made to this specification as follows.

The presence of receptor recognition factors in cells is determined by conventional immunological techniques that can be applied to their measurement. This can be verified by following the standard procedure. A number of effective procedures are known. Especially available Three effective methods include receptor recognition factors labeled with a detectable label; Using antibody Ab+ labeled with a label or antibody Abt labeled with a detectable label. use These methods are summarized by the following formula, and the asterisk indicates that the particle is labeled. and "RRF" stands for receptor recognition factor.

A, RRF” + Abl = RRF” AblB, RRF + Ab” = RRFA b.

C, RRF+Ab++Abt”=RRFAt)+AV”method and its All applications are well known to those skilled in the art and are therefore used within the scope of the present invention. “ Competitive method, Method A, is US Pat. No. 3.654.090 and US Pat. No. 3.850.75 It is stated in No. 2. Method C1 "Sandwich" method is described in U.S. Patent No. RE 31. No. 006 and No. 4.016.043. In addition, “double antibody” or Other methods are also known, such as the "DASP" method.

In each case, the receptor recognition agent is in complex with one or more antibodies or binding partners. and one portion of the complex is labeled with a detectable label. Formation of a complex Indeed, in some cases the amount can be determined by known methods applicable to the detection of the label. can.

It can be seen from the above that the characteristic property of Abt is that it reacts with Abt. There will be. This is an antigen in which A b + produced in mammalian species produces the antibody Abt. This is because it was used by another species as a. For example, using a rabbit antibody as the antigen Abt occurs in goats. Therefore, Abt is an anti-rabbit antibody raised in goats. Book For purposes of the description and claims, Ab is referred to as - or anti-receptor recognition factor antibody. Abt is commonly referred to as a secondary or anti-Abl antibody.

The most commonly used labels for these experiments include radioactive elements, enzymes, and exposure to ultraviolet light. It is a chemical that emits fluorescence when exposed to sunlight.

A large number of fluorescent substances are known and can be used as labels. These include: Examples include fluorescein, rhodamine and auramine. The specific substance to be detected is , prepared in goat and conjugated with fluorescein by isothiocyanate. The anti-receptor recognition factor or its binding partner may also be a radioactive element or an enzyme. It can also be labeled. Radioactive labels can be detected using commonly used vine counting methods. can. Preferred isotopes are 'Hs'4Cs'Ps'S%'CI,'C rs　Co, 11C:　oSllp　e,　ICY, Its　L　Ill　7 and...Re.

Enzyme labels are similarly effective, and currently used colorimetric, spectrophotometric, and fluorescent It can be detected by spectrophotometry, amperometric methods or gas quantitative methods. The enzyme is Reacts with crosslinking molecules such as carbodiimide, diisocyanate, and glutaraldehyde. is bound to the selected particles by. Many of the methods can be used in these methods. Enzymes are known and can be used. peroxidase, β-glucuronida -ase, β-D-glucosidase, β-D-galactosidase, urease, glucose Cose oxidase, peroxidase and alkaline phosphatase are preferred. stomach. U.S. Patent No. 3.654.090, U.S. Pat. No. 016.043 mentions by way of example the disclosure of other labeling substances and methods. Ru.

The specific analytical system developed and used in accordance with the present invention is a receptor assay. is known. In receptor analysis, the substance to be analyzed must be appropriately labeled. , then certain cell test colonies were inoculated with amounts of both labeled and unlabeled substances. Afterwards, binding experiments are performed to determine the extent to which the labeled substance binds to cell receptors. . In this way, differences in the affinity of the amounts of substances can be confirmed.

Therefore, while purified amounts of receptor recognition factors are radiolabeled, e.g. or mixed with other inhibitors, followed by binding experiments. Next, the sign and Solutions containing various amounts of unlabeled and unbound receptor recognition factor are prepared and then The cell samples are inoculated and then incubated. Then wash the resulting cell monolayer Solubilize and then count in a gamma counter for a sufficient time to obtain a standard error of 5%. . These data are then subjected to Scatchard analysis and subsequently related to substance activity. be able to draw relevant observations and conclusions. As shown in the previous example, the receptor A specific description of the method by which the analysis is performed and utilized, in which case the cellular Binding ability serves as a distinguishing feature.

The analysis useful and contemplated in accordance with the present invention is known as "cis/trans". Ru. In summary, this analysis uses two genetic constructs, one of which is typically A plasmid that constantly expresses the specific receptor in question when transferred into an appropriate cell line. and the other is luciferase-like under the control of receptor/ligand complexes. This is a plasmid that expresses the Una receptor. i.e., the ligand for that receptor If it is desired to evaluate a compound as a one construct that expresses the receptor in one cell line; The promoter linked to the luciferase gene into which the response element for have If the compound under test is an agonist of the receptor, the ligand is The resulting complex binds the response factor and the luciferase gene. Begins transcription of genes. The resulting chemiluminescence was photometrically measured, a dose-response curve was obtained, and the Compare with known ligands. The above protocol is published in U.S. Patent No. 4.981.784. and PCT International Publication No. W088103168. A person skilled in the art will be referred to.

Further embodiments of the invention include commercially available test kits suitable for use by medical professionals. The presence or absence of a specific transcriptional activity or the ability of a specific transcriptional activity in a suspected target cell. It is prepared for use in cooking. According to the test method mentioned above, one set of the kit is less than Also labeled receptor recognition factor or its binding partner 1, e.g. The method used, including its structure and usage, such as “competition,” “sandwich,” “ It is natural that the kit is based on "DASP" etc. The kit contains peripheral ingredients such as buffers and stabilizers. Also includes target reagents.

Therefore, test kits are used to demonstrate the presence or capacity of cells for a given transcriptional activity. Prepared for: (a) A label capable of detecting the present receptor recognition factor or its specific binding partner; at least one immunochemical compound obtained by binding directly or indirectly to predetermined amounts of reaction components; (b) Other reagents: and (c) How to use the kit.

More specifically, diagnostic test kits include: (a) usually an immunosorbent; or suitable droplets or a plurality of end products, etc. attached to a solid phase forming an adhesive ( said receptor recognition factor (or binding partner) bound to each one of said receptor recognition factors (or binding partner). (b) optionally other reagents; and (C) How to use the test kit.

In further embodiments, a predetermined protocol (e.g., "competition", "sandwich") If the test kit is prepared and used for the above-mentioned purpose, operating according to , including: (a) Obtained by coupling a receptor recognition factor to a detectable label. Labeled components: (b) at least one of the reagents is a ligand or an immobilized ligand, the ligand one or more additional immunochemical reagents selected from the group consisting of: (i) Ligand capable of binding to labeling component (a): (ii) binding of labeling component (a); Ligand capable of binding with a partner; (mountain) a small amount of the component to be analyzed a ligand capable of binding at least one; and (iv) at least one of the binding partners of at least one of the components to be analyzed; a ligand capable of binding to the species; and (C) a receptor recognition factor; detecting and/or detecting one or more components of an immunochemical reaction between specific binding partners; How to use the protocol to analyze.

According to the above, effective drugs that may modulate the activity of receptor recognition factors have been identified. An analytical system to be screened is prepared. A receptor recognition factor is introduced into the test system, The expected drug was also introduced into the resulting cell culture and the culture was subsequently tested. Expected effect of addition of drug alone or addition of known receptor recognition factor Changes in cellular transcriptional activity based on

Preliminary research As mentioned above, the observations and conclusions underlying the present invention are based on certain types of research with specific stimuli. This was materialized by examining the results of the research. In particular, the present disclosure describes the IFNαFNα gene. Research results on protein factors that regulate the transcriptional control of This is explained by very recent data on the regulation of genes. What's next , Darnel et al., THE NEW BIOLOGIST, 2(10) (1990) of the role that IFN appears to play in transcriptional stimulation. It's simple logic.

Activation of the gene IFNα occurs within minutes of exposing cells to this factor (Lar ner et al., 1984, 1986), strictly speaking, its receptor, 49-kD blood It depends on IFNα binding to serosal polypeptides (Tlze et al., 1990).

Use of phorbol esters, ionopore calcium or cyclic nucleotide analogs The next change in the intracellular second mesosensor concentration is due to activation of the TFNαFNα gene. (Larner et al., 1984: Lew et al. 989), other polypeptides, even IFN7, were specifically induced by IFNα. does not induce interferon-stimulated genes (ISGs). In addition, Heera Thin IFNγ-dependent transcriptional stimulation of at least one gene in cells and fibroblasts is also strictly depends on receptor-ligand interactions and induces changes in the second message receptor. It has been found that it is not activated (Decker et al.

1989: Lew et al. +989). These highly specific receptors Ligand interactions and accurate transcriptional responses require intracellular recognition of receptor occupancy and synchronization. etc.-specific transmission to the nucleus is required.

Activation of ISO by IFNα is induced by the transcription factor l5GF-3 or interferon. It is carried out with stimulatory gene factor 3. This factor is TFNα, as is transcription itself. After treatment, protein acid synthesis is immediately activated (Larner et al., 1986 : Levy et al.

1988: Levy et al., 1989). 15GF-3 is the response gene DNA 5RE binds to interferon-stimulated response factor Re1ch et al., 1987+ (Levy et al., 1988), this binding has a wide range of effects that also affect the transcriptional function of l5RE. All of the mutations in the range are affected (Kessler et al., 1 988a). Partially purified l5GF-3 free of other DNA binding components can stimulate TSRE-dependent in vitro transcription (Fu et al.

+990). IFN-dependent stimulation of l5Gs occurs in cycles and peaks at 2 hours. reached and then quickly declines (Larner et al., 1986). l5GF-3 also occurs in the same cycle (Levy et al., 1988, 1989). Finally, various The presence or absence of l5GF3 in IFN-sensitive and IFN-resistant cells of (Kessler et al., +988b).

l5GF-3 is divided into two subfractions, l5GF-3α and l5GF-3γ. is found in the cytoplasm before IFN binds to its receptor (Levy et al. .

1989). When cells were treated with IFNα, 15GF-3 decreased within 1 min, i.e., TS GF=3 can be detected in the cytoplasm 3-4 minutes before it is seen in the nucleus (Lev y et al.

1989). The cytoplasmic component 15GF-3γ is heated by pretreatment with IFNγ. However, IFNγ alone does not activate the transcription of TSGs and completely The concentration of the factor 15GF-3 also does not increase (Evy et al., 1990). l5GF- Configure 3! The cytoplasmic localization of proteins that interact with the cell is determined by two types of experiments. It has been proven (to be done).

The cytoplasm of IFNγ-treated cells without l5GF-3 was mixed with the cytoplasm of TFNαFNα follicles. When combined, large amounts of l5GF-3 are formed (Levy et al., 1989) . (Showing the presence of l5GF-3γ and l5GF-3α components of ISGF-3 This was the experiment). Furthermore, Dale et al. (1989) enucleated by cells forming a DNA-binding protein that is probably the same as l5GF-3. It has been shown to respond to IFNα.

The l5GF-3γ component is a 48-kD protein that specifically recognizes TSRE. (Kessler et al., 1990 + Fu et al., 1990). l5GF-3α Three other proteins that probably make up the l5GF-3 DNA complex (Fu et al., 1990).

Although the overall role or relationship of these three proteins is not yet known, l It is clear that 5GF-3 is a multimeric protein complex. TFNα thin Binding to the cell surface converts TSGF-3α from an inactive state to an active state within 1 minute. Therefore, at least one of the proteins constituting TSGF-3α is probably <iF It must be immediately affected by interaction with Nα receptors.

How the l5GF-3γ component and three other proteins interact through cytoplasmic events. There are no details on how it activates, then enters the nucleus, binds the l5RE, and increases transcription. unknown. In addition, experiments with individual proteins, e.g. antibodies, are described herein. shown. For example, within 10 minutes of IFNα treatment, more l5GF was found in the nucleus than in the cytoplasm. -3 and the complete factor is 48-kDISGF-3γ component alone than rSR. It is clear that there is a very high affinity for E. (Kessler et al., 1990) .

In short, interferon-α (IFN-α) is linked to its specific cell surface receptor. When it binds to ``interferon-stimulated genes'', it produces a limit called 15Gs. activate transcription of a defined set of genes [Larner et al., PROC, NAT L, ACAD, SCI.

USA, 81 (1984): LLrner et al., J. BIOL, CHEIJ. , 261 (1986): Friedman et al., CBLL, R8 (1984)]. Substances that affect second messenger levels are associated with these genes. The observation that IFN receptor-initiated cytoplasmic proteins do not activate transcription Protein-protein interactions transmit signals generated by receptor occupancy to the nucleus. [Levy et al., NEW BI OLOG [ST, 2 (+991)].

To test this hypothesis, Applicants began experiments with activated gene nuclei.

l5RE and l5GF-3 were first discovered [Levy et al., GENES & DEV, 2 (1988)].

15GF-3 was partially purified and the purified protein was isolated from a specific DNA-protein. When recovered from the protein complex, the complete complex is made up of four types of proteins. [Pu et al., PROC, NATL, ACAD, SCr, USA , 87 (1990); Kessler et al.

GENES & DEV, 4 (+990)]. 4 called l5GF-3γ Pretreatment of HeLa cells with IFN-γ enhanced the presence of the 8kD protein. Therefore, when used alone, the binding strength of DNA is weak [ibid. BO, J, 9(+990)], IFN-α collectively referred to as l5GF-3α. In combination with activated proteins, l5GF-3γ has a 50-fold higher affinity to form a complex that binds the rSRE [Kessler et al., GENE S & DEV, 4 (1990)]. l5GF 3a protein is +13. Contains a set of polypeptides with 91 and 84 kD. l5GF-3 components are all It is initially located in the cytoplasm of the cell [Levy et al., GENES & DEV, 3 ( +989): Date et al., PROCoNATL, ACAD, SC1,U SA, 86 (1989)]. However, it became active just 5 minutes after IFN-α treatment. A sex complex is found in the cell nucleus that allows for the transfer of occupancy receptors to a limited set of genes. confirming these proteins as possible specific linkages in [Levy et al.

GENES & DEV, 3 (1989.

According to the present invention, a specific protein containing a receptor recognition factor is isolated and sequenced. It has been determined. These proteins, their fragments, antibodies and other constructs and Uses are contemplated and provided herein. Cytoplasmic activation of TSGF-3α protein In order to understand the mechanism of l5GF-37 and its transport to the nucleus and its interaction with l5GF-37, this book The factors were purified in sufficient quantities to obtain peptide sequences from each protein. Coat the peptide construct degenerate deoxyoligonucleotides encoding the cRNA library Combination of leaning and PCR amplification of cDNA products copied from mRNA cDNAs encoding each of the four proteins were identified. all Cloning of the cDNA encoding the protein and resulting from the initial gene 11 Primary sequence of 3kD protein and two separately processed RNA products from separate genes The best possible primary sequences of the 91 and 84 kD proteins that appear to arise from A description of the final protein preparation continues in the examples presented herein.

Antisera against some of the 84 and 91 kD proteins were also prepared. Electrophoretic migration shift analysis using cell extracts that specifically binds to NA-binding factors detected), these cloned proteins are actually part of l5GF-3. It was shown that Due to the availability of cDNAs and the proteins they encode , how the coordinated IFN-α receptor interacts with the l5GF-3 protein complex. Receptor recognition as contemplated herein and for understanding immediate activation The material needed to understand the mechanism of action of the factor was obtained. l5GF3-α protein Cloning of each protein and development of antibodies against the receptor recognition factor of the present invention 91kD Protein and IFN-γ Activation as Methsenger including It is all about evaluating and confirming the specific roles played by DNA-binding proteins according to This is illustrated in the examples below.

Example 1 In order to purify a relatively large amount of l5GF-3, HeLa cell nuclear extract was diluted with 0.5 n g/ml IFN-7 overnight (16-18 hours) and TFN-a (500 u/ml). ml) for 45 minutes. There are four stages used in large-scale purification. The steps described above for the identification of similar 15GF-3 proteins were slightly modified.

Therefore, nuclear extracts were prepared from superinduced HeLa cells [Levy et al., THE EM BO, J, 9 (+990)], phosphocellulose P-11, heparin aga Loin (Sigma); DNA cellulose (Boehringer Mannh eim; After adjusting the material to 0.28M KCl and 0.5% NP-40, flow 15RE oligo affinity column (1.8 ml) Column, linear gradient 0.05-1.0M eluted with KCI); point mutant ■S RE oligonucleotide affinity column (materials in 0.28LI KCl) flow-through was collected after adjustment); and a final round of l5RE oligonucleotides. Column (0, 05-1.OM Na whose material was adjusted to 0.05% NP-40) Chromatography as previously described (eluted with a C1 linear gradient) -treated [Fu et al.

PROC, NATL, ACAD, SC1, USA, 87 (1990)]. Pull Subsequently, the purity of the column fraction containing rsGF-3 was tested by SDS/silver staining. and pooled appropriately. The pooled fractions were transferred to Centricon-10 (Amicon). It was concentrated with Combine the pool fractions of samples 1 and 2, 10 cmg, 1.5 mm thickness The results were run on a 7.5% SDS polyacrylamide gel.

Proteins were dissolved in 12.5% MeOH nitrose in 125 Tris, 190-glycine. Electroplot was performed on Lulose at 20 volts for 12 hours. This film was coated with 0.1% Nso 1. 113kD, 91kD, 84kD and The 48 kD band was excised and subjected to peptide analysis after trypsin digestion [Wedr ychowski et al.

J, BIOL, CHEM, 265 (1990): Aebersold et al. , PROC, NATL, ACAD, SC [, USA, 8S (1987)]. The peptide sequences of the obtained 91kD and 84kD proteins are shown in the figure. 6. Degenerate oligonucleotides based on peptide sequences t19, t13b and +27 Designed Otide = (Forward and reverse complements are indicated by F and R) +9F AACG TIGACCAATI’? JAACATG;TGCT +3bRGTCGATG’1mJGGGTANAG: 27RGTACAAIT CAACCAGNGCAAAAAAAATTGTT The final l5RE oligonucleotide affinity selection resulted in S A material with a DS polyacrylamide gel electrophoresis pattern was obtained. to this gel 1, purified from over 200 liters of properly treated HeLa cells. ．． 5% active substance was shown. The 113.91.84 and 48kD bands are the final The middle gate of the product is clearly noticeable (see Figure 4, right panel), but it is about 118 and 70k. There were also two noticeable contaminants of D and a small amount of other contaminants. [Amino acid sequence The data show that 86kD and 70kD contaminants bind to the KU antigen, which binds DNA ends, and It has been shown that it is a highly distributed protein. However, specific 15G F-3: There is no KU antigen in the l5RE complex, therefore IFN-dependent transcription Not given the role of stimulation [Wedrychowski et al., J. BIO L. CHEM, 265 (1990).

The mobilities of the 113.91.84 and 48 kD proteins are characterized by previous experiments. [F J et al., PROC, NATL, ACAD, SC1, USA, 87 (199 0)], no further purification was performed at this stage. 200 liters of HeLa cells? The entire purified sample was loaded onto a gel, subjected to electrophoresis, transferred to nitrocellulose, and bottled. Stained with Inso Red. +13.84.91 and 48kD protein bands were excised separately and subjected to peptide analysis as described above. PROC, NATL, ACAD, SCI USA, 84 (1987) 1. The released peptides were collected, separated by HPLC, and sequenced by automated Edman degradation analysis. The content was analyzed.

Therefore, three of the four peptides from the 91 kD protein and the 84 kD protein The use of peptide sequence data for single peptides derived from proteins is described here. do. The peptide sequence and oligonucleotide constructed from this are shown in Figure 4 or 6. As shown in the description. To start synthesis from HeLa cell cDNA library Using oligonucleotides 19F and 13bR, a PC with 475 bp An R product was created. When this product is cloned and sequenced, it contains an internal 13a peptide. Coded petit de. Oligonucleotides derived from only available 84kD DNA 27R was used in an immobilized PCR method to amplify a 405 bp segment of DNA.

This 405 bp amplified sequence corresponds to the previously sequenced region of the 91 kD protein. They were the same. Then, the +27 sequence is included within peptide tlQ L91 and 84k It was recognized that protein D must be involved (see Figures 5 & 7).

mRNA prepared 16 hours after IFN-γ treatment and 45 minutes after IFN-α treatment Select candidate cDNA clones from the cDNA library created from For this purpose, oligonucleotides 19F and +3a were also used.

These oligonucleotides and cloned PCR products were hybridized. Among the many cDNA clones, cDNA clone E4 has an in-frame stop code. Contained the largest open reading frame flanked by Don. peptide t19 , t13a and tl, 3b are proteins of 793 amino acids (calculated molecular weight 8 This 2217 bp ORF contained enough to encode 6kD). specified The start methionine codon was three frames before the stop codon. This Cody The binding ability is somewhat shorter than the in vitro produced 91 kD protein mentioned earlier (data (not shown) RNA of the E4 clone yielding a product with a nominal size of 86 kD. Confirmed by in vitro translation of copies. Perhaps this result is due to the fact that cells This figure shows post-translational modifications of proteins.

A second clone was also identified (see Figure 5). The primordial type of this type is E4's 5 ’ end to bp2286 (each 701), which is the point where the sequence completely diverges. It was. Both cDNAs terminated with poly(A) tails. By primer extension analysis , another ~150 bp was shown to be missing from both 5' ends to the mRNA. .

DNA probes have both common and unique sequences useful for Northern blot analysis. Created from clones shown in columns. Preparation of the probe is as follows: IFN-α Treatment (6 hours) 20 μm of cytoplasmic RNA of HeLa RNA (dissolved in 0.5% NP-40) solution) in 1% agarose, 6% formaldehyde gel (20 cocoon MOPS, 5mM NaAc.

ImEDTA, pH 7.0) at 125 volts for 4.5 hours. RNA Transferred to Hybond-N (Amersham) at 20xssc, UV crosslinked, l Use the specified probe (1.5X 10”cpm/■) of X 106cpm/ml. and formed a hybrid.

Probes from the region common to E3 and E4 cover approximately 3, IKB and 4.4KB. hybridized to various RNAs. E4's 3' non-component which is unique to E4. Several types of probes derived from the coding end detect only larger RNA species. Ibrid formed. Labeled DNA from the unique 3' non-coding end of E3 The probe hybridized only to smaller RNA species.

Reexamining the sequence of the 3° discontinuous site between E3 and E4 reveals that the short mRNA is either E3 or E4. 3′ xenozyme starting with a different poly(A) site and bp2286fJ calculated molecular weight) It was shown that this results from the selection of The last two nuclei before changing Otide is the E3 of the line that contains the common nucleotide of exon-intron junction. GT, then GT. The E4 ORF extends to bp2401. It encodes a protein that is 38 amino acids longer than that encoded by E3. but otherwise identical (ORF is 82kD).

Since there is no direct analysis of the activity of the 91 or 84 kD proteins, we isolated c. DNA clone actually encodes a protein that is part of l5GF-3 An independent method was needed to determine whether this was the case. For this reason, amino acid 597 This peptide was added to a bacterial fusion protein for the sequence from amino acid 703 (see Figure 6). By expressing the protein in the pGEX-3X vector (15), the anti-inflammatory A body arose. This antiserum (a42) detected both 91kD and 84kD proteins. ISC; F-3 was purified (see Figure 7a). even more important Notably, this antiserum was tested for migration shift analysis using labeled 15RE oligonucleotides. (see Figure 7b), the isolated 91k D and 84kD cDNA clones (E4 and E3) represent components of ISC;F-3. It was confirmed that Additionally, the antiserum is directed against the amino terminus of the E4-encoded protein. and the carboxy terminus. The amino terminal 59 amino acids common to both proteins Unique carboxy-terminal 3 encoded only by amino acids and larger mRNAs 4 amino acids were developed as a fusion protein in pGEX-3X for rabbit immunization. It appeared. Western blot analysis using highly purified l5GF-3 revealed that the expected As shown, the amino-terminal antibody (a55) was used to detect both 91kD and 84kD proteins. showed that they were aware of the However, the other antibody (a57) is a 91kD protein. Recognizes only proteins, larger mRNA (4.4KB) and larger c The DNA encodes a 91kD protein, with smaller mRNA (3.1KB) and We confirmed the hypothesis that the 84-kD protein encodes an 84-kD protein (see Figure 7a). (see).

Example 2 In this example, a 113kD protein containing one of the three components of l5GF-3α was used. Disclose quality cloning.

A 113kD band was identified and excised from the SDS gel of highly purified l5GF-3. and subjected to cleavage and peptide sequence analysis [Aebersold et al., PROC, NATL, ACAD.

SC1, USA, 87 (1987)]. Obtained 55 peptide sequences (A-E) (Figure 8A). These pairs are radiolabeled with degenerate oligonucleotide probes. Human cD of a clone designed according to the peptide and encoding a +13 kD protein. I searched the NA library. 2.5 using a probe derived from peptide E Eighteen positive cDNA clones were recovered from X10' phage plaques (Fig. 8A and explanation). Two of these have been completely sequenced. clone fil contains 3.2KB cDNA, and clone ka31 has approximately 2KB overlap. contains a 2.6 KB cDNA with an extended 5' end and a candidate AU. The G initiation codon was found to be associated with a well-conserved Kozak sequence [K ozak, NUCLE■CACrDS RES,.

12 (1984)].

In addition to phage cDNA clones, oligonucleotides encoding peptides D and E When sequenced, the PCR product generated between the octides will reveal the cDNA clone of this region. This resulted in a 474NT fragment that was identical to the 474NT fragment. These clones fil and ka The 31 combinations are oligonucleotides that can encode a polypeptide of 851 amino acids. The open reading frame is shown (Fig. 8A). Over these two clones -rap region, and the RNA transcribed from this recombinant clone in vitro. A polypeptide that migrates in an SDS gel that has a nominal molecular weight of 105 kD is translated into (Fig. 9A). A suitable clone encoding a 91 kD protein is also transcribed, RNA was translated in a similar experiment. 113kD protein and 91kD protein If both of the complete cDNA clones are translated into protein, the appearance of l5G Create an RNA that migrates somewhat faster than the purified protein as the F-3 component Therefore, the protein undergoes post-translational modification within the cell and is slightly delayed during electrophoresis. It is possible. 660, which encodes the 3' end of the bulk of the 113 kD protein. When bpc DNA was used for Northern analysis, a single species of 4.8KB mRNA was obtained. was observed (Fig. 9B).

+13kD (or indeed l5GF-3α protein) Although the analysis is unknown, this protein is detected by electrophoretic mobility shift analysis. It is known that it is part of a DNA binding complex that can be used [Fu et al., PR D.C.

NATL, ACAD, SC1, USA, 87 (1990)]. DNA binding It has already been shown that antibodies against proteins affect the formation or movement of such complexes. It is knowledge. Therefore, a polypeptide segment fused to bacterial glutathione synthase Antiserum against (amino acid residues 323-527) [Smlth et al., PROC , NATL, ACAD, SC1, USA, 83 (June 1986 turned into a rabbit) This occurred and the reactivity between the 15GF-3 protein and the antibody was determined. western plot TSG purified by specific DNA affinity chromatography In both the F3 fraction (lane 1) and the crude cell extract (lane 2, Figure 10A). It was shown that the antiserum reacted primarily with the 113kD protein.

The weak reactivity that reduces the protein band is probably due to <113 kD proteolytic degradation. It was due to Most importantly, the antiserum contains most of the gel-shifted complexes. All oligonucleotide probes of the shifted Sifubi complex were removed. 50 moles of the oligonucleotide binding site (TSRE, see 2) of l5GF3. (Fig. 10B). In particular, this antiserum is l5GF3-γ The component alone did not affect the fast moving shift band that occurred (Figure 10B). That is, The antiserum against the 113kd fusion product is a separate part of the complete 15GF-3 complex. It has been discovered that it actually reacts with the proteins of

A detailed sequence comparison between the 113 and 91 sequences was performed (Figure 8B): Nucleotide sequences showed only a distant relationship between the two proteins, but long stretches of the same amino acid there were. These conserved regions represent the full-length 715 amino acids encoded by the 91/84 clone. Most of the amino acids were scattered. Amino acids 1-48 and 317-35 of the 113 sequence The regions corresponding to 3 and 654 to 678 are 60 to 70% the corresponding region of the 91 kD sequence. The identity was particularly surprising. i.e. 113 and 84/91 tan The genes encoding proteins are closely related but not identical.

Examination of possible consensus sequences representing subdomains of the 113kD or 84/91kD sequences The sequence of both proteins forms a coiled structure with 7 leucine repeats. It was found that the area includes areas where This is the amino acid 2 of the 113kD protein. occurred at amino acids 209-237 of the 10-245 and 84/91 kD proteins. . For both the 113kD and 91/84kD sequences, 4 out of 5 heptad repeats are leucine. One was valine. This type of domain is found in some other transcription factors. Generates a protein surface that promotes homotypic or heterotypic protein interactions [Vinson et al., 5 CIENCE, 246 (1989)), extended acidic The domain is located at the carboxyl terminus of a 113kD protein and a 91kD protein. (Fig. 8A), and the 113 kD protein is probably involved in gene activation. [Hope et al., Ma et al.

CELL, 48 (1987)].

Consider Compare with scene banks and IMBL databases at medium or high stringency. When compared, there were no 113-like sequences or 84/91 sequences. however, Preliminary experiments have shown that different sequences can be recovered from human cell cDNA libraries. It has been shown that there are parts of other families with (Qureshi, Da rnell unpublished).

That is, the 113 and 84/91 sequences were cloned from a large protein family. This appears to indicate the first two parts that should be included. 113kD and 84/91 IFNα coordinated by kD protein acting as a signal transducer interacts with the internal domain of the receptor or its associated protein, and further Cells that become specific signal transducers when their receptors are occupied It is hypothesized that there are families waiting for quality proteins. This general hypothesis There are many experiments before it can be definitively tested. Recent experiments have shown that protein Kinase inhibitors can prevent l5GF-3 complex formulation is shown [Re1ch et al., PROC, NATL, ACAD, SC1 , USA, 87 (+990): Kessler et al.

J, BIOL, CHEM, 266(199+)). However, until now Both the previously cloned IFNα and TFNγ receptors are kinase-specific. IUze et al., which has no activity.

CELL, 60 (+990) + Aguet et al., CELL, 55 (198 8)], a second receptor chain with kinase activity also binds to the coordinated receptor. A distinct kinase also transmits a signal to the l5GF-3α protein on the inner surface of the plasma membrane. It is presumed that it is part of a complex that reaches

From the above, the exact sequence of the l5GF-3 protein component has been determined, and ■5G The correct cDNA clone encoding the 113.91 and 84 kD components of F-3 It was concluded that the identification results. Staurosporine, a broadly effective kinase [R e1ch et al., PROC, NATL, ACAD, SC1, USA, 87 (19 90); Kessler et al., J. BIOL.

CH Saka, 266 (1991)], l5GF-3α protein is a coordinated receptor. It seems possible that the protein may be a direct cytoplasmic substrate of protein-related kinases. these The antiserum against the protein was used to detect the 15GF-3α protein before and after IFN treatment. important in identifying the condition and the activation of signal transduction from IFN receptors. You can explore science directly.

Example 3 As mentioned above, the observations and conclusions underlying the present invention are based on certain studies with specific stimuli. This was made concrete by considering the results of the above. In particular, the present disclosure describes IFNα-stimulated gene transcription. Research results on protein factors that control transcriptional regulation and genes stimulated by IFNγ. This is illustrated by very recent data on the transcriptional regulation of genes.

For example, when IFNγ is the ligand, the 91 kD protein is a tyrosine kinase. There is evidence that he is a target. That is, two types act by two different types of receptors. Different classes of ligands both use parts of these families. a reasonable number of From the use of milliparts and combinations depending on different ligands, this protein protein The family is a general link between ligand-occupied receptors and transcriptional regulation of specific genes in the nucleus. May represent a chain.

Furthermore, from experiments with the 113.9I and 84kD proteins of the present invention, it was found that cellular IFNα was found to be phosphorylated in response to treatment with (Fig. 11). Additionally, phosphor When amino acids are combined with newly phosphorylated proteins, the amino acids are tyrosine. (Figure 12). This phosphorylation was observed to disappear after several hours, and 113.91 and 84kD protein phosphatases that stop transcription. did. These results demonstrate that IFN-dependent transcription critically requires this specific phosphorylation. The interferon-dependent phosphorylation-hypothetical phosphorylation cycle These results indicate that the protein is involved in regulating transcription.

Other parts of the 113-91 protein family are phosphorylated in response to other ligands. It is proposed to be identified as a target. Chiro on this family of proteins If synphosphorylation sites are thought to be conserved, a portion of the family may be activated. Similarly, some members of the family respond to their extracellular polypeptides by being phosphorylated (phosphorylated). The tide ligand is easily determined. Modify these proteins (phosphorylation and de-phosphorylation) phosphorylation) enhances or blocks intracellular responses to various polypeptides It is possible to prepare and use assays to determine the effectiveness of drugs when contemplated within the scope of the invention.

Example 4 In previous experiments, an IF called GAF by exonuclease protection analysis An N-γ-dependent site-specific DNA-binding protein has been identified [γ-activator (10)]. The DNA site where this complex is specifically formed was called GAS ( 10.14). Therefore, NA-tan has the same characteristics as GAF and is electrophoretically stable. Very convenient electrophoretic migration of proteins that can form protein complexes Identified in fibroblasts by Schiff l-analysis (16X Figure 13). gel shift The complex was induced in 15 min by TFN-γ but not by TFN-α (Fig. 138, lanes 1-3), GAS oligonucleotide specifically competes with IFN -α response site, TSRE (3), does not compete (Fig. 13A, lanes 5-6 ).

Fast IFN-γ-dependent activation of this factor occurs without new protein synthesis (Figures 13B and 13C). This DNA binding activity occurs within minutes of IFN-γ treatment. The fibers lasted up to 15-30 minutes and then disappeared after 2-3 hours (Figure 13C). It is related to the process of TFN-γ induction of the GBP gene in blast cells. In other words, electricity Factors analyzed by pneumophoretic mobility shift analysis were analyzed using exonuclease III analysis. It exhibits similar behavior to previously described factors. Therefore, a gel shift occurs. The factor is called GAF (gamma activator).

To test the size of proteins that contact GAF DNA, proteins were An experiment was conducted to crosslink GAS oligonucleotides. N$dUTP substitution”P label GAS oligonucleotides were mixed with an extract of fibroblasts treated with IFN-γ. Ta. After identifying the DNA complex by gel retardation and autoradiography, the gel was It was exposed to UV irradiation. Cut out the GAF shift band and apply it to SDS gel electrophoresis. Ta. A single band migrating at 97 kD was observed. Therefore, the oligonucleotide -Proteins of protein complex range ~90kD, l5GF-3 protein (7.12).

IFN-α and IFN-γ induce factors that recognize different DNA binding sites. Although it is known that both ligands produce an antiviral state and suppress cell proliferation, , both induce some overlapping genes (2.17). Therefore, antiserum (12) of the TSGF-3α protein (113.91 activated by IFN-α) and 84 kD protein) and 91 kD protein With the knowledge that it is possible to visualize the binding to the site (Figure 14A), the GAF genome Possible effects of antiserum on 113kD and 91kD proteins on protein shift (FIG. 14B). Two blood cells for the 91kD protein segment (1 type or 15GF-3 for +2L amino acids 597-703) A second antibody that recognizes the 91 and 84 kD protein components and is directed against the terminal 36 amino acids. is present in the 91-kD protein but not in the 84-kD protein (12).

Furthermore, antisera against 48 and 113 kD proteins are also effective.

When a specific GAF gel shift complex was tested, the central region of the 91 kD protein The antiserum against it produced a very delayed (“supershifted”) band, 84 kD Serum against the carboxyl terminus of the 91kD protein, which does not recognize the protein, is Blocked the formation of IFN-γ specific gel shift complexes (Figure 14B, lanes 3-6) .

This gel-shifted complex was combined with antisera against 113kD or 48kD proteins. (data not shown). All these experiments are 9 A 1kD protein contacts DNA and participates in the GAF gel shift complex. 5GF-3 protein has been shown not to.

In order to further confirm the proteins in the IFN-γ-dependent gel shift complex, we It was subjected to one-step purification by adsorption onto tinylated GAS oligonucleotides (18).

To directly identify the size of proteins in the GAF gel shift complex, we The purified fractions were analyzed by two-dimensional gel mobility shift-3DS electrophoresis. DNA A binding reaction is performed using a 2'P-labeled oligonucleotide and an unlabeled protein, GAF complexes were precipitated using a mobile shift gel (16) (Figure 140). G.A.F. Confirm band position by autoradiography and rotate gel lane 90'. The cells were subjected to SDS acrylamide gel electrophoresis. SDS polyacrylamide gel After gel electrophoresis, the gel was electroplotted onto nitrocellulose and the component protein Proteins were analyzed using immunoplot analysis (ECL kit) using antiserum against 91 kD protein. (Amersham).

The 91kD protein was actually synthesized by an antiserum specific for the 91kD protein. It was found that it was detected in the ft complex. 113kD or 48kD protein Reprobing a similar plot using antiserum against the GAF-shifted complex (data not shown). In this experiment, the first The DNA binding reaction of No gel-shifted complexes were observed without leotide, and immunoreactive proteins were Gel shift of parallel samples performed without binding sites not recovered from the complex position Ta.

In an attempt to identify other proteins in the GAF complex, cells were The extract was prepared w4 and biotinylated G as described in Figure 14C. Affinity mvi was carried out using the heS oligonucleotide. Then biochi The 363-labeled protein eluted from the nylated oligonucleotide complex was labeled with S″P. Unlabeled proteins used in gel shift reactions containing labeled GAS oligonucleotides Locate the GAF band by autoradiography as previously done in the determined (Fig. 14D). A similar reaction is involved in the binding reaction that blocks GAF complex formation. was carried out using an antiserum against the 91 kD protein, and two reactions were run in parallel. analyzed. After determining the position of the GAF complex, place the two gellets as before. 906 rotations and a second SDS gel electrophoresis to separate individual proteins by size. was separated.

Autoradiography revealed that a large number of 18-labeled proteins were found in gel-shifted complexes. One clearly labeled protein recovered from both gel lanes not located at Only the 91 kD protein was present in the region of specific gel shift. Furthermore, 91kD anti- If processing by the body occurs through complex formation, the 91 kD protein would not be present. It was (in that position). 113.8 or 48kD protein or indeed any other specific The constant protein is present in the GAF complex in an almost stoichiometric amount with the 91 kD protein. If the treated cells were labeled for 14 hours, they should be visible. do not have. Detected only if protein is absent or methionine content is very low. I couldn't. That is, the experiment in FIG. 13 involved UV irradiation of the GAF oligonucleotide. The 91 kD protein, which is more cross-linkable, is the only protein in the GAF complex. It supports the following.

Example 7 After IFN-γ treatment, a fluorescent antibody test was used to transfer the 91 kD protein to the crosspiece. We tested the cellular localization of 113.91 and 84 kD proteins after FN-γ treatment. (Figure 15). Antiserum against the 113kD protein had no reaction in the nucleus. Universal cell fluorescence remained unchanged after IFN-γ treatment (FIG. 14CS 14D). anti In contrast, the C0OH-terminal amino acid of the 91kD protein that is not included in the 84kD protein Antisera specific for amino acids showed strong nucleoplasmic light within minutes of IFN-γ treatment (Fig. 1 5A, 15B).

That is, 91kD but not 13kD translocates to the nucleus immediately after IFN-γ treatment. , all three proteins 113.91 and 84 were transferred to the frame after IFN-α treatment. (12.15). 84kD protein contained entirely within a 91kD protein Is the 84kD protein involved in IFN-α activation without specific antiserum? Although it is not possible to determine whether the antiserum is No protein was seen in GAF.

Example 8 Evidence of phosphorylation in activation of 91-kD protein 91 after IFN-γ treatment Carefully examine the types of changes in the kD protein and the movement of the 91kD protein before and after treatment. It was recommended to test by analysis. First, by Western plot, IFN-γ treatment resulted in a slow migrating form of the 91 kD protein by SDS gel electrophoresis. However, only the fast-migrating form was observed in the untreated extract ( Figure 16A). The presence of a slow migrating form of the 91 kD protein is parallel to time and G The presence of AF DNA binding activity (Figures 16A and 13C) was maximal at 15 minutes of treatment. , disappeared after 2 hours of treatment. Only slow migrating forms detected in affinity purified fractions showed that only slow-moving proteins have high DNA-binding affinity (Fig. 16B).

Phosphorylation results in slow electrophoretic migration, thus rendering affinity-purified GAF into calves. After treatment with intestinal phosphatase and electrophoresing the samples, the 91 kD protein was Analyzed by Estan plot (Fig. 16B). Slowly migrating forms are treated with phosphatases. It was converted into a faster mode of movement by science. Finally, a 91 kD protein (15, 19, Stauros, a protein kinase that blocks IFN-α-dependent phosphorylation of 20) Inhibitors of porins were found to block IFN-γ induced phosphorylation. Ho Both sphatase treatment and staurosporine can block GAF DNA binding activity. It was found that (Fig. 16C). These data are based on slower movement modes or GAF activity. This supports the fact that it is a sex type. In addition, staurosporine-like H7 (8), Another kinase inhibitor can block IFN-γ-dependent transcription of the GBP gene. was found (data not shown).

Next, a direct examination of TFN-γ-dependent phosphorylation of the 91 kD protein was performed. cell was labeled with “PO,” and treated with IFN-γ. An extract was prepared, and the 91kD antiserum The immunoprecipitates were analyzed by 5DSPAGE (Fig. 17A). Actually 91k There was IFN-γ-dependent Up labeling of the D antiserum precipitable band. stp sign van The electrophoretic migration of the "S-labeled 91kD immunoprecipitate corresponds to the slow-migrating form of the untreated The bands from the rational cells corresponded to fast migrating forms.

The Up-labeled band was collected and cleaved with thermolysin treatment under conditions to obtain small peptides. . Both portions of each sample were used for phosphoamino acid analysis. Phosphotyrosine in untreated cells However, phosphotyrosine strongly labels IFN-γ-treated cells. (Figure 17B). A similar analysis was performed at 113 kD and the phosphotyrosine was mediated by IFN-γ. (data not shown).

To further confirm the phosphorylation of the 91 kD protein, two of the thermolysin digests were Dimensional peptide mapping was performed. One non-specific species detected only in IFN-γ-treated cells. Always highly labeled phosphopeptide, X and detected in both treated and untreated cells Three highly unlabeled labeled phosphopeptides, a, b and C, were recognized. (Fig. 18A, 18E). Elute each phosphopeptide and analyze phosphoamino acids Served. Only phosphotyrosine was detected in peptide X, peptides a, b and C was found to contain only phosphoserine.

To confirm that tyrosine phosphorylation is a cytoplasmic event, the 91 kD protein Cells were immunoprecipitated from cytoplasmic extracts with IFN-γ for just 3 minutes. Peptide X Thermolysin peptide mapping of the cytoplasmic fraction containing similar phosphotyrosines (Fig. 18D). Staurosporine, protein kinase inhibitor was found to block IFN-γ-induced phosphorylation of a 91-kD protein. (Figure 17A). Peptide mapping reveals that IFN-γ-dependent tyrosine phosphates It was shown to be specific for peptide Stauros Considering the fact that porin blocks GAF DNA binding activity, the 91kD protein IFN-γ-induced tyrosine phosphorylation of proteins involves binding of proteins to GAS sequences. It is also necessary to activate transcription.

Thoughts and observations As mentioned above, the observations and conclusions underlying the present invention are that certain stimulation This became clear from the consideration of the research results. In particular, this disclosure describes IFN-α Research results on protein factors that govern the transcriptional control of stimulated genes, and IF This is explained by more recent data on the regulation of N-γ-stimulated gene transcription. It will be revealed.

For example, the above points indicate that when IFN-γ is the ligand, the 91kD protein Evidence that it is a tyrosine kinase target. Thus, two different receipts Both of the two different ligands that act through these family members - Use. Only a small number of family members can be treated with different ligands. When used in combination accordingly, this family of proteins can act as a ligand-occupied receptor. Possibility of a rough link between transcriptional regulation of specific genes in the nucleus Or expensive.

Other members of the 113-91 protein family correspond to other ligands. It is thought that it is identified as a phosphorylation target. If you think about it, this family Tyrosine phosphorylation sites on proteins are conserved and which family members are active. It is possible to easily check whether it is phosphorylated or not, and the Easily identify specific extracellular polypeptide ligands supported by Milly members can do. By modifying these proteins (phosphorylation and dephosphorylation) , the effect of drugs in enhancing or blocking intracellular responses to various polypeptides. It becomes possible to create and use analytical methods to confirm Therefore, such an analytical method are intended to be within the scope of the present invention.

Previous studies showed that DNA-binding proteins became active in the cytoplasm in response to IFN-γ treatment. sexualization tag and concluded that this protein stimulates transcription of the GBP gene ( 10.14). In this study, we first investigated this in conjunction with IFN-α gene stimulation. 91kDISGF using antiserum against the protein (7, 12, 15) -3 protein was further assigned a prominent role in IFN-γ gene stimulation. . The rationale for this conclusion includes: 1) Antiserum specific for the 91kD protein 2) that the 91 kD protein affected the G-dependent gel shift complex; AS was able to cross-link to the IFN-γ activation site, 3) 1S-labeled 91kD protein protein and a 91 kD immunoreactive protein were specifically purified with this gel shift complex. 4) The 91kD protein actually responded to TFN-α first. is a proven IFN-γ-dependent tyrosine kinase substrate (15), 5) 1 The 91kD protein, but not the 13kD protein, is released into the nucleus in response to IFN-γ treatment. This includes moving to In both of these experiments, the same 91 kD protein was , different DNA-binding complexes triggered by either IFN-α or IFN-γ. Although this does not prove that they behave differently within a coalescence, it strongly suggests that Ru.

These results demonstrate that polypeptide cell-surface receptors may be inhibited by extracellular ligands. occupancy to latent cytoplasmic proteins that, after activation, translocate to the nucleus and trigger transcription. The hypothesis (4, 15, 21) derived from research on IFN-α is that I strongly support it. Furthermore, cytoplasmic phosphorylation and factor activation are fairly rapid; The functional receptor complex appears to contain tyrosine kinase activity.

IFN-γ cloned so far] Nocebuter! 1 (22) is a unique key It is probably a tyrosine kinase, as there is no slight indication that it has any enzyme activity. Some other molecules with activity may be bound to the IFN-γ receptor. cormorant.

Two recent results with other receptors are similar to the situation with this IFN receptor. This suggests that there is something that can be done. Contains an intracellular tyrosine kinase domain The trk protein activates the NGF receptor when its receptor is occupied. (23). In addition, members of the src family of tyrosine kinases The lck protein coprecipitates with T cell receptors (24). these two Induction of signals into the nucleus by receptors forms part of the activated transcription factors It is possible to speculate that it requires a latent cytosolic substrate. Anyway, if Kinase-like trk or l associated with N-γ receptor or TFN-α receptor It seems possible that ck exists.

Regarding the effect of phosphorylation on the 91kD protein, the 91kD It was a little surprising that a protein could become a DNA-binding protein.

Its role should differ depending on the IFN-α treatment. There, it is Ciro Conjugation of a complex that is highly phosphorylated with 113 and 84 kD proteins However, as determined by UV cross-linking studies (7), the 91 kD protein is not in contact with DNA.

In addition to being a DNA-binding protein, the 91-kD protein also stimulates IFN-γ. It is clear that it moves specifically to the nucleus according to the intensity. This study focused on the 91kD protein. Proteins are strongly associated with the immediate IFN-γ transcriptional response of the GBP gene. However, the following two points should also be made clear. The fourth point is that the 91kD protein It is unknown whether it acts on its own to activate transcription. Second The point is how broad (used) the 91kD protein is in the immediate IFN-γ transcriptional response. The problem is that I don't know how well I'm doing. Synthesizing new proteins However, only a few genes that are immediately activated by IFN-γ have been studied.

At present, it is unclear whether the activation of these genes operates through the 91kD binding site. It is unknown.

Is the model in which the 91kD protein recognizes the ligand-coordination receptor correct? To clarify the binding to membrane-bound receptor complexes and/or Evidence of phosphorylation by the tar complex is required. For that purpose, TFN-γ Efforts are underway to test this proposal by preparing antibodies against the receptor chain. It's here. It is unlikely that any potential substrate molecule will remain at the activation site for long. Therefore, it is unlikely that most of the 91kD protein binds to the receptor complex at any time. Unthinkable. As will be clearly confirmed from now on, the 91kD protein contains The membrane-bound kinase activity active at certain critical sites is the most likely explanation for the validity of this proposal. I hope it will be shown soon.

Below is a list of references related to the above disclosure, particularly experimental procedures and discussions. It's a strike. These references are numbered to match the reference numbers listed above. It is attached.

1. Larner (A, C,), Jonak (G,) , Cheng, Y, S, Korant, B, Na Knight, E. and Darnell, J.

E, Jr.) (+984), Proc, Natl, Acad, S ci, Mouth SA 81:6733-6737, Lerner, Chau dhuri, A.) and Darnell (1986), J., Biol, Che. m, 261:453-459゜ 2. Friedman, R, L, Manly , S, P, ), McMahon, M, Kerr, 1. M, ) and Stark, G, R, (1984).

Ce1l 38 near 45-755° 3. Levy (D, E,), Kessler (D, S, ), Pine (R,), Reich (N,) and Darnell (1988), Genes & Dev, 2:383-392゜4゜Levy, Kestu, Pine, and Darnell (1989). Genes & Dev, 3: 1362-1371゜5 Dale, T, C, Imn, A, IJ, A.) Kerr and Stark.

G, R,) (1989), Proe, Natl, Acad, Sci. 86:1203-1207゜6, Veals, S. A,), Two (Fu, X, -Y,) and Levy.

(+990), Genes & Dev, 4:1753-1765゜7　tsu -, Kesutsu, Veals, Levy and Darnell (+990), Proc, Natl.

Acad, Sci, USA 87:8555-8559゜8, Lew , D., J.), Decker, T., and Darnell (1989). , Mo1. Ce11, Biol, 9:5404-5411゜9, Detsuka -, Lu, Cheno, Levy and Darnell (1989), EMBOJ, 8:2 009-2014゜ 10. Detska, Lu, Markovitch (J.) and D. Nell, 1991゜EMBOJ, 10/927-932゜11, Virus , Schindler, C.W., Leo nard.

D.), Darnell and Levy (1992), Mo1. Ce11. Biol , +2. Printing in progress.

12, Schindler, 2, Improta (T,), Eber Aebersold, R. and Darnell (1992), Proe , Natl, Acad, Sci, USA 89° Now in print.

13, Zu, Schindler, Imbrota, Ebersold, and Darnell (199 2).

Proc, Natl, Acad, Sci, USA 89. Printing in progress.

14, Lu, Detsuka and Darnell (1991), 1Jo1. Ce11.　 Biol, 11:182-191.

15, Schindler, Shuai (K.), 2, Brezioso (Pr. Ezioso, V.) and Darnell (1992), 5science 257 :809-812゜16, Garner (M, M,) and Leban ( Revan, A, (+981), Nuc, Ac1ds Res.

9:3047-3059; Fried (A.) and Crothers ( Crothers, D. M.) (1981) Reference 6505-6525゜1 7. Celis, J, ε, Justessen, J,), Madsan Qladsun, P, S,), Lovmant , J,), Ratz, G, P, and Celis, A, ) (1987), Leukemia I:800-813゜18, Chodott Chodosh (L, A,), Carthe x - (Carthew, R, W, ) and Sharp, P, A, (1986), Mo1.　 Ce11. Biol, 6:4723-4733゜19, Like and Pheno7 - (Pfeffer, L, M,) (1990), Proc, Nat l, Acad, Sci.

USA 87:8761-8765゜ 20, Kesutu and Levy (1991), J. Biol, Chea 26 6:23471-23476゜21, Levy and Darnell (1990), Th e New Biologist 2:923-928゜Agu et, J, M, ), Denbie, Z, and Me. rl in.

G, (1986), Ce1l 55:273-280゜23, Kablan (K aplan, D, R,), Martin-Zanea, D.) and Parada, L.P. (1991), Natu re 350:158-160: Hempstead (G ), Kablan, Martin-Zanka, Barak and Chao.

M,) (199+), Nature 350:67g-683°24, base 1ノ=t)・(Veillette, A,), Bookman , M, A. ), Horak, E, M, and Bo [en, J, B,) (1988). Ce1l　55:301-308　；→ Rudd, D., E., et al. (1988), Proe, Natl., A. ead, Sci, USA 85:5190-5194゜ 5 Evans, R., Johnson, J. , D.) and Haley.

B, E, ) (1986), Proc, Natl, Acad, Sci. IJSA 83:5382-5386゜26 Wa [aas, S, [,) and Najffl, A, C, (1989), J, o f Mol.

Neurosei, i:117-127゜The present invention May be embodied in other forms or carried out in other ways without departing from the characteristics can. Accordingly, this disclosure is expressed in all respects by the appended claims. The purpose of this disclosure is to provide a detailed explanation of the invention, and is not intended to be limiting. All changes that come within the meaning and range of equivalence are considered to be included in the invention.

FIG, Ia t name = rb FIG, 1b ays phe arg tyt lys ile gin ala lys gly lys thr pro 5arleuTGCTTCCGA TAT hehe G ^TCC8c heccc hehehe 〇GG hehe 5G 8CA CCC ding (T e Tct show:,’ name: rb FIG, Ic h,, as,, b F IG, 1d val pro glu pro ttsp CJin g]y pl’o V AI Scr l1ln pl’o va3 pro gl■ G’rG CCA CAG CCA G to CGA8 C; GA CCT GT8 TCA CAG CCA GTG CCA GAGFIG, Ie Session name: “b CTCCTCAT 8 GCATGA 8 TTGTTC CC 8 8 GG 8 TG 8 8 to C8 GG to TC to GTCCCTTC8^GCTGT to CCTCCCCCC AT 88 AA1’G to CCTGCCMTCT 8888888 he he he he he he fart to CGTGCTGTGCGTAGCTGCTCCTTTGGTTG to TCCC To CAGGCCCTTGTTGGGGAC 2b tshiq: z name + rb FIG. 2C 600 (+10, QATACAATTA? ATC8CTCCTCTTTTCAAAGGT8GCCA TC8TGGATCTGGTAGGGGG8AAAFIG. 2e rGCTTTCATCTTGGTCACATACAATTATTrTTTACAG 'rTCTCCC88GGGAGTT71GGC7ATT(8(88CCACT CATTC8888GTTG88. ATT88CCATAGATGcho8G8T8 88CTC8G8A^TTT8ATTC8TGTTTCTT888TGGGCT 8CTTTGTCCT1'TTGTT8TT8GGGTGGTATTTAGT CTATCT(;(8T8TGTTTCGC dingGATAT8TGTGTTTT C71C7iTrTGCG88TGGTTCCATTCTCTCTCCTCT8 CTTTTTCCAGACACTTTTTTG8GTGG8TGATGTTTC GTG88GTAT8CTGT8TTTT8CCTTTTTCCTTCCTT ATCACTG8CAC88888GTAGATT88GAGATGGGTTT GAC 88GGTTCTTCCCTTTTAC 88CTGCTGTCTATG TGGCTGT8TCTTGTTTTTTCCACTACTGCTAC translated Molecular weight -86058. 72FIG. 3a GCCGAGCCCCTCCGCAGACTCTGCGCCGGAAAGT? ’ ? CATT7GCTGTATGCCATCCTCG8GA(;CTC;TCTA GGTTAACGTTCGCACTC'rGTGTiATAACC'TICGA CAGTC DingTGGCACCTh8C common? GCTGTGCGτ8GCTGC’r CC7TTGGTrGAA'rCCCCAGGCCCTTGTT(;GGGCA C enter eight GGasp l@u l*u ser gin l@u asp asp gin tyr ser arg pha ser leuGAC CTC CTG TC8 CAG CTG G^τ GAT C8ATA 8GT C GC τ-T TCT TTG Seshi-N name...b FIG. 3b mat pro thr his pto gin arg pro leu val leu lys jhr gly val ATG CCA ACG C AC CCT CAG AGG CCG CTG G-C TTG 8AG A CA GGG GTCt, *:z@, :rl) F IG.　3cIys　 asn pha pro pha trp leu trp ile glu mer ile leu glu leu 8 AA A 8 T Ding TT CCC T TC TGG CTT TGG ATT GAA ACC ATC CTA G AA CTCFIG. 3d AC8G88GAGTG71C8GOGTTT8CA88CCTC88GCC8G CCTTGCTCCTGGCTCGGGCCTGTTG88G71T(;CTT GT8TTTT8CTTTTCCATTGT88TTGCTATCGCC8choC ACAGCTG88CTTGTTGAG8TCCC’CGTGTT8CchoGCC T8TC8GC8TTTT8CT8CTTT888888888888AA8 GCC88888CC888TTTGTA1'TT88GGTAT71T888 TTTTCCC8888CTG8TACCCTTTG88888GT8T88A cho8888TGAGC8888GTTG8888888888A888888 88 translated molecular weight = 81766.23 FIG. 4 FIG. 5a FIG.6 1 H5Q) ffELOQLDsKF’l, EQV) 10LYDDsF’PHE I:IROYLAQSflEKQD)? EHA) JDV51 SFA’r1M! 1DLLSQL, DDOYSRF'5LEN')irLI, QILNIRXSK Jl, QDNF'OEl:DPhQ lol)ISHIIYSCLKEi:RKILENAQRJ’NQ enter QSGN IQSTV)41. DKQKELDSKVRNVK151 DKV) 1cIr: IIEIKsI,EDLQDEYI))”KCKTI,Q)JREHH:T)J GVAKSDQKQEQLLLj 201　K[LMLDNKRXEVVIIKXXELLNVDingEL’rQN入I JN’DELVE [RROQSACIGG251 PPNACI, DQI, QQ VRQQLKLEELEQKYTYEIlf) Pff ding K) 2KQVLWDR TrSLrOQ301 1JQSSFWERQI’C)ffTllPQR? 1. VLKTGVQF"TVKLRI, LVKLQELJffNLKVK351 V LJ”DKf)VNEIR)JTVKGFRKFNILGT)l-ff, EES TNGSL entry AEFR) ILQLKE401 0KNAGTRTl+EGP1. IVTEEI:LH3LSrETQLCQPGLVIDLETT5LPWVIS )JV451SOLPSGWASrLWYN)ILVAEPR)JLSFFLT PPCARkiAOLSEVLSWQrSSVTK551 LELIKKIIL LPLMDGC! )IGF’1SKERERAL1. KDQOPGTrLLRF Final amino acid of SESSREGA84Kd the law of nature FIG. 7b IsGF-3-@＠-・ γ-component conflict y4'', -j +j+tJ dimension pipe FIG. 8b 35kD +-am 113kD antiserum --0,111iμRIFIG, ll FIG, 14a FIG, 14b GRF→− 1-----1-- FIG, 14c FIG, 14d GRF→J proboscis l- FIG. 15a FIG, 55b FIG, 15c FIG, 15d FIG, +6 17. ,,lIS@1h4mllh FIG. 17a 123 4 5 ° 7 FIG. 17b Untreated IFN-γ Total/ One otsu9ρ→△04 ■ of size number 10 7f International Search Report DrT/II (01/11) Q&.

PCT/US 93102569 ．． ．． 1+PCT/US 93102569 Front page continuation (51) Int, ci, 6 Identification symbol Internal office reference number A61K 3810 0 ADV 38/21 ADU ADV 39/395 U 9284-4C 49100A 9051-4C CO7K 14152 8318-4HC12N 1/21 8828-4B 15109 ZNA C12P 21108 9161-48GOIN 33153 P 7055- 2J (81) Designated countries EP (AT, BE, CH, DE.

DK, ES, FR, GB, GR, IE, IT, LU, MC, NL, PT, S E), AU, CA, JPI A61K 37102 ABH 37/66 ADY G 37102 ADV 37/66 ADU 37102 A C5 (72) Inventor: Tzu Xin Ngee Ann, New York, United States of America 10 029 New York Park Avenue 1249 Apartment 2A Continuation of front page (72) Inventor Shuai Ke United States of America New York 10021 New York East Chic Stisard Street 500 Apartment 22D

Claims (87)

[Claims] 1. binding of a specific polypeptide ligand to its cellular receptor on a target cell A receptor recognition factor that is involved in the transcriptional stimulation of genes in the target cell in response. Therefore, the receptor recognition factor has the following characteristics: a) a ligand-binding receptor; an apparent direct interaction with and one or more that can bind to specific genes. activation of the above transcription factors; b) depending on the presence or concentration of the second messenger; activity not affected as indicated; c) direct interaction with the tyrosine kinase domain; and d) with the G-protein. perception of the absence of interaction. 2. The receptor recognition factor of claim 1 having the following characteristics: a) it is an interface interacting with the eron-γ-binding receptor kinase complex; b) it is a tyrosine kinase substrate; and c) when phosphorylated, it serves as a DNA-binding protein. 3. d) Interferon-γ-dependent activation of the above factors leads to new protein synthesis. what happens to; and e) Activation of the factor appears within minutes of interferon-γ treatment and after 15 It is further characterized as reaching a maximum intensity between 1 and 30 minutes and then disappearing after 2-3 hours. The receptor recognition factor according to claim 2, wherein the receptor recognition factor is a characteristic. 4. The receptor recognition factor of claim 1, which is proteinaceous in composition. 5. The receptor recognition factor according to claim 1, which originates from the cytoplasm. 6. The receptor recognition factor according to claim 1, which is derived from a mammalian cell. 7. 2. The receptor recognition factor of claim 1, labeled with a detectable label. 8. Claim in which the label is selected from enzymes, fluorescent chemicals and radioactive elements 7 receptor recognition factors. 9. An antibody against a receptor recognition factor, wherein the factor that produces the antibody is Antibodies with the following characteristics: a) apparent direct interaction with ligand binding receptors and binding to specific genes; b) activation of one or more transcription factors capable of an activity that is not appreciably affected by the presence or concentration; and c) direct interaction with the tyrosine kinase domain; and d) with the G-protein. perception of the absence of interaction. 10. 10. The antibody of claim 9, wherein the receptor recognition factor has the following characteristics: a) that interacts with the interferon-gamma-binding receptor kinase complex; b) it is a tyrosine kinase substrate; and c) when phosphorylated, it serves as a DNA-binding protein. 11. The receptor recognition factor further comprises: d) Interferon-γ-dependent activation of the factors without new protein synthesis what happens; and e) Activation of the factor appears within minutes of interferon-γ treatment and after 15 It is characterized by reaching its maximum intensity within 30 minutes and then disappearing after 2-3 hours. 11. The antibody of claim 10. 12. 10. The antibody of claim 9, comprising a polyclonal antibody. 13. 10. The antibody of claim 9, comprising a monoclonal antibody. 14. An immortalized cell line producing the monoclonal antibody of claim 13. 15. 10. The antibody of claim 9, labeled with a detectable label. 16. The claim is that the label is selected from enzymes, fluorescent chemicals and radioactive elements. Antibody of item 15. 17. (A) DNA sequence of Figure 1; (B) DNA sequence of Figure 2; (C) DNA sequence of Figure 3; (D) Hybridize with any of the above DNA sequences under standard hybridization conditions. and (E) a DNA sequence coded by any of the above DNA sequences. DNA sequence that encodes the amino acid sequence to be expressed DNA encoding a receptor recognition factor or a fragment thereof selected from the group consisting of Sequence or modified variant thereof. 18. (A) DNA sequence of Figure 1; (B) DNA sequence of Figure 2; (C) DNA sequence of Figure 3; (D) Hybridize with any of the above DNA sequences under standard hybridization conditions. and (E) a DNA sequence coded by any of the above DNA sequences. DNA sequence that encodes the amino acid sequence to be expressed DNA encoding a receptor recognition factor or a fragment thereof selected from the group consisting of A recombinant DNA molecule containing the sequence or a degenerate variant thereof. 19. Claims wherein said DNA sequence is operably linked to an expression control sequence. The recombinant DNA molecule of any of paragraphs 17 or 18. 20. If the expression control sequence is SV40, CMV, vaccinia, polyoma or Denovirus early or late promoter, Iac system, trp system, TAC system, T RC system, LTR system, main operator and promoter region of phage λ, outside fd Control region of skin protein, promoter for 3-phosphoglycerate kinase - from the promoter of acid phosphatase and the promoter of yeast α mating factor. 20. The recombinant DNA molecule of claim 19 selected from the group consisting of: 21. A receptor recognition factor in an alternate species prepared from the DNA sequence of claim 17. Probes that can be screened. 22. (A) DNA sequence of Figure 1; (B) DNA sequence of Figure 2; (C) DNA sequence of Figure 3; (D) Hybridize with any of the above DNA sequences under standard hybridization conditions. and (E) a DNA sequence coded by any of the above DNA sequences. DNA sequence that encodes the amino acid sequence to be expressed DNA encoding a receptor recognition factor or a fragment thereof selected from the group consisting of in a unicellular host transformed with a recombinant DNA molecule containing the sequence or a degenerate variant thereof. and wherein said DNA sequence is operably linked to an expression control sequence. . 23. Unicellular hosts include Escherichia coli, Pseudomonas, Bacillus, and Streptomycetes. Yeast, CHO, RI. 1, B-W, LM, COS1, COS7, BSC 1. BSC40 and BMT10 cells, plant cells, insect cells, and in tissue culture medium 23. The unicellular host of claim 22, selected from the group consisting of human cells. 24. A method for measuring the presence of a receptor recognition factor by the following steps A to G, , a method in which the receptor recognition factor has the following characteristics: a ligand binding receptor; an apparent direct interaction of and one or more that can bind to a specific gene activation of transcription factors; depending on the presence or concentration of second messengers, activity not affected as if by direct interaction with the tyrosine kinase domain ; and recognition of the absence of interaction with G-proteins. A. B. preparing at least one sample of said receptor recognition factor; Said receipt at least one antibody or binding partner directed against the protein recognition agent sample. Prepare; C. the receptor recognition factor sample and the antibody or binding partner thereto; applying a detectable label on a substance selected from the group consisting of;D. End mark from process C mammals in which the presence and/or activity of the receptor recognition factor is presumed. immobilizing a substance selected from the group consisting of biological samples from an object on a suitable support; death; E. contacting the labeled substance from step C with the biological sample and the immobilization contact with a substance; F. The substance from step C bound to the immobilization substance is bound to the immobilization substance. G. The binding substance is combined with the presence of the labeling substance. to be inspected. 25. 25. The method of claim 24, wherein the receptor recognition factor has the following characteristics: a) that interacts with the interferon-γ-binding receptor kinase complex; b) it is a tyrosine kinase substrate; and c) when phosphorylated, it serves as a DNA-binding protein. 26. The receptor recognition factor further comprises: d) Interferon-γ-dependent activation of the factors without new protein synthesis what happens; and e) Activation of the factor appears within minutes of interferon-7 treatment and after 15 It is characterized by reaching its maximum intensity within 30 minutes and then disappearing after 2-3 hours. 26. The method of claim 25. 27. The presence and presence of a polypeptide ligand associated with a given invasive stimulus within a mammal 25. The method of claim 24, comprising a method of measuring activity. 28. 28. The method of claim 27, wherein the invasive stimulus is an infection. 29. The invasive stimulus may include viral infections, protozoal infections, tumorous mammalian cells, and 29. The method of claim 28, wherein the method is selected from the group consisting of toxins and toxins. 30. A claim comprising a method of determining the presence of an invasive or idiopathic stimulus in a mammal 24 methods. 31. Method for measuring binding site for receptor recognition factor by following steps A to D a method in which the receptor recognition factor has the following characteristics: a ligand binding receptor; 1 capable of apparent direct interaction with receptors and binding to specific genes or activation of two or more transcription factors; dependent on the presence or concentration of second messengers. Activity not affected as shown; Direct interaction with tyrosine kinase domains; and interaction with G-proteins recognition of the absence of use. A. B. preparing at least one sample of said receptor recognition factor; Said receipt B. applying a detectable label on the protein recognition agent sample; Recognition of the labeled receptor Add the factor sample to the mammal in which the binding site for the receptor recognition factor is predicted. contact with a biological sample from;D. The biological sample is combined with a research method. The presence of the labeled receptor recognition factor is tested. 32. The receptor for the receptor recognition factor is grown in a growth medium containing the receptor recognition factor. After culturing a colony of test cells containing the protein and adding the drug to be tested. The reactivity of the receptor recognition factor with the receptor on the colony of the test cells is determined. of a drug or other entity that modulates the activity of a receptor recognition factor, including measuring A method for testing ability, wherein the receptor recognition factor has the following characteristics: : a) apparent direct interaction with ligand binding receptors and binding to specific genes; b) activation of one or more transcription factors capable of activity that is not appreciably affected by presence or concentration; c) direct interaction with the tyrosine kinase domain; and d) with the G-protein. perception of the absence of interaction. 33. Any of claims 31 or 32, wherein the receptor recognition factor has the following characteristics: Alternative method: a) it interacts with the interferon-gamma-binding receptor kinase complex thing; b) it is a tyrosine kinase substrate; and c) when phosphorylated, it serves as a DNA-binding protein. 34. The receptor recognition factor further comprises: d) Interferon-γ-dependent activation of the factors without new protein synthesis what happens; and e) Activation of the factor appears within minutes of interferon-γ treatment and after 15 It is characterized by reaching its maximum intensity within 30 minutes and then disappearing after 2-3 hours. 34. The method of claim 33. 35. Observable cell test colonies inoculated with drugs or other supplies and receptors - receptor recognition factor, including the production of a supernatant that is tested for the presence of the recognition factor; Analytical systems for screening drugs and other substances for their ability to modulate offspring production A system in which the receptor recognition factor has the following characteristics: a) a ligand binding receptor; 1 capable of apparent direct interaction with receptors and binding to specific genes or activation of two or more transcription factors; b) by the presence or concentration of a second messenger; Activity not clearly affected; c) direct interaction with the tyrosine kinase domain; and d) with the G-protein. perception of the absence of interaction. 36. 36. The analysis system of claim 35, wherein the receptor recognition factor has the following characteristics: a) that it interacts with the interferon-gamma-binding receptor kinase complex; ; b) it is a tyrosine kinase substrate; and c) when phosphorylated, it serves as a DNA-binding protein. 37. The receptor recognition factor further comprises: d) Interferon-γ-dependent activation of the factors without new protein synthesis what happens; and e) Activation of the factor appears within minutes of interferon-γ treatment and after 15 It is characterized by reaching its maximum intensity within 30 minutes and then disappearing after 2-3 hours. 37. The analysis system according to claim 36. 38. Proof of receptor recognition factors in eukaryotic cell samples, including the following components A to C Test kit for: A. a detectable mark of said receptor recognition factor or a specific binding partner thereto; a predetermined amount of at least one, obtained by direct or indirect attachment to the a labeled immunochemically active ingredient, wherein said receptor recognition factor has the following characteristics: components: apparent direct interactions with ligand-binding receptors and specific genes. activation of one or more transcription factors capable of binding; second messenger Activity not significantly affected by presence or concentration; tyrosine direct interaction with the enzyme domain; and the absence of interaction with G-proteins. recognition of; B. other reagents; and C. Instructions for using said kit. 39. 39. The test kit of claim 38, wherein the receptor recognition factor has the following characteristics: a) it interacts with the interferon-gamma-binding receptor kinase complex thing; b) it is a tyrosine kinase substrate; and c) when phosphorylated, it serves as a DNA-binding protein. 40. The receptor recognition factor further comprises: d) Interferon-γ-dependent activation of the factors without new protein synthesis what happens; and e) Activation of the factor appears within minutes of interferon-γ treatment and after 15 It is characterized by reaching its maximum intensity within 30 minutes and then disappearing after 2-3 hours. 40. The test kit of claim 39. 41. The labeled immunochemically active ingredient is a polynucleotide that targets the receptor recognition factor. monoclonal antibodies against the receptor recognition factor, fragments thereof , and mixtures thereof. test kit. 42. a receptor recognition factor, promoting the production and/or activity of the receptor recognition factor; substances that can mimic the activity of said receptor recognition factors. Substance, substance capable of inhibiting the production and/or activity of the receptor recognition factor a substance selected from the group consisting of: cell deficiency in a mammal, comprising administering to the mammal a therapeutically effective amount of a toner; Preventing and/or treating weakness, confusion and/or impairment and/or other pathological conditions A method, wherein the receptor recognition factor has the following characteristics: a) a ligand; apparent direct interaction with binding receptors and ability to bind to specific genes. activation of one or more transcription factors that can be activated; b) the presence or concentration of a second messenger; Activity not affected as clearly shown by; c) direct interaction with the tyrosine kinase domain; and d) with the G-protein. perception of the absence of interaction. 43. 43. The method of claim 42, wherein the receptor recognition factor has the following characteristics: a) that interacts with the interferon-γ-binding receptor kinase complex; b) that it is a tyrosine kinase substrate; and c) that when phosphorylated, it serves as a DNA-binding protein. 44. The receptor recognition factor further comprises: d) Interferon-γ-dependent activation of the factors without new protein synthesis what happens; and e) Activation of the factor appears within minutes of interferon-γ treatment and after 15 It is characterized by reaching its maximum intensity within 30 minutes and then disappearing after 2-3 hours. 44. The method of claim 43. 45. The pathological condition is chronic viral hepatitis, hairy cell leukemia, and tumors. 43. The method of claim 42, comprising a sexual disorder. 46. Interferon is administered as a first-line therapy to control the progress of treatment. 43. The method of claim 42, wherein the receptor recognition agent is administered to the patient. 47. Interferon is administered as a first-line therapy to control the progress of therapy. 43. The method of claim 42, wherein the substance is administered to the patient. 48. Treatments in which interferon is co-administered with one or more additional therapeutic agents 43. The method of claim 42, wherein the receptor recognition factor is administered to modulate progression. 49. Treatments in which interferon is co-administered with one or more additional therapeutic agents 43. The method of claim 42, wherein the agent is administered to modulate progression. 50. Cellular weakness, confusion and/or dysfunction in mammals, including A and B below: Pharmaceutical composition for treating harm. A. receptor recognition factor, promoting the production and/or activity of the receptor recognition factor Substances that can mimic the activity of the receptor recognition factor substance capable of inhibiting the production and/or activity of the receptor recognition factor a therapeutically effective amount of a substance selected from the group consisting of Substances in which the receptor recognition factor has the following characteristics: clear association with the ligand binding receptor interaction of one or more transcripts that can bind to a specific gene activation of factors; as evidenced by the presence or concentration of second messengers; activity unaffected by sea urchins; direct interaction with the tyrosine kinase domain; and recognition of the absence of interaction with G-proteins; and B. Pharmaceutically acceptable capacitors Riya. 51. 51. The pharmaceutical composition of claim 50, wherein said receptor recognition factor has the following characteristics: a) it interacts with the interferon-gamma-binding receptor kinase complex thing; b) it is a tyrosine kinase substrate; and c) when phosphorylated, it serves as a DNA-binding protein. 52. The receptor recognition factor further comprises: d) Interferon-γ-dependent activation of the factors without new protein synthesis what happens; and e) Activation of the factor appears within minutes of interferon-γ treatment and after 15 It is characterized by reaching its maximum intensity within 30 minutes and then disappearing after 2-3 hours. 52. The pharmaceutical composition of claim 51. 53. Binding of a specific polypeptide ligand to its cellular receptor on a target cell is a receptor recognition factor involved in transcriptional stimulation of genes in the target cell in response to and the receptor recognition factor has the following characteristics: a) it is present in the cytoplasm; to do; b) that it undergoes tyrosine phosphorylation upon treatment of cells with IFNα; c) that it activates the transcription of interferon-stimulated genes: d) that it is ISRE-dependent; Stimulating either spontaneous or gamma-activated site (GAS)-dependent transcription in vivo e) that it interacts with IFNα cell receptors; and f) It undergoes nuclear translocation upon stimulation of IFN cell receptors with IFNα. 54. Target of interferon or interferon-related polypeptide ligand transcription of a gene within said target cell in response to binding to its cellular receptor on the cell; A stimulus-related receptor recognition factor, the receptor having the following characteristics: Recognition factor: a) It is detected in the mammalian cytoplasm before activation of cellular 1FN receptors in vivo. to exist in; b) the tyrosine moiety that is phosphorylated in response to IFN stimulation of the IFN receptor containing the position; c) it is selected from the group consisting of 48kD, 84kD, 91kD and 113kD. have a molecular weight; and d) When phosphorylated, it recognizes the ISRE in the cell nucleus. 55. 55. The receptor recognition of any of claims 53 or 54 in a phosphorylated form. awareness factor. 56. Phosphorylated 1SGF3 polypeptide or fragment thereof in phosphorylated form An antibody that recognizes 57. Injecting an antibody-producing effective amount of ISGF3 polypeptide into a substantially immunocompetent host. The antibody produced by injecting the 1S and collecting the antibody, An antibody in which the GF3 polypeptide has the following properties: a) it is approximately 48 kD, 84 kD , having a molecular weight of 91 kD or 113 kD; b) that it can be isolated from the mammalian cytoplasm; c) that it can be isolated from the mammalian cytoplasm; Contains tyrosine residues that undergo phosphorylation in vivo upon treatment; d) that it can activate the transcription of interferon-stimulated genes in vivo; and; e) it is capable of stimulating ISRE-dependent transcription in vivo; f) it is capable of stimulating ISRE-dependent transcription in vivo; and g) that it is capable of interacting with the FNα cell receptor; Ability to undergo nuclear migration upon stimulation of N cell receptors. 58. 58. The antibody of any of claims 56 or 57, which is monoclonal. 59. 58. The antibody of any of claims 56 or 57, which is polyclonal. 60. Transformed with the DNA molecule of claim 17 or a derivative thereof or a fragment thereof. recombinant virus. 61. Transformed with the DNA molecule of claim 18 or a derivative thereof or a fragment thereof. recombinant virus. 62. A method of enhancing the activity of IFNα and/or IFNγ, the method comprising: (a) promoting phosphorylation of the receptor recognition factor of claim 1 in a mammal in need of or (b) otherwise reduce the level of the phosphorylated receptor recognition factor. A method comprising administering an effective amount of a compound that inhibits the activity of a phosphatase enzyme. . 63. Those receiving treatment for (a) chronic viral hepatitis or (b) hairy cell leukemia method, wherein a mammal in need of such treatment is provided with: or (b) increase the phosphorylation of a phosphorylated receptor recognition factor. A method comprising administering an effective amount of a compound that reduces the level of phosphate removal. 64. 63. The method of claim 62, which enhances the activity of exogenous IFNα and/or IFNγ. . 65. 63. The method of claim 62, wherein the method enhances endogenous IFNα and/or IFNγ activity. . 66. The compound and IFNα and/or IFNγ are administered to a mammal in need of such treatment. 65. The method of claim 64, wherein the method is administered to the animal simultaneously. 67. administering the compound to the mammal; measuring the level of phosphorylated receptor recognition factor present; and receptor recognition Compound testing, including comparing factor phosphate levels to standards. A method for measuring terferon-related pharmaceutical activity. 68. A mammal administered with IFNγ in an amount effective to treat hepatitis or leukemia. In the method for treating hepatitis or leukemia, the IFNγ activity is administered to the mammal. Administering the receptor recognition factor of claim 1 or a derivative thereof in an amount effective to enhance sex. A method characterized by: 69. administering the compound to the mammal; Measure the level of phosphorylated ISGF3 protein present; and Compound testing, including comparing protein phosphate levels to standards. A method for measuring interferon-related pharmaceutical activity. 70. A mammal administered with IFNα in an amount effective to treat hepatitis or leukemia. In the method for treating hepatitis or leukemia, the IFNα activity is administered to the mammal. administering ISGF3 protein or a derivative thereof in an amount effective to enhance sex. A method characterized by: 71. 71. The method of claim 70, wherein a derivative of ISGF3 protein is administered to said. 72. The ISGF3 protein is about 48 kD, 84 kD, 91 kD or 11 kD. 72. The method of claim 71, having a molecular weight of 3 kD. 73. 72. The method of claim 71, wherein the derivative is a phosphorylated ISGF3 protein. 74. Plasmid pGEX-3X, clone E3 or plasmid pGEX-3X 19. The recombinant DNA molecule of claim 18, comprising clone E4. 75. An antisense nucleic acid to a receptor recognition factor mRNA, the m Antisense nucleic acids that include nucleic acid sequences that hybridize to RNA. 76. 76. The antisense nucleic acid of claim 75, comprising RNA. 77. 76. The antisense nucleic acid of claim 75, comprising DNA. 78. 76. The antiserum of claim 75, which binds to a start codon of any of said mRNA. nucleic acids. 79. Transcription produces antisense ribonucleic acid against receptor recognition factor mRNA a recombinant DNA molecule having a DNA sequence in which the antisense ribonucleic acid is A recombinant DNA molecule comprising a nucleic acid sequence that hybridizes to said mRNA. 80. Transcription produces antisense ribonucleic acid against receptor recognition factor mRNA A receptor recognition factor produced by transfection with a recombinant DNA molecule having a DNA sequence of a living cell system, wherein the antisense ribonucleic acid hybridizes to the mRNA; A cell line containing a nucleic acid sequence that 81. Transcription produces antisense ribonucleic acid against receptor recognition factor mRNA transfecting a recognition factor-producing cell line with a recombinant DNA molecule having a DNA sequence of in a method of creating a cell line exhibiting reduced expression of a receptor recognition factor, including and the antisense ribonucleic acid hybridizes to the mRNA. How to include columns. 82. A ribozyme that cleaves receptor recognition factor mRNA. 83. 83. The ribozyme of claim 82, further comprising a Tetrahymena-type ribozyme. 84. 83. The ribozyme of claim 82, further comprising a hammerhead ribozyme. 85. DNA that transcribes a ribozyme that opens the receptor recognition factor mRNA A recombinant DNA molecule with a sequence. 86. DNA that produces a ribozyme that cleaves receptor recognition factor mRNA through transcription A receptor recognition factor producing cell line transfected with a recombinant DNA molecule having the sequence . 87. Recombinant transcription that produces a ribozyme that cleaves receptor recognition factor mRNA reduction of the receptor, including transfecting a recognition factor-producing cell line with a DNA molecule. A method for creating cell lines that exhibit expression of target recognition factors.