CA2119890A1 - Formation of triple helix complexes of single stranded nucleic acids using nucleoside oligomers - Google Patents

Abstract

A specific segment of single stranded nucleic acid may be detected or recognized by formation of a triple helix structure using first and second oligomers comprised of nucleosidyl units linked by internucleosidyl phosphorus linkages. Function or expression of single stranded nucleic acid segments may be prevented by triple helix formation. Novel oligomers comprising modified nucleosidyl units are useful in triple helix formation, and may be optionally derivatized with DNA modifying groups.

Description

W093/07295 PCT/US92/0~58 2119~0 PESCRIPTION

Formation of Tri~le Helix Complexes of Sinqle Stranded Nucleic Acids Usina Nucleoside Oliaomers Cross-Reference to Related A~lications This application is a continuation-in-part of U.S.S.N. 368,027, filed ~une 19, 1989, which is a continu-ation in part of U.s. Serial No. g24,234, filed Octo-ber 28, 1986, the disclosure of which is incorporated herein by reference.

Backaround of the Invention This invention was made with governmental support, including a grant from National Institutes of Health U.S.A., Grant Number CA 42762. The government has cPrtain rights to this invention.
Publications and other reference materials referred to herein are incorporated herein by reference and are numerically referenced in the following text and respec-tively grouped in the appended Bibliography which immedi-ately precedes the claims.
The present invention is directed to novel methods ofdetecting and recognizing specific sequences in single stranded nucleic acids, particularly RNA, using first and second nucleoside Oligomers which are capable of specifi-cally complexing with a selected single stranded nucleicacid structure to give a triple helix structure.
Formation of triple helix structures by homopyrimi-dine oligodeoxyribonucleotides binding to polypurine tracts in double stranded DNA by Hoogsteen hydrogen bond-ing has been reported. (See, e.g. (1) and (2)). Thehomopyrimidine oligonucleotides were found to recognize extended purine sequènces in the major groove of double helical DNA via triple helix formation. Specificity was found to be imparted by Hoogsteen base pairing between the homopyrimidine oligonucleotide and the purine strand of .

~B~nE~Er, .

W093/07295 PCT/US92/0~58 211989~ - `

the Watson-Crick duplex DNA. Triple helical complexes containing cytosine and thymidine on the third strand have been found to be stable in acidic to neutral solutions, t respectively, but have been found to dissociate on 5 increasing pH. Incorporation of modified bases of T, such as 5-bromo-uracil and c, such as 5- methylcytosine, into the Hoogsteen strand has been found to increase stability of the triple helix over a higher pH range. In order for cytosine (C) to participate in the Hoogsteen-type pairing, 10 a hydrogen must be available on the N-3 of the pyrimidine ring for hydrogen bonding. Accordingly, in some circum-stances, cytosine may be protonated at N-3.
DNA exhibits a wide range of polymorphic conforma-tions, such conformations may be essential for biological 15 processes. Modulation of signal transduction by sequence-specific protein-DNA binding and molecular interactions such as transcription, translation, and replication, are believed to be dependent upon DNA conformation.(3) It is exciting to consider the possibility of deve-20 loping therapeutic agents which bind to critical regions of the qenome and selectively inhibit the function, repli-cation, and survival of abnormal cells.(4) The design and development of sequence-specific DNA binding molecules has been pursued by v~rious laboratories and has far-reaching 25 implications for the diagnosis and treatment of diseases involving foreign genetic materials (such as viruses) or alterations in genomic DNA (such as cancer).
Nuclease-resistant nonionic oligodeoxynucleotides (ODN) consisting of a methyIphosphonate (MP) backbone have 30 beén studied n vitro and n vivo as potential anticancer, antiviral and antibacterial agents.(5) The 5'-3' linked internucleotide bonds of these analogs closely approximate the conformation of nucleic acid phosphodiester bonds.
The phosphate backbohe is rendered neutral by methyl sub-35 stitution of one anionic phosphoryl oxyqen, decreasing inter- and intrastrand repulsion due to the charged phos-phate groups.(5) Analogs with MP backbone can penetrate SIJBS117U~E SHEEI

wo93/o72ss PCT/US92/0~58 21~g~

living cells and have been shown to inhibit mRNA transla-tion in globin synthesis and vesicular stomatitis viral protein synthesis, and inhibit splicing of pre-mRNA in inhibition of HSV replication. Mechanisms of action for inhibition by the nonionic analogs include formation of stable complexes with complementary RN~ and/or DNA.
Nonionic oligonucleoside alkyl- and aryl-phosphonate analogs complementary to a selected single stranded for-eign nucleic acid sequence are reported to be able to selectively inhibit the expression or function or expres-sion of that particular nucleic acid without disturbing the function or expression of other nucleic acids present in the cell, by binding to or interfering with that nucleic acid. (See, e.g. U.S. Patent No. 4,469,863 and 4,511,713.) The use of complementary nuclease-resistant nonionic oligonucleoside methylphosphonates which are taken up by mammalian cells to inhibit viral protein synthesis in certain contexts, including Herpes simplex virus-1 is disclosed in U.S. Patent No. 4,757,055.
The use of anti-sense oligonucleotides or phosphoro-thioate analogs complementary to a part of viral mRNA to interrupt the transcription and translation of viral mRNA
into protein has been proposed. The anti-sense constructs can bind to viral mRNA and were thought to obstruct the cells ribosomes from moving along the mRNA and thereby halting the translation of mRNA into protein, a process called "translation arrest" or "ribosomal-hybridization arrest."(6) The inhibition of infection of cells by HTLV-III by administration of oligonucleotides complementary to highly conserved regions of the HTLV-III genome necessary for HTLV-III replication and/or expression is disclosed in U.S. Patent No. 4,806,463. The oligonucleotides were found to affect viral replication and/or gene expression as assayed by reverse transcriptase activity (replication) and production of viral proteins pl5 and p24 (gene expression).

SHEEr ~r . ~ p ~j., ~ P ~? .

W093/0729~ PCT/US92/0~58 ~l~.9~g ,,.,"

l'he ability of some antisense oligodeoxynucleotides containing internucleoside methylphosphonate linkages to inhibit HIV-induced syncytium formation and expression has been studied.(7) Psoralen-derivatized oligonucleoside methylphospho-nates have been reported capable of cross-linking either coding or non-coding single stranded DNA; however, double stranded DNA was not cross-linked.(28) Summary of the Invention The present invention is directed to methods of detecting or recognizing a specific segment of single stranded nucleic acid or a single stranded nucleic acid sequence and to methods of preventing expression of func-tion of a specific segment of single stranded nucleic acid having a given target sequence by forming a triple helix complex. Triple helix complexes of either DNA or RNA tar-get sequences may be formed.
The present invention is also directed to novel modi-fied Oligomers which are useful for preventing expression and/or functioning of a selected single-stranded nucleic acid sequence and which optionally include a nucleic acid mQdifying group. Additionally, the present invention is directed to Oligomers which comprise pyrimidine and/or purine nucleoside analogs. In parti-cular, these purine nucleoside ~nalogs are modified to favor formation and stability of the triplex structure and to decrease mis-reading of the target nucleic acid sequences.
In one aspect, the present invention is directed to methods of preventing function or expression of a single stranded nucleic acid target sequence which comprises con--tacting said target sequence with a first Oligomer and a second Oligomer wherein the nucleoside sequences of said first and second Oligomers are selected so that a triple helix structure is formed. According to one preferred aspect, the nucleic acid target sequence comprises either a polypurine or a polypyrimidine sequence. Where the suss~n~u~EsHEr ' W093/07295 PCT/US92/0~58 211S~3~

target sequence is a homopurine sequence, the first and second Oligomers may comprise only pyrimidine nucleosides or analogs or alternatively one of said first and second Oligomers comprises only purine nucleosides and the other comprises only pyrimidine nucleosides. However, when the target sequence is a homopyrimidine sequence, the first and second Oligomers may comprise only purine nucleosides or, alternatively, one of the first and second Oligomers comprises only purine nucleosides and the other comprises only pyrimidine nucleosides.
In one especially preferred aspect, analogs of the naturally occurring purine nucleosides are employed in the Oligomers of the present invention. These purine nucleo-side analogs have been modified to favor hydrogen bonding lS configurations which encourage triplex formation and also triplex stability while disfavoring misreading (or mis-paring) of the target sequences by the bases of the first and second Oligomers and also disfavoring nonselective interactions between the bases on the three nucleic acid strands.
In one aspect, the present invention is directed to methods of detecting or recognizing a specific segment of single stranded nucleic acid or single stranded nucleic acid sequence and to methods of preventing expression or funct~on of a specific segment of single stranded nucleic acid having a given sequence, especially RNA, by forming a triple helix structure. The present invention is also directed to novel modified Oligomers which are useful for preventing expression and/or functioning of a selected double nucleic acid sequence and which optionally include a DNA modifying group. Additionally, the present inven-tion is directed to novel Oligomers which comprise cyto-sine analogs.
The present invention is also directed to formation of a triple helix structure by the interaction of a speci-fic segment of single stranded nucleic acid and first and second Oligomers. The first Oligomer is sufficiently com-SU~SmlnESHEE1' ' W093/07295 PCT/US92/0~58 9~0 plementary to the segment of single stranded nucleic acid to hybridize to it and the second Oligomer is sufficiently complementary to the hybrid to read it and base pair (or hybridize) thereto.
Accordingly, in one aspect, the present invention is directed to methods of detecting or recognizing a specific segment of single stranded nucleic acid which comprises forming a hybrid between the segment and a first oligomer and contacting said hybrid nucleic acid with a second Oli-gomer which is sufficiently complementary to the sequence of purine bases in said hybrid or a portion thereof to hydrogen bond (or hybridize) therewith thereby giving a triple helix structure.
In another aspect, the present invention is directed to methods of preventing or inhibiting expression or func-tion of a specific segment of a single stranded nucleic acid having a given sequence which comprises first forming a hybrid using a complementary first oligomer and then contacting said hybrid with a second Oligomer suffi-ciently complementary to said double stranded hybrid toform hydrogen bonds therewith, thereby giving a triple helix structure.
The present invention is directed to methods wherein the single stranded nucleic acid segment comprises an mRNA
in a living cell and wherein formation of the triple helix structure inhibits or inactivates said mRNA and prevents its translation.
~ According to another aspect, the present invention provides methods of preventing or interfering with expres-sion of a single stranded nucleic acid target sequencein vivo where the target sequence is an RNA region which codes for an initiator codon, a polyadenylation region, an mRNA cap site or a splice junction by formation of a triple stranded helix. First and second Oligomers are selected that they will form a triple stranded helix and, thus, substantially prevent or interfere with expression of the target sequence.

S~SlllUrE SHEEl Wos3/072ss PCT/US92/0~58

2 1 ~

Alternatively, the present invention provides methods of selectively preventing or interfering with expression of a gene in a cell or a protein product of a gene by preventing splicing of a pre-mRNA to give a translatable S mRNA. According to these methods, first and second Oligo-mers are selected so that they will form a triple stranded helix with the target sequence and introduced into the cell and form a triple stranded helix with the target sequence and prevent splicing of the pre-mRNA.
In a different aspect, the present invention provides methods of inhibiting replication or translation of a single stranded DNA target sequence in vivo without sub-stantially inhibiting overall DNA synthesis by formation of a triple stranded helix by first and second Oligomers with the target.
In a preferred aspect, said second Oligomer is modi-fied to incorporate a nucleic acid modifying group which, after the second Oligomer hydrogen bonds or hybridizes with the hybrid, is caused to react chemically with the hybrid and irreversibly modify it. Such modifications may include cross-linking second Oligomer and hybrid by form-ing a covalent bond thereto, alkylating the hybrid, cleav-ing said hybrid at a specific location, or by degrading or destroying the hybrid.
The present invention also providés Oligomers which include nucleosidyl units in which a cytosine analog replaces cytosine and wherein said cytosine analog com-prises a heterocycle whi~h has a hydrogen available for hydrogen bonding at the ring position which corresponds to N-3 of cytosine and which is capable of forming two hydro-gen bonds with a guanine base at neutral pH.
The present invention provides Oligomers wherein a purine analog of adenine or guanine replaces at least one adenine or guanine base. In particular, 2-amino purine may replace adenine and guanine may be replaced by its 6-selenium analog or by 6-isopropyledine-7-deazaguanine.
The substitution of at least one 2-aminopurine for a SUBSmUTESHEEr . . .

W093/07295 PCT/US92/0~58 2 ~ l9 ~9~ 8 6-aminopurine (adenine) will provide a favorable regular-ity in stacking with the guanine base if homopurines are used for the third strand. In this case, the base pat-terns of 2-aminopurines and guanines will be isomolphic and will have the same geometrical pattern. In such a situation, the 2-amino group of 2-aminopurine will be serving as a proton donor to N7 while Nl of the 2-aminopur-ine will be serving as a proton acceptor to the 6-amino group of the adenine in the duplex, respectively. In the homopurine third strand having the adenines replaced by the 2-amino purines, the 2-amino group of the guanine in the third strand will be a proton donor to the N7 of the guanine in the duplex and the Nl proton of the guanine in the third strand will also be a proton donor to the 6-oxo-group of the guanine in the duplex. In this case, the2-amino purine (of the third strand) will be donating one proton and accepting one proton, while the guanine in the third strand will be donating both protons to form hydro-gen bonds. Thus, this change will substantially increase the discrimination in reading A- and G in the target sequence. The third strand will have a polarity parallel to the purine strand of the duplex and both nucleosides will be in the anti conformation. For the guanine ana-logue, the replacement of the 6-oxo group in guanine by the 6-selenium group or the isopropyiidene group will reduce the non-selectivity of guanine in the third strand for reading other bases.
According to the present invention, first and second Oligomers are provided that comprise at least one nucleo-sidyl unit having a modified purine base. These Oligomerscomprise nucleosidyl units (or nucleoside monomers) which may be linked by any one of a variety of internucleosidyl linkages. Theæe internucleosidyl linkages include, but are not limited to, phosphorus-containing linkages such as phosphodiester linkages, alkyl and aryl-phosphonate link-ages, phosphorothioate linkages, phosphoramidite linkages and neutral phosphate ester linkages such as phosphotries-SUBS mV~ESH Er .

wo93/o72ss PCT/US92/0~58 211~8~

ter linkages; as well as internucleosidyl linkages whichdo not include phosphorus, such as morpholino linkages, formacetal linkages, sulfamate linkages, and carbamate linkages. Other internucleosidyl linkages known in the art may be use~ in these Oligomers. Also, according to a pre-ferred aspect, these Oligomers may incorporate nucleosidyl units having modified sugar moieties which include ribosyl moieties, deoxyribosyl moieties and modified ribosyl moie-ties such as 2'-0-alkylribosyl (alkyl of 1 to lo carbon atoms), 2'-0-arylribosyl, and 2'-halogen ribosyl, all optionally substituted with halogen, alkyl and aryl, and in particular, 2'-0-methylribosyl moieties. In particu-lar, incorporation of nucleosidyl units having modified ribosyl, particularly 2'-0-methyl ribosyl, moieties may advantageously improve hybridization with the double stranded nucleic acid sequence and also improve resistance to enzymatic degradation.
In another aspect, the present invention provides novel nonionic alkyl- and aryl-phosphonate Oligomers com-prising these purine nucleoside analogs which are suffi-ciently complementary to the sequence of a specific single stranded nucleic acid. Segment to hydrogen bond and form a triple helix structure~ Preferred are nonionic methyl phosphonate Oligomers.
The present invention also provides Oligomers having nucleosidyl units in which a cytosine analog replaces cytosine and wherein said cytosine analog comprises a heterocycle which has a hydrogen available for hydrogen bonding at the ring position which corresponds to N-3 of cytosine and which is capable of forming two hydrogen bonds with a guanine base at neutral pH (such as pseudo-isocytosine). Such cytosine analogs include 5-methyl-cytosine, as well as the analogs depicted in Table V.

~s~r . ~

W093/07295 PCT/US92/0~58 2~ 8~0 Definitions As used herein, the following terms have the follow-ing meanings unless expressly stated to the contrary.
The term "purine" or "purine base~ includes not only the naturally occurring adenine and guanine bases, but also modifications of those bases such as bases substi-tuted at the 8-position, or to the guanine analogs modi-fied at the 6-position or the analog of adenine, 2-amino purine.
The term "nucleoside" includes a nucleosidyl unit and it used interchangeably therewith, and refers to a subunit of a nucleic acid which comprises a S carbon sugar and a nitrogen-containing base. The term includes not only units having A, G, C, T and U as their bases, but also analogs and modified forms of the bases (such as 8-sub-stituted purines). In RNA, the 5 carbon sugar is ribose;
in DNA, it is a 2'-deoxyribose. The term also includes analogs of such subunits, including modified sugars such as 2'-O-alkyl ribose.
o The term "phosphonate" refers to the group O=P-R
25 - O ~, wherein R i8 an alkyl or aryl group. Suitable alkyl or aryl groups include those which do not sterically hinder the phosphonate linkage or interact with each other. The phosphonate group may exist in either an "R" or an "S"
configuration. Phosphonate groups may be used as inter-nucleosidyl phosphorus group linkages (or links) to con-nect nucleosidyl units.

O
The term "phosphodiester" refers to the group O=P-O, O

SUBS~rESHEEr W093/07295 2 1 1 9 8 9 0 PCT/US92/0~58 wherein phosphodiester groups may be used as internucleo-sidyl phosphorus group linkages (or links) to connect nucleosidyl units. A ~non-nucleoside monomeric unit"
refers to a monomeric unit which does not significantly participate in hybridization of an Oligomer to a target sequence. Such monomeric units must not, for example, participate in any significant hydrogen bonding with a nucleoside, and would exclude monomeric units having as a component, one of the s nucleotide bases or analogs thereof.
A "nucleoside/non-nucleoside polymer" refers to a polymer comprised of nucleoside and non-nucleoside mono-meric units.
The term "oligonucleoside" or "Oligomer~ refers to a chain of nucleosides which are linked by internucleoside linkages which is generally from about 6 to about 100 nucleosides in length, but which may be greater than about 100 nucleosides in length. They are usually synthesized from nucleoside monomers, but may also be obtained by enzymatic means. Thus, the term ~Oligomer" refers to a chain of oligonucleosides which have internucleosidyl linkages linking the nucleoside monomers and, thus, includes oligonucleotides, nonionic oligonucleoside alkyl-and aryl-phosphonate analogs, alkyl- and aryl-phosphono-thioates, phosphorothioate or phosphorodithioate analogsof oligonucleotides, phosphoramidate anaIogs of oligo-nucleotides, neutral phosphate ester oligonucleoside analogs, such as phosphotriesters and other oligonucleo-side analogs and modified oligonucleosides, and also includes nucleoside/non-nucleoside polymers. The term also includes nucleoside/non-nucleoside polymers wherein one or more of the phosphorus group linkages between mono-meric units has been replaced by a non-phosphorous linkage such as a morpholino linkage, a formacetal linkage, a sul-famate linkage or a carbamate linkage.

SUBSlllV~ESHEI
.

W093/07295 - PC~/US~2/0~58 211989~

The term ~alkyl- or aryl-phosphonate Oligomer" refers to Oligomers having at least one alkyl- or aryl-phospho-nate internucleosidyl linkage.
The term "methylphosphonate Oligomer" (or ~MP-Oligo-mer") refers to Oligomers having at least one methylphos-phonate internucleosidyl linkage.
The term "neutral Oligomer" refers to Oligomers which have nonionic internucleosidyl linkages between nucleoside monomers (i.e., linkages having no net positive or nega-tive ionic charge) and include, for example, Oligomershaving internucleosidyl linkages such as alkyl- or aryl-phosphonate linkages, alkyl- or aryl-phosphonothioates, neutral phosphate ester linkages such as phosphotriester linkages, especially neutral ethyltriester linkages; and non-phosphorus-containing internucleosidyl linkages, such as sulfamate, morpholino, formacetal and carbamate link-ages. Optionally, a neutral Oligomer may comprise a con-jugate between an oligonucleoside or nucleoside/non-nucleoside polymer and a second molecule which comprises a conjugation partner. Such conjugation partners may comprise intercalators, alkylating agents, binding sub-stances for cell surface receptors, lipophilic agents, ` photo-cross-linking agents such as psoralen, and the like.
Such conjugation partners may further enhance the uptake of the Oligomer, modify the interaction of the Oligomer with the target sequence, or alter the pharmacokinetic distribution of the Oligonucleoside. The essential requirement is that the oligonucleoside or nucleoside/non-nucleoside polymer that the conjugate comprises be neutral.
The term "neutral alkyl- or aryl-phosphonate Oligo-mer" refers to neutral oligomers having neutral inter-nucleosidyl linkages which comprise at least one alkyl- or aryl-phosphonate linkage.
The term "neutral methylphosphonate Oligomer" refers to neutral Oligomers having internucleosidyl linkages which comprise at least one methylphosphonate linkage.

SUBSll~Ul~SHEr W093/07295 PCT/US92/0~58 211989~

The term ~Triplex Oligomer Pair~ refers to first and second Oligomers which are capable of reading a segment of a single stranded nucleic acid, such as RNA or DNA, and forming a triple helix structure therewith.
The term "Third Strand Oligomer" refers to Oligomers which are capable of reading a segment of a double stranded nucleic acid, such as a DNA duplex or a DNA-RNA
duplex, and forming a triple helix structure therewith.
The term "complementary," when referring to a Triple Oligomer Pair or first and second Oligomers (or to a Third Strand Oligomer), re~ers to Oligomers having base sequences which hydrogen bond (and base pair or hybridize) with the base sequence of a single stranded nucleic acid (or to a nucleic acid duplex for the Third Strand Oligo-mer) to form a triple helix structure.
In the various Oligomer sequences listed herein "p"
in, e.g., as in ApA represents a phosphodiester linkage, and "~" in, e.g., as in C~G represents a methylphosphonate linkage. Also, notation such as "T" indicates nucleosidyl groups linked by methyl phosphonate linkages.
The term "read" refers to the ability of a nucleic acid residue to recognize through hydrogen bond inter-actions and base sequence of another nucleic acid. Thus, in reading a single stranded DNA sequence, a corresponding base of each Triple Oligomer pair Oligomer is able to recognize through hydrogen bond interactions the corres-ponding base of the segment of a single stranded DNA and form a triplet therewith.
The term "triplet" refers to a situation such as that depicted in Figures lA, lB; 2A to 2D and 3A to 3C, wherein a base of each of the first and second Oligomers has hydrogen bonded (and thus base paired) with the corres-ponding base of the target segment of single stranded DNA
or RNA.

~SHEr W093/07295 PCT/US92/0~58 211989~

Brief Descr~etion of the Drawinas Figures lA and lB depict triplets wherein two pyrimi-dine bases forms a triplet with a central purine base.
Figures 2~ to 2D depict triplets wherein a purine base and a pyrimidine base forms a triplet with a central purine base.
Figures 3A to 3C depict triplets incorporating ana-logs of G or A.
Figures 4A to 4E depict the base sequences of exem-plary mixed sequence triple helix structures wherein oneof the Triplex Oligomer pair "reads" across the two other strands and, thus, base pairs with purine bases on both other strands.
Figure 5 depicts a nucleosidyl unit having a modified sugar moiety with an alkyleneoxy link for lengthening internucleoside phosphorus lin~ages and processes for its preparation.
Figure 6 depicts a nucleosidyl unit having a modified sugar moiety with an alkylene link for lengthening inter-nucleoside phosphorus linkages and processes for its synthesis.
Figure 7 depicts CD spectra of triple helix struc-tures, (-) depicts a MP-Oligomer Third Strand, (---) depicts an Oligonucleotide Third Strand.
Figures 8A and 8B depict cross-linking of (A) single 8tranded DNA and (Bj double stranded DNA using psoralen-derivatized MP-Oiigomers.
Figures 9A to 9E depict CD spectra. Figures 9A
depicts CD spectra of oligomers I (-) and II (---) in buffer A in room temperature and III (-~-) in buffer B at room temperature. Figure 9B depicts CD spectra of I-II, 2:1 at room temperature in buffer A (-) and buffer B
~ ). Fiqure 9C depicts the CD spectrum for 1:1 I-II
(-) and a calculated CD spectrum derived from 1/2 ~I-II
3S (2:1 + II] (----) in buffer A at room temperature. Figure 9D depicts CD spectra of II-III (1:1) + I (-), I (---), II-III (- -), and a summation of the spectra of II-III and , WO93~0729s PCT/US92/0~58 I, all in buffer A in room temperature. Figure ~E depicts CD spectra of II-III (1:1) + I in buffer A at room temper-ature (-~ and at 3C (-----) and in buffer C at room tem-perature (----) and at 3C (-- - --).
Figure 10 depicts autoradiograms of polyacrylamide gel electrophoresis patterns: Lane 1, II; Lane 2, III-II
(2:1); Lane 3, I-II (2:1); Lane 4, III; Lane 5, III-II
(1.5:1); Lane 6 I-~I-III (1.5:1:1.5). In Lanes 1 to 3, II
labelled by 32p, and in Lanes 4 to 6, III labelled by 32p, were used as radioactive marks.
Figures llA and llB depict W melting/annealing pro-files of I-II-I. Figure llA depicts the normali'zed hyper-chromity changes and Figure llB the ratio of the hyper-chromicity changes, for dissociation (-) and association 1 5 ( ~~~~ ) -Figure 12 depicts CD spectra of 2'-O-methyl (piCU) 8-r(AG)8, 2~ ), and 2'-O-methyl (piCU)8 d(AG)8 (----) at room temperature.
Figure 13 depicts a melting curve for 2'-0-methyl (p~CU)~-r(AG)8 (2:1).
Figures 14A and 14B depict breakpoints in mixing curves for d(AG) 8 I d(CT) 8 and d(AG)8 ~ d(CT)8-; Figures lSA-lSD depict CD spectra. Figure lSA
depicts CD spectra for d(AG)8-d(CT)8, 1~ ) and d(AG)8 single strand (---). Figure 15B depicts d(AG)8-d(CT)8, 2:1 (-), calculated spectrum from a weighted average of duplex and single strand (----). Figure 15C depicts CD spectra for d(~)8-d(CT)8, 1:1 (-), d(AG)8 single strand (---), d(CT)8 single strand (--~ ). Figure lSD depicts CD
spectra for d(AG)8-d(CT)8, 2:1 (-) and calculated spectrum from a weighted average of duplex and single strand (---).
Figures 16A-16C depict thermal denaturation curves for d(AG)8-d(CT)8, 1:1, (16A); d(AG)8-d(CT)8, 1:1 (16B) and d(~)8-d(CT)8, 2:1, (16C).
Figure 17 depicts an autoradiograph of a native poly-acrylamide gel, having gamma t32P] end labelled d(CT) R
(lanes 1 to 12) and d(AG) 8 ( lanes 13 to 17).

- ` SlJBSlllUTESHEEr W093/07295 PCT/US92/0~58 8 9 ~ 16 Figure l~A depicts hydrogen ~onded NH-N resonances for d(AG) 8- d(CT) 8 mixtures, 1:1 and 2:1.
Figure 18B depicts temperature dependence of the chemical shift for the three resonances observed for the 2:1 mixture of Figure 18A.

Detailed Descri~tion of the Invention The present invention involves the formation of triple helix structures with a selected target single stranded nucleic acid sequence by contacting said nucleic acid with a first and second Oligomers, the Triplex Oligo-mer Pair, which are selected having nucleoside sequences such that they form a triple helical (or helix) complex with the target sequence.

(A) General Aspects In addition to other aspects described herein, this invention includes the following aspects.
A first aspect concerns the reading (or recognition) of the bases in a single stranded nucleic acid segment, through hydrogen bond formation by the bases in the first and second Oligomers using the extra hydrogen bond sites of purines such as adenine and guanine or analogs thereof.
In other words, in reading the base sequence in the single stranded nucleic acid to give a triplet, there is always a purine in the central position of the triplet ("central purine"). The central purine base may be on the single stranded target sequence, or if the target has a pyrimi-dine base, it will be on one of the first or second Oli-gomers. The triplet is formed through hydrogen bond formation with the bases in the other two strands with the remaining available hydrogen bonding sites of the central purine base. Either purines (such as adenine (a), gua-nine (b) or the adenine and guanine analogs described herein), or pyrimidines (thymine (T), cytosine (c) or cytosine analogs described herein may form hydrogen bonds with the central purine.

SUBSllIUlE SHE~

W093/07295 2 1 1 ~ 8 9 0 PCT/US92/0~8 i) Adenine (A) in the central position of the triplet is read or hydrogen bonded with A (or an A analog) or T in the other strands.
ii) Guanine (G) in the central position of the s triplet is read or hydrogen bonded with c (or a c analog) or G (or a G analog) in the other strands.
In a preferred aspect of the present invention, the phosphorus-containing bac~bone of the first and second Oligomers comprise methylphosphonate groups as well as naturally occurring phosphodiester groups.
The base planes of the purines and pyrimidines are rigid, and the furanose ring only allows a small ripple (about 0.5A above or below the plane). Thus, the confor-mational state of the nucleoside is defined principally by the rotation of these two more or less rigid planes, i.e., the base and the pentose, relative to each other about the axis of the C'-l to N-9 or N-l bond. The sugar-base tor-sion angle, ~, has been defined as ~the angle formed by the trace of the plane of the base with the projection of the C-l' to 0-1' bond of the furanose ring when viewed along the C'-l to a bond. This angle will be taken as zero when the furanose-ring oxygen is antiplanar to C-2 of the pyrimidine or purine ring and positive angles will be;~
taken as those measured in a clockwise direction when; ~ 25 viewing C-1' to N." This angle has also been termed the glycosyl tors~on angle. Using the above definition, it was concluded that there were two ranges of ~ for the nucleosides, about -30 for the anti conformation and about +150 for the syn conformation. The range for each conformation is about +45. (22, 22a) Other researchers have used or proposed slightly different definitions of this angle. (23,24,25,26,27) Information concerning has been obtained using procedures such as X-ray diffrac-tion, proton magnetic resonance (PMR) and optical rotatory dispersion-circular dichroism (ORD-CD). (22a) In situations of double stranded nucleic acid tar-gets, in order to accommodate the change of location of ' Sl.~lTr~llE SHEEr W093/07295 PCT/US92/0~5X

the purine base to be read from one strand (termed the "Watson strand") to the opposite strand (termed the "Crick strand"), we have recognized that a particular conforma-tion of the nucleoside, defined by the torsion angle of the glycosyl bond, of the purine nucleosidyl unit in the Third Strand is required in order that the purine nucleo-side in the Third Strand can be used to read the purine in the duplex. In other words, in order to read the purine bases in the DNA, the conformations of the purine nucleo-sidyl units in the Third Strand are influenced by thepolarity (parallel (5' to 3') or anti-parallel (3' to 5') direction) of the strand containing the pùrine bases to be read in the DNA in relation to the Third Strand. For the purine nucleosidyl units in the Third Strand, reading the purine in the parallel strand in the duplex, the conforma-tion of the purine nucleosidyl unit in the Third Strand should be in the ~Ya conformation. On the other hand, the conformation of the purine nucleosidyl unit in the Third Strand in reading the corresponding purine in the anti-parallel strand in the duplex, should exist in anti con-formation. Thus, in reading the purine bases in the duplex distributed in both strands, one has the choice of using a Third Strand which has the same polarity as (i.e., is parallel to) either one strand or the opposite strand.
As an example, 5' 3' G C (these 2 strands I I are anti-parallel C G to each other) 1 l T A
A T

3' 5' (Watson strand) (Crick strand) The sequence of the Third Strand in the triplet with the DNA duplex having the same polarity of the Watson strand from 5' to 3' would be as follows:

W093/0729~ 2 1 1 9 8 9 ~ PCT/US92/0~58 5 I G~yn G~
A~
1~
3' (the Third Strand parallel to the Watson strand The sequence of a Third Strand parallel to the Crick strand would be as follows:
G~ 3' G~n A'~

5' (the Third Strand parallel to the Crick strand A~cording to one aspect of this invention, in con-structing the Third Strand for reading the purines in the base pairs of the duplex, the following guidelines apply:
25(i) Starting from the 5' end toward the 3' end, the purine nucleosidyl units (A or G) of the Third Strand need to be in syn conformation in reading the purines in the base pair (A or G) of the parallel ("Watson") strand of the double stranded nucleic acid. In reading the second purine in the tsecond base pair, the same requirement applies if the purine is located in the same strand as the first purine. However, if the second purine is located in the opposite anti-Parallel (~'Crick") strand (now the oppo-site strand is anti-parallel to the Third Strand), the purine nucleosidyl unit needs to be in anti conformation.
In all cases, adenine in the Third Strand is used to read adenine in the duplex and guanine in the Third Strand is used to read guanine in the duplex.
A third aspect of this invention concerns the length of the linkage of the phosphorus backbone of the Third Strand to allow reading of the purine bases on either strand of the double stranded nucleic acid. In order to S~JBSmUlESHEr, .

wo93/o72~s PCT/US92/0~58 ?,i~l9890 be able to "read~ (or base pair) with purine bases on either strand, the distance between nucleosidyl units along the phosphorus backbone must be increased. Two types of lengthening link formats for the phosphorus backbone are proposed. One type of link format for the phosphorus backbone would use a universal lengthening link on the individual nucleosidyl units, i.e., all the lengthening links of the Third Strand would be the same.
Such a universal link format is particularly suitable for Third Strands comprising only purine bases. Accordingly, the length of the link between the 5' carbon of the "nucleosidyl unit one" to the 3' oxygen of the subsequent "nucleosidyl unit two" may be increased by two atoms (such as -CH2CH2-) or by 3 atoms (such as -O-CH2-CH2-), thereby lengthening the linkage between individual nucleosidyl units by 2 to 6A. In order to allow an appropriate dis-tance between nucleosidyl units, we recommend that separa-tion of the units be increased by a number of atoms rang-ing from 1 to 6. Figure 6 illustrates an example of a nucleosidyl unit comprising this lengthening link format and proposed synthetic routes.
A second lengthening link format for the phosphorus backbone would comprise non-uniform lengthening links.
Links having internucleosidyl distances on the order of the standard phosphodiester backbone for the Third Strand would be employed when the purines being read were on the same strand, while a lengthened link (15-17A in length) which could comprise lengthening links on the 3' carbon of one nucleosidyl unit and on the 5'- carbon of its neigh-bor, would be employed to read the purine bases located onopposite strands. Such a non-uniform lengthening link format would be particularly suitable for use in Third Strands comprising both pyrimidine (or pyrimidine analog) and purine bases.

SUBSTllUrE S~EF

W093/07295 PCT/US92/0~58 (B) Formation of ~E~e ~elix Structures (1) Tripl~et lgE~3i~le-Stranded) base airina Figure lA depicts a triplet ha~ing a central A base which is hydrogen bonded to a T on either side. In such circumstances, one T-containing strand is aligned parallel to the A-containing strand and the other T-containing strand is aligned antiparallel to the A-containing strand.
Accordingly, the sequence for that triplet is written as foll~ws.

Figure lB depicts a triplet having a central G which is hydrogen bonded to a protonated C on one side and a C
on the other side. In such a circumstance, one of the Triplex Oligomer pair has a cytosine protonated at N3 in order to form hydrogen bonds necessary for a stable trip-let. Optionally, that base may be replaced by a cytosine analog having a nitrogen bearing a proton at a position analogous to N-3. In the triplet depicted, the strand containing C+ (or its analog) is aligned parallel to the central G-containing strand. The C-containing strand is aligned antiparallel to the central G-containing strand.

Su8slm~E ~EEr WO93/0729s PcT~uss2to~s8 2l t9~90 22 Accordingly, such a triplet sequence is written as follows:
r ~ ~ ^

Figure 2A depicts a triplet wherein the central A
forms a hydrogen bond with an A on one side ("side A") and a T on the other. The strand containing the -side A is aligned parallel to the strand containing the central A.
The strand containing the T is aligned anti-parallel to the strand containing the central A. In such a circum-stance, the glycosyl (~-N) torsion angle of the side A is in the sYn conformatisn and the glycosyl torsion angles of the central A and the T bases are both in the anti confor-mation. Such a triplet sequence is written as follows:
- A

Figure 2B also depicts a triplet where a central A
f~rms a triplet with an A one side and a T on the other.
In this triplet the strand containing the side A is aligned anti-parallel to the strand containing the central A. The strand containing the T is aligned parallel to the strand containing the central A. In such circumstance, SUBSllTU~E SHg~ `

Wos3/072ss 2 1 ~ ~ g 3 0 PcT/US92/0~58 all three bases are in the anti conformation. Such a triplet sequence is written as follows:
~A

Figure 2c depicts a triplet having a central G hydro-gen bonded to a G on one side ~side G") and a C on the other. The strand containing the side G is aligned parallel to the strand containing the central G and the strand containing the C is aligned antiparallel to the strand containing the central G. In such circumstance, the glycosyl torsion angle of the side G is in the svn conformation and the glycosyl torsion angles of the cen-tral G and the C are both in the anti conformation. Such a triplet sequence is written as follows.

Figure 2D also depicts a triplet where a central G is hydrogen bonded to a G on one side and a C on the other side. In this example, the strand containing the side G
is aligned anti-parallel to the strand containing the central G and the strand containing the C is aligned anti-parallel to the strand containing the central G. In such circums~ance, the glycosyl torsion angles for all three SUBSll~UlE SHEEl W093/0729~ 24 PCTtUS92/0~58 bases are in the anti conformation. Such a triplet sequence is written as follows:
211989U ~r ~

Figures 3A and 30 depict a trlplet wherein a cen-tral G is hydrogen bonded to a modified G on one side and a C on the other side. The strand containîng the modified G, either 2-amino-9-~-~-ribofuranosyl purin-6-selene ("6-selenium guanosine) in Figure 3A or 6-isopropyledene-7-deazaguanosine in ~igure 3B is aligned anti-parallel to the strand, containing the central G and the strand con-taining the C is aligned anti-parallel to the~strand containing the central G. The triplet containing the 6-selenium guanosine is written as follows:
~ r~ r ~ ~- ~A
and.the triplet containing 6-isopropyledene-7-deazaguano-sine is written as follows:
~ r ~

.
The reading of the modifie~d~Gain the third strand will be much more specific by eliminating the 6-oxo group of normal (i.e., unmodified) G in the triplex formation.

~ITUIE SHEr ' ' W093/0729~ 25 2 1 1 9 ~ ~ O PCT/US92/0~58 Figure 3c depicts a triplet wherein a central A 15 hydrogen b~nded t~ a modified A ( 2 -amino purine) on one side and a T on the other side. The strand containing the 2-amino-purine is aligned parallel to the strand contain-ing the central A and the strand containing the T isaligned anti parallel to the strand containing the central A. Such a triplet sequence is written as follows:
'2a P A

It should be noted that in this triplet, Nl of 2-amino-purine is accepting a proton from the 6-amino group of the central A and that the 2-amino group of the 2-aminopurine is donating a proton to the N7 of the central A. This arrangement will induce the guanine base in the third strand to form a hydrogen bond pair by donating a proton from both N, H and the 2-amino group to the 6-oxo group and N7 group of the central G in a successive triplet. In this manner, A to A pairing should contain a donor and a receptor arrangement from the third strand of A and the G
to G pairing should contain both donor arrangements from the-third strand of G. Tbus, the reading of purines by purines will be much more specific.

(2) Polv~urine Taraet Seouences Wherein the single stranded nucleic acid comprises a polypurine sequence, it can form triplets where that strand provides the central purine of the triplets formed, so that the target is completely sandwiched by the first and second Oligomers. This Triplex Oligomer pair may both comprise havin~ complementary polypyrimidine sequences or alternatively one of the first and second Oligomers has a polypurine seguence and one has a polypyrimidine sequence.
.

, W093/0729s PCT/US92/0~58 .. ..

2 119 89~ 26 (3) Polypyrimidine Taraet Sequences Where the single stranded target nucleic acid com-prises a polypyrimidine sequence, that target nucleic acid will not provide the central purine bases for triplet for-mation. The first and second Oligomers which form thetriple helix structure with the single stranded target may both comprise polypyrimidine sequence or alternatively, one of the first and second Oligomers may have a poly-purine sequence and the other a polypurine sequence.
Since the pyrimidine bases of the target may not provide the central base of the triplets, an "open sandwich"
triple helix complex is formed wherein one of the Triplex Oligomer Pairs provides the central purine ~ase of the triplet. In order to decrease formation of duplex between the Triplet Oligomer Pairs, it may be preferred that the first and second Oligomers both comprise polypurine sequences.

(4) Mixed Sequences Mixed sequences are sequences wherein the selected single stranded nucleic acid target sequence comprises both pyrimidine and purine bases. The triplets formed using the first and second Oligomers requires a central purine base that can hydrogen bond to two other bases to form a triplet. Accordingly, one of thé first and second Oligomers must be able to "read" across the other two strands. Examples of mixed sequences including appro-priately first and second Oligomers are depicted in Figures 4A to 4E.
Figure 4A depicts a mixed sequence wherein the Oligo-mer which reads across the other two strands is pyrimi-dine-rich.
Figure 4B depicts a mixed sequence wherein the Oligo-mer which reads across the other two strands is purine-rich.
35 ; Figures 4C, 4D and 4E depict mixed sequences which reads across the Oligomer containing only purine bases.

- SUBSrlTUrE SHEr W093/0729~ 2 1 1 9 8 9 ~ PCT/US92/0~58 ~n Fiqures 4C to 4E, "s" denotes sYn and "a" denotes anti;
no superscript denotes,anti.
Where one of the first and second Oligomers must read two strands across from one strand to the opposite strand in order to base pair with a central purine base, it may be advantageous to provide a lengthened internucleosidyl phosphorus linkage by incorporation of the previously-d~scribed backbone link formats into the phosphorus back-bone which connects the sugar moieties of the nucleosidyl lo units.
For example, an internucleosidyl linkage may be lengthened by the interposition of an appropriate alkylene (~ (CH2) n~) or alkyleneoxy (-(CH2) n~) lengthening link between the 5'-carbon and the 5' hydroxyl of the sugar moiety of a nucleosidyl unit or a similar link between the 3'-carbon and the 3'-hydroxyl. (See Figures 5 and 6.) Where indicated, such lengthening links may be interposed at both the 3'- and 5'- carbons of the sugar moiety.
Where consecutive central purines used in triplet formation occur on the same strand, such lengthening links need not be employed; internucleosidyl phosphorus linkages such as methylphosphonate linkages allow an appropriate ' base on the other strands to read consecutive central purine bases on,the same strand.
Accordingly, by employing such lengthening links where indicated, Oligomers which are capable of reading central purine bases either of'the single stranded target or of the other Oligomer, may be prepared.

(C) First and Second Oliqomers ' 30 Preferred are f irst and second Oligomers having at least about 7 nucleosides, which can be a sufficient num-ber to allow for specific binding to a desired sequence of a selected target segment` of single stranded DNA or RNA.
More preferred are Oligomers having from about 8 to about 40 nucleosides; especially preferred are Oligomers having from about lO to about 25 nucleosides. Due to a combina-W093/07295 PCT/US92/0~58 211989~

tion of ease in synthesis, specificity for a selected target sequence, coupled with minimization of intra-Oligomer, and internucleoside interactions such as folding and coiling, it is believed that Oligomer~ having from about 12 to about 20 nucleosides comprise a particularly preferred group.

(1) Preferred Oliqomers These Oligomers may comprise either ribosyl moieties or deoxyribosyl moieties or modifications thereof. How-ever, due to their easier synthesis and increased stabil-ity, Oligomers comprising deoxyribosyl or modified ribosyl moieties (such as 2'-0- methyl ribosyl moieties) are preferred.
Although nucleotide Oligomers (i.e., having the phos-phodiester internucleoside linkages present in naturalnucleotide Oligomers, as well as other oligonucle~tide analogs) may be used according to the present invention, preferred Oligomers comprise oligonucleoside alkyl and arylphosphonate analogs, phosphorothioate oligonucleoside analogs, phosphoro-amidate analogs and neutral phosphate triester oligonucleoside analogs. However, especially preferred are oligonucleoside alkyl- and aryl-phosphonate analogs in which phosphonate linkages replace one or more of the phosphodiester linkages which connect two nucleo-sidyl units. The preparation of some such oligonucleo-sidyl alkyl and arylphosphonate analogs and their use to inhibit expression of preselected single stranded nucleic acid sequences is disclosed in U.S. Patent Nos. 4,469,863;
4,511,713; 4,757,055; 4,507,433; and 4,591,614, the dis-closures of which are incorporated herein by reference.A particularly preferred class of these phosphonate ana-logs are methylphosphonate Oligomers.
Preferred synthetic methods for methylphosphate Oligomers t"MP-Oligomers") are described in Lee, B.L., et al., Biochemistry 27:3197-3203 (1988), and Miller, SUBS~rUrESH Er '

5 2 1 1 ~ 3 ~ ~ P~/US92/08458 P . S ., et al ., Biochemistry 25 : 50g2-5097 ( 1986), the dis-closures of which are incorporated herein by reference.
Preferred are oligonucleosidyl alkyl- and aryl-phosphonate analogs wherein at least one of the phospho-diester internucleoside linkages is replaced by a 3'-5' linked internucleoside methylphosphonyl (MP) group (or ''methylphosphonate~). The methylphosphonate linkage has a bond length similar to the bond length of the phosphate groups of oligonucleotides. T~us, these methylphosphonate Oligomers ("MP-oligomers") should present minimal steric restrictions in the interaction with selected nucleic acid sequences. Also suitable are other alkyl or aryl phospho-nate linkages wherein such alkyl or aryl groups do not sterically hinder the phosphonate linkage or interact with each other. These MP-Oligomers should be very resistant to hydrolysis by various nuclease and esterase activities, since the methylphosphonyl group is not found in naturally occurring nucleic acid molecules. Due to the nonionic nature of the methylphosphonate linkage, these MP-oligo-mers should be better able to cross cell membranes andthus be taken up by cells. It has been found that certain MP-Oligomers are more resistant to nuclease hydrolysis, are taken up in intact form by mammalian cells in culture and can exert specific inhibitory effects on cellular DNA
and protein synthesis (See, e.g., U.S. Patent No. 4,469,863).
Preferred are MP-Oligomers having at least about seven nucleosidyl units, more preferably at least about 8, which is usually sufficient to allow for specific recogni-tion of the desired segment of single stranded DNA or RNA.More preferred are MP-Oligomers having from about 8 to about 40 nucleosides, especially preferred are those having from about 10 to about 25 nucleosides. Due to a combination of ease of preparation, with specificity for a selected sequence and minimization of intra-Oligomer, internucleoside interactions such as folding and coiling, SUBSmUlE SHEEI

W093/07295 PCT/US92/0~58 21I particularly preferred are MP-Oligomers of from about 12 to 20 nucleosides.
Especially preferred are MP-Oligomers where the 5'-internucleosidyl linkage is a phosphodiester linkage and the remainder of the internucleosidyl linkages are methylphosphonyl linkages. Having a phosphodiester link-aqe on the 5'-end of the MP-Oligomer permits kinase label-ling and electrophoresis of the Oligomer and also improves its solubility.
The selected single stranded nucleic acid sequences are sequenced and MP-Oligomers complementary to the purine sequence are prepared by the methods disclosed in the above noted patents and disclosed herein.
These Oligomers are useful in determining the pre-sence or absence of a selected single stranded nucleicacid sequence in a mixture of nucleic acids or in samples including isolated cells, tissue samples or bodily fluids.
These Oligomers are useful as hybridization assay probes and may be used in detection assays. When used as probes, these Oligomers may also be used in diagnostic kits.
If desired, labelling groups such as psoralen, chemi-luminescent groups, cross-linking agents, inter-calating agents such as acridine, or groups capable of cleaving the targeted portion of the viral nucleic acid such as molecu-lar scissors like o-phenanthrolinecopper or EDTA-iron may be incorporated in the MP-Oligomers.
These Oligomers may be labelled by any of several well known methods. Useful labels include radioisotopes as well as nonradioactive reporting groups. Isotopic labels include 3H, 35S, 32p, t~I, Cobalt and 14C. Most methods of isotopic labelling involve the use of enzymes and include the known methods of nick translation, end labelling, second strand synthesis, and reverse trans-cription. When using radio-labelled probes, hybridization can be detected by autoradiography, scintillation count-ing, or gamma counting. The detection method selected SUBSmUlE SHEr W093/07295 ~ 8 9 0 PCT/US92/0~58 will depend upon the hybridization conditions and the particular radioisotope used for labelling.
Non-isotopic materials can also be used for label-ling, and may be introduced by the incorporation of modi-fied nucleosides or nucleoside analogs through the use ofenzymes or by chemical modification of the Oligomer, for example, by the use of non-nucleotide linker groups. Non-isotopic labels include fluorescent molecules, chemilumi-nescent molecules, enzymes, cofactors, enzyme substrates, haptens or other ligands. One preferred labelling method includes incorporation of acridinium esters.
Such labelled Oligomers are particularly suited as hybridization assay probes and for use in hybridization assays.
When used to prevent function or expression of a single-stranded nucleic acid sequence, one or both of these Oligomers may be advantageously derivatized or modified to incorporate a nucleic acid modifying group which may be caused to react with said nucleic acid and irreversibly modify its structure, thereby rendering it non-functional. Our co-pending patent application, U.S.
Serial No. 924,234, filed October 28, 1986, the disclosure of which is incorporated herein by reference, teaches the derivatization oP Oligomers which comprise oligonucleoside alkyl and arylphosphonates and the use of such derivatized oligonucleoside alkyl and arylphosphonates to render targeted single stranded nucleic acid sequences non-functional.
A wide variety of nucleic acid modifying groups may be used to derivatize these Oligomers. ~ucleic acid modi-fying groups include groups which, after the derivatized Oligomer (or Oligomers) forms a triple helix structure with the single stranded nucleic acid segment, may be caused to form a covalent linkage, cross-link, alkyiate, cleave, degrade, or otherwise inactivate or destroy the nucleic acid segment or a target sequence portion thereof, SU13ST~SHEEr W093/07295 PCT/US92/0~58 and thereby irreversibly inhibit the function and/or expression of that nucleic acid segment.
The location of the nucleic acid modifying groups in the Oligomer (or Oligomers) may be varied and may depend on the particular nucleic acid modifying group employed and the targeted single stranded nucleic aci~ segment.
Accordingly, the nucleic acid modifying group may be positioned at the end of the Oligomer or intermediate the ends. A plurality of nucleic acid modifying groups may be included. Also both of the first and second Oligomers may include nucleic acid modifying groups.
In one preferred aspect, the nucleic acid modifying group is photoreactable (e.g., activated by a particular wavelength, or range of wavelengths of light), so as to cause reaction and, thus, cross-linking between the Oligo-mer and the single stranded nucleic acid.
Exemplary of nucleic acid modifying groups which may cause cross-linking are the psoralens, such as an amino-methyltrimethyl psoralen group (AMT). The AMT is advan-tageously photoreactable, and thus must be activated by exposure to particular wavelength light before cross-linking is effectuated. Other cross-linking groups which may or may not be photoreactable may be used to derivatize these Oligomers.
Alternatively, the nucleic acid modifying groups may comprise an alkylating agent group which, on reaction, separates from the Oligomer and is covalently bonded to the nucleic acid segment to render it inactive. Suitable alkylating agent groups are known in the chemical arts and include groups derived from alkyl halides, haloacetamides, and the like.
Nucleic acid modifying groups which may be caused to cleave the nucleic acid segment include transition metal chelating complexes such as ethylene diamine tetraacetate (EDTA) or a derivative thereof. Other groups which may be used to effect cleaving include phenanthroline, porphyrin or bleomycin, and the like. When EDTA is used, iron may SUBS~IIUIE SHEr wo g3/07295 2 1 1 9 ~ 9 0 PCT/US92/0~58 be advantageously tethered to the Oligomer to help gener-ate the cleaving radicals. Although EDTA is a preferred DNA cleaving group, other nitrogen containing materials, such as azo compounds or nitreens or other transition metal chelating complexes may be used.
The nucleosidyl units of a first or second Oligomer which read purine bases on two strands to form a triplex sequence may comprise a mixture of purine and pyrimidine bases or only purine bases.
Where purine bases on two strands of a triplex sequence are to be read, it is preferred to use a "read across" Oligomer having only purine bases. It is believed that such purine-only Oligomers are advantageous for sev-eral reasons: (a) purines have higher stacking properties 15 than pyrimidines, which would tend to increase stability of the resulting triple helix struc~ure; (b) uce of pur-ines only eliminates the need for either protonation of cytosine ~so it has an available hydrogen for hydrogen bonding at the N-3 position at neutral pH) or use of a 20 cytosine analog having such an available hydrogen at the ; position which corresponds to N3 on the pyrimidine ring;
and allows use of a universal lengthening link.
The purine bases (and pyrimidine bases as well) are normally in the ~n~i conformation; however, the barrier 25 ~or a base to roll over to the sYn conformation is low.
In formation of the third triple helix, the purines on th~ 2 Third Strand may assume the ~y~ conformation during th-hydrogen bonding process. If desired, it is possible t modify the purine so that it is normally in the svn cor ac 30 formation. For example, the purine may be modified at t1 in 8-position with a substituent such as methyl, bromo, is me propyl or other bulky group so it will assume the ~ 25 al~
configuration under normal conditions. Nucleosidyl un comprising such substituted purines would thus norma 35 assume the svn conformation. Accordingly, where a pu~
base in the syn conformation is indicated, the pre invention contemplates the optional incorporation of , ~SHEr ' W093/07295 2 1 ~ ~ ~ 9 ~ PCT/US92/0~58 ~"~ ed purines in place of unsubstituted A or G.
Studies with Kendrew models indicate that suc~ substitu-tions should not affect formation of the triple helix structure.
Use of purine nucleosidyl units in the anti and sYn conformations, as appropriate (following the rules for reading the central purine bases described herein) allows reading of the central purine ba~es on two strands and formation of a triple helix structure by a purine-only lo third ~trand.
If a Oligomer compri~ing both pyrimides and purines is used to read purines on two strands of a triplex ~equence, a non-uniform link format is used, as described herein, to allow the third str~nd (~read across Oligomer") to read across from one of the two strands to the other.

~2) Preferred Purine Oliqomers The present invention provides a novel class of pur-ine Oligomers which comprise nucleosidyl units selected from:

.C~B~ t-c~

Q~F~ R ~0~ \

wherein Bp is a purine base; R is independently selected from alkyl and aryl groups ~uch that the phosphonate linX-age is not sterically hindered and the groups do not interact with each other; R' is hydrogen, hydroxy or methoxy; and alk is alkylene of 2 to 6 carb.on atoms or z alkylene of 2 to 6 carbon atoms.

SUBSlTrU~E SHEr wo 93/072g5 2 1 1 9 8 9 0 Pcr/usg2~084s8 Preferred are Oligomers which comprise at least about 7 nucleosidyl units.
Preferred are nucleosidyl units where R is methyl.
Also preferred are nucleosidyl units wherein R' is hydro-gen. Suitable bases Bp include adenine and guanine,either optionally substituted at the 8-position, preferred~
substitutions include methyl, bromo, isopropyl and the like. Also according to another preferred aspect, pre-ferred Oligomers which read central purine bases may include purine analogs, modified to favor triplet forma-tion and stability. These purine analogs include 6-selen-ium guanosine or 6-isopropylidene-7-deazaguanosine in place of guanosine or 2-amino purine in place of adeno-sine. Preferred are alk groups having from about 2 to 3 carbon atoms. Particularly preferred are alk groups having two carbon atoms, and include ethylene.

(3) Oliaomers Comprisina Cytosine AnaIoas In another aspect of the present invention, novel Oligomers are provided which comprise nucleosidyl units wherein cytosine has been replaced by a cytosine analog comprising a heterocycle which has an available hydrogen at the ring position analogous to the 3-N of the cytosine ring and i8 capable of forming two hydrogen bonds with a guanine base in the duplex at neutral pH and thus does not require protonation as does cytosine for Hoogstein-type base pairing, or formation of a triplet.
Suitable nucleosidyl units comprise analogs having a six-membered heterocyclic ring which has a hydrogen avail-able for hydrogen bonding at the ring position correspond-ing to N-3 of cytosine and which is capable of forming two hydrogen bonds with a guanine base in the duplex at neu-tral pH and include 2'-deoxy-5,6-dihydro-5-azadeoxycyti-dine (I), pseudoisocytidine (II), 6-amino-3-(~-D-ribo-furanosyl)pyrimidine-2,4-dione (III) and 1-amino-1,2,4-(~-D-deoxyribofuranosyl)triazine-3-[4H]-one (IV), the structures of which are set forth in Table 5.

~nnESHEEr wo93/o72ss PCT/US92/0~58 2 119~ ga 36 (D) Preparation of MP-Oliqomers (1) In General As noted previously, the preparation of methylphos-phonate oligomers has been described in u.s. Patent Nos. 4,469,863; 4,507,433; 4,511,713; 4,ss~,614; and 4,757,055.
Preferred synthetic methods for methylphosphonate Oligomers are described in Lin, S., et al., Biochemistry 28:1054- 1061 (1989); Lee, B.L., et al., Biochemistry lQ 27:3197-3203 (1988), and Miller, P.S., et al., 25:5092-5097 (1986), the disclosures of which are incorporated herein by reference. Oligomers comprising nucleosidyl units which comprise modified sugar moieties having lengthening links (see Figures 5 and 6) may be conven-iently prepared by these methods.
Oligomers comprising phosphodiester internucleosidylphosphorus linkages may be synthesized using any of sev-eral conventional methods, including automated solid phase chemical synthesis using cyanoethylphosphoroamidite pre-cursors (29).
If desired, the previously-described nucleosidyl units comprising cytosine analogs (see Table 5) may be incorporated into the MP-Oligomer by substituting the appropriate cytidine analog (see Table 5) in the reaction mixture.

(2) ~çearation MP-Oligomers Havina Lenathenina Links in the Phosphorus Backbone (a) 5'-(EthyleneoxY)-Substituted-Suaar Intermediates MP-Oligomers may be prepared using modified nucleo-iides where either the bond between the 5'-carbon and the 5'-hydroxyl or the 3'-carbon and the 3'-hydroxyl of the sugar moiety has been substituted with a alkyleneoxy group, such as ethyleneoxy group.
Figure 5 shows proposed reaction schemes for prepa-ration of intermediates for modified nucleosides havingeither a 3'-(ethyleneoxy) or 5'-(ethyleneoxy) link. In SUE~Sm~SHEEr W093/07295 PCT/US92/0~58 2 ~ 9 ~

Figure 5, B represents a base, Tr and R represent protect-ing groups, Tr depicting a protecting group such as dimethoxytrityl and R depicting protecting groups such as t-butyldimethyl silyl or tetrahydropyranyl.
If desired, nucleosidyl units having such lengthening links at both the 3'- and 5'-positions of the sugar moiety may be prepared.

(b) 5'-~-Hydroxyethyl-Substituted Suaar Intermediate In situations where a double stranded nucleic sequence has purine bases on two strands to be read (i.e., both the target sequence and the first Oligomer), it may be preferred to use Oligomers having a slightly lengthened internucleoside link on the phosphorus backbone.
Such Oligomers may be prepared using nucleosides in which the sugar (deoxyribosyl or ribosyl) moiety has been modified to replace the 5'-hydroxy with a ~-hydroxyethyl (HO-CH2-CH2-) group synthetic schemes for the preparation of such a 5'-~-hydroxyethyl-substituted nucleosides is depicted in Figure 6.
Figure 6 depicts a proposed reaction scheme for a 5'-~-hydroxyethyl-substituted sugar analog. In Figure 6, -~- D~C denotes dicyclohexylcarbodiimide, DMSO denotes dimethyl~ulfoxide. B is a base. Suitable protecting groups, R, include t-butyldimethyl silyl and tetra-hydropyranyl.

~c) Preparation of MP-Oliaomers Havina Lenatheninq Inter-~ucleoside Links in the Phos~horus Backbone MP-Oligomers incorporating the above-described modi-fied nucleosidyl units are prepared as described above, substituting the modified nucleosidyl unit.
In the preparation of Oligomers comprising only purine bases, use of nucleosidyl units having the same lengthening links may be employed. However, in the prep-aration of Oligomers comprising both pyrimidine (or pyri-midine analog) bases and purine bases, a mixture of ' ~æmUrESHEr W093/07295 PCT/US92~0~58 nucleosidyl units having no lengthening link and lengthen-ing links are used; nucleosidyl units having lengthening links at both the 3~-carbon and the 5'-carbon of the sugar moiety may be advantageous.

(3) Preparation of Derivatized MP-Oliaomers Derivatized Oligomers may be readily prepared by add-ing the desired DNA modifying groups to the Oligomer. As noted, the number of nucleosidyl units in the Oligomer and the position of the DNA modifying group(s) in the Oligomer may be varied. The DNA modifying group(s) may be posi-tioned in the Oligomer where it will most effectively modify the target sequence of the DNA. Accordingly, the positioning of the DNA modifying group may depend, in large measure, on the DNA segment involved and its key target site or sites, although such optimum position can be readily determined by conventional techniques known to those skilled in the art.

(a) Preparation of Psoralen-Derivatized MP-Oliaomers The derivatization of NP-Oligomers with psoralens, such as 8-methoxypsoralen and 4'-aminomethyltrimethyl-psoralen (AMT), is described in Kean, J.M., et al.,;~
Biochemistry ~:9113-9121 (1988), and Lee, B.L., et al., Biochemistry ~:3197-3203 (1988), the disclosures of which are incorporated herein by reference.

(b) Preparation of EDTA-Derivatized MP-Oliqomers The derivatization of MP-Oligomers with EDTA is described in Lin, S.B., et al., Biochemistry 28:1054-1061 (1989), the disclosures of which are incorporated herein by reference.

(E) ~tilitY
According to the present invention, a specific seg-ment of single stranded nucleic acid may be detected or recognized using first and second Oligomers which form a WO 93/07295 PCT'/US92/08458 21~90 triple helix with the single stranded nucleic acid accord-ing to the triplet base pairing guidelines described herein. The first and second Oligomers have sequences selected such that a base of each nucleosidyl unit of each Oligomer will form a triplet with a corresponding base of the single stranded nucleic acid target to give a triple helix structure. Detectably labeled Oligomers may be used as probes for use in hybridization assays, for example, to detect the presence of a particular single-stranded lo nucleic acid sequence.
The present invention also provides a method of preventing expression or function of a selected target sequence of single stranded nucleic acid by use of first and second Oligomers which hydrogen bond with and form a triple stranded helix structure with ~he single stranded target as described above. Formation of the triple stranded helix may prevent expression and/or function by modes such as preventing transcription, preventing of binding of effector molecules (such as proteins), etc.
Thus, according to the present invention, the target ~equence of single stranded nucleic acid will be recog-nized twice, or in two steps, (1) one time by duplex formation by Watson-Crick base pairing with the first Oligomer and (2) a second time by triplex formation with the second Oligomer with or without an internucleosidyl lengthening link between nucleosides of the second Oligo-mer to allow the second Oligomer to read across strands.
In this manner, a high affinity complex is formed with a high degree of selectivity. Derivatized Oligomers may be used to detect or locate and then irreversibly modify the target site in the nucleic acid by cross-linking (psora-lens) or cleaving one or both strands (EDTA). By careful selection of a target site for cleavage, one of the Oligo-mers may be uæed as a molecular scissors to specifically excise a selected nucleic acid sequence.
The Oligomers may be derivatized to incorporate a nucleic acid reacting or modifying group which can be SU~SHEEr W093/07295 PCT/US92/0~58 2119~90 caused to react with the nucleic acid segment or a target sequence thereof to irreversibly modify, degrade or destroy the nucleic acid and thus irreversibly inhibit its functions.
These Oligomers may be used to inactivate or inhibit a particular gene or target sequence of the same in a liv-ing cell, allowing selective inactivation or inhibition.
The target sequence may be DNA or RNA, such as a pre-mRNA, an mRNA or an RNA sequence such as an initiator codon, a polyadenylation region, an mRNA cap site or a splice func-tion. These Oligomers could then be used to permanently inactivate, turn off or destroy genes which produced defective or undesired products or if activated caused undesirable effects.
Another aspect of the present invention is directed to a kit for detecting a particular single stranded nucleic acid sequence which comprises first and second Oligomers, at least one of which is a detectably labeled purine MP-Oligomer Third selected to be able sufficiently complementary to the target seguence of the single stranded nucleic acid to be able form a triple helix structure therewith.
To assist in understanding the present invention, the following examples are included which describe the results of a series of experiments, including computer simula-tions. The following examples relating to this invention should not, of course, be construed in specifically limit-ing the invention and such variations of the invention, now known or later developed, which would be within the purview of one skilled in the art, are considered to fall within the scope of the present invention as hereinafter claimed.

SU8Sr~lUlESHEEr ' W093/07295 2 1 1 ~ ~ ~ O PCT/US92/0~58 Examples Example 1 Computer Simulations of Tri~le Helix Structures The primary purpose of these computer simulations was to determine whether nonionic nucleotide analogs with a methylphosphonate ("MP") backbone would bind with greater affinity in comparison with unmodified oligodeoxynucleo-tides ("ODN") as the Third Strand of the triple-stranded helical DNA through Hoogsteen-type base pairing. Experi-mental work suggested that ODN ~inding to duplex DNA andinhibition of transcription could be via triplet forma-tion (8), but no experimental comparison had been made between analogs with MP backbone verses native ODN in formation of the triple-stranded DNA helix. It was pre-viously unknown whether a nonionic analog with MP backbonecould be accommodated in the major groove of triple-stranded helical DNA. Furthermore, the conformation of fully solvated triple-stranded helical DNA with native or MP backbone in the third strand had not been determined.
Site-specific oligonucleotide binding via double and triple stranded DNA complex formation has recently been shown to suppress transcription of human oncogenes vitro (8, 9). The goal of this example was to use molecular dynamics simulation to investigate nonionic oligonucleotide analogs with MP backbone in triple-stranded helical complexes, and to gain insight into the molecular mechanism(s) involved in this process.

(A) Simulation Methods Triple-stranded poly (dTIo) -poly (dA~o)-poly (dTIo) tT,AT2] coordinates were obtained from the A-DNA x-ray structure of Arnott and Selsing (lO). The same coordi-nates were used for the starting geometry of poly(dT~o)-poly (dAIo)-poly(dTl0) methylphosphonate [TIAT2MP]. Geometry optimization and partial atomic charge assignments for the dimethyl ester methylphosphonate fragment were calculated by ab initio quantum mechanical methods with QUEST (ver-S~SllrUlESHEr W093/07295 PCT/US92/0~58 sion 1.1) using 3-21G* and STOG* basis sets, respec-tively (11). The latter basis set was used to maintain uniform charge assignments with those previously calcu-lated for nucleic acids in the AMBER database. The final monopole atomic charge assignments for the MP fragment were made to obtain a neutral net charge fo~ each base, furanose, and MP backbone of the third DNA strand. Alter-nating Rp and Sp methyl substitution of the backbone phosphoryl oxygens of the T2MP strand was done by stereo computer graphics. The substitution of MP diastereomers was made in this manner to approximate experimental yield, since the synthesis cannot be controlled. Molecular mechanics and molecular dynamics calculations were made with a fully vectorized version of AMBER (version 3.1), using an all-atom force field (12, 13~. All calculations were performed on CRAY X-MP/24 and VAX 8600 computers.
The negative charge of the DNA phosphate backbone was rendered neutral by placement of positive counterions within 4 A of the phosphorus atoms bisecting the phosphate oxygens; counterions were not placed on the MP-substituted strand. The triple helices and counterions were sur-rounded by a 10A shell of TIP3P water (14) molecules with periodic boundary conditions. There are 9,283 and 10,824 atoms in the T~AT2 and TIAT ~ systems, respectively. The box dimensions were 101, 686.8 A3 for TIAT2, and 124,321.1 A3 for TtAT~P. Initially, the DNA and counterion atoms were fully constrained while the surrounding water mole-cules were energy minimized using an 8.0 A nonbonded cutoff until convergence (root mean-square trms] of the gradient <0.1`kcal/mole/A). The DNA, counterions, and water were subsequently energy minimized without geometric constraints for an additional 1500 cycles, followed by 220 cycles of minimization with SHAKE activated (15).
Molecular dynamics using SHAKE at constant temperature and pressure (300K and 1 bar) was carried out without con-straints for 40 psec trajectories for each of the two molecular ensembles.

~ .
SU~mUrESH~ ~

W093/07295 2 t 1 9 8 9 0 PCT/US92/0~58 (B) Results of Simulation Studies The third DNA strand with MP backbone resulted in several changes consistent with enhanced binding of the ODN with the MP backbone in the triple helix. The average hydrogen bond distances and mean atomic fluctuations are consistently smaller in the TIAT~MP triplet (Table 1). The interstrand phosphorus atoms distance was 9.6A (+/-0.91) for A-T2 and 8.3A (+/-0.58) for A-T2MP. The reduced interstrand phosphorus atom distance and smaller mean atomic fluctua-tions between the second and third strands are due to decreased interstrand electrostatic repulsion accompanying MP substitution in the backbone.
Both triple helical DNA systems had strand-specific polymorphic conformational behavior during molecular dyna-mics. There are significant conformational changes in thefuranose relative to the starting geometry in both systems (Table 2). In the TlAT2 helix the furanose ring popula-tions of the Tl and T2 strands remained predominantly in an A-DNA conformation (C3'endo) and the largest proportion of the adenine sugars adopted a B-DNA conformation (C2'endo).
A notable percentage of the adenine furanose conformations were in an 01'endo conformation in T~AT2 and TIAT2MP. The sugar puckering pattern of the MP substituted helix had a~
greater proportion of 01'endo and C2'endo conformations in contrast to the unsubstituted helix. Analysis of other conformational parameters support the hybrid conforma-tional nature of these triple helices. The helical twist angle (between T1 and A strands) averaged 39.4 degrees (+\-2.86) for the TtAT2 structure and is more consistent with a B-DNA conformation (range 36-45). The T~AT2MP
helical twist angle averages 32.0 degrees (+\-2.19) and is closer to that of A-DNA (range 30-32.7). The average helical repeat sinqles (between the T1 and A strands) for the entire structure are for 10.2 T~AT2 and 11.2 degrees for TIAT2MP. The average intrastrand phosphorus atom distances over the 40 psec trajectory are presented in Table 3. In both helices, the intrastrand phosphorus .

su~r~nE~Er , W093/07295 PCT/~S92/0~58 2t~ ~89~) distances of the Tl strands are most consistent with an A-DNA conformation (7.0 A). The interstrand phosphorus distances of the T2MP strand are more consistent with a B-DNA conformation, in contrast to values more consistent with A-DNA for the T2 strand.
We analyzed the coordination of counterions and water along the backbone of the DNA to determine t~e changes accompanying MP substitution. The average coordination distance and atomic fluctuations of the counterions with phosphorus atoms was 3.8A (~\-0.6) for T~AT2 and 4.6A
(+\-0.9) for the T~AT2MP helix. The increase in average coordination distance and atomic motion in TIAT2MP (by 0.8A) is most likely due to the proximity of Rp (axial projecting) methyl groups to the counterions coordinated to the second strand. The average number of water molecules coordinated to the phosphate groups is not significantly altered in the MP substituted helix.
The DNA backbone and the Cl'-N (base) dihedral tran-sitions of the two helical systems are shown in Table 4.
Comparisons of the ~-dihedral of the adenine strands reveals a slight change in the average position of the dihedral with MP substitution, positioning the dihedral closer to trans, but there is a large overlap in the,~
transitional motions of both dihedrals during the 40 psec tra~ectory. There was a significant change (by 27.0 degrees) in the average Sp-MP diastereomer ~ dihedral angle from baseline. The fluctuation of the ~ dihedral containing the Sp-MP diastereomer was significantly less than the Rp-MP.

(C) Interpretation of Simulation Results The results of these molecular dynamics calculations predict that an MP-substituted ODN incorporated as a colinear third strand with Hoogsteen pairing will form a more stable triple helical complex than a native ODN as the third strand, as in the case of poly(dT)poly(dA)poly (dT). The enhanced binding of the MP strand is due to W093/07295 2 1 1 ~ 8 ~ O PCT/US92/0~58 reduced interstrand electrostatic repulsion. The MP-sub-stituted helix has reduced hydrogen bond distances, decreased interstrand A-T2 phosphorus distances, and less fluctuation in atomic position relative to the native triple helix. The closer fit and reduced atomic motion durins molecular dynamics are qualitatively consistent with a greater enthalpy of binding and stability of the MP-substituted triple helical complex. These findings support the MP-substitution of the third strand facili-tates formation of a more cohesive triple helical struc-ture by decreased interstrand phosphate repulsion, and will secondarily have closer approximation of Hoogsteen and Watson-Crick hydrogen bond interactions. One would expect predominant effects on Hoogsteen pairing, but there is an unexpected enhancement of Watson-Crick hydrogen bonding with MP substitution in these calculations. The latter finding is most likely due to decreased electro-static repulsion and shielding (by the third strand) between the T~ and T2MP strands.
The conformation of these DNA structures differs from experimental data based on the fiber diagram. The struc-ture of poly(dT)poly(dA)-poly(dT) was determined by x-ray diffraction ætudies under conditions of 92% humidity, and,~
is a low resolution structure (10). The molecular dyna-mics simulations are of fully solvatéd DNA structures under periodic boundary conditions with counterions. DNA
in solution is generally believed to predominate in the B-form; A-DNA conformation predominates under conditions of lower humidity (16). Several triple-stranded DNA heli-cal structures have been determined by x-ray diffraction studies and have been uniformly observed in an A-DNA con-f ormation under conditions of low humidity and increased salt concen-tration (10,17,18). These computer simula-tions predict that different DNA conformations coexist within the triple helix, that the individual strands of the helices have predominant conformational populations, and that a Hoogsteen-paired, MP-substituted DNA strand is 8~SHEEr ' ~

WO93/072gS PCT/US92/~58 2119~ 46 predicted to predominate in the B-form. The large propor-tion of 01' endo sugars in both triplexes is of interest since this furanose conformation is 0.6 kcal/mole higher than C2' endo and C3, endo DNA sugar puckers (16). The DNA dodecamer crystal structure (19) has a notable 01' endo population, and a significant proportion of 01' endo sugar puckers were observed in molecular dynamics simula-tions of dsDNA by Seibel et al. t20) Both helical struc-tures generally follow the classical observations of pur-ine nucleotides adopting C2' endo geometries and pyrimi-dines adopting C3' endo geometries.
The large perturbation of the ~ dihedral and variable conformational fluctuation of the Rp and Sp MP diastereoi-somers in the triplet are due to nonbonded and hydrophobic interactions. The Sp-MP groups are in close proximity to thymine methyl groups (in the major groove) on the same DNA strand, and interact by Van der Waals forces, which could locally destabilize the helix by "locking" the thy-mine to the Sp-MP backbone. There are greater deviations in the ~ dihedral of the ~p-MP groups, since these groups project out into the solvent water and are positioned farther away from the thymine methyl groups. There is a known relationship between the orientation of the methyl~
substituent on the phosphorus atom and DNA duplex stabil-ity, and a proposed mechanism of reduced stability ofSp-MP diastereomers is due to local steric interactions (21). Our calculations suggest that steric interactions contribute very little toward local helix destabilization, and the predominant mechanism is mediated by no~-bonded interactions between the methyl groups of the Sp-MP back-bone and thymine on the same strand which locally desta-bilizes the DNA.

SUBSm U~E ~EEr , l W093/07295 2 1 1 9 ~ 3 ~ PCT/US92/0~8 Example 2 Detection of Triple Helix Formation Usina Circular ~ichro-ism Spectroscopy Circular dichroism spectroscopy studies were per-formed using Triple Helix structures formed using a combination following nucleoside oligomers.
I: d(CTCTCTCTC?CTCTCT) abbreviated d(CT)8 E~ = 9.2 x 104 M-~ cm~~
II: d(AGAGAGAGAGAGAGAG) abbreviated d(AG) 8 E~ = 1.45 x 105 ~I cm~l III: d(CpT~C~T~C~T~C~T~CpT~C~T~C~T~C~Tp abbreviated d(C~T) 8 or d(CT)8 E~ = 8.5 x 104 ~I cm-~
Circular dichroism (CD) spectra for the triple helix structures made with (a) 2:1 d(CT)8 d(AG)8 and (b) 1:1:1 d(CT) 8 d(AG) 8 d(C~T~) 8 were performed using a CD spectro-polarimeter in 0.1 M phosphate buffer at the indicated pH.
Figure 7 shows the CD spectra for triple helix (a) [2:1 d(CT)8-d(AG)8 ( - ] and (b) [1:1:1 d(CT)8-d(AG)8-d(CT)8( --- )].
- , ~
~xamPlÇ 3 Crosslinking of Triple Helix Structures Usinq Psoralen-Deriya~ized MP-Oliaomers Psoralen derivatized dTp(T) 6 oligomers were prepared as described in Lee, B.L., et al., Biochemistry 27:3197-3203 (1988).
The T7 oligomers were allowed to hybridize with DNA
having the following sequence including a 15-mer poly dA
subsequence:
5' 10 20 30 40 3' d- TAATACGACTCACTATAGGGAGATTTTTTTTTTTTTTTACGAGCT
d- ATTATGCTGAGTGATATCCCTCTAAA~A~AAAAAAAA~TGCTCGA
3' 5' SUBSllTU~E SHEr ~

WOg3/07295 PCT/US92/0~58 21198~0 48 MP-oligomers derivatized with 4'-(aminoethyl)amino-methyl-4~5~8-trianethyl-psoralen ["(ae)AMT"], 4'-(amino-butyl)-aminomethyl-4,5',8-trimethylpsoralen ["(ab)AMT"]
and 4'-(aminohexyl)aminomethyl-4,5'-8-trimethylpsoralen ["(ah)AMT"] were allowed to hybridize with (a) single stranded DNA of the above DNA sequences and (b) double stranded DN~ of the above sequence at 4C and were irradiated to cause crosslinking as described in Lee, et al.
Results are depicted in Figures 8A and 8B Figure 8A
shows crosslinking of the psoralen derivatized T7 Oligomers with the single stranded (poly A containing) DNA sequence.
Figure 8B shows crosslinking of the double stranded DNA with the double stranded DNA sequence.

AVERAGED HYDROGEN BOND DISTANCES (RMS) WATSON-CRICK WITHOUT MP WITH MP
APE HN6B - THY 04 2.33 (~/-0.31) 1.98 (+/-0.15) ADE Nl - THY H3 2.10 (+/-0.17) 1.95 (+/-0.13) ADE HN6A - THY 04 2.12 (+/-0.22) 2.09 (+/-0~19) ADE N7 - THY H3 1.94 (+1-0.16) 1.92 (+/-0.12) Averaged Watson - Crick and Hoogsteen hydrogen bond distances (in Angstroms) in T~AT2 and T~AT2MP helices.
These distances are calculated for the triple helical DNA
complexes. The fluctuation in atomîc position (calculated as the root-mean-square ~rms]) are in (A).

SUBSTIlUlES~

WO 93/07295 2 1 ~ 9 8 9 0 PCr/US92/0~58 l ~ ~
o ~ o o o o E~
... ... C:
, o ~ o ~ o o ~ .,, Z o H o a ~p ~ ~
~ ~ ~ 0 ~ o p~ - ~D ~` o ~ ,~ h . ~ o ::~
O a d~ 0,O 0~O d~ 0,O ' E-~ ~ o ~
-o ~ ~ Z

C~ Z ~0 0~ 0~o 0~O 0~O
~ 00 ~ 1 t~
3 - ~ o ~ ~

~ D ~ o O a~ O
~1 ~ ~ O ~ ~
_~ N '1 N ~ N NU a ,~5 +l +l +l ~1 +

- w ~1~ o ~ ~ o o, ~ ¢ c o ` .~ ~
^~_ __ o o ~D t~ ~ ~ In tn ooO oOo ~
... ... ~OtU
~ ~ oOo 000 X
O-- +1 +1 +1 ~1 +1 +1 U
, --tn OD 00 a~ o ~r ~ I
c ooo ooo ~ u -~
O ~1 ~
~ o ,¢ a C~ Z ~ X S
~ ~n ~ O
U~ O ~

SUBSlllllrE SHEEt W093~072ss PcT/uss2/o~58 2119~90 AVERA~E INTRASTRAND PHOSPHATE A~OM DISTA~CE (RMS) STRAND WITHOUT MP WITH MP
Tl 6.5 (+/0.28) 6.2 (+/0.31) 5A 7.0 (+/0.26) 7.1 ~+J 0.24) T2 7.3 (+/0.29) 6.8 (+/0.26) Intrastrand phosphate distances of TIAT2 and T~AT~P
helices. The calculated intrastrand phosphate distances (in Angstroms) averaged over the 40 psec trajectory are shown for the entire triple helical systems. Standard interstrand phosphorus di~tances are 6.OA for A-DNA and 7.OA for B-DNA(15).

Without MP With MP
a 03' - P - 05' - C5' `~
T1 280.5 (18.5) 288.4 (11.3) A 252.9 (28.7) 233.2 (28.5) T2 285.1 (11.6) 288.5 (11.3) ~ P - 05' - C5'. - C4' T1 161.2 (11.5) 168.7 ( 8.7) A 151.5 (10.7) 159.3 (21.5) T2 140.8 ( 8.8) POR158.8 (21.9 POS167.8 ( 8.7) Y 05~ - C5 - C4' -~3 Tl 70.6 (14.6j 62.6 ( 9.3) A 104.8 (27.9) 112.3 (25.5) T2 67.2 (10.5) 64.0 (10.4) ~ C5' - C4' - C3' - 03' Tl . 90.3 (12.8) 82.5 (11.1) 3Q A 112.5 (16.7) 111.6 (17.2) T2 88.6 (10.4) 104.5 (16.5) ~ C4 - C3' - 03' - P
T1 196.4 (lO.l) 199.1 (10.6) A 200.1 (10.9) 198.0 (13.3) T2 197.5 (10.5) 187.9 ( 7.8) - SUBSllTUTE SHEr W093/07295 2 1 1 9 8 9 ~ PCT/US92/0~58 TABLE 4 (Cont'd) Without MP With MP
c3'_- 03' - P - 05' ~1 290.8 (10.6) 290.6 ( 9.6~
5 A 282.9 (12.0)282.0 (18.5) T2 285.0 (10.5)280.s .(11.4) PUR 01' - Cl~ - Ns - c4 ADE 215.3 (14.7)212.1 (14.2) PYR
Tl 212.3 (11.0)205.9 (10.0) T2 206.3 (10.7)213.9 (13.2) Average backbone dihedral angles (rms) for the triple helical DNA structures during the 40 psec trajectory.

,.

;~ .

- SUBSrl~UrE SHEr .

WO93/0729~ s2 PCI/US92/08458 9 ~ CYTIDINE ANALOGS
Structure Reference (Pre~aration) ~ Goddard, A.J., et al., 5 I I ~ Tetrahedron Letters 29:1767 (1988) I ~ Beisler, et al., J. Med.
IIO O ~ Chem. 20:806 (1977) . ~0 Doboszawske, B., et al., J.
~ ~ Org. Chem 53:2777 7~ ~ (1988);
~r'~`~ Woodcock, T.M., et al., ~J Cancer Res. 40:4234 ~o - `~' (1980) 0 Burchenal, J.H., et al., \ Cancer Res. 36:~520 / (1976) l~O

~ Winkley, M.W., et al. J.
20 ~ ~ ~ Chem Soc. (c), p. 791 ~0 ~ 0~o '"~

~o 0~

From 1,2,4-triazine-3(4H) / -one (by reaction with ammonium chloride or ll* 11 by (a) nitrosating 25~ ~ tJ followed by (b) treat-h ment with sodium 0 ~ borohydride) '\

SUBSmUrE SJH~

W093/0729s 2 ~ ~ 9 g ~ PCT/US9Z/0~58 ExamPle 4 Formation of a Triple Helix Complex with a Sinqle Stranded Polvdeoxypurine Nucleoside Tarqet Formation of a triple helix complex using a d(AG) 8 single stranded target (II) was demonstrated using two strands of an oligonucleotide analog containing 2'-0-methyl-pseudoisocytidine (piC) and 2'-O~methyluridine (X) in an alternated sequence (piC X)7 piCT (I). Formation of a triple helix complex between a d(AG)g-d(CT)8 duplex (II:III) and I was also demonstrated. (d(CT) 8 is repre-sented by III.) (A) General Methods All chemicals were obtained from Aldrich Chemical Com-pa~y, Inc. (Milwaukee, WI). Solvents were obtaîned from Fisher Scientific Co. ~Pittsburgh, PA). TLC was performed on a silica gel 60F2~ plates (Merck, West Germany) and column chromatography on silica gel G60 (70-230 mesh, ASMT, Merck). HPLC was performed on a Vista 5500 (Varian, Sunnyvale, CA) with a PRP-l column (Hamilton, Reno, NV) or Varian 5000 with ODS-3 column (Whatman, Clifton, NJ).
Radioactivity was counted on an LS 7500 liquid scintilla-t-ion counter (Beckman, Columbia, MD). ;, The following buffers were used in the CD, uv mixing titration, melting/annealing, and geI electrophoresis studies: buffer A, 0.01 M Na phosphate, 0.1 M NaCl, 0.01 mM EDTA p H7.2; buffer B, 0.02 M Na phosphate, 0.01 M
NaCl, S mM MgCl2; buffer C, O.01 M Na phosphate, 0.35 M
NaCl, 5 mM MgCl2, pH 7.2; buffer D, 0.06 M Tris borate, 5 mM MgCl2, 0.075 mM EDTA, pH 7.3.

(B) Synthesis of Nucleoside Analoqs and Oliqonucleotide Analogs X and piC were synthesized according to the reported methods (30, 31, 32), and were converted to their corres-ponding amidite synthons (33, 34). The oligo-nucleotide I was synthesized on a DNA synthesizer ~either Milligen SVBSlllUrE S~EEr W093/0729~ PCT/US92/0~58 7500 or Applied Biosystem) according to the reported methods (31, 32). After being deblocked and cleaved from the solid support by conc. NH40H treatment, I with protect-ing dimethoxytrityl (DMTr) groups was purified by HPLC.
Fractions were treated with 80% acetic acid solution to deblock the DM~r group after which oligomers were purified by HPLC. The purified oligomer I of this preparation showed a single peak by HPLc analysis. Starting from 2 ~mole solid supporting material 2.5 o. D. units of I were obtained.

(C) CD SpectroscoEy CD spectra were obtained on a J-500A CD spectropo-larimeter (Jasco, Japan). Sample temperature was con-trolled by using a circulating water bath. The Oligomer or the Oligomers were concentrated in vacuo, after which the residues were dissolved in appropriate buffers, except for the preparation of the I~ III sample. This mixture was prepared by cooling a solution of II-III duplex in buffer A on an ice bath, and then adding this solution to I. The whole solution mixture was kept on an ice bath for 30 minutes, and then kept at room temperature for another 30 minutes. After CD spectra of this mixture were measured, a con¢entrated salt solution was added to the mixture to set the final salt condition as for buffer C, then other spectra were measured. Sample temperature was controlled by fluid circu~ating from a temperature regu-lated water bath.

(D) Gel Electrophoresis Gel electrophoresis experiments were conducted using gels containing 15~ polyacrylamide in buffer D prepared in a Bio-Rad Protean II gel apparatus with 20 x 22 cm glass slabs and 0.75 mm spacers. The samples (5 ~L) were pre-pared in buffer D with 3% glycerol and kept at room tem-perature for 1 hr. except for the mixture of I and the duplex II-III which was prepared by mixing 2.5 ~L of s~slTru~E s~Er W093/07295 2 1 1 9 ~ ~ ~ PCT/US92/0~58 duplex (II-III) solution and 2.S ~L of the third strand (I) at 4C and then equilibrated at room temperature for S minutes. Each sample contains an oligonucleotide labeled by 32p at the 5'-end as a marker. Bromophenol blue tracking dye (0.025%) was added to the samples containing only a single oligonucleotide molecule. Experiments were conducted at room temperature at 200 volts (5-10 mA) for 4 hrs. After electrophoresis was halted, the gels were dried ~n vacuo, and autoradiogramed. In addition, bands were also cut from the gel, and the radioactivities were counted.

(E) W Mixinq Titration and Meltina/Annealina W absorbance was measured by Varian DMS lOo and 219 spectrophotometers. Thermal profiles of melting/annealing was monitored by the Varian 219 with a thermoregulated sample compartment. Sample temperature was controlled by fluid circulating from a temperature regulated bath moni-tored with a calibrated thermistor probe inserted in a "dummy" cuvette.

(F) Confirmation of Formation of Triple Helix Structure ~1) CD Spectral Studies Formation of the triplex I:II:I was confirmed by CD
spectral studies. (See Figures lOA to E.) Figure 9A
depicts the CD spectra of the single stranded I, II and III at pH 7.2. The CD spectrum of I:II (2:1) showed a large negative band at 213 nm in 0.1 M NaCl (buffer A); a similar spectrum was observed upon addition of 0.25 M NaCl and 5 nM MgCl2~(buffer C). Such ~ spectrum has been shown to be indicative of homopyrimidine-homopurine-homopyrimi-dine triplex formation for the repeating dinucleotideæequences AG/CT in both polymer and oligomer systems (Figure 9B) (35, 35).
Figure 9C depicts the CD spectrum of I:II mixture at one to one ratio. Figure 9C does not show such a large negative band in this wavelength range; however, this SUBSrllUrE E~Er W093/0729~ PCT/US92/0~58 211~890 56 spectrum is identical to a calculated spectrum derived from the spectrum of one half of single stranded II and the spectrum of one half of I:II (2:1). The o~served CD
spectrum indicates the 1:1 I:II mixture is one half I:II:I
triplex and one half single stranded II. Thus, this CD
study indicates that the I:II:I is favored over the I:II
duplex, even at stoichiometric ratios which would favor duplex formation.
The magnitudes of the observed negative band at 213 nm of CD spectrum of the mixture of II-III duplex and single stranded I in 0.1 M NaCl is similar to the calcu-lated spectrum derived from a summation of the spectra of II-III duplex and single stranded I in both room tempera-ture and 3% (See Figures 9D and 9E). In the presence of MgCl2 and higher NaCl concentration (buffer C), a larger negative band was detected, which may indicate formation of a I-II-III triplex. (See Figure 9E.) (2) Detection of Triplexes ~y Gel Electro~horesis Formation of I-II-I and I~ III triplexes can be directly monitored by polyacrylamide gel electrophoresis (30, 31) using different oligonucleotides labeled by 32p at the 5'-end as markers. The result of two sets of experi-ments are shown in Figure 10.
Using II labeled by 32p as a marker, the mobility of single-stranded II is shown in lane 1. At the same condi-tions, the mixture of II and III shows only one band in spite of a one to two concentration ratio (lane 2). The mobility of this band is less than that of II itself. Two bands are detected in the mixture of II and I (lane 3) again with a concentration ratio one to two. The band with fastçr mobility can readily be recognized as the II-I
duplex. The slower band is the evidence of formation of the I II-I triplex. It is interesting to note that only one band is detected in lane 2, which i5 clear evidence that the III-II-III triplex is not formed at these conditions.

SUBS~ SHEEI

wo93/o729s 2 1 i 9 g ~ PCT/~S92/0~58 Lanes four to six in Figure 10 are the electrophore-tic results when single-stranded III is labeled by 32p at the 5'-end. The Mobility of III itself is shown in lane 4 as a reference. The mixture of III and II (1.5:1) is shown in lane 5. The slower moving band has a comparable mobility to the band observed in lane 2 leaving no doubt as to the formation of the III-II duplex. The excess amount of single stranded III is present as a faster moving band which is identical to that in lane 4. This confirms the results obtained from lane 2, namely, that no III-II-III triplex is formed at neutral pH even in the presence of MgCl2. On the other hand, the triplex I-II-III
is observed when a 1.5:1:1.5 mixture was electrophoresed in lane 6. The three bands clearly correspond to triplex, duplex, and single strand from top to bottom, respec-tively, by comparison to bands observed in lanes 2 to 5.
In order to further prove that no III-II-III triplex was formed, the bands in lanes 5 and 6 were cut from the gel plate and counted. In lane 5, the ratio of radioactivi-ties of duplex as single stranded III are about two to one(65:35). This result fits the original mixture ratio (1.5:1) quite well. Namely, one unit of duplex is formed and 0.5 unit of single stranded III remains. Therefore,~
no free II strand should be present in the II-III (1:1.5) mixture. The counting results of lané 5 can now be used as an internal reference for the same purpose in lane 6.
The radioactivity ratio of the slowest to fastest bands in lane 6 is 42:23:35. The sum of triplex and duplex is again 65% (42+23). Therefore, all II strands are again involved in either triplex or duplex formation. Further-more, the concentration of the duplex is 35% of the duplex and triplex (23/(23+43)). Apparently, about one third of II is involved in the duplex formation and the other two thirds is involved in the formation of triplex.
Therefore, the observed triplex band must be due to the formation of the III-III triplex and cannot be III-II-III.
It should be noted that these arguments rule out the for-SUBSlmnE~ , W093/07295 PCT/US92/0~5~
211~890 mation of ~he I-II-I triplex by dismutation in the orig-inal mixture.

(G) U~ i3g_~itration and Meltinq/Annealinq Studies A W mixing titration of the I-II system in buffer A
was performed and monitored at 260 nm. Only one end point at 67:33 stoichiometric ratio of I to II was observed.
This indicated the formation of the I~ I triplex.
Thermal profiles of melting and annealing processes for the l-II-I triplex are shown in Figures llA and llB. Each dissociation or association profile shows only one transi-tion which can be tentatively attributed to the melting of the triplex directly to the single strands or the forma-tion of the triplex directly from the single strands (based on results from uv mixing triation and CD spectra).
The transition for I-II-I triplex annealing was shifted to a lower temperature (Tm = 66C) than that observed for dissociation of the triplex (Tm = 66C~ than that observed for dissociation of the triplex (Tm = 74C). No melting/
annealing experiment was performed on the I~ III triplex system.

Exa~Pl~_5 Formati~ of a Triple Helix Structure With a Single Stranded_Oligoribonucleoside Target Formation of a triple helix structure using a single stranded oligoribonucleoside target, r(AG)8, using two Oligomers which comprise 2'-O~methyl(piC U) 8 was demon-strated, as may be seen in Figures 12 and 13. CD spectra and melting and annealing studies were performed as described in Example 4, in 0.01 M Na phosphate, 0.1 M
NaCl, 0.01 mM EDTA, pH 7.2.
The observed CD spectrum differs from the additive CD
spectrum (see Figure 12), especially in the 210 nm region which indicated triple helix formation.
The melting and annealing profile (see Figure 13) indicated Tm of about 78-80C for the triplex.

SVBSlTrU~E SHEr W093/07295 ~ 1 19 8 9 0 PCT/US92/0~58 Example 6 Formation of a Triple Helix Complex With a Sinqle Stranded Polypyrimidine Oligodeoxyribonucl _tide as_a Target and Polypurine Methyl~hosphonate Oligomers Formation of a triple helix complex with a single stranded d(CT) 8 oligonucleotide and two methylphosphonate d(AG) 8 Oligomers was demonstrated.
Figure 14 depicts continuous variation in composi-tions of W absorption measured at d (AG) 8 phosphodiester and d(AG) 8 methylphosphonate homopurine oligomers with d(CT) 8 at four wavelengths ( ) 280 nm, (-) 260 nm, (O) 254 nm, and (o) 235 nM. Total strand concentration was 2.4 ~m in 0.1 M Na' 0.01 M Po4'3, 10'5 M EDTA, pH 7Ø A
single end point at 1:1 purine:pyrimidine stoichiometric ratio was observed for the interactions of the phosphodi-esters d(AG) 8 and d(CT) 8 which indicated that only aWatson-Crick type duplex formed under these conditions.
Three end points were observed for the d(AT) 8 methylphos-phonate and d(CT)8. At a 1:1 purine:pyrimidine stoichio-metric ratio, a Watson-Crick type duplex was also detecteq. The additional end points at 67:33 (2:1) and 33:67 (1:2) purine:pyrimidine ratios indicated formation o~ purine:purine:pyrimidine and pyrimidine:purine:pyrimi -~
dine triple heliX complexes, respectively, in this system.
Figure 15 depicts observed CD spectra. The observed spectrum for 2:1 d(~)t:d(CT)8 was very different from the spectrum calculated by simpIe addition which indicated triple stranded helical complex formation. The CD spectra were run at 2QC in 0.1 M Na+, 0.01 M Po4-3, 10-5 M EDTA, pH 8Ø Totai strand concentration was 4.8 ~M and the was reported per mole of base residue.
Figure 16 depicts the TTm and melting profiles of d(~)t:d(CT)8 1:1, d(AG)8:d(CT)8 2:1. The thermal dena-turation profiles~for the Oligomer complexes were moni-tored by W absorption hyperchromicity. Total strandconcentration was 4.8 ~m in 0.1 M Na+, 0.01 M P04-3, 10-5 M
E~TA, pH 8Ø For comparison purposes, each curve was sussmurE SHEEr W093/07295 PCT/US92/0~58 21~9~90 normalized to the to~al change in absorbance. The Tm for d(AG)8:d(CT)8 1:1 was 50C. The Tm for d(AG)8:d(CT)8 1:1 was 53C. The Tm for d(AG)8:d(CT)8 2:1 was S1C. As may be seen from the melting curves, the melting profile S observed for the triplex was much more narrow or sharper.
This date suggested a simultaneous dissociation of duplex and triplex, but that the transition of the triplex was more homogeneous in thermal stability.
Figure 17 depicts the electrophoretic analysis of the complexes in native polyacrylamide~gel. Figure 16 is an auto-radiograph of a native 16% (29:1 bis) polyacrylamide gel containing gamma [32p] end labelled d(C$) 8 ( lanes 1-12) and d(~) 8 (lanes 13-17) and their complexes. The gel was electrophoresed at four volts per CM for 30 hours at 5C
in 0.1 M NaCl, 0-04 M Tris, 0.01 M Po4'3, 1o-3 M EDTA, pH 8.0 with buffer recirculation to prevent pH changes. The concentration of Oligomers in each lane is shown below the stoichiometric ratio of the interacting strands. The position of éach species with differential mobility is indicated at the left the position of the origin and the xylene cyanol and bromophenol blue marker dyes are indi-cated by o, x and b, respectively. This gel clearly shows the existence of the d(AG) 8 d(AG) 8 d(CT) 8 triplex and the d(~)~-d(~)8-d(CT)8 triplex in 0.1 M NaCl at 5C.
Figure 18A depicts the hydrogen-bonded NH-N resonance of a 1:1 and a 2:1 mixture of d (AG)8 and d(CT)8 at 300 MHz in 0.1 M Na+, 0.01 M P043, 105 M EDTA, pH 8Ø Figure 17A
depicts spectra at 30C for 1:1 and 2:1 stoichiometric mixtures of purine:pyrimidine Oligomers. Figure 188 depicts the temperature dependence of chemical shift for the three resonances observed for the 2:1 mixture:
-~ Watson-Crick Gua NlH-Cyt N3 (-); Watson-Crick Thy N3H-Ade Nl ( ); and new third strand hydrogen bonded imido protons (~). The Watson-Crick assignments were tentative and based on comparison to chemical shifts observed for the d(AG) 8 phosphodiester duplex. These three resonances were easily detected up to 60C. At 65C their inten-.
SUBSIllUrESHEEr ~

W093/0729s PCT/US92/0~58 sities decreased dramatically, indicating that the hydro-gen bonded complex had, in general, melted. The NH-N
resonance observed (in addition to those attributed to Watson-Crick base pairing) at approximately 12 ppm was due S to triplex formation. At high temperature, the triplex was observed to directly disassociate into sinyle-stranded form.

SUBSllTUlE SHEr ~

W093/07295 PCT/US92~0~58 21 1~89a 62 1. Mosler, H.E., et al., Science 238:645-650 (1987).
2. Povsiz, T.J., et al., J. Am. Chem. Soc. 111:3059-3061 (1989).
3. Wells, R.D., et al., FASEB J. 2:2939-2949 (1988).
4. Dervan, P., Science 232:464-471 (1988).
5. Miller, P.S., et al., Anti-Cancer Drug Design, 2:117-128 (1987).

6. Yarchoan, et al., "AIDS Therapies," Scientific American, pp. 110-119 (October 1988).

7. Sarin, et al., Proc. Nat. Acad. Sci. (USA) 85:7448-7451 (1988).

8. Cooney, M., et al., Science 241:456-459 (1988).

9. Wickstrom, E., et al., Proc. Nat. Acad. Sci. (USA) 85:1028-1032 (1988).

10. Arnoff, S., et al., J. Mol. Biol. 88:509-521 (1974).

11. Singh, U.C., et al., J. Comp. Chem. 5:129-145 (1984).

12. Singh, U.C., et al., AMBER (UCSF) Version 3.1 (1988).

13. Weiner, S.J., J. Comp. Chem. 7:230-252 (1986).

14. Jorgenson, W.J., et al., J. Chem. Phys. 79:926-935 (1983).

15. Berendsen, H.J.C., etj al., J. Chem. Phys. 81:3684-3690 (1984).

16. Sanger, W., Frinciples of Nucle~c Acid Structure (Springer-Verlag, New York, 1984).

17. Arnott, S., et al., N~ture 244:99-101 (1973).

18. Arnott, S., et al., Science 181:68-69 (1973).

19. Drew, H.R., et al., Proc. Nat. Acad. Sci. (USA) 78:2179-2183 (1981).

20. Seibel, G.L., et al., Proc. Nat. Acad. Sci. (USA) 82:6537-6540 (1985).

21. Bower, M., et al., Nucl. Acids Res. 1:4915_4930 (1987).

22. Donohue, J., et al. ! J. Mol. Bio. 2:363 (1960).

Sl~lllUlE 8HEE~. ' W093/07295 2 1 ~ 9 8 9 0 PCT/US92/0~58 ., 22a. Ts'o, P.O.P., Basic Princi~les in Nucleic Acid Chemistry, pp. 453-584 (P.O.P. Ts'o ed., Academic Press, New York, 1974).

23. Sundaralingham, N., Biopolymers 7:821 (1969).

24. Arnott, S., Proqr. Nucl. Acid Res. Mol. Biol. 10:183 tl970) -

25. Sasisekharan, V., et al., Conform. Biopolym., Pap.
Int. Symp. 1967, Vol. 2, p. 641 (1967).

26. Lakshminarayanan, A.V., et al., Biochem. Biophys.
Acta 204:49 (1970).

27. Lakshminarayanan, A.V., et al., Biopolymers 8:475 and 489 (1970).

28. Lee, B.L., et al., Nucl. Acids Res. 16:10681-10697 (1988).

29. Barone, A.D., et al., Nucl. ~cids. Res. 12:4051-4060 (1984).

30. Inoue, H., et al., Nucl. Acids. Res. 15:6131_6148 (1987).

31. Ono, A., et al., J. Am. Chem. Soc. 113:
(1991).

32. Ono, A., et al., J. Org. Chem. (1991), in press.

33. Beaucage, S.L., et al., Tetrahedron Lett. 22:1859-1862 (1981).

34. Sinha, N.D., et al., Tetrahedron Lett. 24:5843-5846 (1983).

35. Lee, J.S., et al., Nucl. Acids Res. 6:3073-3091 (1979)-

36. Kan, J.S., et al., J. 8iolmol. Str. Syn., 911-933 (1991).

37. Kibler-Herzog, L., et al., Nucl. Acids. Res. 18:3545_ 3s55 (1990).

38. Shea, R.G., et al., Nucl. Acids. Res. 18:4859_4866 (1990) .

SUBSlllUrE S~EE J

Claims (72)

Claims

1. A method of detecting or recognizing a specific target segment of a single stranded nucleic acid which comprises:
(a) contacting the single stranded nucleic acid with a first Oligomer sufficiently complementary to said target segment to hybridize therewith to give a stable duplex and (b) contacting the duplex with a second Oligomer having at least seven nucleosidyl units which is suf-ficiently complementary to said duplex to form a stable triple stranded helix, whereby the base sequence of said target segment is recognized two times, one time by formation of the duplex with the first Oligomer and a second time by formation of the triple stranded helix with the second Oligomer.

2. A method according to claim 1 wherein each of said first and second Oligomers independently comprises an oligonucleotide, an alkyl- or aryl-phosphonothioate Oligo-mer, a phosphorodithioate Oligomer, a phosphorothioate Oligomer, an alkyl- or aryl-phosphonate Oligomer, a phos-photriester Oligomer, a phosphoramidate Oligomer, a car-bamate Oligomer, a sulfamate Oligomer, a morpholino Oli-gomer or a formacetal Oligomer.

3. A method according to claim 1 wherein each of said first and second Oligomers independently comprises a substantially uncharged neutral Oligomer.

4. A method according to claim 1 wherein said single stranded nucleic acid is RNA.

5. A method according to claim 1 wherein said single stranded nucleic acid is DNA.

6. A method according to claim 1 wherein said target segment comprises only pyrimidine bases.

7. A method according to claim 6 wherein said first and second Oligomers comprise only purine bases.

8. A method according to claim 6 wherein the first Oligomer comprises only purine bases and said second Oli-gomer comprises only pyrimidine bases.

9. A method according to claim 1 wherein said tar-get segment comprises only purine bases.

10. A method according to claim 9 wherein said first Oligomer comprises only pyrimidine bases and said second Oligomer comprises only purine bases.

11. A method according to claim 9 wherein said first and second Oligomers comprise only pyrimidine bases.

12. A method according to claim 1 wherein said tar-get segment comprises both purine and pyrimidine bases.

13. A method according to claim 12 wherein said first and second Oligomer comprises both purine and pyri-midine bases and wherein said second Oligomer optionally includes internucleosidyl lengthening links as needed between nucleosidyl units to allow each base of the second Oligomer to hydrogen bond with a central purine of a base pair of the duplex and form a triplet.

14. A method of preventing function or expression of a single stranded nucleic acid target sequence which com-prises contacting said target sequence with a first Oli-gomer and a second Oligomer wherein the nucleoside sequences of said first and second Oligomers are selected so that a triple stranded helix structure is formed.

15. A method according to claim 14 wherein said target sequence comprises only purine bases.

16. A method according to claim 15 wherein said first and second Oligomers comprise only pyrimidine bases.

17. A method according to claim 15 wherein one of said first and second Oligomers comprises only pyrimidine bases and the other Oligomer comprises only purine bases.

18. A method according to claim 14 wherein said target sequence comprises only pyrimidine bases.

19. A method according to claim 18 wherein one of said first and second Oligomers comprises only purine bases and the other Oligomer comprises only pyrimidine bases.

20. A method according to claim 18 wherein said first and second Oligomers comprise only purine bases.

21. A method according to claim 14 wherein said tar-get sequence comprises both purine and pyrimidine bases.

22. A method according to claim 21 wherein said first and second Oligomers comprise both purine and pyri-midine bases and wherein said second Oligomer optionally includes internucleosidyl unit lengthening links between nucleosidyl units as needed to allow each base of the second Oligomer to hydrogen bond with a central purine base of either the target sequence or the first Oligomer and form a triplet.

23. A method according to claim 14 wherein cytosine is replaced by a cytosine analog having a protonated nitrogen at the N-3 position at physiological pH.

24. A method according to claim 23 wherein said cytosine analog is 2'-O-methyl-pseudoisocytidine.

25. A method according to claim 14 wherein 2-amino purine replaces at least one adenine in the second Oligomer.

26. A method according to either claim 14 or 25 wherein 6-selenium guanine or 6-isopropylidene-7-deaza-guanine replaces at least one guanine in the second Oligomer.

27. A method according to any of claims 14, 15, 18, 21, 22, 23, 24 or 25 wherein each of said first and second Oligomers independently comprises an oligonucleotide, an alkyl- or aryl-phosphonothioate Oligomer, a phosphorothio-ate Oligomer, an alkyl- or aryl-phosphonate Oligomer, a phosphotriester Oligomer, a phosphoramidate Oligomer, a carbamate Oligomer, a sulfamate Oligomer, a morpholino Oligomer, or a formacetal Oligomer.

28. A method according to claim 26 wherein each of said first and second Oligomers independently comprises an oligonucleotide, an alkyl- or aryl-phosphonothioate Oligo-mer, a phosphorodithioate Oligomer, a phosphorothioate Oligomer, an alkyl- or aryl-phosphonate Oligomer, a phos-photriester Oligomer, a phosphoramidate Oligomer, a car-bamate Oligomer, a sulfamate Oligomer, a morpholino Oligo-mer, or a formacetal Oligomer.

29. A method according to any of claims 14, 15, 18, 21 or 22 wherein said first and second Oligomers are independently selected substantially uncharged neutral Oligomers.

30. A method according to any of claims 14, 15, 18, 21 or 22 wherein said first and second Oligomers are methylphosphonate Oligomers.

31. A method of selectively inhibiting in vivo syn-thesis of one or more specifically targeted proteins with-out substantially inhibiting the synthesis of non-targeted proteins which comprises:
(a) selecting a nucleic acid target sequence which comprises a segment of mRNA coding for said targeted protein;
(b) synthesizing first and second Oligomers having nucleoside sequences selected so that they will form a triple stranded helix sequence with said segment of mRNA; and (c) introducing said first and second Oligomers into a cell;
whereby said first and second Oligomers complex with said mRNA segment thereby substantially blocking translation of its nucleoside sequence and inhibiting synthesis of the target protein.

32. A method according to claim 31 wherein said seg-ment of mRNA comprises only purine bases.

33. A method according to claim 32 wherein said first and second Oligomers comprise only pyrimidine bases.

34. A method according to claim 32 wherein one of said first and second Oligomers comprises only purine bases and the other comprises only pyrimidine bases.

35. A method according to claim 31 wherein said segment of mRNA comprises only pyrimidine bases.

36. A method according to claim 35 wherein said first and second Oligomers comprise only purine bases.

37. A method according to claim 35 wherein one of said first and second Oligomers comprises only purine bases and the other comprises only pyrimidine bases.

38. A method according to claim 31 wherein said segment of mRNA comprises both purine and pyrimidine bases.

39. A method according to claim 37 wherein said first and second Oligomers comprise both purine and pyri-midine bases and wherein said second Oligomer optionally includes internucleosidyl lengthening links between nucleosidyl units, as needed, to allow each base of the second Oligomer to hydrogen bond with a central purine base of either the segment of mRNA or the first Oligomer and form a triplet.

40. A method of selectively inhibiting in vivo repli-cation or transcription of a specific segment of single stranded DNA without substantially inhibiting overall DNA
replication or transcription which comprises:
(a) selecting a nucleic acid target sequence which comprises a portion of said segment of single stranded DNA;
(b) synthesizing first and second Oligomers having nucleoside sequences selected so that they will form a triple stranded helix complex with said nucleic acid target sequence; and (c) introducing said first and second Oligomers into a cell;
whereby said first and second Oligomers complex with said target sequence to give a triple stranded helix complex, thereby substantially inhibiting replication or transcrip-tion of the specific segment of single stranded DNA with-out substantially inhibiting overall DNA replication or transcription.

41. A method according to claim 40 wherein each of said first and second Oligomers independently comprises an oligonucleotide, an alkyl- or aryl-phosphonothioate Oligo-mer, a phosphorodithioate Oligomer, a phosphorothioate Oligomer, an alkyl or aryl-phosphonate Oligomer, a phos-photriester Oligomer, a phosphoramidate Oligomer, a car-bamate Oligomer, a sulfamate Oligomer, a morpholino Oligomer, or a formacetal Oligomer.

42. A method of detecting or recognizing a specific segment of double-stranded nucleic acid without interrupt-ing base pairing of the duplex which comprises contacting said nucleic acid segment with an Oligomer which is suffi-ciently complementary to said nucleic acid segment or por-tion thereof to form a triple helix structure wherein 2-aminopurine replaces at least one adenine in said Oligomer.

43. A method according to claim 42 wherein at least one guanine of said Oligomer is replaced by 6-selenium guanine or 6-isopropylidene-7-deazaguanine.

44. A method of detecting a specific segment of double stranded nucleic acid without interrupting base pairing of the duplex which comprises contacting said nucleic acid segment with an Oligomer which is suffi-ciently complementary to said nucleic acid segment or portion thereof to form a triple stranded helix structure wherein at least one modified guanine analog selected from 6-selenium guanine or 6-isopropylidene-7-deazaguanine replaces guanine in said Oligomer.

45. A method of selectively preventing or interfer-ing with expression of a single stranded nucleic acid target sequence in vivo which comprises:
(a) selecting a nucleic acid target sequence which comprises an RNA region which codes for an initiator codon, a polyadenylation region, an mRNA
cap site or a splice junction;
(b) synthesizing first and second Oligomers having nucleoside sequences selected so that they will form a triple stranded helix with said RNA
region; and (c) introducing said first and second Oligomers into a cell;
whereby said first and second Oligomers complex with said RNA region to form a triple stranded helix, thereby sub-stantially preventing or interfering with expression of the target sequence.

46. A method according to claim 45 wherein said target sequence comprises only purine bases.

47. A method according to claim 46 wherein said first and second Oligomers comprise only pyrimidine bases.

48. A method according to claim 46 wherein one of said first and second Oligomers comprises only purine bases and the other comprises only pyrimidine bases.

49. A method according to claim 45 wherein said target sequence comprises only pyrimidine bases.

50. A method according to claim 49 wherein said first and second Oligomers comprise only purine bases.

51. A method according to claim 49 wherein one of said first and second Oligomers comprises only purine bases and the other comprises only pyrimidine bases.

52. A method according to claim 45 wherein said seg-ment of mRNA comprises both purine and pyrimidine bases.

53. A method according to claim 52 wherein said first and second oligomers comprise both purine and pyri-midine bases and wherein said second Oligomer optionally includes internucleosidyl lengthening links between nucleosidyl units, as needed, to allow each base of the second Oligomer to hydrogen bond with a central purine base of either the segment of mRNA or the first Oligomer and form a triplet.

54. A method according to claim 45 wherein said first and second Oligomers are independently selected substantially uncharged neutral Oligomers.

55. A method according to claim 45 wherein each of said first and second Oligomers independently comprises an oligonucleotide, an alkyl- or aryl-phosphonothioate Oligo-mer, a phosphorodithioate Oligomer, a phosphoro-thioate Oligomer, an alkyl- or aryl-phosphonate Oligomer, a phos-photriester Oligomer, a phosphoramidate Oligomer, a carba-mate Oligomer, a sulfamate Oligomer, a morpholino Oligo-mer, or a formacetal Oligomer.

56. A method according to claims 45 or 54 wherein 2-aminopurine replaces at least one adenine in the second Oligomer.

57. A method according to claim 56 wherein at least one guanine of said second Oligomer is replaced by 6-selenium guanine or 6-isopropylidene-7-deazaguanine.

58. A method according to claims 45 or 54 wherein at least one modified guanine analog selected from 6-selenium guanine or 6-isopropylidene-7-deazaguanine replaces gua-nine in said Oligomer.

59. A method of selectively preventing or interfer-ing with expression of a gene in a cell or a protein prod-uct of a gene by preventing splicing of a pre-mRNA to give a translatable mRNA which comprises:
(a) selecting a single stranded nucleic acid target sequence which comprises a splicing site for the mRNA coding for the protein product of the gene;
(b) synthesizing first and second Oligomers having nucleoside sequences selected so that they will form a triple stranded helix with the target sequence; and (c) introducing said first and second Oligomers into a cell;
whereby said first and second Oligomers complex with said target sequence to form a triple stranded helix, thereby substantially preventing splicing of the pre-mRNA.

60. A method according to claim 59 wherein said target sequence comprises only purine bases.

61. A method according to claim 60 wherein said first and second Oligomers comprise only pyrimidine bases.

62. A method according to claim 60 wherein one of said first and second Oligomers comprises only purine bases and the other comprises only pyrimidine bases.

63. A method according to claim 59 wherein said target sequence comprises only pyrimidine bases.

64. A method according to claim 63 wherein said first and second Oligomers comprise only purine bases.

65. A method according to claim 63 wherein one of said first and second Oligomers comprises only purine bases and the other comprises only pyrimidine bases.

66. A method according to claim 59 wherein said tar-get sequence comprises both purine and pyrimidine bases.

67. A method according to claim 66 wherein said first and second Oligomers comprise both purine and pyri-midine bases and wherein said second Oligomer optionally includes internucleosidyl lengthening links between nucleosidyl units, as needed, to allow each base of the second Oligomer to hydrogen bond with a central purine base of either the segment of mRNA or the first Oligomer and form a triplet.

68. A method according to claim 59 wherein said first and second Oligomers are independently selected substantially uncharged neutral Oligomers.

69. A method according to claim 68 wherein each of said first and second Oligomers independently comprises an oligonucleotide, an alkyl- or aryl-phosphonothioate Oligo-mer, a phosphorodithioate Oligomer, a phosphorothioate Oligomer, an alkyl- or aryl-phosphonate Oligomer, a phos-photriester Oligomer, a phosphoramidate Oligomer, a car-bamate Oligomer, a sulfamate Oligomer, a morpholino Oligomer, or a formacetal Oligomer.

70. A method according to claims 59 or 68 wherein 2-aminopurine replaces at least one adenine in the second Oligomer.

71. A method according to claim 70 wherein at least one guanine of said second Oligomer is replaced by 6-selenium guanine or 6-isopropylidine-7-deazaguanine.

72. A method according to claims 59 or 68 wherein at least one modified guanine analog selected from 6-selenium guanine or 6-isopropylidine-7-deazaguanine replaces guan-ine in said Oligomer.