JPH07327679A - Dna sequence coding udp glucose synthetase - Google Patents

Abstract

PURPOSE:To obtain DNA coding UDP glucose synthetase derived from Gossypium hirsatum, excellent in growth promoting effect of a plant and useful for production, etc., of cotton yarn. CONSTITUTION:This DNA codes UDP glucose synthetase derived from Gossypium hirsatum, having an amino acid sequence expressed by the formula or an amino acid sequence obtained by carrying out addition, loosing and/or substitution of 1-20 amino acids to the above amino acid sequence. Furthermore, the UDP glucose synthetase is obtained by culturing a recombinant microorganism cell, e.g. a microorganism cell belonging to the genus Escherichia and having a gene introduced by a recombinant vector containing the above DNA sequence and a DNA sequence having a function carrying out manifestation control of the DNA in a culture medium and then collecting the UDP glucose synthetase active substance from the cultured mixture.

Description

Detailed Description of the Invention

[0001]

The present invention relates to cotton ( Gossypium hirsat
um ) -derived UDP glucose synthase active substance DNA, a transformant using the DNA, and a UDP glucose synthase active substance and a method for producing UDP glucose using the transformant.

[0002]

BACKGROUND OF THE INVENTION UDP-glucose is an important biosynthetic intermediate of plant cell wall polysaccharides such as cellulose.
It is known that the synthase produced by the condensation of 5'-diphosphate and glucose-1-phosphate exists in many organisms. Therefore, when the gene for UDP glucose synthase is introduced into an appropriate plant by using a genetic engineering technique, cell wall synthesis is activated and plant growth is promoted, which is useful.
Especially when introduced into cotton, the synthesis of cellulose, which is the main component of cotton yarn, is activated, and the growth of cotton yarn is promoted, which is useful.

Conventionally, only genes derived from potato have been known as genes of UDP glucose synthase in plants (J. Biochem. 108 , 321 to 326 (1990)). However, the physiological roles of cotton and potato are very different. That is, this enzyme derived from cotton is present in a large amount in the growing cotton fiber and is mainly involved in the synthesis of cell wall polysaccharides containing cellulose as a main component (J. Biol. Chem. 256 , 308-).
315 (1981)).

On the other hand, the present potato-derived enzyme is present in large amounts in tubers and is mainly involved in the metabolism of sugars required for starch synthesis and decomposition (Plant Physiol.
101 , 1073-1080 (1993)).

[0005]

[Problems to be Solved by the Invention] The physiological roles of the present enzyme derived from cotton and potato are greatly different.
Naturally, it is expected that the control mechanism of activity in vivo and the kinetic parameters are also different. In order to introduce the gene for UDP glucose synthase into plants, activate cell wall synthesis, and promote growth, potato-derived ones are not sufficient, and cotton-derived ones are suitable from the physiological role. It is believed that

[0006] Cotton belongs to the mallow family Cotton genus, and potato belongs to the solanaceous eggplant genus, and they are widely separated from each other in classification.
When introducing a gene into cotton, it is considered that the one derived from the cotton itself is more suitable than the ones derived from other plants that are taxonomically separated, considering the control mechanism of the activity in vivo and the adverse effect on the cotton. To be The object of the present invention is to provide a DNA encoding a cotton-derived UDP glucose synthase for promoting plant growth, and to produce a recombinant UDP glucose synthase using the DNA to analyze the enzyme activity. Especially.

[0007]

[Means for Solving the Problem] The inventors of the present invention searched for a UDP glucose synthase derived from cotton to solve the above-mentioned problems. As a result, a gene which seems to encode this enzyme was isolated and further genetically engineered. The method was successfully expressed, the enzyme activity was confirmed, and the present invention was completed.
Therefore, the above-mentioned problems are caused by the DNA sequence encoding the cotton-derived UDP glucose synthase provided by the present invention, the recombinant vector incorporating the DNA sequence, the recombinant microbial cell into which the gene is introduced by the recombinant vector, and the use thereof. Solvable.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION The DNA encoding the UDP glucose synthase referred to in the present invention consists of a DNA chain of a unit capable of expressing the gene of the synthase when it is incorporated into an appropriate expression vector. Is used in the concept that includes all those that code for enzyme active substances equivalent to.

Specific examples thereof include all DNA sequences encoding the amino acid sequence represented by SEQ ID NO: 1 in Sequence Listing, which encodes such an amino acid sequence and is produced by its expression. It also includes those encoding additional amino acids together (for example, as a fusion protein) as long as the protein exhibits the above-mentioned activity. Specific examples of such a base sequence include the base sequence shown by SEQ ID NO: 1 in the sequence listing.

The present invention further comprises addition or deletion of 1 to a few, for example 1 to 20 or 1 to 10, for example 1 to 5, amino acids with respect to the amino acid sequence of SEQ ID NO: 1. And / or still has a substituted amino acid sequence U
It also includes a DNA encoding a polypeptide having DP glucose synthase activity. Such DNA is
It can also be obtained as mutated DNA from cotton,
Or the usual site-directed mutagenesis
sis) and the like.

The DNA thus obtained is expressed by, for example, the method described in the examples of the present invention, and the enzymatic activity of the expression product is measured to examine whether or not the DNA has UDP glucose synthase activity. Then, the DNA encoding the polypeptide having the enzyme activity can be selected. The DNA of the present invention can be prepared from cotton by a method known per se, which will be described later in detail, and various chain lengths can be provided according to the purpose.

The DNA of the present invention can also be directly cloned from the genome of cotton plants. In this case, a probe having all or part of the base sequence shown in SEQ ID NO: 1 can be used. The DNA of the present invention also comprises
It is also possible to design a base sequence from the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence modified as described above using a known codon, and chemically synthesize DNA according to a conventional method. The present invention also provides a recombinant vector containing the above DNA. Such a recombinant vector also contains a DNA sequence having a function of controlling the expression of the UDP glucose synthase gene carried by the DNA.

Taking E. coli as a host as an example,
It is known to have a gene expression regulating function such as a process of transcribing mRNA from DNA and a process of translating protein from mRNA. As a promoter sequence that regulates mRNA synthesis, a naturally occurring sequence (eg, la
c, trp, bla, lpp, P _L , P _R , tet, T
3, T7, etc.), and mutants thereof (eg, la
An artificially fused sequence (for example, tac, trc, etc.) of cUV5) or a naturally occurring promoter sequence is known and can be used in the present invention.

It is known that the distance between the ribosomal binding site (GAGG and its similar sequences) sequence and the initiation codon ATG is important as a sequence that regulates the ability to synthesize proteins from mRNA. It is well known that a terminator (eg, a vector containing rrnBT ₁ T ₂ commercially available from Pharmacia) that directs the termination of transcription on the 3 ′ side affects the efficiency of recombinant protein synthesis. .

As the vector that can be used to prepare the recombinant vector of the present invention, commercially available vectors can be used as they are, or various vectors derived according to the purpose can be mentioned. For example, pBR322, pBR327, pKK223-3, which has a replicon derived from pMB1.
pKK233-2, pTrc99, etc., and pUC18, pUC19, pUC1 modified to improve copy number
18, pUC119, pHSG298, pHSG396
Etc., and pACYC17 having a replican derived from p15A
7 and pACYC184, and also pSC101 and Co
Examples include plasmids derived from lE1, R1, factor F, and the like.

In addition to plasmids, gene transfer can also be achieved with viral vectors such as λ phage and M13 phage, and transposons. For gene transfer into microorganisms other than E. coli, it is known to transfer genes into the genus Bacillus by pUB110 (sold by Sigma), pHY300PLK (sold by Takara Shuzo) and the like. For these vectors, see Molecular cloning (J. Sambroo
k, EFFritsch, T. Maniatis Cold Spring Harbor La
boratory Press) and Cloning Vector (PHPouwel
s, BEEnger. Valk, Elsevier by WJ Brammar) and other company catalogs.

In particular, pTrc99 (sold by Pharmacia) has Ptrc and l as promoters and control genes in addition to the ampicillin resistance gene which is a selection marker.
acI ″, AG as ribosome binding site
GA sequence, rrnBT ₁ T as terminator
A preferred vector having ₂ and having a function of regulating the expression of the UDP glucose synthase gene.

The incorporation of a DNA fragment encoding UDP glucose synthase and, if necessary, a DNA fragment having a function of regulating the expression of a gene for the enzyme into these vectors is carried out by a known method using an appropriate regulatory enzyme and ligase. In particular, it is convenient to follow the method described below. A specific example of the plasmid of the invention thus produced is pTrcCPP.

As a microorganism into which a gene can be introduced with such a recombinant vector, Escherichia
coli), Bacillus (Bacillus) a microorganism belonging to the genus belonging to such as can also be utilized. This transformation is also a conventional method, for example
Molecular cloning (J. Sambrook, EFFritsch, T. Man
iatis by Cold Spring Harbor Laboratory Press)
And DNA Cloning Vol. I-III (DMGlover Edition I
CaCl ₂ described in RL Press)
Method or protoplast method. As a typical one of the obtained transformants of the present invention, pTr
cCPP / JM105 is mentioned.

According to the present invention, the DNA of the present invention can be expressed in various hosts other than E. coli. For example, a eukaryotic, eukaryotic microbes, such as yeast, for example Saccharomyces (Saccharomyces) genus yeasts, e.g. Saccharomyces cerevisiae (S.Cerevisi
ae), other fungi, for example fungi, such as Aspergillus (Aspergillus) a microorganism belonging to the genus or higher eukaryotic cultured animal cells, such as CHO cells, insect cells, e.g. silkworm cells, or even insects themselves, for example, a silkworm It can also be used.

Furthermore, the DNA of the present invention can be expressed in plants such as cotton plants. This is expected to increase cotton sales. DNA of the present invention further provides a prokaryotic cell, in particular can be allowed to express in bacteria, including, in addition to E. coli, for example, Bacillus (Bacillus)
Includes genus bacteria. Regulatory sequences such as promoters and terminators for expressing foreign genes in the above various hosts are already known, and appropriate regulatory sequences can be selected and used according to the selection of the host. Methods for introducing expression vectors into various hosts are already known, and known methods can be used.

When these transformants or recombinant microbial cells are cultured in a medium usually used for culturing Escherichia coli, UDP glucose synthase accumulates in the cells. The collection of UDP glucose synthase from the bacterial cells is carried out by treating the bacterial cells in an environment in which a physical or appropriate cytolytic enzyme is present, lysing the cells, removing the cell debris, and then using the general enzyme Can be carried out by various isolation and purification methods.

It is preferable to use ultrasonic waves for the physical treatment of cell disruption. For isolation and purification of the enzyme, gel filtration, ion exchange, hydrophobicity, reverse phase, affinity chromatography and other various chromatographic treatments, and extraocular filtration may be performed alone or in combination. As a stabilizer for stabilizing the target enzyme through the isolation / purification process, for example, a reducing agent such as β-mercaptoethanol or dithiothreitol, a protective agent for proteases such as PMSF and BSA, magnesium, etc. These metal ions may coexist in the treatment liquid. The UDP glucose synthase activity is
For example, it can be measured as follows.
Purification can be recommended to proceed using the assay reaction solution used in c) of Example 1 described below while confirming the enzyme activity.

[0024]

EXAMPLES One example of the method for preparing the DNA sequence, plasmid and transformant of the present invention will be described below, but the scope of the present invention is not limited thereto. Example 1 The experimental method is mainly the above-mentioned Molecular cloning and DNA.
According to the catalog of Cloning and Takara Shuzo. The enzyme used was mainly purchased from Takara Shuzo.

A) Preparation of Probe for Screening Cotton UDP Glucose Synthase We decided to obtain the gene of the known potato-derived UDP glucose synthase by the PCR method for the probe. I bought potatoes in a supermarket and sprouted them. Sprout 2
Liquid nitrogen was added to g and crushed in a mortar. Add 5 ml of RNA extraction buffer (100 mM LiCl, 100 mM Tr
is-HCl pH 8.0, 10 mM EDTA, 1% SD
S) and 5 ml of phenol heated to 80 ° C. were added, and the mixture was shaken well and 5 ml of chloroform was added. After centrifugation, 10 ml of 4M LiCl was added to the water layer, and the temperature was -80 ° C.
Left for 1 hour.

After centrifugation, the precipitate was washed with 70% ethanol and dried, and then 1 ml of a buffer solution for oligo dT cellulose column sample (10 mM Tris-HCl pH).
7.4, 1 mM EDTA, 3.0 M NaCl). This was passed through an oligo dT cellulose column (Pharmacia), and this column was loaded with 0.25 ml of a high salt buffer solution.
(10 mM Tris-HCl pH 7.4, 1 mM EDT
A, 0.5 M NaCl) four times, low salt buffer 0.1.
25 ml (10 mM Tris-HCl pH 7.4, 1 mM
It was washed 3 times with EDTA, 0.1 M NaCl), and finally 0.25 ml of elution buffer (10 mM Tris-) at 65 ° C.
HCl pH 7.4, 1 mM EDTA) divided into 4 times m
RNA was eluted.

When each solution was passed through the column, a centrifugal force of 350 g was applied by a centrifugal separator. Oligo d in the eluate
100 μl buffer for T cellulose column sample, 10 μl glycogen solution (10 mg / ml), 2.5 ml ethanol
Was added, the mixture was allowed to stand at −20 ° C. for 2 hours, and the precipitate obtained by centrifugation was washed with 70% ethanol and dried. Thus, potato mRNA was obtained.

Next, cDNA from Boehringer Mannheim
CDNA was synthesized using a synthesis kit. Obtained mR
The NA precipitate was suspended in 3.5 μl of diethylpyrocarbonate-treated water, and 4 μl of the first-strand synthesis buffer (composition is not described in the kit instructions),
RNase inhibitor solution 1 μl (25 units / μ
l), dNTP mixed solution 1 μl (dATP, dCTP, d
GTP, dTTP 10 mM each, synthetic DNA for primers
As RACEdT17 adapter 1.5 μl (sequence:
5'GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT 3 '(SEQ ID NO: 2), concentration 33.7 pmol / μl) and 2 μl of AMV reverse transcriptase solution (20 units / μl) were added and reacted at 42 ° C. for 60 minutes.

Thereafter, the mixture was cooled on ice, and 40 μl of a second strand synthesis buffer (composition is not described in the kit instruction), 1 μl of RNaseH solution (concentration is not described in the kit instruction), E. coli-derived DNA 5 μl of polymerase I solution (5 units / μl) and 34 μl of diethylpyrocarbonate-treated water were added and reacted at 12 ° C. for 60 minutes, 22 ° C. for 60 minutes, and 65 ° C. for 10 minutes, and then T4 DNA polymerase solution 4 μl (1 units / μl
l) was added and reacted at 37 ° C. for 10 minutes, and then EDTA
The reaction was stopped by adding 10 μl of a solution (0.2 M, pH 7.2) and 2 μl of a sodium N-lauroylsarcosine solution (10% w / v).

Then, an equal amount of phenol and chloroform (1: 1) was added to inactivate the enzyme, and the centrifuged aqueous layer was supplemented with 1/10 volume of sodium acetate solution (3M, pH5.
2), 2.5 volumes of ethanol was added and ethanol precipitation was performed. Thus, a double-stranded cDNA precipitate was obtained. Next, a DNA fragment was obtained by the 3'RACE PCR method. 30 μl of TE buffer (10 mM) was added to the obtained cDNA precipitate.
It was dissolved in Tris-HCl pH 8.0, 1 mM EDTA), and 1 μl thereof was used as a template DNA for PCR.

Next, as a primer, 1 μm of synthetic DNA PF3 homologous to known potato cDNA was used.
l (Sequence: 5'GTTGTCCTGAAGCTCAATGGAGG 3 '(SEQ ID NO: 3), concentration 226 pmol / μl) Another is 1 μl of synthetic DNA RACE adapter homologous to 3'end (Sequence: 5'GACTCGAGTCGACATCG 3' (SEQ ID NO: 4) ), A concentration of 35 pmol / μl) was added. Furthermore, 10 μl of a buffer for PCR reaction (100 mM Tris-HCl pH8.
3, 50 mM KCl, 15 mM MgCl ₂ , 0.01%
(W / v) gelatin), dNTP mixture 1 μl (dAT
P, dCTP, dGTP, dTTP 12.5 mM each, T
1 μl of aq DNA polymerase solution (Takara Shuzo, 5 units
/ Μl) and 85 μl of sterilized water were added to carry out PCR reaction.

The reaction conditions were as follows: DNA denaturation at 94 ° C. for 30 seconds, primer annealing at 50 ° C. for 30 seconds, and primer extension reaction at 72 ° C. for 1 minute for 35 cycles. About 1.5 kbp DNA by PCR reaction
Fragments were obtained. This fragment is called plasmid pT7-Blue.
It was cloned into the EcoRV site of eT-Vector to construct plasmid p623RO, and the nucleotide sequences at both ends of the inserted portion were determined.

On the other hand, a nucleotide sequence encoding a region from valine at residue 87 to glutamic acid at residue 155 of a known potato-derived UDP-glucose synthase was obtained, and the portion different from the known gene was only 4 bp. It was The other contained the poly A sequence. Therefore, it is considered that about 70% of the region of known potato UDP glucose synthase was obtained by PCR.

When p623RO is digested with PstI, a DNA fragment of about 1.4 kbp is obtained. This fragment is a PC
It includes the upstream side of the region obtained by R and does not include the poly A sequence. A probe was prepared from this fragment by the random primer method using a DNA DIG labeling kit (Boehringer Mannheim).

Approximately 3 μg of the P623I PstI fragment was dissolved in 15 μl of sterilized water, denatured at 95 ° C. for 10 minutes, and then quickly ice-cooled, and 2 μl of the hexanucleotide mixture (the composition is described in the kit instructions). 2 μl of dNTP mixture for labeling (dATP, dC)
TP, dGTP 1 mM each, dTTP 0.65 mM, digoxygenin-dUTP 0.35 mM, pH 6.5), Klenow fragment solution 1 μl (2 units / μl) was added, and 37
The reaction was carried out at 0 ° C overnight.

2 μl of EDTA solution (0.2 M, pH 8.
0) was added to stop the reaction, and then 4 μL of LiCl solution was added.
1 (4 mM) and 75 μl of ethanol were added, and the mixture was added at -80 ° C for 3
It was left for 0 minutes, centrifuged to separate the precipitate, washed with 70% ethanol, dried, and dissolved in 50 μl buffer. The probe is now complete.

B) Screening of Cotton cDNA Library and Selection of Clones Containing Target Gene Cotton cotton library was purchased from CLONTECH. MRNA was extracted from the whole cotton plant 18 days after germination to prepare a λgt10 cDNA library. Priming was done with both oligo dT and random primers. The size of the library was 1.7 × 10 ⁸ .

This library is called E. Coli. C600
Hfl was infected and allowed to form approximately 2 × 10 ⁵ plaques on the plate. This is transferred to a nitrocellulose filter, 1.5M NaCl, 0.5M NaOH
At 5 minutes, 1.5M NaCl, 0.5M Tris-H
5 minutes at Cl pH 8.0, 2 × SSPE (0.02M Na
H ₂ PO ₄ pH 7.4, 0.3M NaCl, 2 mM E
It was treated with DTA) for 5 minutes, dried, and then baked at 80 ° C. for 2 hours.

Next, 5 × SSC (1 × SSC: 0.15
M NaCl, 0.035M sodium citrate), blocking reagent 1% (composition not stated in kit instructions), N-larloylsarcosine sodium 0.
After treating with a 1% solution at 65 ° C. for 1 hour, the probe prepared in a) was added and treated at 65 ° C. for 15 hours. Filter 2 x SSC, SDS 0.1% at room temperature for 5 minutes twice, then 0.1 x SSC, SDS 0.1%, 68
It was washed once at 5 ° C for 5 minutes.

This filter is used as a nucleic acid detection kit (Boehri
nger Mannheim). Buffer solution 1 (100 mM
The membrane was washed with Tris-HCl pH 7.5, 150 mM NaCl) and then treated with Buffer 2 (Buffer 1 plus 1% blocking reagent) for 30 minutes. After washing the membrane again with buffer solution 1, a conjugate solution (750 units / ml) of sheep anti-digoxygenin polyclonal antibody Fab fragment and alkaline phosphatase was diluted 5000 times with buffer solution 1 and treated for 30 minutes.

After washing the membrane with buffer solution 1, buffer solution 3
(100 mM Tris-HCl pH 9.5, 100 mM
NaCl, 50 mM MgCl ₂ ) for 2 minutes, and 10 ml of buffer 3 was added with nitroblue trizonium salt 7
66 μl of 0% DMF solution (75 mg / ml), 5-bromo-
4-Chloro-3-indolyl phosphate DMF solution 3
After treatment with 3 μl (50 mg / ml) for 30 minutes to overnight, positive plaques were developed and detected.

Eight positive plaques thus obtained were isolated and used as a template for the λgt10 primer (sequence: 5'GCTGGGTAGTCCCACCTTT 3 '(sequence number: 5),
5'CTTATGAGTATTTCTTCCAGGGTA3 '(SEQ ID NO: 6))
PCR was performed to obtain a cDNA-derived fragment of phage DNA. The longest of these is the plasmid p
The plasmid pCPP10 was constructed by cloning into the EcoRV site of T7-Blue T-Vector. The plasmid pUC1 was deleted by using a restriction enzyme.
Subcloning was carried out to determine the nucleotide sequence.

As a result, this clone was found to have an open reading frame consisting of 1398 bp. The amino acid sequence predicted to be the base sequence of this open reading frame is shown in SEQ ID NO: 1 in the sequence listing.

C) UD derived from recombinant cotton by Escherichia coli
Production of P-glucose synthase and analysis of enzyme activity Two types of primers (sequence: 5'GGCCATGGAAAAGCTGGAACACCTCA were used with the plasmid pCPP10 as a template.
AA3 '(SEQ ID NO: 7), 5'GGGGATCCTCAGATGTCTTCGG
PCR was performed using GGCCAT 3 '(SEQ ID NO: 8)), and the restriction enzyme Nc was added to the 5'side boundary of the open reading frame.
A DNA fragment having a restriction enzyme BamHI site immediately outside the oI site and 3'side was obtained. The restriction enzymes NcoI and Ba
After digestion with mHI, N of plasmid pTrc99A
It was cloned into the coI and BamHI sites to construct the expression plasmid pTrcCPP.

E. coli JM105 was transformed with pTrcCPP and pTrc99A, respectively,
1.5 ml of 2 × YT medium containing 50 mg / ampicillin
(1.6% bactotryptone, 1% yeast extract, 0.5% NaCl) was cultured overnight at 37 ° C., then the same medium 11 was placed thereon, and subsequently cultured at 37 ° C. After 2.5 hours from the start of the culture, IPTG (isopropyl-β-D-thiogalactopyrenoside) was added to a final concentration of 1 mM.

After further culturing for 6 hours, the cells were collected, and the cells were mixed with 14 ml of buffer A (5 mM Tris-HCl pH7.
5, 0.2 mM EDTA, 2 mM 2-mercaptoethanol), and the cells were ultrasonically disrupted. After that, centrifugation is performed to separate the soluble and insoluble fractions, ammonium sulfate is added to the soluble fraction, and the mixture is centrifuged to precipitate a fraction at an ammonium sulfate concentration of 0 to 50%.
It was separated into a fraction that precipitated at 80% and a fraction that did not precipitate even at 80%.

When all of these fractions were analyzed by SDS-PAGE, a band which was found in the transformant of pTrcCPP but not in pTrc99A was found in the fraction precipitated at an ammonium sulfate concentration of 50 to 80%. was detected. The molecular weight of this band is about 52 kD
Which was in agreement with the predicted molecular weight of the protein encoded by the ORF of pTrcCPP. Therefore, this fraction was dissolved in buffer solution A, suspended in buffer solution A, and the enzyme activity was measured.

Measurement of UDP glucose synthesis activity was performed by Sowoki.
no et al. (Plant Physiol. 101 , 1073-1080 (1
993)) was carried out as follows. An appropriate amount of the sample is used as a measurement solution 11 in an amount of 11 ml (20 mM Tris-HCl, 1
0 mM MgCl ₂ , 8 mM UTP, 10 mM glucose-
The reaction was carried out in 1-phosphate, 80 mM glycylglycine, 0.03% bovine serum albumin) at 37 ° C. for 20 minutes. The reaction is started by adding glucose-1-phosphate.

After that, the reaction was stopped by treating at 100 ° C. for 2 minutes to inactivate the enzyme. After the denatured protein was removed by centrifugation, 200 μl of this reaction solution was added to 200 μl of the measurement solution to quantify the UDP glucose produced.
00 μl was added to give a final concentration of (20 mM Tris-HC
pH 8.0, 130 μmol glycylglycine, 6 μ
mol NAD: 0.05 units UDP glucose dehydrogenase (bovine liver, Boehringer Mannheim)
The reaction was carried out at 30 ° C., and the production of NADH was quantified by the change in absorbance at 340 nm before and after the reaction to calculate the enzyme activity.

Further, UDP glucose synthase is UDP
It also has glucose degrading activity. Fukui et al. (J. Biochem
106 , 528-532 (1989)), the decomposition activity was also measured. Use an appropriate amount of sample for 1 ml of measurement solution (50 mM
Tris-HCl pH 8.0, 7 mM MgCl ₂ ,
0.5 mM 2-mercaptoethanol, 10 mM sodium fluoride, 2 mM UDP glucose, 0.02 mM glucose-1,6-niphosphate, 0.3 mM NADP, 5 mM pyrophosphate, 1 unit phosphoglucomutase (rabbit muscle,
SIGMA), 1 unit glucose-6-phosphate dehydrogenase (baker's yeast, SIGMA) at 30 ° C.
At the reaction rate of 340 nm during the reaction.
The enzyme activity was calculated by quantifying with the rate of change of the absorbance.

Further, in order to calculate the specific activity, protein was quantified by the Bradford method. Bovine gamma globulin was used for the preparation of the calibration curve. The measurement results are shown in Table 1. Extracts from E. coli transformed with pTrcCPP showed both UDP glucose synthesis activity and degradation activity. On the other hand, in the extract from E. coli transformed with pTrc99A, UDP glucose synthesis activity was not detected, and the degradation activity was about 1/50 of that of pTrcCPP.
It was 00. Thus, by measuring the activity, cotton cD
It was confirmed that the protein encoded by the gene of the present invention isolated from the NA library has UDP glucose synthase activity.

[0052]

[Table 1]

[0053]

INDUSTRIAL APPLICABILITY According to the present invention, a DNA sequence encoding a UDP glucose synthase derived from cotton is provided.
Recombinant microbial cells obtained by incorporating such a DNA sequence into an expression vector and transforming appropriate Escherichia coli have stable UD.
It produces a P-glucose synthesis active substance. This effect is obtained by preparing the DNA sequence from cotton cDNA, which is not mentioned in the prior art literature.

[0054]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 1398 Sequence type: Double strand Topology: Linear Sequence type: cDNA to mRNA Origin Biological name: Cotton (Gossypium hirsatum) Sequence: ATG GAA AAG CTG GAA CAC CTC AAA TCT GCC GTC GCT GCT CTT TCT 45 Met Glu Lys Leu Glu His Leu Lys Ser Ala Val Ala Ala Leu Ser 5 10 15 GAA ATC AGT GAA AAT GAG AAA AAC GGA TTC ATC AAC CTT GTC TCC 90 Glu Ile Ser Glu Asn Glu Lys Asn Gly Phe Ile Asn Leu Val Ser 20 25 30 CGC TAT CTC AGT GGA GAA GCT CAG CAC ATA GAG TGG AGT AAG ATC 135 Arg Tyr Leu Ser Gly Glu Ala Gln His Ile Glu Trp Ser Lys Ile 35 40 45 CAG ACT CCA ACT GAT GAA GTG GTT GTT CCT TAT GAC ACC TTG TCT 180 Gln Thr Pro Thr Asp Glu Val Val Val Pro Tyr Asp Thr Leu Ser 50 55 60 CCC TCT CCT GAT GAT CCT GCT GAA ACC AAG AAG CTC TTG GAC AAA 225 Pro Ser Pro Asp Asp Pro Ala Glu Thr Lys Lys Leu Leu Asp Lys 65 70 75 CTT GTT GTC TTA AAG CTT AAT GGA GGT CTC GGA ACC ACT ATG GGA 270 Leu Val Val Leu Lys Leu Asn Gly Gly Leu Gly Thr Thr Met Gly 80 85 90

TGT ACT GGT CCC AAA TCC GTC ATT GAA GTT CGC AAT GGC TTG ACT 315 Cys Thr Gly Pro Lys Ser Val Ile Glu Val Arg Asn Gly Leu Thr 95 100 105 TTT CTT GAC CTA ATT GTT ATT CAG ATC GAG AAT CTT AAT TCT AAA 360 Phe Leu Asp Leu Ile Val Ile Gln Ile Glu Asn Leu Asn Ser Lys 110 115 120 TAC GGA TGT AAT GTT CCG TTG GTT CTG ATG AAC TCA TTC AAC ACC 405 Tyr Gly Cys Asn Val Pro Leu Val Leu Met Asn Ser Phe Asn Thr 125 130 135 CAT GAT GAC ACA TTG AAG ATT GTC GAC AAG TAC TCA AAT TCA AAC 450 His Asp Asp Thr Leu Lys Ile Val Asp Lys Tyr Ser Asn Ser Asn 140 145 150 ATT GAG ATT CAT ACT TTT AAT CAG AGC CAA TAT CCT CGT CTG GTT 495 Ile Glu Ile His Thr Phe Asn Gln Ser Gln Tyr Pro Arg Leu Val 155 160 165 GTT GAA GAT TTT GCT CCA TTA CCA AGC AAA GGC CAG CAT GGC AAG 540 Val Glu Asp Phe Ala Pro Leu Pro Ser Lys Gly Gln His Gly Lys 170 175 180 GAT GGA TGG TAC CCT CCT GGT CAT GGT GAT GTG TTC CCA TCT CTA 585 Asp Gly Trp Tyr Pro Pro Gly His Gly Asp Val Phe Pro Ser Leu 185 190 195 ATG AAC AGT GGC AAG CTT GAT G CT TTC TTA TCA CAG GGC AAG GAG 630 Met Asn Ser Gly Lys Leu Asp Ala Phe Leu Ser Gln Gly Lys Glu 200 205 210 TAT GTC TTC GTT GCA AAT TCA GAC AAT TTG GGT GCT ATT GTT GAC 675 Tyr Val Phe Val Ala Asn Ser Asp Asn Leu Gly Ala Ile Val Asp 215 220 225

TTG AAA ATC TTA AAC CAT TTG GTC CAA AAC AAG AAT GAA TAT TGT 720 Leu Lys Ile Leu Asn His Leu Val Gln Asn Lys Asn Glu Tyr Cys 230 235 240 ATG GAG GTT ACA CCC AAA ACC CTA GCT GAT GTC AAG GGT GGT ACT 765 Met Glu Val Thr Pro Lys Thr Leu Ala Asp Val Lys Gly Gly Thr 245 250 255 CTT ATT TCT TAT GAA GGA AAA GTT CAG CTC CTT GAA ATT GCT CAA 810 Leu Ile Ser Tyr Glu Gly Lys Val Gln Leu Leu Glu Ile Ala Gln 260 265 270 GTC CCT GAT GAA CAT GTC AAT GAG TTC AAG TCT ATA GAA AAG TTT 855 Val Pro Asp Glu His Val Asn Glu Phe Lys Ser Ile Glu Lys Phe 275 280 285 AAA ATT TTC AAT ACA AAC AAT TTG TGG GTC AAC CTG AAT GCT ATC 900 Lys Ile Phe Asn Thr Asn Asn Leu Trp Val Asn Leu Asn Ala Ile 290 295 300 AAG AGG CTT GTG GAA GCT GAT GAA CTC AAG ATG GAG ATC ATT CCA 945 Lys Arg Leu Val Glu Ala Asp Glu Leu Lys Met Glu Ile Ile Pro 305 310 315 AAC CCA AAG GAG GTC AAT GGA ATC AAG GTT CTT CAA CTG GAA ACT 990 Asn Pro Lys Glu Val Asn Gly Ile Lys Val Leu Gln Leu Glu Thr 320 325 330 GCA GCT GGT GCA GCA ATT AGG T TC TTT GAT CAT GCT ATT GGT ATC 1035 Ala Ala Gly Ala Ala Ile Arg Phe Phe Asp His Ala Ile Gly Ile 335 340 345 AAC GTA CCT CGA TCG CGA TTC CTT CCA GTG AAG GCA ACT TCA GAT 1080 Asn Val Pro Arg Ser Arg Phe Leu Pro Val Lys Ala Thr Ser Asp 350 355 360

TTG CTT CTT GTT CAG TCT GAC CTT TAC ACC TTA GTT GAT GGA TTT 1125 Leu Leu Leu Val Gln Ser Asp Leu Tyr Thr Leu Val Asp Gly Phe 365 370 375 GTT ATC CGG AAT AAA GAT AGA GCG AAT CCT ACA AAC CCA TCC ATA 1170 Val Ile Arg Asn Lys Asp Arg Ala Asn Pro Thr Asn Pro Ser Ile 380 385 390 GAA TTG GGG CCT GAA TTC AAG AAG GTT GGT AAC TTC TTA AGT CGA 1215 Glu Leu Gly Pro Glu Phe Lys Lys Val Gly Asn Phe Leu Ser Arg 395 400 405 TTC AAG TCA ATC CCG AGC ATC ATT GAG CTT GAT AGC CTT AAG GTG 1260 Phe Lys Ser Ile Pro Ser Ile Ile Glu Leu Asp Ser Leu Lys Val 410 415 420 ACT GGT GAT GTT TGG TTT GGT GCT GGC ATT GTG CTC AAG GGG AAA 1305 Thr Gly Asp Val Trp Phe Gly Ala Gly Ile Val Leu Lys Gly Lys 425 430 435 GTG AGT ATC GCT GCA AAA CCC GGG GTG AAG TTG GAG ATT CCC GAT 1350 Val Ser Ile Ala Ala Lys Pro Gly Val Lys Leu Glu Ile Pro Asp 440 445 450 GGA GCT GTA ATT GAG AAC AAG GAA ATT AAT GGC CCC GAA GAC ATC 1395 Gly Ala Val Ile Glu Asn Lys Glu Ile Asn Gly Pro Glu Asp Ile 455 460 465 TGA 1398

SEQ ID NO: 2 Sequence length: 35 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA sequence GACTCGAGTC GACATCGATT TTTTTTTTTT TTTTT 35

SEQ ID NO: 3 Sequence length: 23 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence GTTGTCCTGA AGCTCAATGG AGG 23

SEQ ID NO: 4 Sequence length: 17 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence GACTCGAGTC GACATCG 17

SEQ ID NO: 5 Sequence length: 19 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence GCTGGGTAGT CCCACCTTT 19

SEQ ID NO: 6 Sequence length: 24 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence CTTATGAGTA TTTCTTCCAG GGTA 24

SEQ ID NO: 7 Sequence length: 28 Sequence type: Nucleic acid Number of strands: Single-stranded Sequence type: Synthetic DNA Sequence GGCCATGGAA AAGCTGGAAC ACCTCAAA 28

SEQ ID NO: 8 Sequence length: 26 Sequence type: Nucleic acid Number of strands: Single-stranded Sequence type: Synthetic DNA sequence GGATCCTCAG ATGTCTTCGG GGCCAT 26

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Office reference number FI technical display location C12R 1:19)

Claims (7)

[Claims] 1. A UD derived from cotton (Gossypium hirsatum)
DNA encoding P glucose synthase. 2. The enzyme has an amino acid sequence represented by SEQ ID NO: 1 in the sequence listing or 1 to 20 relative to this amino acid sequence.
The DNA according to claim 1, which has an amino acid sequence in which one amino acid has been added, deleted and / or substituted. 3. The DNA according to claim 1, which has the nucleotide sequence represented by SEQ ID NO: 1 in the sequence listing. 4. D according to any one of claims 1 to 3.
D having the function of controlling the expression of the NA sequence and its DNA
A recombinant vector comprising an NA sequence. 5. A recombinant microbial cell into which a gene has been introduced by the recombinant vector according to claim 4. 6. The host cell is Escherichia
The recombinant microbial cell according to claim 5, which is a microbial cell belonging to the genus. 7. A method for producing an active substance comprising culturing the recombinant microbial cell according to claim 5 in a medium and collecting a UDP glucose synthase active substance from the culture.