JPH07284399A - Method for cloning pathogenic virus gene, dna derived from piscine pathogenic iridovirus and method for rapidly diagnosing piscine pathogenic virus utilizing the same dna - Google Patents

Abstract

PURPOSE:To design a primer having high specificity applicable to diagnosis of fishes infected with iridovirus. CONSTITUTION:Cloning of pathogenic virus genes is carried out using a mixed primer designed by a base sequence corresponding to an amino acid sequence in a region having high storage property in a ribonucleoside reductase gene stored among viral varieties. For example, a piscine pathogenic virus such as iridovirus is used as the pathogenic virus. A mixed primer is designed by a base sequence having high specificity applicable to diagnosis for fish diseases in the resultant DNA from an infected and piscine pathogenic iridovirus is rapidly diagnosed using the mixed primer. Preferable primer is a combination of 20mer of GCA TGT ATG CTG TTT AGA CA with 20mer of GAG CAT CAA GCA GGC GAT CT. Genes of whole iridovirus genome are cloned by a molecular-biological procedure using the combined primer as a probe.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for cloning a pathogenic virus gene, a DNA derived from a fish pathogenic iridovirus gene, and a rapid fish pathogenic virus diagnostic method using the same. More specifically, the present invention is to isolate the gene of the fish iridovirus, which is currently considered to be the causative virus that causes diseases in various fishes (red sea bream, striped horse mackerel, yellowtail, etc.), and utilize this gene. The present invention relates to a method for rapidly and accurately diagnosing the presence or absence of infection of this disease.

[0002]

BACKGROUND OF THE INVENTION Diagnosis of viral diseases in fish is carried out by collecting various organs from fish suspected of having fish disease and homogenizing them.
The cells were inoculated into various cell lines and the growth of the virus was diagnosed using the expression of cytopathic effect (CPE) as an index. In this method, it takes a very long time to culture until the expression of CPE, and the measures against diseases tend to be delayed.

A rapid diagnostic method using a monoclonal antibody that specifically reacts with this virus has been developed. This is a method of examining the reactivity to a monoclonal antibody using a culture supernatant of virus-infected BF-2 cells (bluegill fibroblast) and serum such as red sea bream and striped horse mackerel. As described above, the method for diagnosing a viral infection using an antibody is suitable for identifying a virus, but not for detecting a trace amount of virus.

[0004]

SUMMARY OF THE INVENTION It is an object of the present invention to provide a method for cloning a pathogenic virus gene and a method for rapidly diagnosing a fish viral disease. Specifically, the present invention has an object to provide a method capable of diagnosing red sea bream virus infection by detecting the ribonucleotide reductase gene derived from iridovirus rapidly and accurately. The present invention is a highly specific primer that can be applied to the diagnosis of a fish infected with an iridvirus by isolating the gene of a fish iridvirus and utilizing the information of its nucleotide sequence, that is, by using a molecular biology technique. The purpose is to provide a method of designing.

[0005]

[Means for Solving the Problems] A virus is a DNA (RNA) encoding a protein necessary for its own growth.
Are incorporated into cells of a host (human, fish, etc.), proteins encoded by those viral genes are expressed using the protein expression system of the host, and proliferate themselves.
Fish infected with the virus contain viral genes in addition to their own genes. A gene diagnostic method targets a gene derived from this virus and detects the virus using a molecular biology method.

PCR (Polymerase Chai)
n Reaction) is also called replication chain reaction, and D
It is a reaction in which only a specific region of the NA chain is repeatedly replicated. This reaction mainly involves the dissociation of the template DNA double strand due to heat, the annealing (binding) of an oligonucleotide called a primer (which is synthesized using a DNA synthesizer) and the template DNA, and the complementary strand synthesis by a thermostable DNA polymerase. There are two stages.

In this reaction, the most important thing is the design of the primer. When designing this, what must be paid special attention to is complementation with the target gene (viral DNA). For that, detailed information about viral genes is needed. Therefore, it is preferable to obtain the gene of the desired virus and design the primer based on the information of the nucleotide sequence.

The present invention pays attention to a gene called ribonucleotide reductase (RR1) which is very well conserved among virus species among the genes of double-stranded DNA viruses, and the DNA sequences of various ribonucleotide reductases. PCR by selecting highly homologous region from the information of
A combination of primers (mixed primer) synthesized to carry out the above was prepared.

The present invention uses a mixed primer designed with a nucleotide sequence corresponding to the amino acid sequence of a highly conserved region in a ribonucleotide reductase gene conserved among virus species A method for cloning a gene is provided.

The pathogenic virus is a fish pathogenic virus, such as the ylide virus. A preferred example of the mixed primer is AA (TC) GA (AG) TT (TC) AT.
(TCA) TC (GATC) CG (GATC) G
A (TC) GA 23-mer primer A and TT (TC) TC (GA) AA (GA) AA
(GA) TT (GATC) GT (TC) TT 2
It is a mixture of primer B consisting of 0 mer.

A PCR reaction was carried out using a mixed solution of a viral DNA solution obtained from a fish body infected with an iridvirus and primers A and B.

The resulting reaction product was purified and subcloned into the pSK vector manufactured by Stratagene, and the insert fragment (about 350) incorporated in the obtained transformant.
The base sequence of bp) was determined, and a highly specific primer applicable to diagnosis was designed based on this.

The iridvirus that causes this disease can be purified as particles from infected fish. It is easy to extract a DNA from this virus particle and prepare a gene library by using general molecular biological means. Moreover, since a probe (a gene fragment of iridvirus) for screening this library was provided for the first time in the present invention, it is possible to easily determine the nucleotide sequence of the gene of the entire iridvirus.

As described above, the base sequence of DNA corresponding to the amino acid sequence of the highly conserved region in the known ribonucleotide reductase gene is designed, mixed primers are synthesized, and the gene is cloned by the PCR method. Using this method, even if the properties of the virus have not been analyzed in detail, it is possible to use the PCR method by simply extracting the total DNA from the infected cell without purifying the virus.

A part of the viral gene thus obtained can be diagnosed based on the specific sequence in the region. Further, it can be used as a powerful probe for cloning a gene of the entire viral genome by using a general molecular biological technique such as gene manipulation.

The present invention is a DNA having the nucleotide sequence represented by SEQ ID NO: 1. This DNA is preferably DNA derived from the iridovirus gene. By designing a mixed primer having a highly specific nucleotide sequence applicable to fish disease diagnosis in this DNA and using it, the fish disease pathogenic iridvirus can be rapidly diagnosed.

The preferred primer in this case is GCA
2 of TGT ATG CTG TTTAGA CA
Primer PR5 and GAG CA consisting of 0 mer
20mer of TCAA GCA GGC GAT CT
Is a combination of primers PR6.

Further, by using the nucleotide sequence in DNA as a DNA probe, the gene of the entire iridovirus genome can be cloned by a molecular biological technique. As a preferred probe, a mixture of the above-mentioned primers PR5 and PR6 is used.

It has been reported that icosahedral virus having a diameter of about 200 nm is observed in atypical hypertrophic cells by observing a fish body infected with an iridvirus with an electron microscope. The virus particle does not have an envelope, and a core with a high electron density with a diameter of about 120 nm is observed in the central part, and has a characteristic morphology of iridvirus. Infected cells before virion formation are characterized by cell hypertrophy and nuclear degeneration.
From the observation of the morphology of the degenerated cells, it is possible to infer the outflow of nuclear contents into the cytoplasm due to the collapse of the nuclear membrane and the subsequent formation of virus particles at the outflow site.

When a stamp specimen of the spleen of a red sea bream diseased fish is stained by a blood staining method such as Giemsa staining, atypical hypertrophy cells are stained as spherical cells whose cytoplasm is deeply stained in blue-violet. This method has been regarded as an effective means as a simple diagnostic method in the field. However, in some fish species other than red sea bream, diagnosis by this method may be difficult. In addition, the time of appearance of such atypical cells is in a state in which the condition has progressed considerably, and is not suitable for early detection of iridovirus disease.

To date, in addition to red sea bream, yellowtail, amberjack,
Iridoviruses have been confirmed in six species of Perciformes, which are striped horse mackerel, sea bass, sea bream, and sea bream, and the range of diseased fish species may further expand in the future. 1991
According to the annual outbreak situation survey, outbreaks of iridovirus infectious diseases have been reported in 12 major aquaculture prefectures in western Japan, mainly in Kyushu and Shikoku.

Regarding the isolation of the causative virus by the cultured cells, the following reports are found. The spleen ground filtrate of diseased fish was BF-
2, FHM, RTG-2, CHSE-214, KRE-
When inoculated into cells derived from fish species such as No. 3 and cultured at 20 to 25 ° C., CPE characterized by the appearance of hypertrophic spherical cells is expressed in all cells after a few days, but it seems to be seen in other fish viruses. It does not show any sudden cell collapse. The virus infectious titer was about 10 ³ to ⁵ TCID ₅₀ / ml, and all cells had low sensitivity, and the infectious titer tends to decrease with passage.

The growth of this virus is suppressed by IUdR treatment, and it is sensitive to ether and chloroform, and heat (5
It shows unstable properties at 5 ° C for 30 minutes) and acid (pH 3). The filter method slightly passes 220 nm.
It can grow at 15 to 30 ° C, but the optimum temperature is around 25 ° C, and growth at 37 ° C is not observed. Since these results and the virus particles are hexagonal in size in medium size and proliferate only in the cytoplasm, it is considered that the virus belongs to the Iridoviridae.

[0024] Lyrid virus infections in fish are known to occur in many types of marine fish such as lymphocytic disease and viral erythrocytic necrosis, but they are all related to symptoms, pathological findings, size of virus particles, properties, etc. Unlike the virus, the red sea bream iridvirus is considered to be a new species different from the previously reported fish iridvirus.

[0025]

EXAMPLES The present invention will be described with reference to examples. The invention is in no way limited by this example.

Example 1 Preparation of Viral DNA Solution Approximately 5 g of spleen was excised from a fish body that had died due to iridovirus disease-like symptoms occurring in a red sea bream farm in western Japan.
The solution was homogenized in 0 ml of physiological saline, and the supernatant was used as a virus solution. To 10 ml of this solution, 2 ml of 20% polyethylene glycol solution was added, and the mixture was allowed to stand in ice for 30 minutes.
The precipitate was collected by centrifugation at 00 g for 20 minutes. This precipitate was dissolved in 0.4 ml of water and phenol extraction was repeated 3 times, followed by ethanol precipitation to suspend the precipitate in 0.1 ml of water to obtain a viral DNA solution.

Example 2 Cloning of the Iridovirus Gene by PCR Method The Iridovirus belongs to a double-stranded DNA virus and is about 10
It consists of a 0k genome. There are various methods for cloning the gene of this virus.
Among the genes of the double-stranded DNA virus, we focused on the gene called ribonucleotide reductase (RRI), which is very well conserved among virus species. Various 2
Synthetic primers A and B designed from the commonality of the sequences of the RR1 gene of the double-stranded DNA virus were prepared. Primer A: AA (TC) GA (AG) TT (T
C) AT (TCA) TC (GATC) CG (GAT
C) GA (TC) GA 23mer primer B: TT (TC) TC (GA) AA (G
A) AA (GA) TT (GATC) GT (TC)
20mer of TT

First, 1 μl of the prepared viral DNA solution
And 0.5 μg each of primers A, B and 2.5 mM d
PCR (polymerase chain reaction) was performed on the mixed solution of NTPs using TAQ DNA polymerase reaction reagent manufactured by Boehringer under the following conditions. 94 ° C 30
The cycle of 50 seconds, 50 ° C. for 60 seconds and 72 ° C. for 120 seconds was repeated 30 times.

When the PCR product of the obtained reaction product was confirmed using 2% agarose gel, a band of about 350 bp was confirmed. Use this band for D using agarose gel
Purified using the NA recovery method, p-produced by Stratagene
Subcloned into SK vector. Insert fragment (about 350 bp) integrated in the obtained transformant
Was determined using an automatic gene sequencer manufactured by Pharmacia. The results are shown in SEQ ID NO: 1.

An amino acid sequence predicted from this DNA sequence [Madai Irido
virus), see SEQ ID NO: 1] for other double-stranded DNA
The viruses Avian virus Fever virus (ASF virus) and Vaccinia virus (v
The amino acid sequence of the ribonucleotide reductase gene reported in Accinia virus) was compared. The result is shown in FIG. In the figure, the part where the amino acid sequences match among the three is marked with *.

As shown in FIG. 1, the gene fragment successfully cloned by us shows very high homology with the gene amino acid sequence reported in other double-stranded DNA viruses. It turned out that it is very likely that it is a part of the gene of Iridovirus.

Example 3 Based on the nucleotide sequence in the ribonucleotide reductase gene shown above, synthetic primers PR5 and PR6 for specifically detecting infection of this virus were designed and synthesized. PR5: GCATGTTATGCTGTTTAGCA PR6: GAGCATCAAGCAGGCGATCT

Example 4 Diagnosis of red sea bream iridovirus disease by PCR using synthetic primers PR5 and PR6 Red sea bream dead fish and normal fish 3 with an average weight of 150 g and having iridovirus disease-like symptoms that occurred at the red sea bream farm in western Japan. About 5 g of spleen was removed from the tail and DNA was prepared by the same method as above.

1 μl of DNA solution prepared from red sea bream spleen
And 0.5 μg each of PR5, PR6, 2.5
A PCR reaction was carried out in which mM dNTP and a DNA polymerase reaction reagent were mixed and a cycle of 94 ° C. for 30 seconds, 60 ° C. for 60 seconds and 72 ° C. for 120 seconds was repeated 30 times.

The results of subjecting the reaction product obtained by PCR to 2% agarose gel electrophoresis are shown in FIG. From the DNA of all three individuals prepared from diseased fish, a band was recognized at the same position as the target ribonucleotide reductase gene fragment. No amplification of the ribonucleotide reductase gene fragment was observed from the DNA prepared from normal fish.

From the above results, it was revealed that the primers PR5 and PR6 designed from this gene fragment can be used for diagnosis of red sea bream virus.

[0037]

INDUSTRIAL APPLICABILITY DN that can be used as a powerful probe when cloning a fish virus gene
A fragment can be provided. It is possible to provide a method for rapid diagnosis of fish viral diseases. It is possible to design highly specific primers that can be applied to the diagnosis of fish infected with iridovirus.

[Brief description of drawings]

FIG. 1 Madai Irid virus
o virus), the amino acid sequence predicted from the DNA sequence represented by SEQ ID NO: 1 is used as the other double-stranded DNA virus, African wine fever virus (AS).
F virus) and vaccinia virus (vacc)
FIG. 2 is a view showing a sequence compared with the amino acid sequence of the ribonucleotide reductase gene reported in (inia virus).

[FIG. 2] As a result of PCR amplification of DNA extracted from spleens of diseased fish and normal fish using the PR5 and 6 under the conditions described in the examples, bands derived from PR5 and 6 were observed only in the diseased fish. Drawing showing that.

[Sequence list]

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location // (C12Q 1/68 C12R 1:92) (C12N 15/09 ZNA C12R 1:92) C12R 1 : 92)

Claims (9)

[Claims] 1. A pathogenic virus gene characterized by using a mixed primer designed with a nucleotide sequence corresponding to an amino acid sequence of a highly conserved region in a ribonucleotide reductase gene conserved among virus species. Cloning method. 2. The method for cloning a pathogenic virus gene according to claim 1, wherein the pathogenic virus is a fish pathogenic virus. 3. The method for cloning a pathogenic virus gene according to claim 2, wherein the fish pathogenic virus is iridvirus. 4. A DNA having the base sequence shown in SEQ ID NO: 1. 5. The DNA according to claim 4, which is derived from an iridovirus gene. 6. A rapid disease-causing iridovirus characterized in that a mixed primer is designed and used with a highly specific nucleotide sequence applicable to fish disease diagnosis in the DNA according to claim 4 or claim 5. Diagnostic method. 7. The primer is GCA TGT ATG.
20mer and G of CTG TTTAGA CA
The rapid diagnostic method for a fish disease pathogenic iridovirus according to claim 6, which is a 20-mer combination of AG CAT CAA GCA GGCGAT CT. 8. A method for cloning a gene of the entire iridovirus genome by a molecular biological method using the nucleotide sequence in the DNA according to claim 4, claim 5 or claim 6 as a probe. 9. A GCA TGT AT as a probe
G CTG TTTAGA CA 20mer and GAG CAT CAA GCA GGCGAT CT
9. The method for cloning a gene of the entire iridovirus genome according to claim 8, which uses a combination of 20 mers.