JPH07241195A - Fusion gene having lysomucorpepsin-like gene and human apolipoprotein gene, plasmid including the gene and its use - Google Patents

Abstract

PURPOSE:To provide a novel gene for secreting human apo E-like protein which is useful as a reagent for research, a medicine and a synthetic intermediate for apolipoprotein-like protein. CONSTITUTION:The gene is prepared by fusing the gene of Rhyzomucor pepsin- like gene with human apolipoprotein E-like gene. The expression vector including the MPP-like gene, the promotor, the terminator and human apo E-like gene is obtained in accordance with the scheme given in the formula. The gene having the MPP-like sequence is PCR-amplified using the plasmid bearing MPP-like gene as a template, the human apo E-like gene is cloned by effecting the PCR amplification of cDNA synthesized from mRNA of human liver. Both are preferably ligated through the sequence recognizing restriction enzymes.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a lyso Mucor pepsin in order to efficiently produce and secrete human apolipoprotein E-like protein by genetic recombination technology [Rhizomucor pep
sin : a milk-clotting enzyme-producing microorganism belonging to the genus Rhizomucor,
For example, Rhizomucor pusillu
s ) and Rhizomucor miehei ( Rhizomucor miehei ) produce the microbe pepsin (Microbial pepsin) is a generic term. Hereinafter referred to as MPP. ] A gene encoding a fusion protein with and a plasmid having the gene inserted therein and its use. The obtained fusion protein is a multifunctional protein having the antigenicity of MPP and human apolipoprotein E and their activities, and is thus useful as a reagent for these studies. Furthermore, the obtained fusion protein is
Many enzymes that recognize and cleave specific amino acid sequences are known, and are also useful as intermediates for obtaining human apolipoprotein E-like protein.

[0002]

2. Description of the Related Art Lipids existing in the plasma of a living body, especially non-polar lipids (triglyceride, cholesteryl ester, etc.) are almost insoluble in water. Therefore, for transporting these in vivo, they are covered with lipoproteins and phospholipids to form spherical particles, become plasma lipoproteins, and transport lipids from one tissue to another. Lipoproteins are classified into several types according to the difference in their hydration densities, and it is apolipoprotein bound to their surface that plays an important role in their metabolism in blood. Currently, more than 10 kinds of apolipoprotein are known, and apolipoprotein E [hereinafter referred to as apo E]. ] Etc. are mentioned. In vivo, Apo E
Is considered to play an important role in the reverse transport system of cholesterol from the periphery to hepatocytes via receptors in the body.

Furthermore, E2, E3, and E4 have been found as major subclasses of this human apoE. E3 is derived from a normal person, whereas E2 and E4 are seen from patients with type III hyperlipidemia. Issued and is considered to be abnormal. [The Journal of Biological Chemistry (J. Biol. Chem) Volume 255, 1759-1762 (1980)
Year)]. Those who lack the human apoE3 or have E2 or E4 often have hyperlipidemia and further atherosclerosis. In such a case
Administration of 3 can restore normal human ApoE function. It is also known that administration of rabbit Apo E to rabbits with hyperlipidemia significantly reduces the plasma cholesterol level. [Proceedings of the National Academy of Sciences of the United States of America (Proc.Natl.Acad.Sci.USA) Vol. 86, 66]
Page 5-669 (1989)]

When the target protein is mass-produced in a host by a gene recombination technique, secretory production has many advantages. That is, when the target protein is produced and accumulated in a recombinant host cell and exhibits adverse toxicity to the growth and survival of the host, it is possible to avoid this toxicity by secreting and producing the target protein. In addition, even if it is not toxic, the target protein may interfere with the growth of the host by accumulating it in a large amount in the host cell, but it can be avoided by secretory production.
Furthermore, when the target protein accumulates in the host cell, a phenomenon in which the target protein is denatured and insolubilized in the host is often observed, but it can be avoided by secretory production.

When the target protein is commercially produced in large quantities by gene recombination technology and the target protein accumulates in the host cell, the host cell is purified to purify the target protein. It is necessary to destroy and to purify the target protein from the disrupted solution. Such purification is contaminated with a large amount of impurities derived from a recombinant host, and it is difficult to obtain a highly pure target protein. On the other hand, when the target protein is produced in a secretory production system, the target protein may be purified from the culture solution, contamination with impurities derived from the recombinant host can be prevented to a minimum, and a highly pure target protein can be easily obtained. Obtainable.

[0006] Furthermore, many proteins undergo sugar chain addition, formation of disulfide bonds, activation of inactive precursor proteins by limited decomposition, and modification such as phosphorylation and carboxylation of specific amino acids. Some of these modifications are common to various cells, and some of these modifications occur during the process of secretion. Therefore, when the target protein is secreted and produced, it is expected to produce a protein having a function and structure closer to that of a natural protein as compared with the system that accumulates in cells.

Up to now, in order to secrete and produce a target protein, the target protein should be located downstream of the signal peptide (presequence and preprosequence) of the protein derived from or efficiently secreted and produced in the host cell. This has been mainly done by expressing a protein chain. However, even if such a signal peptide is used, the protein is not always secreted efficiently. In the case of yeast or animal cells, signal peptides are known to be cleaved when they enter the secretory organs of the cells, that is, when they pass through the endoplasmic reticulum membrane, and whether or not the target protein is secreted from the secretory organs. Depends largely on the nature of the target protein.

Escherichia coli, animal cells, insect cells, yeast cells and the like are known as hosts used for gene recombination. Regarding secretory production of human apoE using yeast as a host, human apoE is easily decomposed by a protease possessed by yeast cells and is hardly secreted from yeast cells. By using a specific mutant strain, extremely small amount (40 ng / ml) is obtained. ), Human apoE was secreted into the medium [The Journal of Biological Chemistry (J. Biol. Chem) Vol. 266, 16273].
-16276 (1991)], a human apoE-like protein was secreted and produced in large amounts using recombinant yeast.

[0009]

[Problems to be Solved by the Invention] Currently, many researchers are conducting research on ApoE all over the world.
Human Apo E is considered to be useful as a therapeutic agent as well as a research reagent. However, apoE obtained by purifying apoE from plasma
The amount of is limited. On the other hand, it has not been known so far that a large amount of human apoE-like protein was secreted and produced using recombinant yeast cells, and recombinant DNA technology was used to efficiently secrete and produce large amounts of human apoE-like protein. It is desired to develop a method of making it happen.

[0010]

Under these circumstances, the inventors of the present invention have conducted extensive studies and as a result, have determined that a human apoE-like gene is a fusion gene with an MPP-like gene, which is used as a recombinant yeast cell. It was found that a sufficient amount of human apoE-like protein as a fusion protein can be secreted by using it for expression, and completed the present invention. Hereinafter, the present invention will be described in detail.

So far, studies on amino acid variants of MPP have revealed that, for example, the amino acid at the 38th or 237th amino acid has been changed in order to lack protease activity.
Amino acid at position 218 or 303 was changed to change H, Amino acid at position 79 or 188 was changed to delete the sugar chain binding site, Substrate binding and specificity were changed There is such a MP
Amino acid variants of P can also be used instead of MPP. For example, MPP with the 38th amino acid converted
The expression vector JP-138G can be used to prepare MPP from which the protease activity has been eliminated. [The Journal of Biological Chemistry (J. Biol. Chem) No. 26
Volume 4, pages 16862-16866 (1989)] In the present invention,
The MPP-like protein including MPP and its amino acid modification is referred to as the MPP-like gene. Similarly, including human apoE and its amino acid variants,
Like protein, and its encoding gene is referred to as apoE-like gene.

MPP, which is known as a pseudomilk enzyme, is known to be produced in large quantities by using recombinant yeast [Molecular General Genetics (Mol.
Gen. Genet.) 210, 462-467 (1987)]. Therefore, the present inventors have paid attention to the property of MPP and found that it is possible to make human apoE-like protein highly secreted from yeast cells by utilizing it. That is, for example, when a fusion gene in which a human ApoE- like gene is linked to the downstream region of the full-length sequence of an MPP-like gene is expressed under the control of a strong promoter such as yeast GAL7 promoter, recombinant yeast transformed with the expression vector is obtained. The fusion protein was obtained in the culture supernatant.

A gene having an MPP-like sequence is prepared, for example, by using a plasmid carrying the MPP-like gene as a template.
Amplification by the polymerase chain reaction (PCR) method using an appropriate restriction enzyme recognition sequence and a synthetic primer having a sequence complementary to or homologous to each MPP part, and ligated in frame with the apoE-like gene Good.

In the present invention, the plasmid used for transforming yeast is not particularly limited as long as it is capable of autonomous replication in yeast or capable of being transferred to the chromosome. YEp13, YCp50, YI
Examples include p5, pJDB207 and pJDB219. For example, pJDB207 is the Molecular Genetics in yeast Alfred Benzon Sympos
ium) 16, page 383 (1983). The plasmid may include an autonomous replication initiation region in the host yeast, for example, a replication initiation region of 2 μm DNA or ARS region (Autonomous replicating sequence), and may also include a centromere (centromere). .

In the plasmid, a gene fragment which is considered to be necessary than other vectors for more effective use can be cleaved with, for example, a restriction enzyme and converted or newly introduced. For example, plasmid JGH5 is a plasmid
It can be obtained by introducing the GAL7 promoter and GAL10 terminator sequences into a vector derived from pJDB207 [Applied and Environmental Microbiology No. 5
Volume 6, pp. 2125-2132 (1990)]. When converting the restriction enzyme recognition sequence of a gene fragment, use a restriction enzyme such as Hi
After cutting, etc. n dIII, it was blunted by Klenow fragment, linker gene having a restriction enzyme recognition sequence of interest, for example, may be introduced and Sal I recognition sequence. In addition, when there is no suitable restriction enzyme recognition sequence, a sequence known in the literature, such as [Yeast, Vol. 1, pp. 67-77 (1985)] and [Nucleic Acids], is used.・ Research (Nucleic Acid R
ess) Vol. 14, according to p. 7557-7568 (1986)], primers containing appropriate restriction enzyme sequence, e.g., the sequence of interest the recognition sequence, such as Sal I Oyo <br/> beauty Hin dIII Can be obtained by the PCR method using a cloned plasmid or chromosomal DNA known to have the gene thereof as a template. For example, by this method, the GAL7 promoter gene fragment having the Sal I and Hin dIII linkers of FIG. 1 can be obtained.

To transfer the plasmid into the chromosome, a plasmid containing a partial DNA sequence of the gene existing in the host yeast chromosome (for example, LEU2 , HIS4 , TRP1 , URA3 or ribosomal DNA gene) may be used. . The homologous sequence allows the entire plasmid or linear fragment thereof to be stably introduced into the host yeast chromosome by recombination. That is, the progeny cells stably retain the introduced genetic material even in the absence of selective pressure. The gene of interest can be produced, for example, according to the production routes shown in Chemical formula 1 and Chemical formula 2.

[0017]

[Chemical 1]

[Chemical 2]

For example, a plasmid containing a naturally occurring sequence in a yeast chromosomal gene and a heterologous gene can be stably integrated at the locus of the chromosomal gene. Examples of homologous sequences include amino acid or nucleic acid synthesis genes, ribosomal DNA or Ty factor (Transposon of Transposon of
Yeast element) etc. can be used. For example, when the host yeast is an amino acid or nucleic acid auxotrophic strain, that is, in a strain in which the amino acid or nucleic acid synthesis system gene is deficient, a gene that complements the mutation of the host is used. Therefore, it can be used as a selectable marker for transformants. At this time, the gene causes an auxotrophy of the auxotrophy of the host yeast. As the amino acid or nucleic acid synthesis gene,
Examples include LEU2 , HIS4 , TRP1 and URA3 .

As a selection gene marker for yeast,
For example, when the host yeast is auxotrophic, a gene such as an amino acid or nucleic acid synthesis system gene can be used, and when the host yeast is antibiotic sensitive, a gene expressing the antibiotic resistance can be used. Examples of the gene include genes that confer resistance to antibiotics such as ampicillin, cycloheximide, G418, chloramphenicol, bleomycin and hygromycin.

The gene of human apoE is cloned by a conventional method, for example, by using the mRNA extracted from human liver as a template, that is, after synthesizing cDNA using reverse transcriptase and then using the PCR method. The sequence of the primer is the sequence of the human apoE gene [Proceedings of the National Academy of Sciences of
The United States of America (Proc.N
atl.Acad.Sci.USA) Vol. 82, pp. 3445-3449 (1985)
Year)], and similar to the above. That is, one of the sequences is homologous to the 5'side of the human apoE gene, and the other is complementary to the 3'side thereof. Further, if a restriction enzyme recognition sequence is added to each of the primers, the restriction enzyme recognition sequence is also added to the amplified gene product, so that they are later added to an E. coli vector (for example, pAT153, pUC19 or pBR322). Etc.), a promoter (eg GAL7 etc.) and a terminator (eg GAL10 etc.) and an expression vector etc.

When ligating the gene of each length and the gene corresponding to the human apoE matured form, it is preferable to carry out via a restriction enzyme recognition sequence. Also, in that case, it is necessary to design so that the frames of the fusion genes match. For example, a restriction enzyme recognition sequence for ligating the apo E gene before the stop codon, such as Xba I
Using a primer designed to add a recognition sequence, a PCR reaction is performed, and the target gene, for example,
Amplify the MPP full-length gene. This gene fragment is incorporated into an expression vector, and then the human apo E gene is ligated, for example, using this restriction enzyme recognition sequence.

A specific method for obtaining an expression vector containing an MPP-like gene, a promoter, a terminator and a human apoE-like gene is, for example, the production method of Chemical formula 3 and the like.

[0023]

[Chemical 3]

As the promoter, it is preferable to use a promoter of a highly expressing yeast gene. For example, TRPI ,
ADHI , ADHII , acid phosphatase ( PHO3 or PHO
5 ) and promoters of genes such as isocytochrome C; promoters of galactose metabolism such as GAL1 , GAL10 and GAL7 ; promoters of invertase such as SUC2 ; enolase, glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ), phosphoglycerate kinase. ( PGK ), hexokinase, pyruvate carboxylase, phosphofructokinase, glucose-
6-phosphate isomerase, pyruvate kinase,
Examples thereof include promoters of genes encoding glycolytic systems such as triose phosphate isomerase and phosphoglucose isomerase genes, and promoters such as α-factor and yeast mating pheromone gene encoding α-factor.

In a preferred embodiment, a signal sequence useful in yeast cells may be introduced in addition to the MPP signal sequence in order to secrete the fusion protein into the plasmid. The signal sequence is yeast invertase (JP
60-41488) and α-factor gene (JP-A-59)
A signal sequence derived from yeast such as -132892) may be used. Further, a signal sequence synthesized for secretory production in yeast, for example, the signal sequences described in JP-A-1-240191 and JP-A2-167095 can also be used. The plasmid also contains a suitable terminator for polyA conversion of mRNA and termination of transcription, such as PHO5 ,
It is preferable to insert GAPDH, GAL10 terminator and the like at the 3'end side of the fusion gene. In addition to the promoter, fusion gene region, this plasmid may also contain an origin of replication for a bacterial host, eg E. coli, and a genetic selectable marker. The plasmid obtained at this time can obtain a large amount of the hybrid vector by growth and replication in Escherichia coli by using an E. coli replication origin and a selectable marker for Escherichia coli in the yeast hybrid vector. Construction of hybrid vectors can be readily accomplished using all of the cloning techniques based on. E. coli plasmids, such as pBR322, contain the E. coli origin of replication and E. coli genetic markers that confer resistance to antibiotics such as tetracycline and ampicillin and are advantageously used as part of a yeast hybrid vector.

The plasmid preferably contains a promoter, a fusion gene region controlled by the promoter, and a terminator, and the plasmid may optionally contain a signal sequence for secretory production, a selection gene marker for yeast, An E. coli replication origin region and a selection gene marker for E. coli can be contained.

The method for producing a transformant using this recombinant plasmid and the method for producing the target heterologous protein are shown below.

First, the recombinant plasmid is introduced into a host cell. Transformation of yeast can be carried out by known methods, for example, lithium method, electroporation method and spheroplast method [Nature 275, 104-109 (1978); Proceedings of the・ National Academy of Sciences of the United States of America (Proc.Natl.Ac
ad.Sci.) Vol. 75, pp. 1929-1933 (1978)]. Examples of host cells include yeasts such as Saccharomyces, Schizosaccharomyces, Pichia,
Examples thereof include those belonging to the genus Kleberomyces, the genus Hansenula, the genus Yarrowia, and the like, and preferably auxotrophic strains or antibiotic-sensitive strains. Furthermore, specifically, a mutant strain having a mutation that is complemented by a yeast selectable marker gene carried by a plasmid to be inserted, for example, leucine and histidine-requiring mutant strains, which are G418-sensitive strains Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) AH22 strain (MAT a, his
4 , leu2 , can1 ), MC16 strain (MAT α, leu2 , his4 , ade2 ), AB
The 103-1 strain (MAT α, leu2 , his4 , ura3 , pep4-3 ), YPH252 and SHY3 strains are preferably used. Further, when the fusion gene is inserted into the host cell chromosome, any site in the sequence homologous to the host cell chromosome of the plasmid to be inserted is cleaved with a restriction enzyme to introduce a linearized plasmid into the host. Is desirable. The linearized plasmid integrates into a region on the host chromosome that is homologous to the region integrated into the plasmid. The linearized plasmid has a higher frequency of integration on the host chromosome than the circular plasmid.

Next, it is confirmed whether or not the plasmid has been introduced into the expected site and whether or not the introduced fusion gene is stable. Specifically, when the fusion gene is inserted into the chromosome of the host cell, the Southern blotting method introduces the plasmid into the expected site using a sequence homologous to the chromosomal sequence of the host cell used for transformation. Confirm that it has been done. The confirmed strain is a transformant in which a plasmid containing a region encoding a heterologous protein of interest has been integrated into a host cell. This transformant can be used as a host to transform again with a plasmid into which a fusion gene containing the region encoding the target protein has been inserted. In this case, a homologous region other than the region used in the initial transformation can be used as the cell chromosome homologous region. In addition, ribosomal DNA and Ty factor are examples of sequences homologous to the chromosomal sequence of the host cell. Since a plurality of these genes are present per cell, a plurality of target genes can be integrated into the host chromosome by one transformation.

The obtained transformant is cultured in a medium suitable for the host. Examples of the medium include YN in the case of yeast.
B medium [0.7% yeast nitrogen base (Yeast Ni
trogenBase) (Difco), 2% glucose], YPD medium [1% yeast extract (Difco), 2% bactopeptone (Difco), 2% glucose] and YPG medium [2% glucose in YPD] 3% galactose is used] and the like, but those in which the amount of each component of the medium is changed in order to optimize the desired protein production are also used. In addition, amino acids, nucleic acids, antibiotics or 2% agar can be added for use as necessary.

The culture is usually carried out at 15-43 ° C (preferably 30 ° C).
About 20-100 hours, and if necessary,
Aeration and stirring can also be performed. After culturing, the supernatant is recovered by a known method, for example, centrifugation. The target heterologous protein is produced in this supernatant,
It is possible to confirm that the protein is efficiently secreted into the culture supernatant by a known method, for example, a method such as trichloroacetic acid precipitation and ethanol precipitation, followed by concentration and Western blotting.

In the present invention, for example, a preferred specific example is a yeast GAL7 promoter in which a fusion gene in which a human apoE- like gene is linked via a gene is inserted to construct a yeast production plasmid. To be These are, for example, Saccharomyces cerevisiae
It is introduced into MC16 strain and transformed. By culturing these transformants in a culture medium containing galactose for 1 to 3 days, a sufficient amount of the fusion protein can be obtained in the culture supernatant.

Regarding the activity of apolipoprotein E,
Some are known [Science No. 240
Vol. 62-630 (1988)] One of them is that it has an adsorption activity on heparin [The Journal of Biological Chemistry (J. Bi.
ol.Chem.) 261, 2068-2076 (1986)]. The MPP-like-human apoE-like fusion protein obtained by the present invention is
Since it has the binding activity to heparin, it can be confirmed that it retains the activity as apoE. Pseudomilk activity is known as one of the activities as MPP, but [Aggric Cultural Birological Chemistry (Agric.Biol.Chem.) Vol. 31, 540-545 (196)
7 years)] It can be confirmed that the MPP-human apoE-like fusion protein obtained by the present invention has its pseudomilk activity.
This activity can be easily measured using skim milk agar plates [Analytical Biochemistry (Anal.Biochem.) Vol. 146, 353-360 (1985).
Therefore, it can be used as an index when purifying this fusion protein. In addition, this fusion protein can be used as an anti-human apoE antibody and an anti-MPP antibody [agricultural
Biological Chemistry (Agric Biol Chem) 4th
3, 209-215 (1979)], it is confirmed that each protein has antigenicity, that is, immunological activity. As described above, the fusion protein with the MPP-like and human apoE-like proteins obtained by the present invention is a multifunctional protein having each activity. Also, many enzymes that cleave specific amino acid sequences are known [Methods in Enzymology, Vol. 185, pp. 140-142 (1).
990)], for example, an apoE-like protein can be obtained by enzymatically cleaving from a fusion protein prepared so as to contain an amino acid sequence matching the substrate specificity of those enzymes.

Next, the present invention will be specifically described with reference to examples, but the present invention is not limited thereto. Many techniques, reactions and analytical methods used in the present invention are well known to those skilled in the art. Unless otherwise stated, all enzymes are commercially available sources such as Takara Shuzo Co., Ltd .; New England Biolabs (NEB), Amersham (UK) and Bethesda Research. Laboratories (BRL: Bethes
da Research Laboratories, Maryland, USA). Unless otherwise specified, buffers and reaction conditions for the enzyme reaction may be used according to the manufacturer's recommendations for each enzyme. Primers may be synthesized by an automatic phosphamide method using a DNA synthesizer (Milligen, MilliGen).

[0035]

【Example】

Example 1 Isolation of MPP gene (I) Strain, plasmid, medium Mucolpcillus IFO 4578 (+) strain M for cloning
Used as a donor for the PP gene. FDT agar is 0.4
% Potato extract (manufactured by Difco), 2% glucose,
Used as a storage medium, consisting of 2 mg / l thiamine hydrochloride and 1.5% agar (pH 7.0). The YPD medium consists of 0.3% yeast extract (manufactured by Difco), 1% bactopeptone (manufactured by Difco) and 2% glucose (pH 7.0), and is used to obtain cells for DNA preparation. E. coli HB101 strain is 0.2%
Cosmid vector p cultured in L-broth containing maltose
Used for cloning with JB8. pBR322 is M
Used for subcloning the PP gene.

(II) Synthesis of oligonucleotide probe An oligonucleotide probe in which two 14-mers and two 17-mers are mixed is synthesized. As a synthetic probe, polynucleotide kinase was γ- ³² P-ATP (New England Biochemicals).
End label with. The oligonucleotide probe is shown below. 143 147 amino acid Met Glu Ala Glu Tyr mRNA 5'AUG GAA GCN GAA UAU 3'GG probe 14T-1 3'TAC CTT CGN CTT AT 5'CC 208 213 amino acid Tyr Phe Phe Trp Asp Ala mRNA 5'UAU UUU UUU UGG GAU GCN 3 ′ CCCC probe 17T-2 5 ′ TAT TTT TTT TGG GAT GC 3 ′ CCCC 326 330 amino acid Asn Gln Phe Ile Val mRNA 5 ′ AAU CAA UUU AUA GUN 3 ′ CGCUC probe 14T-3 3 ′ TTA CTT AAA TAA CA 5 'GC GTG 315 320 amino acids Thr Cys Met Phe Ile Val mRNA 5'ACN UGU AUG UUU AUA GUN 3'CCUC probe 17T-4 3' TGN ACA TAC AAG TAA CA 5'GG

(III) Preparation of Rhizomucor pusillus DNA From slope culture on PDT agar medium to Rhizomucor pusillus IFO
Spores of the 4578 (+) strain are ingested in 1 L of YPD medium, and cultured by shaking at 30 ° C for 3 hours. Wet mycelium (about 100 g) is frozen in liquid nitrogen and ground with a homogenizer. 0.5 cells obtained
0.5M ethylenediaminetetraacetic acid (EDT) containing 100% sodium dodecyl sulfate (SDS) and 100 mg / l proteinase K
A) Extract with 600 ml of (pH8.0) solution at 50 ° C for 30 minutes. After removing cell debris, the extract is treated with phenol and the nucleic acid is precipitated with ethanol. DNA is purified from the obtained precipitate by a cesium chloride equilibrium concentration centrifugal gradient centrifugation method.

(IV) Construction of Rhizomucolupsillus gene library Purification Rhizomucorpusillus DNA was partially cleaved with Sau3AI to give a 25 kb fragment.
Collect the above DNA fragments by agarose gel electrophoresis and
JB8 DNA is ligated with an arm and packaged in phage particles using an in vitro packaging kit (Amersham). Escherichia coli HB101 strain is infected with the phage to obtain about 20,000 ampicillin-resistant transformants.

(V) Cloning of MPP Gene A gene library of Escherichia coli mucorpils is screened by colony hybridization using a synthetic probe [Nucleic Acids Res., Vol. 9, 2989-2998]. page
(1981)]. Hybridization temperature is 17-mer
43 ° C for probe and 28 ° C for 14-mer probe. The plasmid DNA can be obtained by the method of Godson et al. [Biochim.Biophyka.
s. Acta.) 299, 516-520 (1973)]. Transformation of E. coli with the recombinant plasmid
The method of Norgard et al. [Gene 3rd
Vol. 279-292 (1978)]. Unless otherwise specified, various restriction enzymes and other enzymes are purchased from Takara Shuzo Co., Ltd.

(VI) Southern Blot Analysis Transfer of DNA fragments from agarose gel to nitrocellulose paper is carried out by the Southern method [Journal of Molecular Biology, Vol. 98, 503-]. 517 pages
(1975)]. Hybridization conditions and labeling of DNA hybridization probes by nick translation are
y) et al. [Journal of Molecular Biology (J. Mol. Biol.) Vol. 113, pp. 237-251 (1977).
Year)].

(VII) DNA Sequencing A specific restriction enzyme fragment of cloned DNA was ligated to M13 vector mp10 or mp11, and chain terminating dideoxy method [Proceedings of the.
National Academy of Sciences of the United States of America (Pro
c.Natl.Acad.Sci.) Vol.74, No.5463-5467 (1977)]
The sequence is determined by.

(VIII) Cloning of MPP gene MPP was prepared from a cosmid library of the mucorpils gene in E. coli using a labeled synthetic probe.
Screen genes. Several out of about 10,000 colonies produce positive hybridization with the probes (14T-1 and 14T-3). Among them, those that have hybridized with other probes (14T-3, 17T-2, 17T-4) are selected. About 4.5 kb Hin dIII in pJB8
The fragment-bearing plasmid is recovered from the selected strain and pCT11 is constructed. DNA fragments of 4.5kb obtained by processing the probe and pCT11 with Hin dIII was confirmed that hybridizing. The Hin dIII fragment obtained is subcloned into pBR322 to construct a recombinant plasmid pCT113, and the restriction enzyme pattern is determined. Hin dI of total mucorp sils DNA
When the II fragment was labeled with ³² P and the 4.5 kb fragment was subjected to Southern blot DNA-DNA hybridization, a single band with the same molecular weight was shown.

(IX) DN of cloned MPP gene
To identify cloned DNA region hybridized with A sequencing probes, the results of decomposing the 4.5kb- Hin dIII fragment of pCT113 with various restriction enzymes were tested using a labeled probe (17T-2), The 1.7 kb Hae III fragment was found to hybridize with the probe. The fragment and flanking region were also sequenced and found to have a single open reading frame of 1281 bp with no intron encoding a 427 amino acid polypeptide.

Example 2 Isolation of Human ApoE Gene Synthetic primers are prepared using a DNA synthesizer. The primer AEH is apoE downstream of the Hin dIII linker.
A homologous sequence is added to the N-terminus that encodes the protein. Primer AEE adds a sequence complementary to the C-terminus encoding human apoE protein downstream of the Eco RI recognition sequence. Next, the primer AEE is added to mRNA (manufactured by Toyobo) extracted from human liver to make the total amount 51.5 μl. After reacting at 65 ° C for 10 minutes, quench in ice and add 20 μl RT buffer (250
mMTris-HCl pH 8.3, 40 mM MgCl ₂ , 250 mM KCl), 20 μl of 5
mM dNTP, 1 μl 1M dithiothreitol, 1.5 μl RNase
An inhibitor (Pharmacia) and 6 μl of reverse transcriptase (Seikagaku Corporation) are sequentially added, and the mixture is reacted at 50 ° C. for 2 hours. After the reaction, the DNA prepared by ethanol precipitation was used as a template for P
Carry out CR reaction. The PCR reaction was performed using 2.5 units of Taq polymerase (Takara Shuzo) and 10 μl of buffer solution (500 mM KCl, 10 mM).
0mM Tris-HClpH8.3,0.01% gelatin, 15mM MgCl _2), 10
Add dNTPs to 0 pmol of primer AEE and 100 pmol of primer AEH to a final concentration of 200 μM, and add 100 μl of the prepared template DNA to 100 μl and overlay with mineral oil.
The reaction cycle of ℃, 1 minute; 45 ℃, 2 minutes; 72 ℃, 5 minutes is repeated 25 times. After the reaction, after removing the mineral oil,
After phenol and ether treatment, ammonium acetate was added, ethanol precipitation was performed, and treatment with Hind III- Eco RI was performed, followed by ligation to similarly treated pUC19 to obtain plasmid pTHAE5.

Example 3 Preparation of Expression Vector Plasmid JGH5 was treated with Hin dIII, blunt-ended with Klenow fragment, and Sal I linker was introduced to obtain DNA fragment JGH5S. In addition, the plasmid pTHAE5 in which the apoE gene was cloned was treated with Eco RI, and then Kleno
Treatment with the w fragment and introduction of the Bam HI linker yields the plasmid pTHAB5. Next, the following primers are synthesized using a DNA synthesizer. Perform a PCR reaction using the following conditions Plasmid JGH5 using primers GAL7-5 and GAL7-3 as template, Sa
GAL 7 promoter DNA having a l I and Hin dIII linker
Get fragments. Specifically, 2 μg of plasmid JGH5 and about 100 pmol of each primer were buffered with 100 mM Tris-HCl buffer (pH 8.3), 500 mM KCl, 15 mM MgCl ₂ , 0.01% (w / v) gelatin (autoclaved)]. It is added so as to be diluted twice, heated at 94 ° C. for 8 minutes, and then cooled in ice for 5 minutes. Add 5 units of Taq polymerase and 200 μM of dNTP to the reaction mixture.
And layer with mineral oil. The reaction solution
After reacting at 94 ° C for 1.5 minutes, 94 ° C for 1 minute, 40 ° C for 1 minute and 72 ° C for 1.5 minutes are repeated 10 times, and then reacted at 72 ° C for 1 minute. Further, the reaction solution is treated with phenol and chloroform and then ethanol precipitated to obtain a DNA product. The obtained DNA product was digested with Hin dIII and Sal I, and the above-mentioned JGH5S was treated with Sal I and Bam HI.
Connecting the apo EcDNA fragment of about 1kb derived from the DNA fragment and pTHAB5 was treated with Hin dIII and Bam HI, the plasmid pH
Get AE1. After digesting the resulting plasmid with Eco RI, Klen
Blunt with ow fragment and introduce Sal I linker.
Furthermore, This plasmid was digested with Sal I, Sal from YEp13
Digestion with I and Xho I and ligation of the LEU2 DNA fragments obtained gives the plasmid pHAN1. Furthermore, the following primers are synthesized using a DNA synthesizer. Primer MPP5 5'-CGC AAGCTT CATGCTCTTCTCCAAGATC Hin dIII primer MPP3 5'-G GGATCC TTAG TCTAGA CTGTTGTTCTCGTATCCGG Bam HI Xba I primer MPP03 5'-CGG TCTAGA GCGAACGCCTTGATACCG Xba I primer XBHAP5 5'-CCC TCTAGA CAAGGTGGAGCAAGCGGTG Xba I primer HAP3 5'-GCGCAGCTC GGGCTC CGGCTCTGT Ava I pTHAB5 as a template, using primers XBHAP5 and HAP3, PCR reaction was performed in the same manner, after digesting the obtained DNA fragment with Xba I and Ava I, recovered from agarose gel, pTHAB5 to Ava with resulting DNA fragment of about 0.8kb was digested with I and Bam HI and ligated into pUC19 digested with Xba I and Bam HI, to obtain plasmid PTHAX5. Furthermore, p
CT113 as a template, using primers MPP5 and MPP03, subjected to PCR reaction in the same manner, the resulting DNA fragment was digested with Hin dIII and Xba I, recovered from the agarose gel, Hin plasmid PHAN1 dIII and Bam A fragment of about 7 kb obtained by digestion with HI and a plasmid of pTHAX5 which was digested with Xba I and Bam HI were ligated with a fragment of about 1 kb to obtain plasmid pHAN2. Also, using pCT113 as a template and using primers MPP5 and MPP3, respectively, PC
R reaction was performed and the obtained DNA fragment was used for Hin dIII and Ba
Digested with m HI, recovered from agarose gel, and plasmid p
Ligated with fragment obtained approximately 7kb by digesting HAN1 with Hin dIII and Bam HI, to obtain plasmid PSMRN. The resulting plasmid was digested with Xba I and Bam HI and the plasmid pTHAX5
The fragment of about 1 kb obtained by digestion with Xba I and BamH I was ligated to obtain the plasmid pHMAN. Plasmid pHAE1
Digestion with Hin dIII and Bam HI yields a fragment of approximately 8 kb. Plasmid pHMAN was added to the obtained DNA fragment using Hin dIII and Bam HI.
Digested with, ligate the resulting 2 kb fragment and
Get the MAE.

Example 4 Preparation of Expression Vector The following primers are synthesized using a DNA synthesizer. Primer GAL7-2; 5'-CGC AAGCTT CTTTTGAGGGAATATTCAAC Hin dIII This primer complements the 3'side region of the GAL7 promoter and is used together with the primer GAL7-5 in a plasmid.
pFY1016 [Nucleic Acids Research (Nuc
leic Acids Research) Volume 11, pp. 8555-8568 (1983
Year)] to obtain the GAL7 promoter DNA fragment with Sal I and Hin dIII linker performed in the same manner as in PCR reaction as in Example 4 as a template. After digesting this fragment with Sal I and Hin dIII, the approximately 0.8 kb GAL10 terminator DNA fragment obtained by treating plasmid pFY1016 with Bam HI and Eco RV and plasmid YEp13 were digested with Xho I and Stu I and agarose. the DNA fragment of about 9kb recovered from the gel and plasmid pHAB was digested with Hin dIII and Bam HI, and ligated to MPP and human apo EDNA fragment of about 2.2kb was recovered from the agarose gel to obtain plasmid PMAB.

Example 5 Preparation of Expression Vector In the same manner as in Example 4, MPP expression vector JP1- in which the amino acid of MPP was converted to lack protease activity.
Using 38G as a template, the plasmid pHMAE-38G is obtained.

Example 6 Preparation of Transformant and Its Culture Yeast AH22 strain (ATCC 38626) was added to 100 ml of YPD medium (2
% Bactopeptone, 1% yeast extract, 2%
Glucose) and incubate at 30 ° C with shaking. When the bacterial concentration reached OD ₆₀₀ = 5, centrifuge at 1000 xg for 10 minutes,
Collect bacteria. Suspend in sterile water, centrifuge at 1000 xg for 10 minutes,
After collecting the bacteria, solution A (50 mM dithiothreitol, 25 mM EDT
A, 1.2M sorbitol) is added and suspended, and then the mixture is incubated at 30 ° C for 10 minutes. Then, after washing with 1.2M sorbitol solution, suspend in solution B (0.2mg / ml Zymoly Ace 100T (manufactured by Seikagaku Corporation), 10mM EDTA, 0.1M citrate buffer, 1.2M sorbitol) and at 20 ℃ for 20 minutes. Keep warm. Then C
After washing with liquid (10 mM CaCl ₂ , 1.2 M sorbitol),
Suspend with 2 ml of solution C. Plasmids pHAN1, pHAN2 and pH
MAN digested 10 μg of each with Eco RI to obtain plasmid pHMAE,
For pHMAE38G and pMAB, 10 μg of each was suspended in 10 μl of TE buffer (10 mM Tris-HCl pH7.5, 1 mM EDTA), added to 100 μl of the adjusted bacterial solution, and incubated at 30 ° C. for 30 minutes, and then D 1.2 ml of a solution [20% polyethylene glycol 4000 (manufactured by Sigma), 10 mM CaCl ₂ , 10 mM Tris-HCl pH 7.5] is added, and the mixture is kept at 30 ° C. for 1 hour. After that, the collected bacterial solution is E
Suspend in 0.5 ml of solution (YPD, 10 mM CaCl ₂ , 1.2 M sorbitol) and incubate at 30 ° C for 1 hour. After collecting the bacteria, 0.2 ml of C liquid
Resuspend. Next, it is overlaid on a selective medium (0.7% yeast nitrogen base, 2% glucose, 30 mg / l histidine, 2% agar). Yeast MC16 and AB103-1
In the case of, the same procedure is performed by further adding 30 mg / l adenine sulfate and 30 mg / l uracil to the selective medium.

Example 7 Production of MPP-ApoE Fusion Protein by Yeast The obtained transformant was first subjected to YPDA medium (2% bactopeptone, 1% yeast extract, 2% glucose, 0.1% adenine sulfate). After culturing for 18 hours, the same amount of YPGA medium (2% bactopeptone, 1% yeast extract, 3% galactose, 0.1% adenine sulfate) is used for culturing at 30 ° C. for 18 hours. Then, 5 times the amount of 10% trichloroacetic acid is added to the culture supernatant, left for 30 minutes under ice cooling, and then centrifuged at 15000 rpm for 10 minutes. The obtained precipitate was suspended in 50 mM Tris-HCl (pH 8.0) buffer and subjected to polyacrylamide gel electrophoresis to obtain anti-human apo E antibody (Chemicon), anti-MPP antibody and peroxidase-labeled secondary antibody (Chemicon). Western blotting method is performed using As a result, the plasmid pHMA
N, pHMAE, pMAB and pHHAE38G, that is, a molecular weight of about a molecular weight that reacts with anti-apoE or anti-MPP antibody only when a fusion gene with the full length sequence of lysomucolpepsin is expressed
76KDa (Rhizomucor pepsin 42KDa + human apo E34KD
The target fusion protein which is a) could be detected.

Example 8 Using the transformant obtained in the same manner as in Example 6, 100 ml was used.
18 in YPDA medium (2% bactopeptone, 1% yeast extract, 2% glucose, 0.1% adenine sulfate)
After culturing for an hour, the cells are again cultivated at 30 ° C. in the following medium containing 100 ml of galactose. The culture time is 18 for each medium.
-72 hours (Table 2). After adding 2.5 volumes of ethanol to the obtained culture supernatant and leaving it for 30 minutes under ice cooling, 15,000 r
Centrifuge at pm for 10 minutes. The obtained precipitate is suspended in 50 mM Tris-HCl (pH8.0) buffer, subjected to polyacrylamide gel electrophoresis, and examined by Western blotting. The same antibody as that used in Example 7 is used at that time. It is calculated by using a sheet colored by Western blotting, using human Apo E (manufactured by Chemicon) as a standard, and measuring the color developed by a TOYO densitometer. The following three types of media are used. Medium 1; YPGA medium Medium 2; Medium prepared by adding 50 mM MOPS to YPGA medium to pH 7 Medium 3; Medium of YPGA medium prepared with 6% bactopeptone and 3% yeast extract Medium 1-3 The maximum secretory production amount is measured by a densitometer using Western blotting method using Apo E as a standard, and the results in Table 1 are obtained.

[Table 1] ──────────────────────────────────── Plasmid / host secreted production amount Medium used Culture time (Mg human apo E / L) (time) ──────────────────────────────────── pHMAE / MC16 15.7 3 72 pHMAE38G / MC16 15.2 3 72 pHMAE / AH22 12.2 3 72 pHMAE / AB103-1 1.6 1 72 pHMAN / MC16 11.3 1 18 pHMAN / MC16 16.4 2 60 pHMAN / MC16 23.7 3 72 ─────────── ──────────────────────────

The culture supernatant obtained in Example 8 using pHMAE / AH22 was diluted 10 times with 50 mM Tris-HCl buffer (pH 8.0) and equilibrated with DEAE-TOYOPEARL 650M ( Adsorb on a column (4 cm x 15 cm) manufactured by Tosoh Corporation. 500 ml
After washing with the same buffer solution of 1., elution is performed with the same buffer solution containing 0.2 M sodium chloride. For the fractions after elution, the activity was measured using a skim milk plate, and each active fraction was subjected to SDS-PAGE and then subjected to CBB solution (0.25% Coomassie.
Stain with brilliant blue, 50% methanol, 10% acetic acid) and collect the major fraction of the desired protein with a molecular weight of about 76 KDa. For the skim milk plate, mix A liquid (1 g of skim milk (manufactured by Difco) in 25 ml of water) and 10 ml of liquid B (1M sodium acetate pH5.5), and mix liquid C (1 g agarose ME (manufactured by Iwai Chemical) / 65 ml Each is maintained at 55 ° C with water) and then mixed to prepare a plate. This fraction is diluted 5 times and adsorbed at 4 ° C. on a heparin sepharose column [HiTrap-Heparin (5 ml) Pharmacia] equilibrated with 50 mM Tris-hydrochloric acid buffer (pH 8.0). After adsorption, washing with the same buffer solution and elution with the same buffer solution containing 2M KCl gave a fraction having an absorption of 280 nm in about 3-6 ml. When this was subjected to SDS-PAGE and subjected to Western blotting, it was confirmed that the obtained protein was MPP and human apoE fusion protein having a molecular weight of about 76 KDa which reacts with anti-MPP and anti-human apoE antibodies.

[0052]

EFFECTS OF THE INVENTION Rhizomucor pepsin-like protein obtained from yeast transformed with a plasmid into which a fusion gene in which the lysomucolpepsin-like gene of the present invention and a human apolipoprotein E-like gene are ligated is inserted, and The human apolipoprotein E-like fusion protein is useful as a research reagent, a drug, and a synthetic intermediate for the apolipoprotein E-like protein, and the production method thereof provides an efficient method for mass-producing the human apolipoprotein E-like protein. To do.

Continuation of the front page (51) Int.Cl. ⁶ Identification number Reference number within the agency FI Technical indication C12P 21/02 C 9282-4B // A61K 38/46 (C12N 15/09 ZNA C12R 1: 645) (C12N 1 / 19 C12R 1: 645) (C12N 9/64 C12R 1: 645) (C12P 21/02 C12R 1: 645) (C12N 15/00 ZNA A C12R 1: 645)

Claims (4)

[Claims] 1. A fusion gene in which a lysomucol pepsin-like gene and a human apolipoprotein E-like gene are linked. 2. A plasmid in which a fusion gene in which a lysomucolpepsin-like gene and a human apolipoprotein E-like gene are linked is inserted. 3. A yeast transformed with a plasmid into which a fusion gene in which a lysomucolpepsin-like gene and a human apolipoprotein E-like gene are linked is inserted. 4. A Rhizomucor pepsin-like protein, which expresses yeast transformed with a plasmid into which a fusion gene in which a Rhizomucor pepsin-like gene and a human apolipoprotein E-like gene are linked is inserted. -A method for producing a human apolipoprotein E-like fusion protein.