JPH07241196A - Fusion gene having albumin gene and human apolipoprotein gene, plasmid including the gene and its use - Google Patents

Abstract

PURPOSE:To provide a novel gene for secreting human apo E-like protein which is a polyfunctional protein and useful as a reagent for research, medicines and a synthetic intermediate for apolipoprotein-like protein. CONSTITUTION:The fused gene is prepared from the whole or a partial sequence for albumin and human apolipoprotein E-like gene. In the case that the human apolipoprotein E-like gene is ligated to the downstream of the whole or a partial sequence of albumin, the fused protein is most secreted. The expression vector including the albumin gene or a part thereof, the promotor, the terminator and human apo E-like gene is obtained in accordance with the scheme given in the formula. The human albumin gene is obtained by the PCR amplification using the cDNA library synthesized from the mRNA of human liver as a template and the human apo E-like gene is cloned by effecting the PCR amplification of cDNA synthesized from mRNA of human liver. Both are preferably ligated through the sequence recognizing restriction enzymes.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to an albumin gene and an apolipoprotein E-like gene for efficiently secreting and producing human apolipoprotein E or a human apolipoprotein E-like protein having physiological activity similar to that by a gene recombination technique. Fusion gene, a plasmid having the same, and its use. The obtained fusion protein is a multifunctional protein having the antigenicity of albumin and human apolipoprotein E and part of the activity of human apolipoprotein E, and is useful as a reagent for these studies. Furthermore, many enzymes known to recognize and cleave specific amino acid sequences are known for the obtained fusion protein, and they are also useful as intermediates for obtaining human apolipoprotein E-like protein.

[0002]

2. Description of the Related Art Lipids present in the plasma of a living body, especially non-polar lipids (triglyceride, cholesteryl ester, etc.) are almost insoluble in water. Therefore, for transporting these in vivo, they are covered with lipoproteins and phospholipids to form spherical particles, become plasma lipoproteins, and transport lipids from one tissue to another. Lipoproteins are classified into several types according to the difference in their hydration densities, and it is apolipoprotein bound to their surface that plays an important role in their metabolism in blood. Currently, more than 10 kinds of apolipoprotein are known, and apolipoprotein E [hereinafter referred to as apo E]. ] Etc. are mentioned. In vivo, Apo E
Is considered to play an important role in the reverse transport system of cholesterol from the periphery to hepatocytes via receptors in the body.

Furthermore, E2, E3, and E4 have been found as major subclasses of this human apoE. E3 is derived from a normal person, whereas E2 and E4 are seen from patients with type III hyperlipidemia. Issued and is considered to be abnormal. [The Journal of Biological Chemistry (J. Biol. Chem) Volume 255, 1759-1762 (1980)
Year)]. A person lacking this apoE3, or having E2 or E4 often becomes hyperlipidemic, and further leads to arteriosclerosis. In such cases, the normal human apoE function can be restored by administering normal E3 to the patient. It is also known that administration of rabbit Apo E to rabbits with hyperlipidemia significantly reduces the plasma cholesterol level. [Proceedings of the National Academy of Sciences of the United States of
America (Proc.Natl.Acad.Sci.USA) Vol. 86, 665-6
Page 69 (1989)]

When the target protein is mass-produced in a host by a gene recombination technique, secretory production has many advantages. That is, when the target protein is produced and accumulated in a recombinant host cell and exhibits adverse toxicity to the growth and survival of the host, it is possible to avoid this toxicity by secreting and producing the target protein. In addition, even if it is not toxic, the target protein may interfere with the growth of the host by accumulating it in a large amount in the host cell, but it can be avoided by secretory production.
Furthermore, when the target protein accumulates in the host cell, a phenomenon in which the target protein is denatured and insolubilized in the host is often observed, but it can be avoided by secretory production.

When the target protein is commercially produced in large quantities by gene recombination technology and the target protein accumulates in the host cell, the host cell is purified to purify the target protein. It is necessary to destroy and to purify the target protein from the disrupted solution. Such purification is contaminated with a large amount of impurities derived from a recombinant host, and it is difficult to obtain a highly pure target protein. On the other hand, when the target protein is produced in a secretory production system, the target protein may be purified from the culture solution, contamination with impurities derived from the recombinant host can be prevented to a minimum, and a highly pure target protein can be easily obtained. Obtainable.

[0006] Furthermore, many proteins undergo sugar chain addition, formation of disulfide bonds, activation of inactive precursor proteins by limited decomposition, and modification such as phosphorylation and carboxylation of specific amino acids. Some of these modifications are common to various cells, and some of these modifications occur during the process of secretion. Therefore, when the target protein is secreted and produced, it is expected to produce a protein having a function and structure closer to that of a natural protein as compared with the system that accumulates in cells.

Up to now, in order to secrete and produce a target protein, the target protein should be located downstream of a signal peptide (presequence or preprosequence) of the protein derived from or efficiently secreted and produced in the host cell. This has been mainly done by expressing a protein chain. However, even if such a signal peptide is used, the protein is not always secreted efficiently. In the case of yeast or animal cells, signal peptides are known to be cleaved when they enter the secretory organs of the cells, that is, when they pass through the endoplasmic reticulum membrane, and whether or not the target protein is secreted from the secretory organs. Depends largely on the nature of the target protein.

Escherichia coli, animal cells, insect cells, yeast cells and the like are known as hosts used for gene recombination. In the secretory production of human apoE using yeast as a host, human apoE is easily decomposed by a protease possessed by yeast cells and is difficult to be secreted from yeast cells, and an extremely small amount (40 ng / ml) is used by using a specific mutant strain. ), Human apoE was secreted into the medium [The Journal of Biological Chemistry (J. Biol. Chem) Vol. 266, 16273-162].
76 (1991)], but an example in which human apoE-like protein is secreted and produced in large amounts using recombinant yeast has not been known so far.

[Problems to be Solved by the Invention]

[0009] At present, many researchers are conducting research on apo E all over the world, and it is considered that human apo E is useful not only as a research reagent but also as a therapeutic drug. However, the amount obtained by purifying Apo E from plasma is limited. on the other hand,
There is no known example in which a large amount of human apo E-like protein is secreted and produced using recombinant yeast cells, and development of a method for efficiently secretory producing a large amount of human apo E-like protein using recombinant DNA technology. Is desired.

[0010]

Under these circumstances, the present inventors have conducted diligent studies, and as a result, have made a human apoE-like gene a fusion gene with albumin and expressing it in yeast cells. As a result, it was found that a sufficient amount of human apoE-like protein as a fusion protein was secreted, and the present invention was completed. Hereinafter, the present invention will be described in detail.

In the present invention, the apoE protein including apoE and its amino acid modification is referred to as an apoE protein, and the gene encoded thereby is referred to as an apoE-like gene. Albumin, which is known as one of the major proteins in serum, has been previously known to be secreted in large quantities using recombinant yeast [Biotechnology, Vol. 11, Vol.
05-910 (1993)]. Therefore, the present inventors focused on the property that albumin is secreted and produced in large quantities by yeast cells, and by utilizing it, it is possible to secretively produce human apoE-like protein in yeast cells in large quantities. Found. That is, when a fusion gene in which a human apoE-like gene was linked downstream of the albumin gene was expressed in yeast cells, a large amount of albumin and human apoE
Fusion protein can be obtained from the culture supernatant.

The human albumin gene has a polymerase chain reaction (P) using a cDNA library synthesized using mRNA extracted from human liver as a template.
CR) method. That is, first,
Sequence of human albumin gene [Proceedings of the National Academy of Sciences of the United States of America (Proc.Natl.Acad.Sci.USA) Vol. 79, No. 71] -Page 75 (198
2 years)], and a synthetic primer is prepared using a DNA synthesizer. The sequences of the primers, restriction enzyme recognition sequence, for example, be those obtained by adding a Hin dIII site or Bam HI site in its 5 'side, preferably upon incorporation into such an expression vector for the amplified gene product.

Although the albumin gene is known to have a prepro sequence, when it is expressed using Saccharomyces cerevisiae , high secretory production is achieved by removing the prosequence. Journal of Biochemistry (J.
Biochem.) 110, 103-110 (1991)]. In the present invention, the albumin gene means an albumin gene and a gene obtained by removing a gene corresponding to its pre- and / or pro-sequence from the albumin gene. In order to remove the gene corresponding to its prosequence from the albumin gene, for example, the PCR method can be used. The gene of interest can be produced, for example, according to the production route shown in Chemical formula 1.

[0014]

[Chemical 1]

First, a synthetic primer is prepared using a DNA synthesizer. Each primer is: primer 1: sequence homologous to 5'side of albumin gene primer 2: sequence complementary to 3'side of albumin gene primer 3: sequence homologous to target pre-mature sequence primer 4: target And the pre-mature sequence is designated as the complementary sequence (I). As the sequences of the primers 1 and 2, those having a restriction enzyme recognition sequence added to the 5 ′ side thereof can also be used. Next,
Using the albumin gene as a template, primers 1 and 4
And PCR reactions with primers 2 and 3, respectively. As a result, the gene (II) corresponding to the pre-sequence and mature sequence of the albumin gene is amplified, respectively.
Primers 3 and 4 have sequences complementary to each other,
Further, since each amplified gene product has a sequence derived from the primer, the same molar amount of these gene products is added, and PCR reaction is performed for one cycle. That is, for example, the gene product of (III) is obtained by heating at 94 ° C and quenching at 37 ° C. Furthermore, for example, 72 ℃
When the temperature is raised to, the gene product becomes a complete double-stranded DNA by the action of Taq polymerase (IV). This DNA
It is possible to obtain the albumin gene excluding the pro-sequence by carrying out a PCR reaction using the primers 1 and 2 as a template.

Human albumin is known to consist of three domain structures [Proceedings of the National Academy of Sciences of the United States of America (Proc. .Natl.Acad.Sci.USA) Vol. 79, pp. 71-79 (198
2 years)]. Therefore, a portion of albumin up to domain 1 or domain 2 is amplified by the PCR method, and each of them is used to express the gene of itself or the fusion gene to which human apoE is linked in recombinant yeast. That is, first, a primer complementary to a sequence obtained by adding a stop codon to the gene sequence corresponding to the C-terminal side of each domain and a primer having a sequence homologous to the 5'side of the albumin gene are used, for example, corresponding to a pro sequence. PCR is carried out using the albumin gene from which the gene has been removed as a template. Next, the amplified gene fragment is incorporated into an expression vector and expressed in yeast. In addition, when amplifying the genes corresponding to albumin and its respective domains using the PCR method, use a primer that complements a restriction enzyme recognition sequence upstream of the stop codon, for example, a sequence with Sal I site added. Thus, each albumin gene having a restriction enzyme recognition sequence for linking the human apoE gene can be obtained. As a specific method for obtaining each albumin gene having a restriction enzyme recognition sequence,
For example, the manufacturing method of Chemical formula 2 may be mentioned.

[0017]

[Chemical 2]

The human apoE gene is cloned by a conventional method, for example, by using the mRNA extracted from human liver as a template, that is, after synthesizing cDNA using reverse transcriptase and then using the PCR method. The sequence of the primer is the sequence of the human apoE gene [Proceedings of the National Academy of Sciences of
The United States of America (Proc.N
atl.Acad.Sci.USA) Vol. 82, pp. 3445-3449 (1985)
Year)], and similar to the above. That is, one of the sequences is homologous to the 5'side of the human apoE gene, and the other is complementary to the 3'side thereof. Further, if a restriction enzyme recognition sequence is added to each of the primers, the restriction enzyme recognition sequence is also added to the amplified gene product, so that they are later added to an E. coli vector (for example, pAT153, pUC19 or pBR322). Etc.), a promoter (eg GAL7 etc.) and a terminator (eg GAL10 etc.) and an expression vector etc.

When the albumin gene of each length and the gene corresponding to the mature human apoE are ligated, it is preferable to carry out via a restriction enzyme recognition sequence. Moreover, in that case, the frames of the fusion genes must match. A gene product corresponding to a mature human apoE matured by using a primer with a restriction enzyme recognition sequence added by the PCR method is cleaved with the restriction enzyme such as Xba I, and then integrated into a multicloning site such as plasmid pUC19. It is also possible to add another kind of restriction enzyme recognition sequence to the gene fragment amplified by the PCR method by excising again with another restriction enzyme that it has.

The fusion gene obtained by linking the albumin and the human apoE-like gene thus obtained is used, for example, in the present invention, Yeast, Vol.
6-77 (1985) and Nucleic Acids
Using the PCR method according to Research (Nucleic Acid Ress) Vol. 14, pages 7557-7568 (1986), it was expressed in yeast cells under the control of a strong promoter such as the cloned yeast GAL7 promoter. Obtain the fusion protein. In particular, when a human apoE-like protein is connected downstream of the full-length sequence of albumin, the highest amount of the fusion protein is secreted.

Specific methods for obtaining an expression vector containing an albumin gene or a part of a gene, a promoter, a terminator and a human apoE-like gene include:
For example, the manufacturing method of Chemical formula 3 may be mentioned.

[0022]

[Chemical 3]

Regarding the activity of apolipoprotein E,
Some are known [Science No. 240
Vol. 62-630 (1988)] One of them is that it has an adsorption activity on heparin [The Journal of Biological Chemistry (J. Bi.
ol.Chem.) 261, 2068-2076 (1986)]. It can be confirmed that the albumin and human apoE-like fusion protein obtained by the present invention retain the activity as an apoE-like protein since they have the binding activity to heparin. In addition, this fusion protein shows reactivity to anti-albumin and anti-human apoE antibodies,
It is confirmed that each protein has the antigenicity, that is, the immunological activity. That is, in the present invention, the human apoE-like protein secreted in large amounts from yeast cells as a fusion protein with albumin is a multifunctional protein having each activity as a fusion protein. Many enzymes that cleave specific amino acid sequences are also known [Methods in Enzymology (Method
s in Enzymology) 185, 140-142 (1990)
)], For example, an apoE-like protein can be obtained by enzymatically cleaving from a fusion protein adjusted to contain an amino acid sequence matching the substrate specificity of those enzymes.

In the present invention, the plasmid used for transforming yeast is not particularly limited as long as it is capable of autonomously replicating in yeast or capable of being transferred to the chromosome. YEp13, YCp50, YI
Examples include p5, pJDB207 and pJDB219. For example, pJDB207 is the Molecular Genetics in yeast Alfred Benzon Sympos
ium) 16, page 383 (1983). The plasmid may include an autonomous replication initiation region in the host yeast, for example, a replication initiation region of 2 μm DNA or ARS region (Autonomous replicating sequence), and may also include a centromere (centromere). .

For the transfer of the plasmid into the chromosome, a plasmid containing a DNA sequence (for example, LEU2 , HIS4 , TRP1 , URA3 or ribosomal DNA gene) of a part of the gene existing in the host yeast chromosome is used. The homologous sequence allows the entire plasmid or linear fragment thereof to be stably introduced into the host yeast chromosome by recombination.
That is, the progeny cells stably retain the introduced genetic material even in the absence of selective pressure.

For example, a plasmid containing a naturally occurring sequence in a yeast chromosomal gene and a heterologous gene can be stably integrated at the locus of the chromosomal gene. Examples of homologous sequences include amino acid or nucleic acid synthesis genes, ribosomal DNA or Ty factor (Transposon of Transposon of
Yeast element) etc. can be used. For example, when the host yeast is an amino acid or nucleic acid auxotrophic strain, that is, in a strain in which the amino acid or nucleic acid synthesis system gene is deficient, a gene that complements the mutation of the host is used. Therefore, it can be used as a selectable marker for transformants. At this time, the gene causes an auxotrophy of the auxotrophy of the host yeast. As the amino acid or nucleic acid synthesis gene,
Examples include LEU2 , HIS4 , TRP1 and URA3 .

As a selection gene marker for yeast,
For example, when the host yeast is auxotrophic, a gene such as an amino acid or nucleic acid synthesis system gene can be used, and when the host yeast is antibiotic sensitive, a gene expressing the antibiotic resistance can be used. Examples of the gene include genes that confer resistance to antibiotics such as ampicillin, cycloheximide, G418, chloramphenicol, bleomycin and hygromycin.

The promoter is a promoter of a highly expressing yeast gene.
It is preferable to use a Romotor. For example,TRPI,
ADHI,ADHII, Acid phosphatase (PHO3OrPHO
Five) And the promotion of genes such as isocytochrome C
Tar;GAL1,GAL10andGAL7Galactose metabolism such as
System promoters;SUC2Invertase Promos such as
Starter; enolase, glyceraldehyde-3-phosphine
Ate dehydrogenase ( GAPDH), Phosphoglyceride
Tokinase (PGK), Hexokinase, pyruvatecal
Voxylase, phosphofructokinase, glucose-
6-phosphate isomerase, pyruvate kinase,
Triose phosphate isomerase and phosphoglux
The remains that encode glycolytic systems such as the course isomerase gene
Gene promoters and α-factors and α-factors
Such as the yeast mating pheromone gene that encodes an actor
Examples include promoters.

In a preferred embodiment, a signal sequence useful in yeast cells can be introduced in addition to the albumin signal sequence in order to secrete the fusion protein into the plasmid. As the signal sequence, yeast-derived signal sequences such as yeast invertase (JP-A-60-41488) and α-factor gene (JP-A-59-132892) may be used. Further, a signal sequence synthesized for secretory production in yeast, for example, the signal sequences described in JP-A-1-240191 and JP-A2-167095 can also be used. The plasmid also contains a suitable terminator for polyA conversion of mRNA and termination of transcription, such as PH.
It is preferable to insert O5 , GAPDH, GAL10 terminator and the like at the 3'-terminal side of the fusion gene.

In addition to the promoter, fusion gene region, this plasmid may also contain an origin of replication for a bacterial host, eg E. coli, and a genetic selectable marker. The plasmid obtained at this time can obtain a large amount of the hybrid vector by growth and replication in Escherichia coli by using an E. coli replication origin and a selectable marker for Escherichia coli in the yeast hybrid vector. Construction of hybrid vectors can be readily accomplished using all of the cloning techniques based on. E. coli plasmid, eg pB
R322 and the like contain an E. coli origin of replication and E. coli genetic markers that confer resistance to antibiotics such as tetracycline and ampicillin, and are advantageously used as part of a yeast hybrid vector.

This plasmid preferably contains a promoter, a fusion gene region controlled by the promoter, and a terminator. Further, the plasmid may optionally contain a signal sequence for secretory production, a selection gene marker for yeast, An E. coli replication origin region and a selection gene marker for E. coli can be contained.

This plasmid is a DNA sequence consisting of a fusion gene, each of which is selected from the above-mentioned PCR product or plasmid group,
It can be obtained by, for example, a method in which a DNA sequence containing a promoter and a DNA sequence containing a terminator are cleaved with a restriction enzyme and then ligated and inserted into an appropriate plasmid, or one DNA sequence is cleaved and then inserted into the other plasmid. it can. Further, the plasmid is preferably one that already carries an expression control system of a physiologically active substance such as a promoter, an operator and a terminator,
Furthermore, it is preferable to have a restriction enzyme site suitable for obtaining an albumin gene, a human apoE-like gene, and a fragment carrying a linker sequence connecting them in a part other than the expression control system gene of the plasmid. In addition, even when there is no suitable restriction enzyme site, it can be used by applying a method using PCR, a method of adding dC tail and dG tail, a method of using a linker, or a method of ligating with a blunt end by S1 nuclease. You can also The order of the sequences may be adjusted from the upstream to the downstream so that the promoter, the fusion gene and the terminator are provided. Examples of the method for preparing a transformant using the fusion gene include a method using a plasmid having the fusion gene inserted therein and a method having the fusion gene inserted into the chromosome of the host.

The method for producing a transformant using this recombinant plasmid and the method for producing the desired heterologous protein are shown below.

Transformation of yeast is carried out by a known method, for example,
It may be performed by a lithium method, a protoplast polyethylene glycol fusion method, an electroporation method, or the like. For example, in the case of the lithium chloride method, Journal of Bacteriology (J. Bacteriol) Volume 153,
It may be carried out according to pages 163-168 (1983). First,
The recombinant plasmid is introduced into the host cell. Examples of the host cell include yeast, for example, those belonging to the genus Saccharomyces, Schizosaccharomyces, Pichia, Kleberomyces, Hansenula or Yarrowia, preferably an auxotrophic strain or antibiotic sensitivity. Stocks and the like. Furthermore, specifically, a mutant strain having a mutation that is complemented by a yeast selectable marker gene carried by the plasmid to be inserted, for example, leucine and a histidine-requiring mutant strain, which is a G418-sensitive strain Saccharomyces cerevisiae ( Saccharomyces cere
visiae ) AH22 strain (MAT a, his 4, leu 2, can 1), MC16 strain, SH
Examples include Y3 strain, YPH274 strain and AB1380 strain. Further, when the fusion gene is inserted into the host cell chromosome, any site in the sequence homologous to the host cell chromosome of the plasmid to be inserted is cleaved with a restriction enzyme to introduce a linearized plasmid into the host. It is preferable. The linearized plasmid integrates into a region on the host chromosome that is homologous to the region integrated into the plasmid. The linearized plasmid has a higher frequency of integration on the host chromosome than the circular plasmid.

Next, it is confirmed whether or not the plasmid has been introduced into the expected site, and whether or not the introduced fusion gene is stable. Specifically, when the fusion gene is inserted into the chromosome of the host cell, the Southern blotting method introduces the plasmid into the expected site using a sequence homologous to the chromosomal sequence of the host cell used for transformation. Confirm that it has been done. The confirmed strain is a transformant in which a plasmid containing a region encoding a heterologous protein of interest has been integrated into a host cell. This transformant can be used as a host to transform again with a plasmid into which a fusion gene containing the region encoding the target protein has been inserted. In this case, a homologous region other than the region used in the initial transformation can be used as the cell chromosome homologous region. In addition, ribosomal DNA and Ty factor are examples of sequences homologous to the chromosomal sequence of the host cell. Since a plurality of these genes are present per cell, a plurality of target genes can be integrated into the host chromosome by one transformation.

The obtained transformant is cultured in a medium suitable for the host. Examples of the medium include YN in the case of yeast.
B medium [0.7% yeast nitrogen base (Yeast Ni
trogenBase) (Difco), 2% glucose], YPD medium [1% yeast extract (Difco), 2% bactopeptone (Difco), 2% glucose] and YPG medium [2% glucose in YPD] 3% galactose is used] and the like, but those in which the amount of each component of the medium is changed in order to optimize the desired protein production are also used. In addition, amino acids, nucleic acids, antibiotics, agar and the like can be added and used if necessary.

The culture is usually carried out at 15-43 ° C (preferably 30 ° C).
About 20 to 100 hours. Aeration and agitation can be performed if necessary. After culturing, the supernatant is recovered by a known method, for example, centrifugation. The target heterologous protein is produced in this supernatant, and after being concentrated by using a known method, for example, a method such as ethanol precipitation, the protein is efficiently added to the culture supernatant by Western blotting or the like. You can confirm that it is secreted.

In the present invention, for example, as a preferred specific example, a yeast production plasmid is constructed by inserting a fusion gene in which a human apoE- like gene is linked via an albumin gene downstream of the yeast GAL7 promoter. Can be mentioned. These are introduced into, for example, Saccharomyces cerevisiae strain AH22 for transformation. By culturing these transformants in a culture medium containing galactose for 1 to 3 days, a sufficient amount of the fusion protein can be obtained in the culture supernatant.

[0039]

EXAMPLES Next, the present invention will be specifically described with reference to examples, but the present invention is not limited thereto.
Many techniques, reactions and analytical methods used in the present invention are well known to those skilled in the art. Unless otherwise noted, all enzymes are commercial sources, such as Takara Shuzo Co., Ltd .; New England.
Biolabs (NEB: New England Biolabs, Massachusetts, USA); Amersham (UK) and Bethesda Research Laboratories (BRL)
Research Laboratories, Maryland, USA). Unless otherwise specified, buffers and reaction conditions for the enzyme reaction may be used according to the manufacturer's recommendations for each enzyme. The primer may be synthesized by an automatic phosphamide method using a DNA synthesizer (Milligen).

Example 1 Preparation of human albumin gene (1) Cloning of human albumin gene Primer 1 (a homologous sequence added to the N-terminal encoding human albumin protein downstream of Hin dIII linker) using a DNA synthesizer And primer 2 ( Ba
m HI, obtained by adding a sequence complementary to C-terminal encoding human albumin protein sequence downstream of and Sal I linkers to complement stop codon) to synthesize. The sequence is shown below. Primer 1; 5'-CT AAGCTT AATGAAGTGGGTAACCTTTATT Hin dIII Primer 2; the reaction of 5'-CCC GGATCC TTAG GTCGAC CGTAAGCCTAAGGCAGCTTG Bam HI Sal I PCR, 10μl of buffer Taq polymerase (Takara Shuzo) in 2.5 unit (500 mM KCl, 100 mM Tris-HCl pH
8.3, 0.01% gelatin, 15 mM MgCl ₂ ), primer 1 and primer 2 were prepared to a final concentration of 200 μM each.
Human liver cDNA library (Clontech) with dNTP added
After overlaying with 100 μl of mineral oil, 95 ℃, 1
Min; 45 ° C., 2 min; 72 ° C., 5 min. After completion of the reaction, after removing mineral oil, after treating with a mixture of phenol and chloroform,
Ammonium acetate was added to perform ethanol precipitation and DNA
Get fragments. The obtained was a Hin dIII- Bam HI-treated DNA fragment was ligated into pUC19 which was treated as the fragments of about 2 kb, to obtain plasmid PALB1.

(2) Removal of human albumin gene pro-sequence A primer 3 and a primer 4 are prepared using a DNA synthesizer. Primer 3; 5-AGCTCGGCTTATTCCGATGCACACAAGAGTGAG Primer 4; 5-CTCACTCTTGTGTGCATCGGAATAAGCCGAGCT Using plasmid pALB1 as a template, Primer 1 and 4 are used, and Primer 2 and 3 are used to amplify a pre-sequence and a mature body sequence portion, respectively. . The PCR reaction was carried out by using 2.5 UNIT Taq polymerase (Takara Shuzo) with 10 μl of buffer solution (500 mM KCl, 100 mM Tris).
-HCl pH8.3,0.01% gelatin, 15 mM MgCl _2), a dNTP respectively prepared to a final concentration of 200μM each primer, after overlaid with mineral oil as 100μl with plasmid pALB1, 95 ℃, 1 minute; 45 ° C., 1 minute; 72 ° C, 2 minute reaction cycle repeated 12 times. After the reaction is completed, the target DNA fragment contained in the reaction solution is extracted from each agarose gel.
Using the obtained two DNA fragments in the same molar amounts each, 2.5 UNIT of Ta
q Polymerase (Takara Shuzo) with 10 μl of buffer (500 mM KC
l, 100 mM Tris-HCl pH8.3, 0.01% gelatin, 15 mM MgCl
₂ ) Add dNTPs adjusted to a final concentration of 200 μM to make 95 μl, overlay with mineral oil, and perform reaction at 94 ° C. for 3 minutes; 37 ° C. for 3 minutes; 72 ° C. for 3 minutes. further,
Primers 1 and 2 are added, and the reaction cycle of 95 ° C, 1 minute; 45 ° C, 1 minute; 72 ° C, 2 minutes is repeated 12 times. After completion of the reaction, mineral oil is removed, after treatment with phenol and chloroform, ammonium acetate is added and ethanol precipitation is carried out to obtain a DNA fragment. The obtained DNA fragment is Hi
After n dIII- Bam HI treated, ligated into pUC19 which was treated as a fragment of the approximately 2 Kb, to obtain plasmid PALB2.

(3) Cloning of partial sequence of human albumin gene Primer 5 and primer 6 are prepared using a DNA synthesizer. Each 5-GC GGATCC TTAC with primers 1 and 5 GTCGAC CCTTGTTTGATTAAATTCTGAGGC Bam HI Sal I plasmid pALB2 as template and using primers 1 and 6; Primer 5; 5-GC GGATCC TTAC GTCGAC CCGAGTCTCTGTTTGGCAGA Bam HI Sal I primer 6 , A portion of human albumin up to domain 1 and domain 2 is amplified. The PCR reaction was carried out by using 2.5 UNIT Taq polymerase (Takara Shuzo) with 10 μl of buffer solution (500 mM KCl, 100 mM Tris).
-HClpH8.3,0.01% gelatin, 15 mM MgCl _2), each primer, respectively dNTP were adjusted to be 200μM added at a final concentration, after overlaid with mineral oil as 100μl with plasmid PALB2, 95 ° C., 1 minute; 45 ° C. , 1 minute; 72 ° C., 2 minutes reaction cycle repeated 12 times. After the reaction is complete, mineral oil is removed and after phenol and ether treatment,
Ammonium acetate was added and ethanol precipitation was performed to DNA
Get the product. The resulting a DNA product was Hin dIII- Bam HI treatment, were treated fragment of each about 0.7,1.3kb Similarly pUC19
Ligated to pALB2D1 and pALB2D2.

Example 2 Isolation of Human ApoE Gene Using a DNA synthesizer, primer 7 (having a homologous sequence at the N-terminal encoding human apoE protein downstream of the Hin dIII linker) and primer 8 ( Eco RI
A complementary sequence is added to the C-terminal encoding human apoE protein downstream of the linker). Primer 7; 5'-CT AAGCTT AATGAAGGTTCTGTGGGCTGCGT Hin dIII Primer 8; 5'-A GAATTC ATCAGTGATTGTCGCTGGGCACAG Eco RI Next, primer 8 is added to mRNA extracted from human liver (Toyobo) to bring the total amount to 51.5 µl. After reacting at 65 ° C for 10 minutes, quench in ice and add 20 μl RT buffer (250
_{mMTris-HCl pH8.3,40mM MgCl 2, 250mM} KCl), the 20μl
5 mM dNTP, 1 μl 1M dithiothreitol, 1.5 μl RNas
An e-inhibitor (Pharmacia) and 6 μl of reverse transcriptase (Seikagaku Corporation) are sequentially added and reacted at 50 ° C. for 2 hours. After the reaction, a PCR reaction is carried out using the one prepared by ethanol precipitation as a template. This reaction is based on 2.5 UNIT Taq
10 μl of buffer solution (500 mM KC) in polymerase (Takara Shuzo)
l, 100 mM Tris-HCl pH8.3, 0.01% gelatin, 15 mM MgC
l ₂ ), primer 7 and primer 8 each had a final concentration of 20
Add dNTPs to 0 μM and add 100
After overlaying mineral oil as μl, 95 ℃, 1 minute; 45 ℃,
2 minutes; 72 ° C, 5 minute reaction cycle repeated 25 times. After the reaction is completed, mineral oil is removed, and after phenol and ether treatment, ammonium acetate is added to perform ethanol precipitation to obtain a DNA product. To the resulting DNA product was treated with Hin dIII- Eco RI, was similarly treated pUC19
Ligated to the plasmid pTHAE5. Nucleotide sequence chain termination dideoxy method [Procedures of the National Academy of Sciences of the United States of America (Proc.Natl.Acad.Sci.USA)] Volume 74, 54
63-5467 (1977)], and the cDNA sequence thereof is the sequence described in the literature [Proceedings of the
National Academy of Sciences of the United States of America (Pro
c.Natl.Acad.Sci.USA) Vol. 82, pp. 3445-3449 (1985)
Year)].

Example 3 Construction of human apoE gene from which signal sequence was removed Using a DNA synthesizer, primer 9 (a homologous sequence was added downstream of the Xba I linker to the N-terminal encoding the mature sequence of human apoE) And primer 10 (a human ApoE matured sequence with a complementary sequence added to the region containing the Ava I site). Primer 9; 5-CCC TCTAGA CAAGGTGGAGCAAGCGGTG Xba I Primer 10; 5-GCGCAGCTC GGGCTC CGGCTCTGT Ava I PCR reaction was carried out by using primers 9 and 10 with plasmid pTHAE5 as a template and 2.5 μT of Taq polymerase (Takara Shuzo) in an amount of 10 μl. Buffer solution (500 mM KCl, 100 mM Tris
-HCl pH8.3,0.1% gelatin, 15mM MgCl _2), respectively after overlaid with mineral oil as 100μl added dNTP, prepared to a final concentration of 200μM, 95 ℃, 1 min; 45 ° C., 1 min; 72
The reaction cycle of 2 minutes at ℃ is repeated 12 times. After completion of the reaction, mineral oil is removed, after treatment with phenol and chloroform, ammonium acetate is added and ethanol precipitation is carried out to obtain a DNA product. The resulting DNA product is Xba I
− After Ava I treatment, a fragment of about 0.1 kb was used for plasmid pTHAB5.
Was digested with Ava I- Bam HI and Xba I-
Ligation into pUC19 treated with Bam HI gives the plasmid pTHAX5.

Example 4 Preparation of Expression Vector Plasmid JGH5 derived from plasmid pJDB207 [Applied Environmental Microbiology (Applie
d and Environmental Microbiology) Volume 56, 2125-
2132 pp., The (1990)], and Hin dIII treated, blunted with Klenow fragment, by introducing a Sal I linker to obtain plasmid JGH5S. Using a DNA synthesizer, primer 11 (having a sequence homologous to the 5'side region of the GAL7 promoter added downstream of Sal I linker) and primer 12
To create (obtained by adding a sequence complementary to the 3 'side of the untranslated region of the plasmid JGH5 including downstream GAL7 promoter Hin dIII linker). The PCR reaction was carried out by using primers 11 and 12 with plasmid JGH5 as a template, and using 2.5 UNIT Taq polymerase (Takara Shuzo) in 10 μl of a buffer solution (500 mM KCl, 100 mM Tris-HC).
l pH8.3,0.1% gelatin, 15mM MgCl _2), each final concentration 200μ
Add dNTPs prepared to make M and add 100 μl of mineral oil, and overlay, 95 ℃, 1 minute; 45 ℃, 1 minute; 72 ℃, 2
The 12 minute reaction cycle is repeated. The reaction mixture is treated with a mixture of phenol and chloroform, then ethanol precipitated, and digested with Hin dIII and Sal I to obtain DNA fragment a. About 8 kb of DNA fragment obtained by treating plasmid JGH5S with Sal I and Bam HI, DNA fragment a and plasmid pALB2
Albumin DNA cleaved with Hin dIII and Bam HI from DNA
The fragments are ligated to obtain the plasmid pSAB. The resulting plasmid was cleaved with Hin dIII and Bam HI to obtain a DNA fragment of about 8 kb, and the plasmids pALB2D1 and pALB2D2 were converted to Hin dIII and B
Each domain fragment of the human albumin gene cleaved with am HI is ligated in place of the human albumin gene to obtain plasmids pSAB1 and pSAB2. In addition, the plasmid pSA
Each human albumin fragment obtained by digesting B, pSAB1 and pSAB2 with Hin dIII and Sal I was previously prepared from the plasmid pTHAX5 together with the human apoE gene from which the signal sequence excised with Sal I and Bam HI was removed. introduced into approximately 8kb of pSAB which had been treated with Hin dIII- Bam HI, to construct a human apo E expression vector pHAB, pHAB1 and PHAB2.

Example 5 Preparation of Expression Vector The following primers are synthesized using a DNA synthesizer. Primer 13; 5'-CGC AAGCTT CTTTTGAGGGAATATTCAAC Hin dIII This primer complements the 3'side region of the GAL7 promoter, and together with primer 11, plasmid pFY1.
016 [Nucleic Acids Research (Nucleic
Acids Research) Vol. 11, pp. 8555-8568 (1983)]
PCR was performed in the same manner as in Example 4 using
GAL7 promoter DNA with Sal I and Hin dIII linkers
Get fragments. This fragment was digested with Sal I and Hin dIII, and then the plasmid pFY1016 was treated with Bam HI and Eco RV to obtain an about 0.8 kb GAL10 terminator DN.
The A fragment and the plasmid YEp13 were digested with Xho I and Stu I and the about 9 kb DNA fragment recovered from the agarose gel and the plasmid pHAB were digested with Hin dIII and Bam HI and the about 2.8 kb albumin and human apoprotein recovered from the agarose gel were digested. The EDNA fragments are ligated to obtain the plasmid pYAB.

Example 6 Preparation of transformant and its culture strain AH22 were inoculated into 100 ml of YPD (2% bactopeptone, 1% yeast extract, 2% glucose) medium,
Incubate until the OD ₆₀₀ = 1.5. 1000 xg culture solution
Centrifuge for 5 minutes at room temperature, and filter the resulting cells with TE buffer (10 mM Tris
-HCI pH8, 1 mM EDTA) and re-centrifuge at 1000 xg for 5 minutes. After suspending the obtained bacterial cells in 1 ml of TE buffer, a TE buffer containing 0.2 M lithium acetate in the same amount as the suspension is added, and the mixture is kept at 30 ° C. for 1 hour. To 100 μl of the obtained bacterial solution, 10 μl (10 μg) of the DNA constructed according to the present invention was added, and the mixture was again kept at 30 ° C. for 30 minutes, the same amount of 70% polyethylene glycol-4000 (manufactured by Sigma) was added, and the mixture was added at 30 ° C. Keep it warm for hours. After incubating the obtained bacterial solution at 42 ℃ for 5 minutes, 1000 ×
After centrifuging at 5 g for 5 minutes, the obtained bacterial cells were suspended in sterilized water and then applied to selective medium A (0.7% yeast nitrogen base, 2% glucose, 30 mg / l histidine, 2% agar), and 30 Incubate at ℃ for 3 days. The transformant strain growing in the obtained medium was applied to selective medium A, the grown strain was inoculated into 100 ml of YPD medium, and cultured at 30 ° C. for 18 hours.
After centrifuging at 00 × g, the cells are suspended in 100 ml of a galactose-containing medium (6% bactopeptone, 3% yeast extract, 3% galactose) and cultured at 30 ° C. for 36 hours. The obtained culture solution was centrifuged, and the obtained culture supernatant was added with 2.5
Double the amount of ethanol is added and ethanol precipitation is performed to obtain a protein. The obtained protein was subjected to SDS polyacrylamide gel electrophoresis (SDS-PAGE), and an anti-apoE antibody (manufactured by Chemicon), an anti-albumin antibody (manufactured by UCB), and a secondary peroxidase-labeled secondary antibody (manufactured by Chemicon) were added. As a result of Western blotting using
Proteins reactive with anti-albumin antibodies of about 23 kDa, about 47 kDa and about 67 kDa were detected from recombinant yeast cells transformed with pSAB1, pSAB2 and pSAB, respectively. In addition, about 60 kDa, about 80 kDa, about 100 kDa from recombinant yeast cells transformed with the plasmids pHAB1, pHAB2, pHAB and pYAB.
A protein reacting with anti-Apo E and anti-albumin antibody was confirmed at about 100 kDa. The molecular weight is obtained by SDS-PAGE of a molecular weight marker (Bio-Rad low marker) and blotting on a nitrocellulose filter (calculated based on the one stained with 0.1% amido black, 10% acetic acid, 40% methanol). You can check it from. Further, using a TOYO decintometer, human Apo E (manufactured by Chemicon) was quantified, and the amount secreted from the yeast transformed with the plasmids pHAB1, pHAB2, pHAB and pYAB was about 0.05 as human Apo E. mg / l, about 0.
It was 42 mg / l, about 2.2 mg / l and about 2.0 mg / l. The culture supernatant obtained from the yeast cells transformed with pHAB was treated with 50 mM Tris-HCl.
Heparin Sepharose column HiTrap-Heparin (5 ml), which was diluted 10 times with a buffer solution (pH 8.0) and equilibrated with the same buffer solution.
(Pharmacia) at 4 ° C. After adsorption, the product is washed with the same buffer and then eluted with the same buffer containing 2M KCl to obtain a fraction having an absorption of 280 nm in about 3-6 ml. SD this
Western blotting after S-PAGE,
It was confirmed that the obtained protein was a human albumin-human apoE fusion protein having a molecular weight of about 100 kDa that reacts with anti-albumin and anti-human apoE antibodies.

[0048]

INDUSTRIAL APPLICABILITY A fusion gene having albumin and a human apoE-like gene, a plasmid into which the fusion gene is inserted, or a fusion protein secreted from a recombinant yeast into which the gene is introduced is
It is useful as a research reagent, a drug, or a synthetic intermediate for an apoE-like protein, and its production method provides an efficient method for mass-producing a human apoE-like protein.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location // A61K 38/00 (C12N 15/09 ZNA C12R 1: 645) (C12N 1/19 C12R 1: 645) (C12P 21/02 C12R 1: 645) (C12N 15/00 ZNA A C12R 1: 645)

Claims (4)

[Claims] 1. A fusion gene in which a partial or full-length sequence of albumin and a human apolipoprotein E-like gene are linked. 2. A plasmid in which a fusion gene in which a partial or full-length sequence of albumin and a human apolipoprotein E-like gene are linked is inserted. 3. A yeast transformed with a plasmid into which a fusion gene in which a partial or full-length sequence of albumin and a human apolipoprotein E-like gene are linked is inserted. 4. Albumin and human apolipoline, which express yeast transformed with a plasmid into which a fusion gene in which a partial or full-length sequence of albumin and a human apolipoprotein E-like gene is linked are inserted. A method for producing a protein E fusion protein.