JPH07501936A - Formation of triple-stranded helical complexes of single-stranded nucleic acids using nucleoside oligomers - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Formation of triple-stranded helinox complexes of single-stranded nucleic acids using nucleoside oligomers Cross-reference with consecutive applications This application is filed under U.S. Patent No. 924.234 (issued October 28, 1986, No. 1 U.S. Patent Application No. 368.027 (1989), a continuation-in-part application of JI) This is a partial continuation of the application filed on June 19th, and these disclosures constitute a part of this specification. It shall be.

My skin is Ω back The present invention is directed toward the National Institutes of Health, This was done with government support, including support from S.A. (Aid Number C^42762). It is. The Government has certain rights in this invention.

Publications and other bibliographical materials cited herein are incorporated herein by reference. shall be referred to by number in the following text and appended immediately before the claims. All materials are summarized in the bibliography provided.

The present invention specifically combines with a selected single-stranded nucleic acid structure to create a triple-stranded sock structure. Using first and second nucleoside oligomers that give , novel methods for detecting and recognizing specific sequences in RNA).

Homopyri to polypurine region in double-stranded DNA by Hoogsteen hydrogen bonding Formation of triple-stranded socks structure by midine oligodeoxyribonucleotide binding have been reported (see e.g. 1 and 2). This homopyrimidine oligonucleotide Creotides form the main grove of double-helical DNA ( It was known that it recognizes long (extended) purine sequences in the grooves. Mopyrimidine oligonucleotide and purine chain of cytosine click double-stranded DNA It was found that the Hoogsteen base pairs included between the two.

The triple helix complex containing cytosine and thymidine on the third mirror is acidic to neutral. Each is known to be stable in solutions of It is known that This Hoogsteen chain has T modified bases (for example, 5- bromouracil) and modified bases of C (e.g., 5-methylcytosine). It was found that the stability of the triple-stranded helix increases at higher pH ranges. ing. In order for cytosine (C) to participate in Hoogsteen-type pairing, pi The hydrogen on N-3 of the midine ring must be available for hydrogen bonding. Therefore, Under certain circumstances, cytosine may be protonated at N-3.

DNA exhibits a wide range of polymorphic conformations, and these conformations play a role in biological processes. May be required. Sequence-specific protein-DN binding and molecular phase Signals due to interactions with transducitans (e.g., transcription, translation, and replication) ) is thought to depend on the conformation of DNA (3).

Binds to critical regions of the genome and selectively inhibits abnormal cell function, replication, and survival It is interesting to consider the possibility of developing therapeutic drugs for the treatment of cancer (4). Array special The design and development of different NA-binding molecules is being promoted by various research institutes. foreign genetic material (e.g., a virus) or changes in genomic DNA (e.g., cancer) It has wide-ranging implications for the diagnosis and treatment of the diseases involved.

Nuclease-resistant nonionic oligo consisting of a methylphosphonate (MP) backbone Deoxynucleotides (ODNs) are potential anticancer, antiviral and It has been studied in vitro and in vivo as an antimicrobial agent (5). these types The analogous 5°-3° linked internucleotide linkage is similar to that of a nucleic acid phosphodiester linkage. The conformation is very similar. This phosphate skeleton consists of one anionic phosphorus The phoryl oxygen is made neutral by methyl substitution, and the charged phosphate group (5). Generating analogues of MP scaffolds This analog can be used to improve globin synthesis and varicella canker sores. Inhibits translation of mRNA in viral protein synthesis and inhibits H3V replication. It has been shown to inhibit splicing of pre-n+ RNA. these The mechanism of action of inhibition by nonionic analogs involves the use of complementary RNA and/or D Involves the formation of stable complexes with NA.

of nonionic oligonucleosides that are complementary to a selected single-stranded foreign nucleic acid sequence. Alkyl and aryl phosphonate analogs are attached to or attached to the nucleic acid. interfere with the function or expression of other nucleic acids present in the cell by interfering with acids It has been reported that the function or expression of the specific nucleic acid can be selectively inhibited without (e.g., U.S. Patents No. 4.469.863 and 4.511) ．． 713). Complementary nuclease resistance taken up by mammalian cells Under certain circumstances, non-ionic oligonucleoside methylphosphonates can be used to inhibiting the synthesis of viral proteins (including herpes simplex virus 1) in Disclosed in U.S. Patent No. 4.757.055.

Antisense oligonucleotides or oligonucleotides that are complementary to a portion of the viral mRNA uses phosphorothioate analogs to improve the translation of viral aRNA into proteins. and have been proposed to block transcription. This antisense construct will can bind to mRNA, and cellular liposomes move along the mRNA. It is thought to prevent the translation of mRNA into protein, thereby stopping the translation of mRNA into protein. (called “translation stop” or “liposome hybridization stop”) process called).

HTI, V-111 genome required for reproduction and/or expression of HTLV-I++ HTLV-I by administration of an oligonucleotide complementary to a highly conserved region of Inhibition of cell infection by I+ is disclosed in U.S. Patent No. 4.806.463. Disclosed. These oligonucleotides have reverse transcriptase activity (replication). and by the production (gene expression) of the viral proteins p15 and p24. were found to affect viral replication and/or gene expression. .

Certain antisense oligonucleotides containing internucleonodal methylphosphonate linkages The ability of K/nucleotides to inhibit H[V-induced syncytium production and expression has been demonstrated. being studied (7).

Psoralen-derivatized oligonucleoside methylphosphonates are It has been reported that it is possible to cross-link either code-water DNA; Stranded DNA was not crosslinked (28).

-Susushi Rashio The present invention detects or recognizes a single w1 nucleic acid or a specific segment of a single-stranded nucleic acid sequence. methods for identifying and labeling by forming wax complexes on the double strands. relates to a method for inhibiting the expression of a function of a specific segment of a single-stranded nucleic acid having a specific sequence .

1) Formation of a wax complex to the duplex of either NA or RNA target sequence You can let me.

The invention also provides methods for preventing expression and/or functionalization of selected single-stranded nucleic acid sequences. novel modification oligonucleotides containing groups useful for and optionally modifying nucleic acids; Regarding Gomer. Additionally, the present invention provides pyrimidine and/or purine nucleoside The present invention relates to oligomers containing de-analogs. Specifically, these Purine Nucleo 7 analogs to favor the formation and stability of triple-stranded structures and target nucleic acids. Modify sequences to reduce misreading.

In one embodiment, the invention provides methods for - interfering with the function or expression of a waterway nucleic acid target sequence. A method comprising: contacting the target sequence with a first oligomer and a second oligomer. of the first and second oligomers. The rheoside sequence is chosen so that a double-stranded helinox structure is formed). one preference According to a preferred embodiment, the nucleic acid target sequence is a polypurine or polypyrimidine sequence. What do you think of any of these? When this target sequence is a homopurine sequence, the first and the second oligomer contains only pyrimidine nucleosides or analogs. Alternatively, one of the first and second oligomers may be a purine. one containing only rheosides and the other containing only pyrimidine nucleosides. but , when the target sequence is a homopyrimidine sequence, the first and second oligomers may contain only purine nucleosides, or alternatively the first and One of the second oligomers contains only purine nucleosides and the other contains pyrimidines. Contains only nucleosides.

In one particularly preferred embodiment, analogs of natural purine nucleosides are used in the present invention! Used in bright oligomers. These purine nucleoside analogs can be modified to Favor elementary bond configuration. This configuration is similar to that of the first and second oligomers. The invention provides that the single-stranded nucleic acid segment is mRNA in living cells, and that the two-stranded nucleic acid segment is Helps with chain stability.

In one embodiment, the invention provides a single-stranded nucleic acid or a specific segment/segment of a single-stranded nucleic acid sequence. This invention relates to novel oligomers containing analogs.

Furthermore, the present invention provides a method for combining a specific segment of a single-stranded nucleic acid with a first and second oligomer. It relates to the formation of a double-stranded helinox structure by the interaction of this first time The hybrid has sufficient complementarity to base pair (or hybridize) to it. have for de.

Accordingly, in one embodiment, the present invention provides methods for detecting or detecting specific segments of single-stranded nucleic acids. A method for recognizing gulls, the method comprising: forming a hybrid node between the segment and a first oligomer; the hybrid nucleic acid to form a second oligomer (this oligomer is Hydrogen bonding or hybridization to the purine base sequence or part thereof in the hybrid have sufficient complementarity to it to cause 2. A method comprising contacting with a material (giving a structure).

In another aspect, the present invention provides a method for producing a particular segment of a single-stranded nucleic acid having a sequence. A method of preventing or inhibiting expression or function, the method comprising: first obtaining a first origin of complementarity; Gomer is used to form a hybrid and then the hybrid is injected into a second oligomer. mer (sufficient complementarity to form hydrogen bonds with the double-stranded hybrid) to the lid, thus giving a linox structure to the duplex). A method comprising:

an o-ring containing a heterocycle with hydrogen available for hydrogen bonding at the ring position. The formation of linox structures may inhibit or inactivate the mRNA and prevent its translation. Regarding the method.

According to another aspect, the present invention provides for converting single strands in vivo by wax formation into double strands. Provided are methods for preventing or interfering with the expression of a nucleic acid sequence (wherein tpical sequences include the start codon, polyadenylation region, aRNA cap site, or start codon. (This is the RNA region encoding the price junction). First and second oligos Mers such that they form a double-stranded helix and thus substantially inhibit the expression of the target sequence. Choose to prevent or interfere with it.

The present invention also provides splicing/splicing of pre-mRNA to obtain translatable mRNA. expression of a gene or protein product of a gene in a cell by preventing provides a method for selectively preventing or interfering with. According to these methods For example, the first and second oligomers form a double-stranded helinox with the target sequence. Select the target sequence, introduce it into cells, and form the wax into a duplex with the target sequence. and prevent splicing of pre-ff1 RNA.

In another aspect, the present invention provides a method for producing a duplex comprising a target and a first and second oligomer. The formation of helinox does not substantially inhibit overall DNA synthesis (in Methods of inhibiting the reproduction or translation of single-stranded DNA target sequences in vivo are provided.

In a preferred embodiment, the second oligomer is modified to introduce a nucleic acid modification group. . This group indicates whether this second oligomer is hydrogen bonded to the hybrid or not. After hybridization, it causes a chemical reaction with the hybrid and makes it impossible. It modifies the opposite. Such modifications involve forming covalent bonds. Cross-linking of the second oligomer and hybrid by) Alkylation of the hybrid , cutting the hybrid at a specific location, or disassembling or destroying the hybrid. I wonder if it depends.

The present invention also provides nucleosides that are substituted for tonton analogues and tontonn. an oligomer containing a sequence position, wherein the citon analogue is guanilated at neutral pH. A link that can form two hydrogen bonds with the base and corresponds to N-3 of totocin. I agree with Bomber.

The present invention contains fewer purine analogues of adenine or guanine (both one adenine Or provide an oligomer that replaces the guanine base. in particular, 2-Ami/purine may be substituted for adeni7, and guanine is the 6-se Rhenium analogues or 6-imbroviresin-7-diazag-containing compounds Bonds include phosphorus-containing bonds, such as phosphodiester bonds, alkyl and aryl bonds. - Phosphonate bonds, phosphorothioate bonds, phosphoramidite bonds and and neutral phosphate ester bonds, such as phosphotriester bonds; No internucleosilyl bonds, e.g. morpholino bonds, formacecool bonds , sulfamate bonds, and carbamate bonds, but are not limited to Not done. Other internucleosilyl linkages known in the art may be used in these oligomers. It's okay to stay. Furthermore, according to a preferred embodiment, these oligomers contain modified sugar moieties. It may contain any number of nucleosidyl units. These modified sugar moieties includes ribosyl moieties, deoxyribosyl moieties and modified ribosyl moieties, e.g. For example, 2°-0-arylribosyl (alkyl of 1 to 10 carbon atoms), 2'-0 -arylribosyl, and 2'-halogenribosyl (all optionally halogen optionally substituted with - Contains a methylribosyl moiety. In particular, modified ribosyls (especially 2°-0 -Methylribosyl) moiety by introducing a nucleosidyl unit, resulting in a double-stranded nucleus. Hybridization with acid sequences is advantageously improved and also resistance to enzymatic degradation This will improve tolerance to

In another aspect, the present invention provides a method that is sufficiently complementary to the sequence of a particular single-stranded nucleic acid. Novel nonionic alkyl and aryl containing purine nucleoside analogs phosphonate oligomers are provided. Hydrogen bonds and 1 lux structure into double strands Segments that form the structure. Nonionic methylphosphonate oligomers are preferred. stomach.

The present invention also provides for nucleocysts in which cytosine analogs are substituted for cytosine. oligomers having guanine analog units at neutral pH; A ring capable of forming two hydrogen bonds with a base and corresponding to N-3 of cytosine those containing heterocycles that make hydrogen available for hydrogen bonding at positions (e.g., The present invention provides oligomers that are (isocytosine). Cytosine analogues such as includes 5-methylcytosine, as well as the analogs shown in Table 1.

definition As used herein, the following terms have the following meanings unless otherwise specified: Ru.

The term "purine" or "purine base" refers to the natural adenine and guanine salts. groups, but also modified forms of these bases, e.g. bases substituted at the 8-position, bases substituted at the 6-position. Also includes modified guanine analogs or adenine analogs, 2-aminopurines. Contains.

The term "nucleoside" refers to the nucleosidyl unit and the nucleosidyl unit used interchangeably. It refers to a nucleic acid subunit consisting of a pentose and a nitrogenous base.

This term includes not only units with A, G, CST and U as bases, but also Analogs and modified forms of these bases (e.g., 8-substituted purines) are included. .

In RNA, the pentose is ribose, and in DNA, it is 2°-deoxyribose. .

The term also includes analogs of such subunits (2°-0- (including modified sugars such as alkyl ribose).

The term "phosphonate" [wherein R is an alkyl or aryl group]. suitable alkyl or The aryl group must have a steric 111-harmful or mutually contains groups that do not interact with each other. This phosphonate group has an rRJ or rSJ configuration. It may exist in any configuration. Phosphonate group to internucleosilyl phosphorus group can be used as a bond (or linkage) to link nucleosidyl units. Ru.

The term "phosphodiester" ■ In this case, the phosphodiester group is combined with the internucleosilyl phosphorus group bond (or linkage). can be used to link nucleosidyl units]. "Non-nucle" ``Oside monomer units'' are used to hybridize oligomers to target sequences. refers to a monomer unit that does not significantly participate in the Such monomeric units are must not participate in any significant hydrogen bonding with the nucleoside. Monomers having either 5 nucleotide bases or analogs thereof as components Exclude units.

“Nucleoside/non-nucleoside polymer” refers to nucleoside and non-nucleoside polymers. refers to a polymer consisting of monomer units.

[Oligonucleoside] or [Oligomer J 11, formed by internucleoside bonds. refers to a chain of linked nucleosides, usually from about 6 to about 100 nucleosides in length. but may be longer than about 100 nucleosides. Usually these are It is synthesized from nucleoside monomers, but can also be obtained by enzymatic methods.

That is, [the term oligomer refers to nucleoside monomers that link nucleoside monomers]. refers to an oligonucleoside chain with interlinkages. Therefore, oligomers have oligonucleotides, nonionic oligonucleoside alkyl and aryl-phosphatides Phonate analogs, alkyl and aryl-phosphonothio of oligonucleotides Neat, phosphorothioate or phosphorodithioate analog, oligonucleotide Phosphoramigate analogue of otide, neutral phosphate ester oligonucleolymer side analogs, such as phosphotriesters and other oligonucleoside analogs nucleosides and modified oligonucleosides, as well as nucleoside/non-nucleoside Contains leoside polymers. Additionally, the term includes one or more of the monomer units. is a non-phosphorus bond, such as a morpholino bond or a formacetic bond. substituted by a sulfamate bond, a sulfamate bond, or a carbamate bond. Includes nucleoside/non-nucleoside polymers.

The term "alkyl or aryl-phosphonate oligomer" means at least Has one alkyl or aryl-phosphonate internucleosilyl bond Refers to oligomers.

The term “methylphosphonate oligomer” (or rMP-oligomer) is an oligonucleotide having at least one methylphosphonate internucleosilyl linkage. Pointing to Gomer.

The term "neutral oligomer" refers to non-ionic nucleotides between nucleoside monomers. have interconducting bonds (i.e., bonds that have no net positive or negative ionic charge) refers to oligomers, including, for example, oligomers with internucleosilyl bonds. , e.g. an alkyl or aryl-phosphonate bond, an alkyl or aryl -phosphonothioate, neutral phosphate ester linkage, e.g. phosphotriester ter bonds, especially neutral ethyltriester bonds; as well as non-phosphorus-containing nucleosyls interlyl bonds, such as sulfamate, morpholino, formacecool, and carboxyl Oligomers with bamate bonds are included. If desired, neutral oligomers can be ligonucleoside or nucleoside/non-nucleoside polymer and a second molecule ( (forming the conjugate partner).

Such conjugate partners include intercalation reagents, alkylation reagents, , cell surface receptor binding substances, lipophilic reagents, photocrosslinking reagents such as psoralen, etc. It's okay to be. Additionally, such conjugate partners are enhance insertion, modify the interaction of the oligomer with the target sequence, or It may also alter the pharmacokinetic distribution of the gonucleoside. Required The requirement is that the conjugate contains oligonucleosides or nucleosides/ The non-nucleoside polymer is neutral.

The term "neutral alkyl or aryl-phosphonate oligomer" refers to Neutral nucleosides containing one alkyl or aryl-phosphonate bond Refers to a neutral oligomer with interfusyl bonds.

“The term neutral methylphosphonate oligomer J refers to at least one methylphosphonate oligomer J. Refers to neutral oligomers with internucleosilyl linkages containing sulfonate linkages .

The term "triple A riboma pair" refers to a single-stranded nucleic acid (e.g., RNA or DNA) The first segment can be read and form a double-stranded helical structure with it. and a second oligomer.

The term "third strand oligomer" refers to a double-stranded nucleic acid (e.g., a DNA duplex or Read the segment of NA-RNA duplex) and form a double-stranded linox structure with it. Refers to oligomers that can be

Triple oligomer pair or first and second oligomer (or third strand oligomer ) when referring to the base sequence of a single-stranded nucleic acid (also hydrogen bonding (and base pairing or hybridization) to the nucleic acid duplex of the third strand oligomer. An oricomer with a base sequence that forms a double-stranded helical structure by Point.

In the various oligomer sequences listed herein, e.g. rpJ in APA represents a phosphodiester bond, for example, IPJ in CPG is methylphosphonate Represents a bond. In addition, indications such as [11] are linked by a methyl phosphonate bond. This shows the nucleondyl group.

[The term “Read-1” refers to the base sequence of another nucleic acid and the recognition through hydrogen bonding interactions. refers to the ability of a nucleic acid residue to recognize That is, when reading a single-stranded DNA sequence, each The corresponding bases of the oligomers of the triple oligomer pair, through hydrogen bonding interactions, Recognizes the corresponding base in a segment of single-stranded DNA and forms a trible with it can do.

The term "triblet" is shown in Figures IA, IB: 2A-2D and 3A-3C. refers to a situation where Here, the bases of each of the first and second oligomers are: Hydrogen bonds (and thus , base pairing).

Brief description of the drawing Figures IA and IB show a triplet, where two pyrimidines The base forms a triblet with the central purine base.

Figures 2A to 2D show a triplet, here a purine base and a pyrimidine. The purine base forms a triplet with the purine base as the center.

Figures 3A-3C show triplets incorporating G or A analogs.

Figures 4A to 4E show base sequences of mixed sequence double-stranded helix structures for purposes of illustration. , where one of the triple oligomer pairs "reads" across the other two strands, Therefore, it base pairs with both purine bases of the other strand.

Figure 5 has an alkyleneoxy linkage to lengthen the internucleoside phosphorus linkage. This figure shows a nucleosidyl unit having a modified sugar moiety and a method for producing the same.

Figure 6 shows a modification with an alkylene linkage to lengthen the internucleoside phosphorus bond. A nucleosidyl unit having a sugar moiety and a method for its synthesis are shown.

Figure 7 shows the CD spectrum of the double-stranded hex structure, and (d) is the M P- indicates the third strand of the oligomer, and (E) indicates the third strand of the oligonucleotide.

Figures 8A and 8B show (A) Cross-linking of double-stranded DNA and (B) double-stranded DNA is shown.

Figures 9A-9E show CD spectra. Figure 9A shows oligomers in buffer A at room temperature. -■(-) and II(---) and 111(---) in buffer B at room temperature The CD spectrum of . Figure 9B shows buffer A (−) and buffer B ( ---) shows the CD spectrum of t-11 (2:1). Figure 90 shows the CD7. of 1'-11 of 1=l in buffer A. pek)le (-), and 1/2rI- The calculated CD spectrum (---) derived from II (2:1+11] is shown. Figure 9D is ll-111 (1: 1) + 1 (-), + (---), ll-l11 (= ・-) CD spectrum and the sum of +i-m and 1 spectra (all chamber) warm buffer solution philtrum). FIG. 9E shows that in buffer A at room temperature (-) and at 3°C (...), and ++-1o (t : 1) Shows the CD spectrum of II.

Figure 10 shows an autoradiogram of the polyacrylamide gel electrophoresis pattern. : Lane 1ull; Lane 2: III-11 (2: 1): Lane 3 : l-11 (2: l); Lane 4: III; Lane 5: lll-1t ( 1,5: 1); lane e: l-II-Ill (1°5:I:1.5).

In lanes 1-3, label 11 with 3 hits, and in lanes 4-6. used 31P-labeled III as a radioactive mark.

Figures 11A and IIB show the UV melting/annealing profile of l-11-1. shows the file. Figure 11A shows the normalized hyperchromic effect change, Figure 11B shows the dissociation (=) The ratio of the change in the hyperchromatic effect of and association (---) is shown.

Figure 12 shows 2'-〇-methyl (piCU)s·r(AG)s, 2:I( -), and 2'-〇-methyl (pick). d(80)s(---) CD star Showing the spectrum.

Figure 13 shows the melting of 2°-0-methyl (piCU), ・r(AG)s (2:1) Show a curve.

Figures 14A and 14B are d(AG), +d(CT). and d (8Ω), +d (CT) shows the turning point of the mixing curve of s.

Figures 15A-15D show CD spectra. FIG. 15A shows d(AG), d(C CD spectra of T), 1:1 (-) and d(AG), single strand (---). show. Figure 15B shows d(AG)s・d(CT), (2:IX-), double-stranded The calculated spectrum (---) of the calculated spectrum from the weight average of the single strand.

16A to 16C show d(AG), d(CT), (1:　])(16A); d (AG) e・d(CT), (1: +, )(t 6B): and d(xG),・ d(CT), (2:1) (18C) thermal denaturation curve is shown.

Figure 17 shows γ[”P]-terminally labeled d(CT) (lanes 1-12) and d (AG).

Autoradiograph of natural polyacrylamide gel containing (L/-713-17) Indicates the

FIG. 18A shows d(AG), d(CT), i! Compounds (1:1) and (2:1 ) shows the hydrogen-bonded N H-N resonance.

Figure 18B shows the chemistry/flux of the three resonances observed for the 2-1 mixture to Figure 18. This shows the a degree dependence of

Detailed description of the invention The present invention involves the formation of a wax structure into a duplex with a selected target-waterway nucleic acid sequence. The formation of this structure binds the nucleic acid to the first and second oligomers (tertiary oligomers). heavy oligomer pair) [triple helix (or double-stranded helix) complex with target sequence [selected to have a nucleotide sequence that forms] .

(A) General aspects In addition to the other tube embodiments described herein, the invention includes the following embodiments.

The first aspect relates to decoding (or recognizing) bases in single-stranded nucleic acid segments. and the excess of purines such as adenine and guanine or their analogs. hydrogen bonding by the bases in the first and second oligomers using hydrogen bonding sites. Depends on what can be formed. In other words, reading the base sequence in a single-stranded nucleic acid When giving a triblet, the pudding is always in the center of the triblet. There is (“center pudding”). This central purine base is located on the -waterway target sequence. Alternatively, when the target is a pyrimidine base, the first or second oligo It will probably be in either market. This triblet consists of the remaining central purine base. formation of hydrogen bonds between the available hydrogen bonding sites and the bases in the other two strands. formed by. Purines [adenine (a), guanine (b), or Adenine and guanine analogues, etc. listed in the specifications], or pyrimidines [Thymine (T), cytosine (c), or a cytosine analog as described herein Both bodies] can form hydrogen bonds with the central purine.

(i) The adenine (A) in the central position of the triplet is replaced by A in the other chain (or analogue) or read T or hydrogen bond with it.

(ii)) The guanine (G) in the central position of the riblet is replaced by the C in the other chain (or C analog) or G (or 6 analog) or hydrogen bond with it.

In a preferred form of the present invention, the phosphorus-containing skeletons of the first and second oligomers contains a methylphosphonate group as well as a natural phosphodiester group.

The basic planes of purines and pyrimidines are hard, and the furanose rings have small waves (approximately 0.5 people) is possible. Therefore, the conformational state of the nucleoside is is mainly defined by the rotation of two rather rigid surfaces (i.e., salt group and pentose, the C'-1 axis to the N-9 or N-1 bond with respect to each other. around). Torsion angle φ based on sugar. is seen along Co-1 with respect to the bond. Tray of the base plane by projection of Co-1 onto the 0-1゛ bond of the furanose ring of is defined as the angle formed by the This angle is determined by the oxygen in the furanose ring. When it is antiplanar to C-2 of the pyrimidine or purine ring, it is designated as O, A positive angle is taken as an angle measured clockwise when looking at C-1゛ with respect to N. do.

This angle is also called the glycosyl torsion angle. Using the above definition, Two ranges of φ for nucleosides. It is concluded that there exists [i.e. , about −301 for the Kai ■ conformation and about 150° for the υ Dan conformation] . The range of each conformation is approximately ±45° (22.22a). other researchers have used or proposed a slightly different definition of this angle (23.24. 25.26.27). φ. Information on X-ray diffraction, proton magnetic resonance (P obtained using methods such as MR) and optical rotational dispersion-circular dichroism (ORD-CD). There is (22m).

For double-stranded nucleic acid targets, one strand (called the "Watson strand") leads to the opposite strand (called the "Watson strand"). adapting changes in the position of the purine bases that are read into the "click strand") Therefore, the torsion angle of the glycosyl bond of the purine nucleosidyl unit in the third chain The specific conformation of the nucleoside, defined by required to be able to read the purines in the duplex using osside. I realized that it would happen. In other words, to read purine bases in DNA. , the conformation of the purine nucleosidyl unit in the third strand is similar to that of the DNA in relation to the third strand. The polarity of the strand containing the purine base read inside [parallel (5° to 3°) or antiparallel] direction of the row (3° to 5°)]. Pri in parallel strands in duplex For the purine nucleosidyl unit in the third strand to read the purine nucleosidyl unit in the third strand, The conformation of the creosidyl unit should be in the syn configuration. On the other hand, double stranded Purine nucleosidyl in the third strand when reading the corresponding purine in the antiparallel strand in Three-dimensional distribution of units [1. When reading purine bases that have Selection with a third strand that has the same polarity as the opposite strand (i.e. is parallel to it) There is. For example, Triplet 1 with a DNA duplex with the same polarity of the Watson strand from 5' to 3° The sequence of the third strand in the sample would be: 5' G@y′″ 3゜ Gs'11 mFn According to one embodiment of the invention, the third strand for reading purines in double-stranded base pairs is When building, apply the following guidelines + (i) Start from 5° end to 3″ end direction Thus, the third strand purine nucleosidyl unit (A or G) (“Watson”) conformation that is seen when reading a purine (A or G) in a base pair of a strand. It is required that the When reading the second purine in the second base pair, this The same requirements apply when the phosphorus is located in the same chain as the first purine. It fits. However, this second purine , the opposite strand is antiparallel to the third strand), then the block is The phosphorus nucleonidyl unit is required to be in the ant i conformation. all In this case, the adenine in the third strand is used to read the adenine in the double strand; The guanine in the strand is used to read the guanine in the double strand.

The third aspect of the present invention enables decoding of purine bases on either mirror of double-stranded nucleic acids. This relates to the length of the bond in the phosphorus skeleton of the third chain. Purine base on either mirror In order to be able to "read" (or base pair with) the phosphorus backbone The distance between nucleondyl units along must increase. Phosphorus skeleton For this reason, a format is proposed in which two types of bonds are lengthened. One type of phosphorus skeleton The bonding format uses a universal extended bond for each nucleondyl unit (i.e. , all of the lengthening bonds of the third strand are identical). This universal form of connection is Particularly suitable for third strands containing only purine bases. That is, "nucleosidyl monomer" From the 5° carbon at position ↓ to the 3° oxygen at the following nucleosidyl unit 2J The length of bond 6 is set to 2 atoms (e.g. -CH, CHt-) or 3 atoms (e.g. - 0-CH.

-CH,-), thereby increasing the bonds between individual nucleosidyl units. It can be extended by 2 to 6 people. Allows for proper distance between nucleosidyl units In order to increase the separation of these units by the number of carbon atoms ranging from 1 to 6 is recommended. Figure 6 shows an example of a nucleosidyl unit that includes a form that lengthens this bond. and propose a synthetic route.

The second bond lengthening format for the phosphorus backbone includes non-uniformly lengthening bonds. There will be. Nucleondyl similar to the phosphodiester backbone of the lapel pin for the third chain A bond with distance is used when the objects to be read are on the same mirror, On the other hand, elongated bonds (15-17 members long) [3° carbon of a certain nucleosidyl unit] Use a long (can contain a bond that is) on the elementary and adjacent 5° carbons. and read the purine base located on the opposite strand. lengthen unevenly like this The linkage format includes both pyrimidine (or pyrimidine analog) and purine bases. Particularly suitable for use in the third strand with

(Hereafter, margin) (B) Double-stranded hem! Formation of a cube structure Figure IA shows a trible with a central A base hydrogen bonded to T on either side, .

Indicates the In this case, one T-containing strand is aligned parallel to the A-containing strand, and the other T-containing strand are arranged antiparallel to one A-containing chain. Therefore, the array of this triblet is Written as: Figure IB shows a protonated C on one side and a center hydrogen bonded to C on the other side. A tribled with C is shown. In this case, one of the triple oligomer pairs is a stable protonated to N3 to form the hydrogen bonds necessary for the triplet node. It has /n. Optionally, this base can be modified to have a proton at a position similar to N-3. can be replaced by cytosine analogs with two nitrogens. Tribre shown In the cut, the C' (or analog thereof)-containing strands are aligned parallel to the central C-containing strand. I'm reading. The C-containing chains are arranged antiparallel to the center (4 chains. Therefore, such The triplet array is described as follows: In Figure 2A, the center A is on one side (r-side AJ) and a trifluoride hydrogen bonded to T on the other hand. rhinoceros The do A-containing chains are aligned parallel to the central A-containing chain.

The T-containing chains are arranged antiparallel with center/ll positions. In such a case, the side A group The lycodyl (C-N) torsion angle is in the normal conformation, and the glycosidium of the central A and T bases is Both nortorsion angles are in the concave conformation. Such a triblet array is Written as: In addition, FIG. 2B shows that the center A forms a triblet with A on one side and T on the other side. Shows the triblet. In this triplet, the side A-containing chain is It is aligned antiparallel to the core A-containing strand. The T-containing strands are aligned parallel to the central Δ-containing strand. Ru. In this case, all three bases are in the same conformation. Such a triblet arrangement Column (described as follows: Figure 2C is hydrogen bonded to G (r-side G, J) on one side and C on the other side. Tribre, G, which covers the center G, is shown. The side C-containing chains are aligned parallel to the center C-containing chain. (The four chains are arranged antiparallel to the central C-containing chain. In such a case, the sa The glycodyl torsion angle of the id G is in the Aras conformation, and the glycodyl torsion angle of the centers G and C is Both torsion angles are in the gnti conformation. Such a triblet array is It is written like this.

Also, Figure 2D shows that center C is hydrogen bonded to G on one side and to C on the other side. Showing a triblet. In this example, the side C-containing chains are antiplanar to the central C-containing chain. The C-containing chains are arranged antiparallel to the central C-containing chain. A place like this In this case, the glycosyl torsion angles of all three bases are in the anti conformation. like this A triblet array is described as follows: Figures 3A and 3B show that the center G is Shows a triplet hydrogen bonded to a modified G on one side and a C on the other side. vinegar. Modified G [2-amino-9-β-D-lipofuranosylbulin- in Figure 3A 6-Selenium (“6-selenium guanosine”) or 6-isopropyli in Figure 3B The chain containing either den-7-deazaguanosine is antiparallel to the central C-containing chain. The C-containing chains are aligned antiparallel to the central C-containing chain. 6-Selenium The guanosine-containing triplets are described as follows: and a triblet containing 6-isopropylidene-7-deazaguanone is written as follows.

The modified G in the third strand reads normal (i.e., unmodified) G in duplex formation. Deletion of the 6-oxo group would further increase specificity.

Figure 3C shows A (2-aminopurine) modified on one side and the center on the other side. The triplet is shown hydrogen bonded to T on the side. The 2-aminopurine-containing chain is central The A-containing chains are aligned parallel to each other, and the T-containing chains are aligned antiparallel to the central A-containing strand.

Such a triblet array is written as; Therefore, Nl of 2-aminopurine accepts a proton from the 6-amino7 group of center A. The 2-amine group of 2-aminopurine donates a proton to N7 of center A. It should be noted that This arrangement induces a guanine base in the third strand, N, H and 2-amine group to N1 group of center G in continuous triblet and 6-oxo A pair of hydrogen bonds is formed by donating a proton to the group. in this way Therefore, the pairing of 8 and A should contain a donor and accept sequence from A in the third strand. , the G and G pairing should contain both donor sequences from the third strand G.

Therefore, the reading of purines by purines may become even more specific. cormorant.

(2) Polypurine target sequence When a single-stranded nucleic acid contains a polypurine sequence, the triplets formed, This strand provides the central purine of the target so that the target is targeted by the first and second oligomers. It is possible to form a triblet that is completely converted into a trill. This Mie A pair of orycomas may both contain polypyrimidine sequences that are complementary to the t order, or In addition, one of the first and second oligomers has a polypurine sequence, and one of the first and second oligomers has a polypurine sequence. It may have a rimidine sequence.

(3) Polypyrimidine target sequence When the single-channel nucleic acid contains a polypyrimidine sequence, this target nucleic acid It will not provide a central purine base for triblet formation. - waterway targets and The first and second oligomers forming the double-stranded helinox structure are both polypyridine. The first and second oligomers may contain a midine sequence, and one of the first and second oligomers may contain a midine sequence. One may have a polypurine sequence, and the other may have a polypurine sequence. target poly The pyrimidine base may not provide the central base of the tributary, so the ``open'' A double-stranded helical fusion of ``sandwich'' is formed, here a triple oligomer -One of the pairs provides the central purine base of the triplet. This triple oligomer pair Both the first and second oligomers are polymerized to reduce duplex formation between them. It would be preferred to contain a liprin sequence.

(4) Mixed array A mixed sequence is one in which the selected single-stranded nucleic acid target sequence contains both pyrimidine and purine bases. is a containing sequence. This trigonium formed using the first and second oligomers A bullet can hydrogen bond to two other bases to form a triplet. It requires a central purine base. Therefore, one of the first and second oligomers is , must be able to "read" across the other two strands. 1st Examples of mixed sequences suitably containing a second oligomer and a second oligomer are shown in FIGS. 4A-4E.

Figure 4A shows a mixed sequence in which the oligomer reading across the other two strands is rich in pyrimidine. shows.

Figure 4B shows a mixed purine-rich sequence in which the oligomer reads across the other two strands. vinegar.

Figures 4C, 4D, and 4E show cross-reading of oligomers containing only purine bases. shows a mixed array. In FIGS. 4C to 4E, "s" indicates "shi", and raJ The character without a superscript indicates a n t i.

Because one of the first and second oligomers base pairs with the central purine base, When you have to read two strands by crossing from one strand to the other, The previously described backbone bonding format is used in the phosphorus backbone that connects the sugar moieties of the nucleondyl unit. It is preferable to provide a longer internucleosidyl phosphorus bond by introducing It would be convenient.

For example, between the 5'-carbon and 5'-hydroxyl of the sugar moiety of the nucleondyl unit, appropriate lengthening of the bond or similar bond between the 3″-carbon and the 3°-hydroxyl. Alkylene [-(CHt). -] or alkyleneoxy[-(CH,)110 −] can lengthen the bond between nucleo and diyl (Figures 5 and 5). and Figure 6). As shown in this figure, attach the linkage for extension to the 3″ and 3″ portions of the sugar moiety. It can be interposed at both carbons of 5'.

When successive central purines used for triblet formation appear on the same chain, There is no need to use such extension bonds (such as methylphosphonate bonds). The internucleonidyl phosphorus bond of (allows the heart to read purine bases).

Therefore, by using such a bond for extension where indicated, − can read the central purine base of either the waterway target or the pond oligomer; oligomers can be prepared.

(C) First and second oligomers specific for the desired sequence of a selected target segment of single-stranded DNA or RNA. having at least about 7 nucleosides, which may be in sufficient number to permit binding. The first and second oligomers are preferred. More preferably about 8 to about 40 pieces An oligomer having about 10 to about 25 nucleosides is particularly preferred. It is an oligomer with nucleosides. Ease of synthesis, selected targets Sequence specificity is enhanced by intra-oligomeric and internucleoside interactions (folding and coiling, etc.), the reduction of about 12 to about 20 Oligomers with rheosides are believed to constitute a particularly preferred group.

(1) Preferred oligomers These oligomers contain ribosyl moieties, deoxyribosyl moieties, or their May consist of modifiers. However, their increased ease of synthesis and stability Therefore, thioxyliposyl or modified ribosyl moieties (e.g. if, 2'-0 -methylribosyl moiety) is preferred.

Nucleotide oligomers (i.e., natural nucleotide oligomers, as well as other with phosphodiester internucleoside linkages present in oligonucleotide analogs. can be used in accordance with the present invention, but preferred oligomers are Nucleoside alkyl and aryl phosphonate analogs, phosphorothioates Oligonucleoside analogs, bosphoramidate analogs and neutral phosphates Consists of triester oligonucleoside analogs. However, particularly preferred is The phosphonate linkage is one or more phosphodiester linkages (two nonnucleo oligonucleoside alkyl and and arylphosphonate analogs. Such oligonucleosidol kits Preparation of several aryl and aryl phosphonate analogues, and pre-selected sN The use of these analogs to inhibit the expression of single-stranded nucleic acid sequences is described in U.S. Patent No. 4.469.883; 4.511.713+4.757.055; 4. 507.433; and 4.591.614 (these disclosures are (which forms part of this specification). Particularly preferred classes of these phosphonate analogs is a methylphosphonate oligomer.

Preferred synthesis method for methyl phosphate oligomer (rMP-oligomer) , Lee, B. et al. [Bioche+n1sLry 27:3197-320 3 (198 g)], and M.I.I. Ier, P., SA et al. m1stryυ:5092-5097 (+986)] (this (the disclosures of which are incorporated herein by reference).

Nuclides with at least 1 phosphodiester sclerond bonds linked at 3°-5° to the interleosidic methylphosphonyl (MP) group (or "methylphosphonate") Oligonucleonidyl alkyl and aryl phosphones substituted by Preferred are analogs. This methylphosphonate bond is the molecule of the oligonucleotide. It has a bond length similar to that of the sphate group. Therefore, these methods Chylphosphonate oligomers (“MP-oligomers”) are combined with selected nucleic acid sequences. should provide minimal steric constraints on the interaction. Also, alkyl or Aryl groups do not sterically hinder the phosphonate bond or interact with each other Other alkyl or aryl phosphonate linkages are suitable. This methyl Since phosphonyl groups are not found in naturally occurring nucleic acid molecules, these MP-nucleotides The polymer is highly susceptible to hydrolysis by various nuclease and esterase activities. should be highly resistant to Because of the nonionic nature of the methylphosphonate bond, These MP-oligomers are better able to cross the cell membrane and therefore It should be possible to incorporate it more easily. Certain MP-oligomers are more resistant to nuclease hydrolysis (by cultured mammalian cells) taken up in intact form and specific for cellular DNA and protein synthesis It is known that it may exert an inhibitory effect (for example, U.S. Patent No. 4. 469.863).

Preferably at least about 7 and more preferably at least about 8 nucleotides. MP-oligomers with glycan units, which are usually single-stranded DNA or sufficient to allow specific recognition of the desired segment of RNA. even better Preferred are MP-oligomers having from about 8 to about 40 nucleosides; Preferred are MP-oligomers having from about 10 to about 25 nucleosides. Ru. Ease of preparation is combined with specificity for the chosen sequence and nucleic acid within the oligomer. In combination with minimizing inter-osidic interactions (e.g. folding and coiling), Particularly preferred are MP-oligomers of about 12-20 nucleosides.

Particularly preferably, the 5°-nucleo/dyl bond is a phosphodiester bond. MP-oligo in which the remainder of the nucleo/dyl bonds are methylphosphonyl bonds It's Ma. Having a phosphodiester bond at the 5′-end of the MP-oligomer allows for the labeling and electrophoresis of this oligomer by a kinase, and also , improving its solubility.

The selected single-stranded nucleic acid sequence was sequenced and an MP-oligo complementary to the purine sequence was sequenced. The mer is prepared by the methods disclosed in the above patents or herein.

These oligomers can be used in mixtures of nucleic acids or isolated cells, tissue samples or bodies. Determine the presence or absence of a selected single-stranded nucleic acid sequence in a sample containing a liquid It is useful for

These oligomers are useful as probes in the hybridization assay. Yes, and can be used in detection assays. When used as a probe, These oligomers can also be used in diagnostic kits.

Optionally label groups such as psoralen, chemiluminescent groups, crosslinking reagents, intercalators, etc. – Sikono reagents (e.g. acridine) or cleavage of the targeted portion of the viral nucleic acid. molecules such as O-phenanthroline steel or EDTA-iron ) can be introduced into this MP-n ribomer.

These oligomers can be labeled by any of several well-known methods. I can do it. Standard labels include radioactive isotopes as well as non-radioactive reporter groups. is included. Isotopic labels include 'H1''3%31p, 11S1.Cobalt, and 14c. Most isotope labeling methods involve the use of enzymes and are Known 2-noctran-rayon method, terminal labeling method, second strand synthesis method, and reverse Includes transcription methods. When using radiolabeled probes, do not accidentally damage the radiograph. Hybridization by fee, millimeter/gram counting, or gamma counting can be detected. The detection method of choice is hybridization It will depend on the conditions and the specific radioisotope used for the label.

Non-isotopic substances can also be used for labels, and modified nucleic acids can be modified using enzymes. or by chemical modification of oligomers by the introduction of leonodo or nucleotide analogs. can be introduced by decoration, e.g. by the use of non-scleotide linker groups. Wear. Non-isotopic Rahels include fluorescent molecules, chemiluminescent molecules, enzymes, cofactors, and enzyme groups. This includes the ligands of the protein, habten or its ponds. One preferred labeling method involves the introduction of an acridinium ester.

Such lachelated oligomers can be used as probes in hybridization assays. C, and is particularly suitable for use in hybridization assays.

When used to interfere with the function or expression of a single nucleic acid sequence, these One or both comers may be conveniently derivatized or modified to introduce nucleic acid modifying groups. (This causes a reaction with the nucleic acid and irreversibly changes its structure.) (qualifying it, thereby making it non-functional). Concurrent patent application filed by the inventors U.S. Continuation No. 924.234 (filed October 28, 1986) [this The disclosure of the application is incorporated herein by reference to the oligonucleoside alkyl and derivatization of oligomers containing arylphosphonates and arylphosphonates and such derivatives. Using conductorized oligonucleoside alkyl and aryl phosphonates It is taught to render a targeted single nucleic acid sequence non-functional.

These oligomers can be derivatized with a wide variety of nucleic acid modifying groups. . A derivatized oligomer (or group of oligomers) is attached to the nucleic acid modifying group. After forming a wax structure into a triple strand with a heavy chain nucleic acid segment, the nucleic acid segment or covalent bond formation, cross-linking, alkylation, cleavage, or degradation of the target sequence portion. or otherwise cause inactivation or destruction, thereby Capable of irreversibly inhibiting the function and/or expression of said nucleic acid segment Contains groups.

The position of the nucleic acid modifying group in the oligomer (or group of oligomers) may vary; This will depend on the particular nucleic acid modifying group used and the specific nucleic acid segment. Dew. That is, this nucleic acid modifying group may be located at the end of the oligomer, or may be located at both ends of the oligomer. It may be located between the ends. A large number of nucleic acid modifying groups will be included. Ma Alternatively, both the first and second oligomers may contain nucleic acid modifying groups.

In one preferred embodiment, the nucleic acid modifying group is photoreactive (e.g., specific (activated by light at a wavelength or range of wavelengths), oligomers and single-stranded Causes a reaction between nucleic acids, ie crosslinking.

Examples of nucleic acid modifying groups that can cause cross-F are psoralen, e.g. It is tiltrimethylpsoralen group (AMT). This AMT is conveniently photoreactive can be activated by exposure to light of a specific wavelength before cross-linking. Must be. These can be combined with other crosslinking groups that may or may not be photoreactive. Oligomers can be derivatized.

In addition, this nucleic acid modifying group separates from the oligomer upon reaction and becomes a nucleic acid segment. contains an alkylating reagent group that covalently bonds to the agent and renders it inactive. Appropriate a Alkylating reagent groups are known in the field of chemistry and include alkyl halides, alkyl halides, and alkyl halides. Includes groups derived from cetamide, etc.

Nucleic acid modifying groups that would cause cleavage of nucleic acid segments include transition metal chelates. chemical compound, such as ethylenediaminetetraacetic acid (EDTA) or its Contains derivatives. Other groups that can be used to perform the cleavage include fe These include nanthroline, porphyrin or pleomycin. EDTA When used, it tethers the iron to the oligomer and conveniently assists in the generation of the cleavage group. be able to. EDTA is the preferred DNA cleaving group, but other nitrogen-containing substances, For example, ab compounds or nitreen, or other derivatives. Transfer metal chelation complexes can also be used.

A first or second oligo that reads the purine bases on the two mirrors to form a triplex sequence. The nucleondyl unit of mer is a mixture of purine and pyrimidine bases or purine salts. It may consist only of the base.

When reading purine bases on two mirrors in a triplex arrangement, read the purine bases that have only purine bases. Preferably, "cross-reading" oricomers are used. This kind of pudding-only food Sesame is considered advantageous for several reasons: (a) pudding is pirimi; It has higher lamination properties than gin, and this is achieved by the triple-stranded link structure. (b) Only the use of purines tends to increase the stability of cytosine (that is, it has a hydrogen available for hydrogen bonding at the N-3 position at neutral pH) ) or such available water at the position corresponding to N3 of pyrimidine 1. eliminates any need for the use of analogues of the elements, and provides a universal extension. Enables the use of lengthening joins.

substituents (e.g. methyl, bromo, isopropyl or other bulk It is possible to modify the purine at the 8-position using a In other words, like this It will be. Therefore, when a purine base in a further conformation is shown, the present invention is optionally substituted with such 8-substituted purines in place of unsubstituted A or G. intended for introduction. Research using the Kendrew model has shown that It is shown that conversion should not affect the formation of wax structures into triple strands.

Using purine nucleosidyl units in the monomeric and engineered conformations where appropriate is (following the rules for reading the central purine base described herein) two mirrors. Reading the central purine base above and hacking into the triple strand with the purine-only third strand allows for the formation of space structures.

on two mirrors in a triplex array using oligomers containing both pyrimides and purines. When reading Pudding, use the non-uniform combination format described herein. The third strand (the “cross-reading oligomer”) cross-reads from one of the two strands to the other. make it possible to

(2) Preferred Purin Orikoma The present invention describes a new class of polymers containing nucleosidyl units selected from: Provide oligomers and [wherein Bp is a purine base; R is independently from alkyl and aryl groups selected (so that the phosphonate bond is not sterically hindered and these groups are mutually selected so as not to interact with each other); R' is hydrogen, hydroxy or methoxy; and alk is alkylene of 2 to 6 carbon atoms or alkylene of 2 to 6 carbon atoms. is an alkylene of a carbon atom].

Preferred are oligomers containing at least about 7 nucleosidyl units. It is.

Preferred are nucleosidyl units in which R is methyl. Also, R゛ is hydrogen Preferred are nucleo/zyl units. A suitable base Bp may optionally have the 8th position Preferred substituents include adenine and guanine, which may be substituted. includes methyl, bromo, isopropyl, etc. In addition, according to other preferred embodiments, If so, the preferred oligomers that read the central purine base are triblet formation and It may contain purine analogs modified to favor stability. these Purine analogs include 6-selenium guanosine or 6-selenium guanosine instead of guanosine. -isopropylidene-7-deazaguanosine or 2-alternative to adenosine Contains minobrine. Alk groups having about 2 to 3 carbon atoms are preferred. Special Preferred are alk groups having 2 carbon atoms and include ethylene.

(3) Oligomer containing cytosine analog In another embodiment of the present invention, cytosine analog-containing oligomer Nucleosidyl in which syn is replaced by a heterocycle-containing cytosine analog Novel oligomers containing units are provided. This heterocycle is 3 of the cytosine ring. -N has available hydrogen in the same ring position, and guar in the duplex at neutral pH. can form two hydrogen bonds with the nin base, thus forming a Hoogsteen-type salt Requires protonation such as that required by cytosine for group pairing or triplet formation. It is an unnecessary heterocycle.

A suitable nucleosidyl unit is a hydrogen bond at the ring position corresponding to N-3 of cytosine. has hydrogen available for and neutral p) (with a guanine base in the duplex and two Contains analogs with a 6-membered heterocycle capable of forming hydrogen bonds. child This includes 2°-deoxy-5,6-cyhydro-5-azadeoxycytidi/(■) , pseudoisocytidine (11), 6-ami/-3-(β-D-ribofuranosyl ) pyrimidine-2,4-dione (II+), and 1-amino-1,2,4-( β-D-deoxyribofuranosyl) triazin-3-[4H]-one (!V) (These structures are shown in Table (1) ~ General Description As mentioned above, the preparation of methylphosphonate oligomers is described in US 4e No. 4 ．． 469.863: 4,507,433; 4.511,713; 4,59 1,614; and 4.757.055.

A preferred method of synthesis of methylphosphonate oligomers is described by Lin, S., et al. [Bioc heen 1stry28: l054-1061 (1989) 1: Lee, B. L et al fBiochemistry 27:3197-3203 (1988)n ：Oyo Miler, P, S, et al. [25:5092-5097 (1986) (the disclosures of which are incorporated herein by reference). extended knot Oligomers containing nucleosidyl units containing modified sugar moieties with and FIG. 6) can typically be prepared by these methods.

Oligomers containing phosphodiester internucleosidyl phosphorus linkages can be prepared using several conventional methods. It can be synthesized using any of the following. These conventional methods include cyanoethyl phosphate. Automated solid-phase chemical synthesis methods using holamidite precursors are included (29).

Optionally, nucleosidyl units containing cytosine analogs as described above (see Table 5) can be used. ) by substituting the appropriate /thidine analog (see Table 5) in the reaction mixture. can be introduced into MP-oligomers by

The bond between the 5°-carbon and 5°-hydroxy or the 3°-carbon and 3′-hydroxy of the sugar moiety Either of the bonds between doroxy groups is an alkyleneoxy group (e.g., ethyleneoxy MP-oligomers using modified nucleosides substituted with It can be prepared.

Figure 5 shows whether the 3゛-(ethyleneoxy) or 5゛-(ethyleneoxy) bond The proposed reaction scheme for the preparation of intermediates for modified nucleosides with It is something. In FIG. 5, B represents a base, and Tr and R represent a protecting group ( Tr represents a protecting group such as dimethoxytrityl, and R represents (-butyldimethylsilyl). or a protecting group such as tetrahydropyranyl).

Optionally, with the extended linkage at the same 3′- and 5′-positions of the sugar moiety. nucleosidyl units can be prepared.

(both the target sequence and the first oligomer) include a slightly extended nucleotide on the phosphorus backbone. Preference will be given to using oligomers with interrheosidic linkages.

Such oligomers replace 5°-hydroxy with β-hydroxyethyl (HO-C Sugar (deoxyribosyl or ribosyl) moiety to be substituted with H, -CH, -) group (such as 5゛-β The synthetic formula for the preparation of -hydroxyethyl-substituted nucleosides is shown in Figure 6. vinegar).

Figure 6 shows the proposed reaction equation for 5°-β-hydroxyethyl-substituted sugar analogs. This shows that. In Figure 6, DCC represents dicyclohexylcarbodiimide. and DMSO represents dimethyl sulfoxide. B is a base. suitable protecting group R includes t-butyldimethylsilyl and tetrahydropyranyl. Ru.

The MP-oligomer introduced with the above modified nucleosidyl unit is prepared as described above by substituting the nucleosidyl unit.

When preparing oligomers containing only purine bases, it is important to A nucleosidyl unit can be used. However, pyrimidine (or pyrimidine analogues) in preparing oligomers containing both bases and purine bases. contains nucleo/zyl units with nonextended and extended bonds. using a mixture of It has an extended bond at both the 3°-carbon and the 5″-carbon of the sugar moiety. A nucleo/zyl unit would be advantageous.

(3) The derivatized oligomer made of 51al of the derivatized MP-oligomer is Easily prepared by adding desired DNA modification groups to oligomers Can be done. As noted, the number of nucleosidyl units in the oligomer and the The position of the DNA@decoration group in the gomer can be varied. This DNA modification group The part that most efficiently modifies the target DNA sequence is the DNA segment involved. This will depend on the agent and its key target site or sites; The optimum position can be easily determined by conventional methods known to those skilled in the art.

(a) MP-oligomer derivatized with psoralen Preparation of 8-methoxypsoralen and and psoralen such as 4°-ami/methyltrimethylpsoralen (AMT). Derivatization of MP-oligomers was described by Kean, J. M., et al. sLry 27:91H-9121 (1988)] and Lee, B.L. , et al [Bioche+m1sLry 27:3197-32O3 (1 988)] (the disclosures of which are incorporated herein by reference).

21054-1061 (1989)] (the disclosure of which is incorporated herein by reference). ).

(E) Satonuri According to the invention - a specific segment of the heavy chain nucleic acid can be The first orifice that forms a double-stranded helinox with a single-stranded nucleic acid according to the bullet base pairing guidelines. and a second oligomer. These first and the second oligomer, the bases of each nucleosidyl unit of each oligomer are single-stranded. Forms triplets with corresponding bases in the nucleic acid sequence to give a linox structure to the double strand. It has a sequence selected to Detectably labeled oligomers as a probe for use in a hybridization/:I assay, e.g. For example, the presence of a specific single-stranded nucleic acid sequence can be detected.

The invention also provides - a method of interfering with the expression or function of a selected target sequence of a heavy chain nucleic acid; , hydrogen bonds with the single-stranded target as described above, and then bonds with it to the double-stranded heli-node. method by using first and second oligomers forming a polymer structure. provide The formation of double-stranded heli- expression and/or function, such as by preventing binding of protein (e.g. protein). Probably. That is, according to the present invention, the target sequence of the -heavy chain nucleic acid is recognized in two steps or in two steps. It will be recognized that: (1) The first time is a 1-look watsonk with the first oligomer. (2) by the formation of a duplex by base pairing; and (2) the second the second oligomer so that the polymer can be read across multiple strands; with or without an extended bond between the open nucleosides of - By forming a duplex with a second oligomer. In this way, with a high degree of selectivity A high affinity complex is formed. On the other hand, using derivatized oligomers, or by cleaving (EDTA) or cross-linking (psoralen) both strands. can be detected or located and then irreversibly modified . By careful selection of the target site for cleavage, one side of the oligomer can be molecularly scissored. can be used to specifically excise selected nucleic acid sequences.

These oligomers can be derivatized and reacted with nucleic acid segments or their target sequences. cause irreversible modification, degradation, or destruction of the nucleic acid; Introducing nucleic acid-reactive or modifying groups that can irreversibly inhibit its function. I can do it.

These oligomers can be used to target specific genes or their target sequences in living cells. can be activated or inhibited, allowing selective inactivation or inhibition.

This target sequence can be directed to DNA or RNA, e.g. bresRN, a+RNA or RNA sequences, such as start codons, polyadenylation regions, mRNA cap sites, or a splice function. These oligomers are then used to create defects or a gene that produces an undesired product, or a gene that, when activated, produces a desired product. It is possible to permanently inactivate, denature, or destroy genes that cause unwanted effects. can.

Another aspect of the invention relates to Ki7) for detecting specific single-stranded nucleic acid sequences.

The kit contains first and second oligomers, at least one of which is - sufficiently complementary to a target sequence of a heavy chain nucleic acid and having a double-stranded helinox structure with the target sequence; detectably labeled purine MP-oligomers selected to form It is.

To aid in understanding the invention, a series of experiments, including computer simulations, are presented. Examples are given below that describe the results of the experiments. These embodiments of the invention are It is not intended that the invention be limited to specifics. Within the understanding of a person skilled in the art Modifications of the present invention, now known or hereafter developed, which fall within the scope of It is considered to be within the scope of the invention as claimed.

(Hereafter, margin) Example Implementationff1l+ Computer simulation of double-stranded helix structure The aim is to gain insight into the molecular mechanisms involved in this process.

(A) Nomulation method Double-stranded poly(dT+a)-poly(dAlo)-poly(dT+o)[T+ATt] The coordinates were determined from the A-DNA X-ray structure of ArnotL and Selsing (10). I got it from The same coordinates are poly(dT,,)-poly(dA,.)-poly(dT,,) used for the first external form of tylphosphonate [T1ΔT tM P] . Optimal external morphology for dimethyl ester methylphosphonate fragments and partial atomic charge assignments are 3-21G* and 5TO (d basis set), respectively. First, by quantum mechanical methods using QtJEST (version 1.l) using Calculated from (11). Using the latter basic set, we added The same charge assignments were maintained as those previously calculated for the nucleic acids in the sample. MP hula Perform the final 11-pole atomic charge assignment for the Neutral net charges for each base and furanose were obtained. T, MP chain Alternative Rp- and SP-/thyl substitutions of the backbone phosphoryl oxygen are stereoconformed. Made with pewter graphics. Because synthesis cannot be controlled, Substitution of MP diastereomers was performed in this manner, approaching experimental yields. molecular force and molecular dynamics calculations using AMBER's fully vectorized (vect ortzed version (version 3.1), it is possible to perform (12.13) All calculations are done on CRAY X-MP/24 and VAX 8 Line ivy on 600+ computers.

By substitution of the positive counterion in 4A of the phosphorus atom bisecting the phosphate oxygen Neutralize the negative charge on the DNA phosphate backbone; place the counterion on the MP-substituted mirror. It didn't happen. The double-stranded helinox and counterion are TI with intermittent boundary states It was surrounded by an IOA shell of P3P water (14) molecules. T, AT, and T, A There are 9,283 and 10,824 atoms in the T and MP systems, respectively. The dimensions of the box are , 101,686.8A' for T,AT, and for T,AT,MP. It was 124,321°Sks. First, the DNA and counterion atoms are thoroughly 8. Restricts surrounding water molecules. energy until convergence using OA non-coupling cutoff (root mean square of slope [rmS] < O, l kca11 mol/A) . Subsequently, DNA, counterions, and water are further combined for 150 min without geometrical constraints. Energy minimization is performed in 0 cycles, followed by maximum optimization by activated 5HAKE. Miniaturization was performed for 220 cycles (15). Normal temperature and normal pressure (300 and I/ Molecular dynamics using 5HAKE was performed using 40p for each of the two molecular populations. The sec trajectory was performed without constraints.

(B) Results of simulation research A third DNA strand with an MP backbone connects the MP backbone in the double-stranded lysox. Several changes occurred that were consistent with increased binding of the ODN. average hydrogen bond distance The separation and average atomic fluctuations are consistently relatively small in the T, AT, MP triple strand. (Table 1). The mirror-opening phosphorus atomic distance is 9.6A (±/-0,9 1) and A - T, M was 8.3 A (Tomoe/-0,58) . Reduced optical phosphorus atomic distance between the second and third chains and a relatively small mean element The child fluctuations may also be due to a decrease in electrostatic repulsion accompanying MP replacement in the spine. It is.

For both duplexes, the Linox DNA system generates strand-specific polymorphic components through molecular dynamics. It had a home/gun movement. The first outer surface in both systems in furanoses There is a significant change in the shape of the human body compared to the normal morphology (Table 2). T, AT, helicopter In the chain, T, and the furanose ring population of the T, chain form the A-DNA compomer. remains predominant in the chain (C3° end) and accounts for the largest proportion of adenine sugars. In this case, B-DNA funkhome 7g (C2 end) was used. worth paying attention to The adenine fura/-1 conho J-7g of the combination is T, AT, and T, AT, MP. It was in the 0 1' end conformation. MP-substituted helinox saccharide The type has a larger proportion of 01' ends and C2 to unsubstituted helinoxes. ’ had endoconformation. of other conformational parameters. Analysis supports the ibrinodofunhomecidin-like nature of these double-stranded helinox. I have it. The torsion angle of the helix (the average between the TI and Δ chains is T, AT, The structure is 39.4 degrees (2.86 degrees), and the B-DNA funkhomesi 3 (range 36-45). T1AT+MP Helinox torsion angle is flat The average angle is 320 degrees (±\-2,19), and the torsion angle of A-DNA (range 30-32 ．． 7) is closer. Helical repeats for the entire structure - number (between Tl and A chains) The average of T, ΔT, 1o, 2 and T, ATtMP is 11.2 degrees It is. Table 3 shows the average intrachain phosphorus atom distances over 40 psec trajectories. Both helicopters In the box, the intra-pathway phosphorus distance of the T chain is the A-DNA component tan (7, O It is most consistent with A). The stepping distance of the T, MP chain is A-D for the T, chain. For values that are relatively consistent with NA, B-DNA funhome-7gin and more = one We are doing so.

The present inventors analyzed the coordination of z・t ions and water along the DNA spine, and found that M The change in V accompanying the Pa exchange was measured. The average coordination distance of a counterion with a phosphorus atom and The original f fluctuation is 3.8A (+\-0,6) for T, AT, and T, A It was 4.6A (10\-0,9) for wax to T and MP. T, AT, M The increase in average coordination distance and atomic motion in P (0,8A) is relative to the second chain. Possible due to the proximity of the Rp (aki/al protruding) methyl group to the counterion coordinated with sex is the biggest. The average number of water molecules coordinated to the phosphate group is It is not significantly modified in the modified helinox.

Table 4 shows the two helices, the C1'-N (base) biplanar rearrangement, and the C1'-N (base) DNA backbone. show. Comparison of the α-biplanes of the adenine chain reveals the average position of the two planes with MP substitutions. It is clear that a slight change in position, placing the two planes closer to the transformer. However, there is a large difference in the dislocation motion of both two planes through the 40 psec trajectory. There is an overlap. 5 p-M P diastereomer β dihedral angle from baseline There was a significant change (27,0 change) in the mean of Sp-MP diastereomerism. The fluctuations of the β biplane containing - were significantly smaller than Rp, , MP.

(C) Interpretation of 7 E, s ration results The results of these molecular dynamics calculations It is incorporated as a colinear third strand by Hoogsteen-type pairing. The MP-substituted ODN is, as in the poly(dT)poly(dA)poly(dT) example, It will form a double-stranded helix that is more stable than natural ○DN as the third strand. It is expected that The increase in iφP chain binding is due to the decrease in mirror-opening electrostatic repulsion. It is. Wax to MP substitution decreases the hydrogen bond distance, and the path A-T, phosphorus distance reduced the separation and lowered the fluctuation of atomic positions compared to natural double-stranded helix. . A tighter fit and reduced atomic motion in molecular dynamics results in MP placement. Larger binding enthalpy and stability and quality of substituted triple helinox complexes are in agreement. These findings demonstrate that MP substitution in the third strand is a mirror-opening phosphate reaction. The reduction in oxidation facilitates the formation of a wax structure into a more cohesive double strand, and the second Further connections of Hoogsteen and Watson-Crick hydrogen bond interactions I support what will bring about the future. Dominance over Hoogsteen pairing One might expect that it would have a significant effect, but in these calculations, MP replacement There is an unexpected enhancement of hydrogen bonding. The latter discovery is due to the fact that T1 and T, due to reduction in electrostatic repulsion between the MP chains and shielding (by the third chain) Most likely.

These DNAtjt constructions are based on experimental data based on fiber diagrams. is different. The structure of poly(dT) poly(dA)-poly(dT) is under the condition of 92% humidity. Its structure is a poorly resolved structure, as determined by X-ray diffraction studies below (10). minutes The molecular dynamics simulation shows that the solution is well-dissolved under intermittent boundary conditions with counterions. It is about a mediated DNA structure. Type B of DNA in solution is usually predominant. However, under conditions of relatively low humidity, the A-DNA compome Nyong is dominant (16). Some double-stranded DNA helix structures are It has been determined by folding studies that A-DNA fragments under conditions of low humidity and increased salt concentration. It is uniformly observed in the embomation (In, 17, +8). these Computer simulations of different DNA conformations/! 1st coexist within a double-stranded helix, with either individual strands of the helix or the dominant funformation The MPi exchange DNA strands with Hoogsteen pairing have a population and are dominated by type B. It is predicted that A large proportion of the 01' endosaccharides in both triplexes is due to this furanose The funtion is 02' end and C3, 0.6k from the endo DNA sugar fold. This is important because it has a high ca11 mole (T6). DNA12ffi crystal structure (19 ) has a notable O1'xnd population, and the ds by 5eibel et al. (2o) A significant proportion of 01′ endosugar folds was observed in DNA molecular dynamics. both The heli-nox structure is typically a pudding-nox structure that adopts a C2'-end external morphology. Classical observations of pyrimidines adopting an endomorphic morphology following.

RP in the duplex, and the β biplane of S P, M P diastereomers and The large fluctuations in the variable Funhome/Yon fluctuations are due to non-bonding and hydrophobic interactions. This is due to The Sp-MP group is located on the mirror on the same DNA strand (major groove). ) is very close to the interaction between van der Waalska and However, this group creates a local helium by “anchoring” thymine to the Sp MP spine. could destabilize the system. There is an even larger deflection in the β biplane of the Rp-MP group. This is because these groups protrude into the solvent water and are further away from the thymine methyl group. This is because they are located far away. Orientation of methyl substituents on phosphorus atom and DN A known relationship exists between the A duplex stability and the S p-M P diastereomer The proposed mechanism for the decreased stability of is due to local steric interactions (21 ). According to our calculations, the steric ten-molar interaction is caused by local heli-cus destabilization. The dominant mechanism is the same as that of the methyl group in the Sp-MP backbone. It is mediated by non-bonding interactions between thymines on the road, which localizes the DNA. It is suggested that it becomes unstable locally.

Friendship plate λ Detection of double-stranded helix formation using circular dichroism spectroscopy Circular dichroism Spectroscopic studies were conducted using a combination of nucleoside oligomers formed using This was done using a double-stranded helinox structure.

1: abbreviated as d(CTCTCTCTCTCTCTCT) d(CT) E”’=9.2X10’M-’cm-’+1:d(AGAGAGAG AGAGAGAG)d(AC), abbreviated as E"' = 1.45x 10'M-'cm-'lit: d(CpTpCpTpC 4TpCpTpCpTpCpTpCpTpCpTp) d(CpT)-* or d( CT) 8 abbreviated as E"' = 8.5x l O'M-'am-' (a) 2: ] d(CT)s ・d(AG)s and (b)l: 1 + 1 d(CT)s Regarding the double-stranded helinox structure created using -d(AC) and d(CPTP)* Circular dichroism (CD) spectroscopy was performed in 0.1 M phosphate buffer at the indicated pH. It was performed using a CD spectropolarimeter.

Figure 7 shows double-stranded helinox (a) [2:I d(CT)*・d(AG)s(2 ] and (b) [1: 1: I d(CT)ll-d(AG), -d(CT ), (222)] is shown.

Example 3 Double-stranded helix structure using psoralen derivatized MP-oligomer crosslinking Psoralen-derivatized dTp(T)6 oligomer was prepared by Lee, B., L., et al. [Bio Chemistry 27: 3197-3203 (1988)] disclosed It was prepared as follows.

The T7 oligomer has the following sequence containing the l 5-mer poly dA subsequence: Hybridized with NA.

5' 10 20 30 40 3゜ d-T^^TACGACTCACTATAGGGAGATTTTTTTTTT TTTTACGAGCTd--^TTATGC dingGAGTG/, TATCCCT CTA＾＾＾＾＾＾AAA＾＾＾＾AATGCTCGA3゛5゛ 4゛-(aminoethyl)aminomethyl-4,5°,8-trianethylpsoralen [ "(ae)AMT"], 4"-(aminobutyl)-aminomethyl-4,5' , 8-trimethylpsoralen [″(ab)AMT″]t and 4-(amino-xyl ) aminomethyl-4,5°,8-trimethylpsoralen ["(ah)AMT"] The derivatized MP-oligomer was transferred to (a) the single-stranded DNA of the above DN'A sequence. and (b) hybridized with double-stranded DNA of the above sequence at 4°C and irradiated. Crosslinking was caused as described by Lee et al.

The results are shown in Figures 88 and 8B. Figure 8A shows one of the psoralen-derivatized T7 oligomers. Cross-linking with a full-stranded (IJA-containing) DNA sequence is shown.

Figure 8B shows cross-linking of double-stranded DNA with double-stranded DNA sequences.

Table 1 Average hydrogen bond distance (RMS) Watson Crick Without MP APE with MP HN6B-THY 04 2 ．． 33 (+/-0,31) 1.98 (+/-0,15) ADE Nl -TH Y H32,10(+/-0,17) I,95(+/-0,13) Hoogste een ADE HN6A-THY 04 2.12 (+/-0,22) 2.09 (+ /-0,19) ADE N? -THY 83 1.94 (+/-0,16) 1.92 (+/-0,12) T, AT, and T + A T t M P helicopter The average Watson-Crick and Hoogsteen hydrogen bond distances in Tux ( Angstrom). 1 lux DNA to double strand these distances? About 1 combination Calculate. The fluctuation of the atomic position (calculated as the root mean square [r+ns]) is (in) represent.

Table 2 Average, phase and hunhomesion population heliphus chain of furanose folds (Q) Average (RMS) Phase RMS C3’xnd 01’xnF C2’xn Do 01’z4 So Tl O, 36 (±0.06) 35.70 (±24.7) 86.8% 6.6% 6.6% O, [1% A O, 39 (tho, 05) 107.44 (±30.8) 3.6% 34.3% 57.1% 5.0 %T2 0.38 (Sat o, o6) 40.99 (±24.1) 75.3% 24.1% 0.6% 0.0% Tl O, 38 ("0.06) 36.71 (±26J6) 79.1% 18. F% 2.8% 0.0% A O, 39 (±0.05) 109.78 (+28.59) 14.7% 41.5% 43.8% 0.0% T2-MP 0.40 ('0.05) 103.14 (±29.50) 11.2% 61.8% 27.0% 0.0%T, AT, and furanose sugar folds (Q ) average, phase and conformal population (15). Q is angstrom, phase degree, and the population has total furanose conformation in each of the three DNA strands. Expressed as a percentage of the total weight.

Table 3 TI 6.5 (±10.28) 6.2 (±10.31) A 7.0 (±10. 26) 7.1 (±10.24) T2 7.3 (±10.29) 6.8 (±1 0.26) Intrapathic phosphate distances of T, AT, and T, AT, MP helices . Road phosphate distance calculated by averaging over 40 psec trajectory Trom) is shown for all double-stranded helinox systems. Standard link distance is A-DN Regarding A6. About OA and B-DNA7. It is OA (15).

Table 5 Example 4 Double-stranded helix with single-stranded bolideoxypurine nucleoside target Formation of chronic union d(AG), the formation of a double-stranded helinox complex with a single-stranded target (11), °-0-methyl-pseudoisocytidine (piC) and 2″-0-methyluridine ( X) in an alternative sequence (piCX)vpiCT(1) This is illustrated using two chains of tide analogs. Furthermore, d(AG), d(CT), two The formation of a double-stranded helical complex between the main strand (II: Ill) and I was shown.

[d(CT)s is indicated by Ill. ] (Δ) 衾秋n方迭 All chemical products are from Idrich Cheko 1cal Company+In c, obtained from (Milvaukee, I.).

The solvent was Fisher 5 scientific Co, (Pittsburgh , PA). TLC was performed using silica gel 60F t5-plate (Merc k, West Germany), and the column 07 graph is free. It was performed on Kagel G60 (70-230 mesh, SMT, Merck).

HPLC used PRP-1 column (I (Amilton, Reno+ NY) VisLa5500 (Varian, 5unnyvale, C^) or a 0DS-3 column (Lhataan, C11rton, NJ) It was performed on a Varian 5000. Radioactivity is measured using LS7500 liquid scintillator. Calculated by application counter (Beck+un, Columbia, VD) I measured it.

For CD, UV7i titration, melting/annealing and gel electrophoresis studies. The following slow TH solution was used: - Slow III solution A - 0.01M sodium phosphate, 0. 1M NaCl 1,0, O 1mM EDTA, pH 7,2: Buffer B: 0.02M Sodium phosphate, 0, OIM NaCl, 5mM MgCl; Buffer C: 0. 01M sodium phosphate, 0.35M NaCl, 5mM MgCl, pH 7,2; Buffer D: 0.06M Tris-borate, 5M MgC1,,0,0 75% M E DTA, pH”?, 3° (B) Nucleonodide analogs and oligos Synthesis of nucleotide analogs X and piC using reported methods (30, 31, 32) and their corresponding amidite synthons (aiidiLe 5 ynthons) (33.34). oligonucleotide I, A DNA synthesizer (MilIge) was used according to reported methods (31, 32). Synthesized by either n7500 or Applied Biosystem) did. After deblocking and cleavage from the solid support by concentrated N840H treatment, I with the protected dimethoxytrityl (DMTr) group was purified by HPLC. Manufactured. The fractions were treated with 80% acetic acid solution to unblock the DMTr groups and then The oligomer was purified by HPLC. Purified oligomer I from this preparation is HPLC analysis showed a single peak. Starting from 2 μmol solid support material, 2 ．． 50. D, the unit I is obtained and the CD spectrum is measured using a J-500A CD spectropolarimeter. (Jasco, Japan). Sample temperature is controlled using a circulating water bath. I controlled it. Concentration of the oligomer(s) under vacuum followed by appropriate relaxation of the residue. Dissolution in buffer solution is as follows: 1. -II-I11 sample preparation was performed. This mixture The mixture is made by cooling a solution of the ll-Ill duplex in buffer A on a water bath and then The solution was prepared by adding 1 to 1. Keep the entire solution mixture on a water bath for 30 minutes, It was then kept at room temperature for an additional 30 minutes. After measuring the CD spectrum of this mixture To set the final salt conditions for Buffer C, add concentrated salt solution to the mixture, then Another spectrum was measured. Adjust the sample temperature by adjusting the liquid circulation from a temperature-controlled water bath. Controlled by a ring.

(D) Gel electrophoresis Gel electrophoresis experiments were performed using a 20X22cm glass slab and a 0.7F+a++ spacer. prepared in a Bio-Rad Protean If gel apparatus with a A gel containing 15% polyacrylamide in a buffer solution was used.

Double strand (II-Ill) solution 1ffl (2.5 μL) and third strand (1) (2.5 μL) m,) prepared by mixing at 4°C and then equilibrated for 5 minutes at room temperature. Samples (5 μl,) were diluted with 3% glycerin, except for the mixture of The roll was prepared in a buffer bath and kept at room temperature for 1 hour. Each sample is 5° Contains an oligonucleotide labeled with 31P as a marker at the end . Bromophenol blue tracking dye (0,025%) as the only oligonucleotide added to the sample containing the de-molecule. Experiments were carried out at room temperature, at 200 volts (5-10 mA) for 4 hours. After electrophoresis has stopped, the gel is dried under vacuum, subjected to autoradiography. Furthermore, the band is also cut from the gel and radioactive was measured.

(E) UV mixture titration and melting/annealing LIV absorption in Varian DM Measured by SI OO and 219 spectrophotometer. Melting/annealing temperature Temperature graphs were modeled by Varian 2+9 with a temperature controlled sample compartment. I watched it. The sample temperature is determined by a scale inserted into the gummy cuvette. liquid from a temperature-controlled bath being monitored with a thermistor probe Controlled by circulation.

The formation of the duplex 1:11:I was confirmed by CD spectral studies. (Figure 10A? et al.). Figure 9Δ shows single-stranded I, 11 and III CD chains at pH 7.2. Showing the spectrum. The CD spectrum of 1:11 (2:l) is O, IM NaCl ( Shows a large negative band at 213’nm in buffer A) + 0.25M NaC Similar spectra were observed with the addition of 1 and 5 nM MgCIt (buffer 0). It was noticed. Such spectra can be seen in both polymeric and oligomeric systems. (Homopyrimidine homopurine for M dinucleotide sequence A G/CT) - Homopyrimidine duplex formation (Figure 9B) (35,35 ).

Figure 9C shows the CD spectrum of a 1:1 ratio of the 111 mixture. Figure 90 shows this wavelength range. Although it does not show such a large negative band in the Obtained from a half spectrum of 11 and a half spectrum of 1:11 (2:] Identical to the calculated spectrum. The observed CD spectrum is 1:l :11 mixture is half of the 1:11:I duplex and half of the single strand. show. That is, this CD study shows that even at stoichiometric ratios, which would favor duplex formation, It shows that 1:11:I is preferable to I·I+ duplex.

CD spectra of mixture of II-II+II chain and single chain ■ in 0.1M NaCl The magnitude of the negative No.nd observed in the 213th chain of Tor is due to the It-II+II chain and The calculated values obtained from the sum of the spectra at room temperature and 3% for both single-stranded I (see Figures 9D and 9E). MgCL and ratio A relatively large negative band was detected in the presence of relatively high NaCl concentration (buffer C). , which would suggest the formation of an l-11-111 triple strand. (See Figure 9E) Light. ) (2) Detection of double strands by gel electrophoresis 1-111 and I-II-II +3-3 formation was determined by polyacrylamide gel electrophoresis (30, 31). Using a different oligonucleotide labeled with sep at the 5′ end as a car can be directly monitored. The results of the two sets of experiments are shown in Figure 1O.

Using 11 labeled by “P” as a marker, record the mobility of single-stranded!1. Shown in Section 1. Under the same conditions, the mixture of 11 and Ill also has a concentration ratio of 1 to 2. Only one band is shown (lane 2). The mobility of this band is the movement of II alone. less than degree. In the mixture of No. 11 and ■, two bands were detected again at a concentration ratio of 1 to 2. served (lane 3). Band with faster mobility as 11-■ double-stranded can be easily recognized. Slower bands are evidence of l-111 triplex formation It is. It is interesting to note that the only band detected in lane 2 This means that III-II-II + three-three-three shapes cannot be formed under these conditions. This is clear evidence.

Lanes 4 to 6 in Figure 10 are single-stranded I11 labeled with stp at the 5′ end. This is the result of electrophoresis. Move to lane 4 based on the mobility of 111 alone. show. A mixture of Ill and 11 (1,5:1) is shown in lane 5. slower transition The mobility band has a mobility comparable to that observed in lane 2; Therefore, there is no doubt about the formation of the l11-11 duplex. Excess amount of single strand 11 1 exists as a faster migrating band, which is the band in lane 4. is the same as de. This allows the results obtained from lane 2, i.e. any l1l -II-II! At neutral pH it is not formed even in the presence of MgCl2 This result is confirmed. On the other hand, the duplex 1-II-II+ is 1.5: l: Observed when the 1.5fi compound was electrophoresed in lane 6. child The three bands are revealed by comparison with the bands observed in lanes 2 to 5. Crab double-stranded, double-stranded and single-stranded from top to bottom, respectively. Even more? III-II-II! In order to prove that the Bands in sections 5 and 6 were cut from the gel plate and counted. to Rhea 5 The ratio of radioactivity to double-stranded single-stranded 111 is approximately 2:1 (65:35). It is. This result fits very well with the original /I1 compound ratio (1,5:1). vinegar That is, one unit of double strand is formed and 0.5 unit of single strand I11 remains. therefore , the free 11 chains present in the +1-111 (1:1.5) U compound are No way. Here, the measurement results for lane 5 are used internally for the same purpose in lane 6. It can be used as a reference. From slowest band to fastest in lane 6 The radioactivity ratio of the lower band is 42:23:35. The sum of double strands and double strands is Again 65% (42+23). Therefore, all 11 strands are double stranded or double stranded. are again involved in the formation of either. Furthermore, the concentration of duplexes is It is 35% (23/(23+43)) of the main chain. Apparently, about 1/3 of II is The remaining two thirds are involved in double strand formation. therefore , the observed double-stranded band must be due to III-II + triple-stranded formation. There is no such thing as 1lill-111. These arguments are based on the differences in the original mixture. It is noteworthy that this excludes the formation of a 1-11-1 triple strand due to the same change. It is.

CG) UV mixed titration and melting/annealing study of the I-II system in Il buffer A. UV mixed titration was performed and monitored at 260 nm. ■67 vs. 11: 33 Only one end point was observed at stoichiometry. this is! -11-r triple strand formation was shown. . Figure 3 shows the temperature graph of the melting and annealing process for the l-11-1 triple strand. 11A and JIB. Each dissociation or association graph represents a direct-to-water channel of the duplex. The only transition that can be tentatively attributed to melting or direct double-stranded formation from single-stranded (based on results obtained from UV mixed titration and CD spectra). Lll-1 The transition to triple-stranded annealing occurs at the temperature observed for duplex dissociation (T m = 74°C) to a lower temperature (Tm = 66°C). Any melting/anime -ring experiments were also not performed for the I-II-I1111 chain system.

Example 5 - Formation of double-stranded helical structures using heavy chain oligoribonucleoside targets Growth Double-stranded helinox structure using single-channel oligoribonucleoside r(AG) The formation of Figure 1 using two oligomers containing 2-0-methyl (piCU)s 2 and 13. CD spectra and melting and annealing Ring studies were performed as described in Example 4 using C1,01M sodium phosphate, O,I It was carried out in M NaCl 1° 0.01 M EDTA, pH 7.2.

The observed CD spectra are particularly sensitive to the 210na region, which indicates double-stranded helinox formation. is different from the additive CD spectrum (see FIG. 12).

The melting and annealing graph (see Figure 13) is about 78-80 for duplex. TIl in °C is shown.

(Hereafter, margin) Example 6 Single-stranded polypyrimidine oligodeoxyribonucleoside as a collar and wax conjugation to duplexes using polypurine methylphosphonate oligomers. body formation single-stranded d(CT), oligonucleotide and two methylphosphonate d(A G) Demonstrated the formation of wax complexes on double strands using @oligomers.

Figure 14 shows d(CT), d(8G), phosphodiester and d(AG) , for the methylphosphonate homopurine oligomer, four wavelengths (·) 280 UV measured at nm, (■) 260 nm, (b) 254 nm, (○) 235 nM Showing continuous changes in the composition of absorption. All JV is O, IM Na” 0.0 1M PO, -3,10-'MEDT8, pH 7.01 and 24 μm. Ta. Regarding the interaction of phosphonic esters d(AC)* and d(CT), II. A single endpoint was observed at the I purine:pyrimidine stoichiometry, which was It was shown that only rick-type duplexes were formed under these conditions. d(AT )s methylphosphonate and d(CT), three endpoints were observed.

With a 1:l purine:pyrimidine stoichiometry, further Watson-Crick duplexes are formed. was detected. 67: 33 (2: D and 33: 67 (1: 2) pre Additional endpoints to the pyrimidine ratio include purinibrin:pyrimidine and pyrimidine. In this system, a wax complex is formed on the midine-purine-pyrimidine triple strand. The observed spectrum is very different from the spectrum calculated by simple addition. This spectrum indicated wax complex formation on the double strands. CDs The spectra are O, 1 MNa', 0. OIM PO4-', 10-'M EDTA, Obtained at 20°C at pH 8°0. The total concentration is 48 μM, and ε is 1 of the base residue. Reported per mole.

Figure 16 shows d(AG), :d(CT), I:L d(AG), :d(CT), 2 : Shows the TTm and melting graph of 1. Heat denaturation of 16 oligomers The graph was monitored by UV absorption increase. Total tract concentrations were O, 1 MNa', 0. O IM PO,-', 10-sλ'I 4.8 μm in EDTA, pH 8.0. It was. For comparison purposes, each curve was normalized to the total change in absorption. d(A G), :d(CT), T- for l:1 was 50°C. d(Δp ). :d(CT)*1:TI for 1 was 53°C.

The TI for d(AG)*:d(CT)-2:1 was 51°C. melting Although one would notice from the curve, the melting graph observed for duplexes is much narrower. It was squid or something sharp. This data supports simultaneous dissociation of duplexes and duplexes. However, the duplex transition was more uniform in thermal stability.

Figure 17 shows electrophoretic analysis of the complex in a natural polyacrylamide gel.

Figure 16 shows γ[3P] and labeled d(CT), (lanes 1 to 12) and d (Person Q)@(lanes 13-17) and natural compounds containing these complexes 1 is a radiophotograph of a 16% (29:1 bis) polyacrylamide gel. this gel , O,IM NaC1,0,04 with buffer recirculation to prevent pH changes M Tris, O, OLM PO4-3,10-3M EDTA, pH8,0 Electrophoresis was performed at 4 volts per CM for 30 hours at 5°C. Oligos in each lane The mer concentrations are shown below the stoichiometry of the interacting strands. Various positions with different mobilities The position is shown to the left of the original position, and the xylene shear tool and bromophenol bloomer The marker dyes are indicated by 0, X and b, respectively.

This gel clearly shows d (individuals), · d (individuals), · d (CT), double-stranded and 5 °C 0. IMN a d(AG)-・d(AC)s・d(CT)*double strand in Cl It shows the existence of

Figure 18A shows 0.1 MNa'', O, OIM PO, -', 10-'M EDTA , d(8p) and d(CT)e at 300MHz in pH 8°0 with l = 1 or and the hydrogen-bonded NH-H resonance of the 2:1 mixture. Figure 17A shows pudding:pi Spectra of 1:1 and 2:1 stoichiometric mixtures of rimidine oligomers at 30°C. Toll is shown. Figure 18B shows the chemical shift of the three resonances observed for the 2.1 mixture. shows the temperature dependence of: Watson-Crick Gua N I H-Cyt N3 (■); Watson Crick ThyN3H-Ade N1 (・); and new Third-strand hydrogen-bonded imido proton (Δ). Watson-Crick attribution is a hypothesis. d(AG), compared to the chemical shifts observed for the phosphodiester duplex. It was based on These three resonances were easily detected up to 60°C. 65 At °C their strength decreases dramatically, as hydrogen-bonded complexes generally melt. It showed that. N)(-N resonance (Watson Kut) observed at about 12 ppm (in addition to those attributed to lick base pairing) were due to duplex formation.

At high temperatures, the duplex was observed to dissociate directly into the single-stranded form.

6. Yarchoan et al., rAIDs treatment J+ 5 scientific A serican, pp, 110-119 (October P988).

12, Singh, U, C, et al. ^MBER (UC5P) Version 3.1 (1988).

+6. Sanger, L, Principles of Nucleic Acid Structure J (Springer-Ve rlag, New York, 1984).

22a, Ts’o, P, O, P, , r Fundamental principles in nucleic acid chemistry J, p p, 453-584 (edited by P, O, P, Ts'o.

^ Academic Press, Nev York, 1974).

23, Sundaralingham, M., Biopolymers' L: 821 (1969).

24, Arnott, S., Progr. Nuel, Incid Res, Mo1 ．． Biol, 10:183 (1970).

25, 5asisekharan, V. et al., Collorm, Biopol ys,, Pap, lnt, Symp, 1967, Vol, 2K p, 641 (1967).

26. Lakshminarayanan, A.V., et al., BiochetBio phys, Acta 204: 49 (1970).

27, LaksbIIlinarayanan, AV, et al., Biopoly mers 8L: 475 and 489 (1970).

28, Lee, B. et al., Nucl, aids Res, 16: 10681- 10697 (1988).

29, Barone, A, D, et al., Nucl, ^cids, Res, 12: 4051-4060 (1984).

30, I noue, H, et al., Nucl, ^cids, Res, 15: 61 31-61411 (1987).

31, 0no, A et al., J, As, Chem, Soc, 113: (1991 ).

32, 0no, A, et al., J, Org, Chem, (1991), in press.

33, Beaucage, S, L, et al., TeLrahedron Lett , 22: 1859-1862 (1981).

34, 5inha, N, D, et al., TeLrahedron Lett, 24: 5843-5846 (1983).

35, Lee, J. S., et al., Nucl. Ac1ds Res, %: 3073- 3091 (t979).

36,’ Kan, J, S, et al., J, Btolsol, Str, Syn,, 91 1-933 (1991).

37, Kibler-Herzog, L., et al., Nucl, ^cidr, Res. 18: 3545-3555 (1990).

38, 5hea, R, G, et al., Nuel, Ac1ds, Res, 18: 48 59-4866 (1990).

/ZriitL /Z Uke no Z- ,,□f 1) N l-l Xu Yuu-〃 /wa9L Special Table Sen7-501936 (20) Heart〃-11”ゝ Time (minutes) F/G, 9o.

F/G, 9b.

F/G, 9c Wavelength (nm) F/G, 9e.

Temperature ("C) FIG, / phantom.

Temperature (℃) FIG //b.

FIG　／2゜ Temperature (℃) FIG, /, 3゜ (AG)8Φ(Cη8.pH7(鵠)8 + (CηB, pH7F/G, /4 σ FIG, /4b Temperature (℃) Temperature (℃) Temperature (’C) to ok to Temperature dependence of 2:1 mixture Temperature (℃) Continuation of front page (72) Inventor Tso, Paul On-Pong Melila, United States of America 21042 9039 Farrow Avenue, Ellicott City, N.D. (72) Inventor Adams, Thomas Henry United States 92067 Cali Fournia, Rancho Santa Hue, Post Office Box 3092 , El Vuelo No. 17645 (72) Inventor Arnold, Lyle Jay Jr. United States 920 64 California, Bowie, Martinquoit 16624

Claims (72)

[Claims] 1. A method for detecting or recognizing a specific target segment of a single-stranded nucleic acid, the method comprising: a) converting the single-stranded nucleic acid into a first oligomer that is sufficiently complementary to the target segment; (b) contacting with and hybridizing with the double strand to obtain a stable duplex; a double strand with at least seven nucleosidyl units that are sufficiently complementary to the duplex. to form a stable triple-stranded helix with a second oligomer containing The first time is due to the formation of a double strand with the first oligomer, and the second time is due to the formation of a double strand with the first oligomer. The base sequence of the target segment is modified by forming a triple-stranded helix with the oligomer. Recognize twice, A method consisting of things. 2. Each of the first and second oligomers independently Rukyl or aryl phosphonothioate oligomers, phosphorodithioates oligomer, phosphorothioate oligomer, alkyl or arylpho Suphonate oligomer, phosphotriester oligomer, phosphoramidite oligomer oligomer, carbamate oligomer, sulfamate oligomer, morpholinomer 2. The method of claim 1, comprising oligomers or formacetal oligomers. 3. each of the first and second oligomers is independently substantially uncharged 2. The method of claim 1, comprising a neutral oligomer. 4. 2. The method according to claim 1, wherein the single-stranded nucleic acid is RNA. 5. 2. The method according to claim 1, wherein the single-stranded nucleic acid is DNA. 6. 2. The method of claim 1, wherein the target segment contains only pyrimidine bases. 7. 7. wherein the first and second oligomers contain only purine bases. Method. 8. The first oligomer contains only purine bases and the second oligomer contains pyrimidyl bases. 7. The method according to claim 6, wherein the method contains only a base. 9. 2. The method of claim 1, wherein the target segment contains only purine bases. 10. The first oligomer contains only pyrimidine bases and the second oligomer contains only pyrimidine bases. 10. The method of claim 9, containing only phosphorus bases. 11. Claim 9, wherein the first and second oligomers contain only pyrimidine bases. Method described. 12. Claim 1 wherein the target segment contains both purine and pyrimidine bases. The method described in. 13. The first and second oligomers contain both purine and pyrimidine bases and each base of the second oligomer is double-stranded, if desired. The nucleosydide hydrogen bonds with the central purine of the base pair to form a triplet. Claim 1 containing a bond that lengthens the required nucleosidyl between the nucleosidyl units. The method described in 2. 14. A method of interfering with the function or expression of a single-stranded nucleic acid target sequence, the method comprising: is the first in which the nucleoside sequences are selected such that a three-stranded helical structure is formed. A method comprising contacting one oligomer with a second oligomer. 15. 15. The method of claim 14, wherein the target sequence contains only purine bases. 16. Claim 15 wherein the first and second oligomers contain only pyrimidine bases. The method described in. 17. one of the first and second oligomers contains only pyrimidine bases and the other 16. The method of claim 15, wherein the oligomer contains only purine bases. 18. 15. The method of claim 14, wherein the target sequence contains only pyrimidine bases. 19. One of the first and second oligomers contains only purine bases and the other oligomer contains only purine bases. 19. The method of claim 18, wherein the oligomer contains only pyrimidine bases. 20. 19. The first and second oligomers contain only purine bases. How to put it on. 21. 15. The target sequence contains both purine and pyrimidine bases. How to put it on. 22. The first and second oligomers contain both purine and pyrimidine bases and the second oligomer is optionally configured such that each base of the second oligomer has a target sequence. or triplet by hydrogen bonding with the central purine base of either of the first oligomers. nucleotides that lengthen the bonds between nucleosidyl units required to form nucleosidyl units. 22. The method of claim 21, comprising interrheosidyl units. 23. Cytosine is a cytosine with a protonated nitrogen at the N-3 position at physiological pH. 15. The method of claim 14, wherein the syn analog is substituted. 24. A claim in which the cytosine analogue is 2'-O-methyl-pseudoisocytidine. 23. The method described in 23. 25. 2-aminopurine replaces at least one adenine in the second oligomer 15. The method of claim 14, wherein: 26.6-Selenium guanine or 6-isopropylidene-7-deazaguanine guanine substitutes for at least one guanine in the second oligomer. The method according to item 14 or 25. 27. Each of the first and second oligomers independently has an oligonucleotide , alkyl or aryl phosphonothioate oligomers, phosphorothioates oligomers, alkyl or aryl phosphonate oligomers, phosphonate oligomers, phosphonate oligomers, alkyl or aryl phosphonate oligomers, Triester oligomers, phosphoramidite oligomers, carbamate oligomers mer, sulfamate oligomer, morpholino oligomer or formacetate Claim 14, 15, 18, 21, 22, 23, 24 or 25. The method according to any one of 25. 28. Each of the first and second oligomers independently has an oligonucleotide , alkyl or aryl phosphonothioate oligomers, phosphorodithioates ate oligomers, phosphorothioate oligomers, alkyl or aryl -Phosphonate oligomer, phosphotriester oligomer, phosphoramidite oligomer, carbamate oligomer, sulfamate oligomer, morpholin The method according to claim 26, comprising a formacetal oligomer or a formacetal oligomer. Law. 29. The first and second oligomers independently form a substantially uncharged neutral oligomer. Any one of claims 14, 15, 18, 21 or 22 selected from oligomers. Method described. 30. Claims that the first and second oligomers are methylphosphonate oligomers The method according to any one of Items 14, 15, 18, 21, or 22. 31. one or more without substantially inhibiting the synthesis of non-target proteins. It is a method to selectively inhibit the synthesis of specifically targeted proteins in vivo. hand, (a) a nucleus containing a segment of mRNA encoding the targeting protein; select an acid target sequence; (b) selected to form a triple-stranded helical sequence with the segment of the mRNA; synthesize first and second oligomers having nucleoside sequences; and (c ) introducing said first and second oligomers into a cell; thereby introducing said first and second oligomers into a cell; A second oligomer complexes with the mRNA segment, thereby substantially blocks the translation of the nucleoside sequence and inhibits the synthesis of the target protein. A method consisting of things. 32. 32. The method according to claim 31, wherein the mRNA segment contains only purine bases. Law. 33. 32. The first and second oligomers contain only pyrimidine bases. The method described in. 34. One of the first and second oligomers contains only purine bases and the other 33. The method of claim 32, containing only rimidine base. 35. 32. The segment of mRNA contains only pyrimidine bases. the method of. 36. 36. The first and second oligomers contain only purine bases. How to put it on. 37. One of the first and second oligomers contains only purine bases and the other 36. The method of claim 35, containing only rimidine base. 38. A segment of mRNA contains both purine and pyrimidine bases. The method according to claim 31. 39. The first and second oligomers contain both purine and pyrimidine bases and the second oligomer is optionally configured such that each base of the second oligomer is an mRNA. by hydrogen bonding with the central purine base of either the segment or the first oligomer. Nucleosidyl units between nucleosidyl units required to form triplets 38. The method of claim 37, comprising inter-sigil lengthening bonds. 40. single-stranded DNA without substantially inhibiting overall DNA replication or transcription is a method of selectively inhibiting the replication or transcription of specific segments of hand, (a) selecting a nucleic acid target sequence containing a portion of the segment of single-stranded DNA; b) a nucleotide selected to form a triple helical complex with the nucleic acid target sequence; synthesizing first and second oligomers having an osidic sequence; and (c) the first and a second oligomer into the cell; thereby introducing said first and second oligomers into the cell; the oligomer complexes with the target sequence to give a triple-helix complex; This allows for single-stranded D without substantially inhibiting overall DNA replication or transcription. A method comprising substantially inhibiting the replication or transcription of a specific segment of NA. 41. Each of the first and second oligomers independently has an oligonucleotide , alkyl or aryl phosphonothioate oligomers, phosphorodithioates ate oligomers, phosphorothioate oligomers, alkyl or aryl -Phosphonate oligomer, phosphotriester oligomer, phosphoramidite oligomer, carbamate oligomer, sulfamate oligomer, morpholin The method according to claim 40, comprising a formacetal oligomer or a formacetal oligomer. Law. 42. Detects specific segments of double-stranded nucleic acids without blocking double-stranded base pairing or a method of recognizing the nucleic acid segment, the method comprising: an oligomer that is sufficiently complementary to a portion of at least one of the oligomers. contact with an oligomer in which 2-aminopurine is placed in place of adenine. A method consisting of forming a triple-stranded helical structure. 43. At least one guanine of the oligomer is 6-selenium guanine or Claim 42 substituted by 6-isopropylidene-7-deazaguanine The method described in. 44. Detects specific segments of double-stranded nucleic acids without blocking double-stranded base pairing A method comprising: adding the nucleic acid segment to the nucleic acid segment or a portion thereof; an oligomer that is complementary to 6- Selected from selenium guanine or 6-isopropylidene-7-deazaguanine at least one modified guanine analogue is placed in contact with the oligomer. A method consisting of contacting each other to form a triple-stranded helical structure. 45. Selectively prevent or affect the expression of single-stranded nucleic acid target sequences in vivo A method of selectively interfering, (a) Start codon, polyadenylation region, mRNA cap site or splice (b) selecting a nucleic acid target sequence containing an RNA region encoding an R linkage point; with a nucleoside sequence selected to form a triple-stranded helix with the NA region (c) synthesizing first and second oligomers; and (c) synthesizing the first and second oligomers; introducing oligomers into the cell; thereby causing the first and second oligomers to interact with the RN complexes with the A region to form a triple-stranded helix, thereby or substantially interfering with the expression of a sequence; Law. 46. 46. The method of claim 45, wherein the target sequence contains only purine bases. 47. Claim 46 wherein the first and second oligomers contain only pyrimidine bases. The method described in. 48. One of the first and second oligomers contains only purine bases and the other 47. The method of claim 46, containing only rimidine base. 49. 46. The method of claim 45, wherein the target sequence contains only pyrimidine bases. 50. Claim 49, wherein the first and second oligomers contain only purine bases. How to put it on. 51. One of the first and second oligomers contains only purine bases and the other 50. The method of claim 49, containing only rimidine base. 52. A segment of mRNA contains both purine and pyrimidine bases. The method according to claim 45. 53. The first and second oligomers contain both purine and pyrimidine bases and the second oligomer is optionally configured such that each base of the second oligomer is an mRNA. by hydrogen bonding with the central purine base of either the segment or the first oligomer. Nucleosidyl units between nucleosidyl units required to form triplets 53. The method of claim 52, comprising a linkage that lengthens the sigils. 54. The first and second oligomers independently form a substantially uncharged neutral oligomer. 46. The method of claim 45, wherein the method is selected from oligomers. 55. Each of the first and second oligomers independently has an oligonucleotide , alkyl or aryl phosphonothioate oligomers, phosphorodithioates ate oligomers, phosphorothioate oligomers, alkyl or aryl -Phosphonate oligomer, phosphotriester oligomer, phosphoramidite oligomer, carbamate oligomer, sulfamate oligomer, morpholin The method according to claim 45, comprising a formacetal oligomer or a formacetal oligomer. Law. 56. 2-aminopropylene instead of at least one adenine in the second oligomer 55. A method according to claim 45 or 54, wherein phosphorus is placed. 57. at least one guanine of the second oligomer is 6-selenium guanine; or 6-isopropylidene-7-deazaguanine The method according to item 56. 58. 6-selenium guanine or 6-selenium guanine in place of guanine in the oligomer At least one modified member selected from isopropylidene-7-deazaguanine 55. The method according to claim 45 or 54, wherein a guanine analogue is provided. 59. Prevent splicing of pre-mRNA to obtain translatable mRNA selectively alter the protein product of a gene or the expression of the gene in the cell. A method of inhibiting or selectively interfering with: (a) A single-stranded nucleic acid mark containing the splicing site of mRNA encoding a protein product Select the desired sequence; (b) nucleoside sequences selected to form a triple-stranded helix with the target sequence; (c) synthesizing first and second oligomers having a sequence of 2 oligomers into the cell; thereby introducing the first and second oligomers into the cell; complexes with the target sequence to form a triple-stranded helix, thereby A method comprising substantially preventing splicing of pre-mRNA. 60. 60. The method of claim 59, wherein the target sequence contains only purine bases. 61. Claim 60 wherein the first and second oligomers contain only pyrimidine bases. The method described in. 62. One of the first and second oligomers contains only purine bases and the other 61. The method of claim 60, containing only rimidine base. 63. 60. The method of claim 59, wherein the target sequence contains only pyrimidine bases. 64. 64. The first and second oligomers contain only purine bases. How to put it on. 65. One of the first and second oligomers contains only purine bases and the other 64. The method of claim 63, containing only rimidine base. 66. 60. The target sequence of claim 59, wherein the target sequence contains both purine and pyrimidine bases. How to put it on. 67. The first and second oligomers contain both purine and pyrimidine bases and the second oligomer is optionally configured such that each base of the second oligomer is an mRNA. by hydrogen bonding with the central purine base of either the segment or the first oligomer. Nucleosidyl units between nucleosidyl units required to form triplets 67. The method of claim 66, comprising an inter-sigil lengthening bond. 68. The first and second oligomers independently form a substantially uncharged neutral oligomer. 60. The method of claim 59, wherein the method is selected from oligomers. 69. Each of the first and second oligomers independently has an oligonucleotide , alkyl or aryl phosphonothioate oligomers, phosphorodithioates ate oligomers, phosphorothioate oligomers, alkyl or aryl -Phosphonate oligomer, phosphotriester oligomer, phosphoramidite oligomer, carbamate oligomer, sulfamate oligomer, morpholin 69. The method according to claim 68, comprising a formacecool oligomer or a formacecool oligomer. Law. 70. 2-aminopropylene instead of at least one adenine in the second oligomer 69. A method according to claim 59 or 68, wherein phosphorus is placed. 71. at least one guanine of the second oligomer is 6-selenium guanine; or 6-isopropylidene-7-deazaguanine The method according to paragraph 70. 72. 6-selenium guanine or 6-selenium guanine in place of guanine in the oligomer At least one modified member selected from isopropylidene-7-deazaguanine 69. The method according to claim 59 or 68, wherein a guanine analogue is provided.