JPH07143887A - Acetyl coa carboxylase gene of plant - Google Patents

Abstract

PURPOSE:To provide a new gene fragment useful for the breeding of a desired plant from the viewpoint of the fat synthesis and the protein synthesis of the plant. CONSTITUTION:The gene fragment coding a part of acetyl CoA carboxylase is produced by the polymerase chain reaction using a genom DNA or cDNA of a plant as a template and using one kind of oligomers of formula I to formula IV and one kind of oligomers of formula VII to formula X as primers. Preferably, the genom DNA or cDNA of Arabidopsis thaliana is used as the template.

Description

Detailed Description of the Invention

[0001]

The present invention relates to plant acetyl-CoA.
More particularly, it relates to a DNA fragment encoding acetyl CoA carboxylase, which is one of the factors controlling the biosynthesis of plant storage substances.

[0002]

2. Description of the Related Art Acetyl CoA carboxylase (hereinafter referred to as "ACCase") is considered to be a rate-limiting enzyme for fat synthesis, and its existence has been confirmed in various organisms. This enzyme has C at the acetyl group of acetyl CoA.
The O ₂ by bonding, catalyzes the synthesis of malonyl CoA. In Escherichia coli, ACCase is constituted as an assembly of four independent polypeptides, and each polypeptide has a different activity of biotin carboxylase, biotin carboxyl carrier protein, or transcarboxylase (SJ Li &
JE Cronan Jr., J. Biol. Chem., 267, 16841-16847
(1992)).

On the other hand, ACCas of animals, yeasts and plants
In e, it is known that one large polypeptide having a molecular weight of 220,000 to 240,000 contains three active domains (Corn Stamp Biochemistry, 5th Edition, Tokyo Kagaku Dojin (1988), MA Egli et al., Plant Physio
l., 101, 499-506 (1993)).

The plant ACCase has a molecular weight of 220,000-2.
Is a dimer of 40,000 large multifunctional polypeptides,
It is said to be present in the plastid. However, it was extremely difficult to purify the enzyme protein of ACCase and analyze its structure and biochemical properties because of its unique properties. So far, the purification of the enzyme protein has been reported only in a few cases such as rape, soybean and corn (AR Slabas & A. Hellyer, Plant
Sci., 39, 177-182 (1985), DJ Charles & J. H. Cher
ry, Phytochemistry, 25, 1067-1071 (1986), MA Egl
i et al., Plant Physiol., 101, 499-506 (1993)).

Therefore, plant ACC based on protein information
Research on the gene for ase has not advanced much. Recently, it has been reported that the isolation of the ACCase gene is proceeding in carrot and soybean (BJ Nikolau & E.
A. Wurtele, In US ー JAPAN BINATIONAL SEMINAR-BIOCHE
MICAL AND MOLECULAR BIOLOGICAL ASPECTS OF MEMBRANE
AND STORAGE LIPIDS OF PLANTS (1992)). However, its analysis and characterization have not yet been made.

On the other hand, in animals and microorganisms, biochemical and genetic studies on ACCase have been relatively advanced. By analysis based on these findings, ACCas
The entire nucleotide sequence encoding e has been revealed in "rat", "chicken", "yeast" and "Escherichia coli" (F. Lopez-Casillas et al., Proc. Natl. Acad. Sci.
USA, 85, 5784-5788 (1988), T. Takai et al, J. Bio
l. Chem., 263, 2651-2657 (1988), W. Al-Feel et al.,
Proc. Natl. Acad. Sci. USA, 89, 4534-4538 (1992),
H. Kondo et al., Proc. Natl. Acad. Sci. USA, 88, 9
730-9733 (1991), SJ Li & JE Cronan Jr., J. Bio
l. Chem., 267, 855-863 (1992), S. Muramatsu & T. Mi
zuno, Nucleic Acids Res., 17, 3982 (1989), SJ Li
& JE Cronan Jr., J. Biol. Chem., 267, 16841-16
847 (1992)).

[0007]

Acetyl-CoA is the starting point of fat synthesis, is converted into malonyl-CoA by the catalytic reaction of ACCase, and this malonyl-CoA serves as a substrate for fatty acid biosynthesis by fatty acid synthase. . Further, the fatty acid becomes a constituent of triacylglycerol, which is a storage fat, through some enzymatic reactions.

[0008] Acetyl CoA also produces citric acid by condensation with oxaloacetic acid. This citric acid returns to oxaloacetate in a series of enzymatic reactions called the TCA cycle. The metabolites that entered the TCA cycle are
Eventually, it is consumed as energy or linked to the amino acid synthesis system, and further becomes a protein. That is, acetyl CoA exists at a branch point between fat synthesis and protein synthesis.

Therefore, when the activity of ACCase is relatively strong, it is expected that the amount of citric acid produced will be relatively reduced, protein synthesis will be suppressed, and fat synthesis will be promoted.

A negative correlation between the fat content stored in seeds and the protein content has been reported in soybean (T. Sugimoto et al., Agri. B).
iol. Chem. 53,885-887 (198
9)). Therefore, it is of interest to artificially manipulate the ACCase activity of plants to change the ratio of fat synthesis and protein synthesis (distribution ratio).

In the oilseed rape, soybean, sesame, cotton, corn, sunflower, peanut, safflower and other plants used as oil crops, the increase in the fat content is an important breeding issue. On the contrary, in the case of soybean, increasing the protein content is also an important breeding task. However, in the conventional breeding method, it takes a long time and much labor to improve such a trait. Therefore, improvement of traits by a molecular breeding method using genetic manipulation has been awaited.

[0012] Although increasing the production of food is an urgent global need, expanding the cultivated land area leads to destruction of nature and is not preferable. In order to increase the production of food under such conditions, a method of increasing the concentration of specific components in plants can be considered.

The present invention has been made from this point of view, and it is an object of the present invention to solve the above-mentioned demand by utilizing a genetic engineering technique. In particular, an object is to cultivate a desired plant from the viewpoint of increasing the production of fat and protein, and it is an object to clone a gene involved in the synthesis of fat and protein.

[0014]

Means for Solving the Problems As a result of intensive studies to solve the above problems, the present inventors have found that the carbohydrates produced by photosynthesis are branch points when they are converted into proteins or fats as storage substances. Of Arabidopsis thaliana from Arabidopsis thaliana was attempted to isolate the gene for ACCase
The inventors succeeded in isolating the gene, and also succeeded in cloning the ACCase gene of oilseed rape, which is an oil crop, resulting in the present invention.

That is, the present invention is a DNA fragment amplified by the polymerase chain reaction using plant genomic DNA or cDNA as a template, and is selected from the oligonucleotides shown in SEQ ID NOS: 1 to 6 in the polymerase chain reaction. A gene fragment encoding a part of acetyl-CoA carboxylase, which is obtained by using, as a primer, one kind and one kind selected from the oligonucleotides shown in SEQ ID NOS: 11 to 14 of the sequence listing, and this gene A gene encoding the entire amino acid sequence of acetyl-CoA carboxylase selected from a plant gene library by hybridization using the fragment as a probe.

The present invention also provides a DNA fragment encoding acetyl-CoA carboxylase having the amino acid sequence shown in SEQ ID NO: 22 of the sequence listing, and SEQ ID NO: 21 of the sequence listing.
In, a DNA fragment having a sequence represented by nucleotide numbers 408 to 7169 is provided.

Further, the present invention provides acetyl Co by introducing the gene fragment, the gene or the DNA fragment.
Provided is a transformed plant body in which the expression level of A carboxylase is changed.

The present invention will be described in detail below.

<1> DNA Fragment Encoding Part of Plant ACCase As a means for obtaining a specific DNA sequence, a polymerase chain reaction, a so-called polymerase chain reaction method is known. This method comprises heat denaturing double-stranded DNA into single-stranded DNA, annealing two kinds of oligonucleotide primers corresponding to sequences at both ends of the region existing inside the DNA, and the heat-denatured DNA, This is a method of exponentially amplifying the above region by repeating an amplification cycle consisting of a polymerase reaction using an oligonucleotide as a primer.

Thus, in order to amplify a DNA sequence by the polymerase chain reaction, it is necessary to know the sequence at least partially. By the way, the structure of the plant ACCase gene has not been reported so far, but it was presumed that it contains a portion showing some similarity to the ACCase gene of animals and microorganisms. Therefore, when the amino acid sequences encoded by the ACCase genes of "rat", "chicken", "yeast" and "Escherichia coli", which have been already reported, were compared, a region in which similarity was recognized between them was found. The regions at these locations were designated as “α”, “β” and “γ”. A comparison of the DNA sequences of each region of these four types of ACCase genes is shown in FIG. The numbers at the beginning of the amino acid sequence are the ACC of each organism.
It is the number of the amino acid counted from the starting methionine in ase.

An oligonucleotide expected from the partial amino acid sequence in each of these regions was synthesized and used as a primer for polymerase chain reaction to obtain ACCase.
An attempt was made to isolate the gene. The primer is "α"
6 regions (α1 to α6: SEQ ID NO: 1 to
6 shows the sequence), and 4 types (β1 from the region sequence of “β”)
.About..beta.4: SEQ ID NOS: 7 to 10), and four types (.gamma.1 to .gamma.4: SEQ ID NOS: 11 to 14) were prepared from the ".gamma." Region. In order to obtain the ACCase of the present invention, the primer is not limited to the above, and it is preferable to use an oligonucleotide having a sequence corresponding to a region well conserved in ACCase, that is, a region having high similarity in various organisms. it can.

As shown in the Examples below, the nucleotide sequence of the DNA fragment obtained by the polymerase chain reaction in which the α3 and γ4 primers were combined was determined to determine the known ACCa.
By performing comparative analysis with the se gene, 927
It was revealed that the amplified fragment of bp is a part of the Arabidopsis ACCase gene. The sequence of this DNA fragment is shown in SEQ ID NO: 15.

<2> ACCase gene Since the DNA fragment obtained as described above is limited to the region corresponding to the primer, the obtained fragment is ACC.
It is a DNA encoding a part of ase. Therefore,
When it is desired to obtain a longer DNA fragment, it can be obtained from a genomic library or a cDNA library by carrying out hybridization using this as a probe. Further, since ACCase has a large molecular weight, when a single clone cannot cover the entire ACCase gene, by repeating chromosomal walking,
It can be obtained as a plurality of DNA fragments that cover the entire region encoding the enzyme.

The nucleotide sequence of the cloned DNA fragment is determined by the Maxam-Gilbert method or the dideoxy method. The nucleotide sequence can be determined by the dideoxy method using a commercially available kit, and an autosequencer for automatically performing the sequence determination may be used.

As shown in Examples below, three types of DNA fragments covering the Arabidopsis ACCase were obtained. Each of these was cloned into a lambda phage vector and then converted into a plasmid vector. Escherichia coli harboring each plasmid DNA was transferred to FERM P-13792, FE at the Institute of Biotechnology, Institute of Industrial Science and Technology.
Deposited as RM P-13793 and FERM P-13794.

Further, the thus obtained DNA encoding a part of the Arabidopsis ACCase gene.
DNA of other plants by hybridization using fragments or the whole ACCase gene as a probe
AC of other plants by searching the library
It becomes possible to isolate a cDNA fragment or a genomic DNA fragment containing a base sequence encoding Case. Examples of other plants include oil crops such as rape, soybean, sesame, cotton, corn, sunflower, peanut, and safflower.

As shown in Examples below, three kinds of clones containing the Arabidopsis ACCase gene were obtained using a DNA fragment encoding a part of the Arabidopsis ACCase gene as a probe. Furthermore, we succeeded in isolating a genomic clone containing the rapeseed ACCase gene using one of them as a probe. These clones
It was expected to contain a sequence encoding an ACCase enzyme protein and a promoter sequence involved in the regulation of expression of this gene in plant cells.

<3> cDNA encoding ACCase
Fragment A cDNA fragment encoding ACCase is amplified by the polymerase chain reaction method using the mRNA fraction as a template in the same manner as described above, or by hybridization using the ACCase gene or its fragment obtained above as a probe. cDNA
Obtained by selecting from the library.

For the cDNA library, mRNA is extracted from the foliage of plants such as Arabidopsis thaliana and the like, cDNA is synthesized using reverse transcriptase, and 2
It can be prepared by inserting the stranded chain into a vector and transforming into Escherichia coli or the like. Since cDNA cloning kits are commercially available, these may be used.

From the obtained cDNA library, a transformant carrying a vector having a cDNA fragment encoding ACCase is obtained by carrying out hybridization using the ACCase gene or its fragment obtained above as a probe. If the vector is recovered from this transformant, a cDNA fragment encoding ACCase can be obtained. In addition, library DNA was prepared from a cDNA library, and A was prepared by the polymerase chain reaction method using this as a template.
A cDNA fragment encoding CCase may be amplified.

The vector used for preparing the library is
Many types are commercially available and these can be used. The methods necessary for general gene recombination such as DNA cleavage, ligation, transformation, gene nucleotide sequence determination, and hybridization are described in the instructions attached to commercially available enzymes used for each operation, and Molecular cloning. (Maniatis T.
et al . Cold Spring Harbor Laboratory Press).

In this way, A obtained in Examples described later was obtained.
The nucleotide sequence and amino acid sequence of the cDNA fragment encoding CCase are shown in SEQ ID NO: 21 and only the amino acid sequence is shown in SEQ ID NO: 22 in the sequence listing.

<4> Transformed Plant Introduced with ACCase Gene A sense / ACCase gene or anti-body produced by processing the isolated ACCase gene (hereinafter, in this section, a cDNA fragment encoding ACCase may be used). By introducing the sense / ACCase gene into a plant, the expression of ACCase in the plant can be increased or suppressed.

The sense / ACCase gene is ACCa.
The se gene is linked to a plant-expressible promoter such as a promoter derived from cauliflower mosaic virus,
It can be expressed by introducing it into plant cells.

The antisense ACCase gene can be expressed by binding all or part of the ACCase gene to a promoter in the reverse direction and transforming a plant cell with this.

In the present specification, the term "ACCase gene" may refer to not only a structural gene encoding ACCase but also a sense / ACCase gene or an antisense / ACCase gene.

In order to transform a plant with the above gene, a plant cell protoplast is prepared by inserting the above gene into a plasmid by electroporation (electroporation) or a method using a Ti plasmid of Agrobacterium. Can be done by introducing

Examples of such plants include rape, soybean, sesame, cotton, corn, sunflower, peanut, safflower and many other plants utilized for fat production. In addition, Isochrysis and Pavlov, which have excellent fat-producing ability,
a), Cryptomonas, Crycosphaera, and Chaetoceros. Particularly, Arabidopsis plants belonging to Arabidopsis thaliana and oilseed rape contain useful crops with high ability to produce high-quality fats and are widely produced. ACCase of the present invention
A very high economic effect can be expected by increasing the fat component by a molecular breeding method using a gene.

Further, ACCas obtained by the present invention
Part of the e gene is specifically mutated to produce ACCa.
It can be used for artificial modification of se. It can be used in studies seeking to improve the function of ACCase. At the same time, it can be used for a wide range of studies on functional expression of enzyme proteins.

In the above operation, DNA cleavage, ligation,
For methods required for general gene recombination such as transformation, determination of gene nucleotide sequence, hybridization, etc., refer to the instructions attached to commercially available enzymes used for each operation or Mole.
cular cloning (Maniatis T. et al. Cold Spring Harbo
r Laboratory Press), or Current Protocols in M
olecular Biology (edited by FM Ausubel et al., John Wiley & S
ons, Inc., 1987).

The Arabidopsis thaliana transformed with the sense / ACCase gene and the antisense / ACCase gene as described above is a plant bio-research laboratory of Mitsui Industrial Co., Ltd. It has been cultivated in storage at 10), and the present applicant declares that it can be useful for confirmation of the present invention.

[0042]

EXAMPLES The present invention will be described in detail below based on examples. Curren unless otherwise stated
t Protocols in Molecular
Biology (edited by FM Ausubel et al., Jo
hn Wiley & Sons, Inc. , 198
The method described in 7) was followed.

[0043]

Example 1 Isolation of Arabidopsis thaliana ACCase gene and its expression (1) Amplification of Arabidopsis thaliana ACCase gene fragment by polymerase chain reaction ACCase of each of “rat”, “chicken”, “yeast” and “Escherichia coli” already reported. The amino acid sequences encoded by the genes are compared with each other, and among the amino acid sequences showing common similarity among them, ACCase
Three regions within the biotin carboxylase domain of Escherichia coli were selected and named "α", "β" and "γ", respectively (Fig. 1).

Next, six types of oligonucleotide primers α1 to α6 (SEQ ID NOS: 1 to 6 in the sequence listing) based on the amino acid sequence of “α” and four types of oligonucleotide primers based on the amino acid sequence of “β” were used. Four kinds of oligonucleotide primers γ1 to γ4 (SEQ ID NOS: 11 to 14 in the sequence listing) were prepared from the primers β1 to β4 (SEQ ID NOS: 7 to 10 in the sequence listing) based on the amino acid sequence of “γ”.

Twenty-four polymerase chain reactions combining these α1 to α6 oligonucleotide primers and γ1 to γ4 oligonucleotide primers, and β1 to β4 oligonucleotide primers and γ
Sixteen different polymerase chain reactions using 1 to γ4 oligonucleotide primers were performed using total Arabidopsis DNA as a template.

The conditions of the amplification reaction are as follows. 40 ng total Arabidopsis DNA, 40 pmol each of two oligonucleotide primers, 50 mM KC
l, 1.5 mM MgCl ₂ , 0.001% gelatin, 100 μM dNTP,
0.4 units of DNA polymerase (Perkin-Elmer Cetus
10 mM Tris-HCl containing AmpliTaq DNA polymerase)
(PH 8.3) 40 μl was overlaid with 15 μl of mineral oil, and a commercially available device (perkin-Elmer Cetus thermal cyc
ler) was used to carry out the amplification reaction.

After heating at 90 ° C. for 10 minutes to denature the DNA, the DNA was denatured (94 ° C. for 1 minute) and annealed (5
The cycle consisting of 5 ° C. for 2 minutes) and polymerase reaction (72 ° C. for 3 minutes) was repeated 30 times to obtain a plurality of amplified fragments.

Each of these amplified fragments was cloned into the plasmid Bluescript SK +, and then the nucleotide sequence was determined and compared with the known ACCase gene. As a result, it was amplified by polymerase chain reaction in which α3 shown in SEQ ID NO: 3 of the sequence listing and γ4 primer shown in SEQ ID NO: 14 of the sequence listing were combined.
The 27 bp fragment contains a nucleotide sequence capable of encoding an amino acid sequence showing 60% homology with animal ACCase,
It was revealed to be a part of the Arabidopsis thaliana ACCase gene.

The nucleotide sequence of this 927 bp gene fragment is shown in SEQ ID NO: 15 of the sequence listing. In the same gene fragment, the nucleotide sequence encoding the amino acid of the enzyme protein was 4
It was divided by several introns.

On the other hand, in the polymerase chain reaction in which the primers of β1 to β4 and γ1 to γ4 were combined, no amplification of the gene fragment was observed. This was found to be because one of the above introns disrupted the nucleotide sequence encoding the “β” region, so that the oligonucleotides β1 to β4 did not function as primers for the polymerase chain reaction.

(2) Preparation of Arabidopsis Genomic DNA and Construction of Genomic Library Genomic DN of Arabidopsis thaliana
A is the method of Rogers and Bendich (Plan
t Mol. Biol. , 5, 69 (1985)). The obtained genomic DNA is physically cut into pieces and further subjected to sucrose density gradient centrifugation to give 4 to 10
A kb DNA fragment was obtained.

EcoRI adapters were ligated to both ends of this DNA fragment using a ligation kit (Takara Shuzo). This was ligated to an arm of a λZAPII phage vector cut with EcoRI, and then an in vitro packaging kit (Stratagene, Gigap)
A large number of recombinant λ phages were obtained by packaging lambda phage using ackII Gold) and infecting E. coli XL1-Blue strain.
This was designated as an Arabidopsis genomic DNA library. The size of the library was 2 × 10 ⁶ .

(3) Isolation of a genomic clone of the Arabidopsis thaliana ACCase gene A genomic clone containing the Arabidopsis thaliana ACCase gene was prepared from the above-mentioned genomic library of Arabidopsis thaliana, and an amplified fragment of 927 bp, which is a part of the above-mentioned Arabidopsis thaliana ACCase gene. Screening was performed by plaque hybridization used as a probe.

As a result, genomic clones showing a plurality of positives were obtained. Each clone was infected with helper phage and converted into a plasmid. Six restriction enzymes (BamHI, BglII, EcoRV, HindIII,
PstI, XbaI) was used to create a physical map of the insert of the genomic clone, and the correspondence between the clones was investigated. Genomic clones are classified into three groups,
It was confirmed that these were derived from three sites in the chromosome. Therefore, ACC contained in these three sites
ase genes are defined as ACCase-1 and ACCas, respectively.
It was named e-2 and ACCase-3. In addition, it was confirmed that the amplified fragment of 927 bp, which is a part of the ACCase gene used as a probe, was derived from ACCase-1.

Further, by using the downstream portion of the obtained ACCase-1 genomic clone as a probe, a new genomic clone is isolated by repeating chromosomal walking to obtain ACCase-1, ACCase-2, ACCas.
The whole gene of each e-3 was covered by the genomic clone. A physical map of each ACCase gene is shown in FIG.

In FIG. 2, the restriction enzyme cleavage points in the physical map are BamHI (Bm), BglII (Bg) and EcoR.
V (Ev), HindIII (Hd), PstI (P
s) and XbaI (Xb). Sequence number 1 in the sequence listing
5 and the base sequence shown in SEQ ID NO: 20 in the sequence listing described below are derived from the regions indicated by bold lines with "15" and "20" at the top of the physical map of ACCase-1. The thin line at the bottom of each physical map shows the region covered by the isolated individual genomic clones.

The thin lines with a, b, and c are pATgACC-, three of the genomic clones converted into plasmids by the above-mentioned helper phage infection.
1a, pATgACC-1b, pATgACC-1c are the areas covered. The Escherichia coli XL1-Blue carrying these plasmids was sequentially transferred to the Institute of Biotechnology, Institute of Industrial Science and Technology, FERM P-13792 and FE, respectively.
Deposited as RM P-13793 and FERM P-13794.

(4) Detection of coding region of biotin carboxyl carrier protein domain in Arabidopsis thaliana ACCase-1 gene "rat", "chicken", and "yeast" ACCa
In the se gene, the coding region for the biotin carboxyl carrier protein domain is located downstream of the region coding for the biotin carboxylase domain. Also in the Arabidopsis ACCase gene, the coding region of the biotin carboxyl carrier protein domain presumed to be located downstream of the region coding for the biotin carboxylase domain was detected.

Each of the previously reported "rat", "chicken", "yeast" and "E. coli" ACCa
The amino acid sequences of the biotin carboxyl carrier protein domain encoded by the se gene were compared, and the amino acid sequences showing common similarity between them were selected and named as "BCCP" (Fig. 3). In FIG. 3, the number added to the beginning of the amino acid sequence is the number of the amino acid counted from the initiation methionine in ACCase of each organism.

Next, four kinds of oligonucleotide primers BCCP1 to BCCP based on the amino acid sequence of "BCCP"
CCP4 (SEQ ID NOS: 16 to 19 in the sequence listing) was prepared.
Under the same conditions as described above, four kinds of polymerase chain reactions were performed, in which the oligonucleotide primers of BCCP1 to BCCP4 and the aforementioned oligonucleotide primer of α3 corresponding to the region encoding the biotin carboxylase domain of the Arabidopsis thaliana ACCase-1 gene were combined. Then, a genomic clone of the Arabidopsis ACCase-1 gene was used as a template.

As a result, BCCP2 and α3, and BC
3k in combination of CP3 and α3 primers
The amplified fragment of b was obtained, and it was located downstream of the nucleotide sequence encoding the "α" region in the biotincarboxylase domain 3
It was suggested that there is a region encoding the biotin carboxyl carrier protein domain in kb.

Actually, when the base sequence of the genomic clone in the region where the coding region of this biotin carboxyl carrier protein domain was considered to exist was analyzed, it was found that biotin carboxyl carrier protein A nucleotide sequence (SEQ ID NO: 20 in the sequence listing) capable of encoding the amino acid sequence of the domain could be found.

The above results indicate that the gene of the present invention is ACCa.
This proves that it is a gene encoding se.

(5) RFLP mapping of Arabidopsis thaliana ACCase-1 gene Using the 927 bp amplified fragment derived from a part of the above-mentioned Arabidopsis thaliana ACCase-1 gene as a probe, genomic DNA of Arabidopsis thaliana Colombia strain and Landsburg strain and Southern hybridization was performed. The hybridization band of the ACCase-1 gene shows that the AC
It was clearly distinguished from the bands of Case-2 gene and ACCase-3 gene. In addition, the hybridization band of the ACCase-1 gene against the genomic DNA degradation product by the restriction enzyme BamHI showed RFLP (restriction fragment) between the Columbia strain and the Landsburg strain.
length polymorphism) (Fig. 4).

Using this RFLP, the locus on the chromosome of the ACCase-1 gene can be determined by associating with the RFLP map already prepared in Arabidopsis. Using genomic DNA of progeny of Arabidopsis thaliana strain and Lansburgh strain,
Southern hybridization was performed using a 927 bp amplified fragment derived from the ACCase-1 gene and an RFLP marker whose locus had been determined as a probe, and recombination values were calculated to determine the ACCase-1 locus. . As a result of the analysis, the ACCase-1 gene was located in the central part of chromosome 1 of Arabidopsis thaliana (Fig. 5).

(6) Preparation of Rape Genomic DNA and Construction of Genomic Library The rape (Brassica napus) genomic DNA was obtained by the method of Rogers and Bendich (Pl.
ant Mol. Biol., 5, 69 (1985)). The obtained genomic DNA was digested with the restriction enzyme Sau3AI and further subjected to sucrose density gradient centrifugation to obtain 10 kb.
The above DNA fragments were obtained.

This DNA fragment was ligated to an arm of a λEMBL3 phage vector cleaved with BamHI, and then an in vitro packaging kit (Stratagene,
GigapackII Gold) was used for packaging and infecting E. coli strain LE392 to obtain a large number of recombinant λ phages. This was used as a canola genomic DNA library. The size of the library was 1.9 × 10 ⁶ .

(7) Isolation of a genomic clone of the canola ACCase gene By subjecting the rapeseed genomic library to plaque hybridization using the above-mentioned genomic clone containing the Arabidopsis ACCASE-1 gene as a probe, the canola ACCase gene was isolated. Was screened for genomic clones containing

As a result, 4 kinds of positive genomic clones were obtained. For each clone, λDNA was prepared and three restriction enzymes (BamHI, SalI, Xh) were prepared.
oI) was used to create a physical map of the insert. From the comparison of physical maps, it was confirmed that the four genomic clones were classified into two groups and that they were derived from two sites in the chromosome. In addition, Arabidopsis ACCa
A region of the canola ACCase gene having homology with the se gene was identified. Figure 6 shows the rapeseed ACCase.
1 shows a physical map of a genomic clone containing a gene. Figure 6
Among them, the restriction enzyme cleavage points are BamHI (Bm) and SalI.
(S), XhoI (Xh). The thin line at the bottom of each physical map shows the region covered by the isolated individual genomic clones. ACCASE of Arabidopsis
The region of the canola ACCase gene having homology with the gene is shown shaded.

(8) Increased expression of ACCase Genome D containing Arabidopsis ACCase-1 gene
Construction of the sense / ACCase gene was performed using the NA fragment (FIG. 7). Three genomic clones (pATgACC-1a, pATgAC) were obtained in order to obtain a genomic DNA fragment containing the entire nucleotide sequence encoding the ACCase enzyme protein and a promoter sequence for controlling the expression.
A divided into C-1b and pATgACC-1c)
After the CCase-1 gene region was ligated, it was partially digested with the restriction enzyme EcoRV to obtain a genome D of 11.8 kb.
The NA fragment was obtained. Restriction enzymes HindIII and Eco
Binary vector pB cut with RI and blunt-ended
I121 (R. Jefferson et al., E.
MBO J. , 6,3901-3907 (1987)).
The above-mentioned 11.8 kb genomic DNA fragment was inserted into to obtain a sense / ACCase gene (FIG. 7). This vector has a kanamycin resistance gene (Km ^r ) as a marker. Further, in FIG. 7, the upper line shows a physical map of the Arabidopsis thaliana ACCase-1 gene. The thin lines with a, b, and c at the bottom of the physical map are A
Genomic clone p used for ligation of CCase-1 gene
ATgACC-1a, pATgACC-1b, pATg
The area covered by ACC-1c is shown.

Transformed Arabidopsis into which the sense / ACCase gene was introduced was prepared by the Agrobacterium-mediated gene introduction method. First, the sense A
The CCase expression vector was added to Agrobacterium (Agroba
cterium tumefaciens)
A mixed culture of Escherichia coli having an ACCase expression vector, Escherichia coli having a transposable element plasmid pRK2013, and Agrobacterium was mixed with LB agar medium containing 100 μg / ml rifampicin and 25 μg / ml kanamycin (1% bactotryptone, 0.5% yeast). Extract, 0.
28 on 5% sodium chloride, 1.2% Bacto agar
After 2 days at C, colonies of Agrobacterium to which kanamycin resistance was imparted by transfer of the sense / ACCase gene were selected. Then, sense, ACCa
100 μg of Agrobacterium having se gene /
A culture solution was prepared by culturing at 28 ° C. for 16 hours in an LB liquid medium (1% bactotryptone, 0.5% yeast extract, 0.5% sodium chloride) containing ml rifampicin and 25 μg / ml kanamycin.

On the other hand, as for Arabidopsis thaliana, seeds were sown on an agar medium of a petri dish, grown at 22 ° C. for 20 days, and the flower stalks immediately after being pulled were excised. A culture solution of the above-mentioned Agrobacterium having the sense / ACCase gene was injected into the cut end of this Arabidopsis thaliana using a syringe to infect it. The infected plants were cultivated for one month and seeded. The seeds were sown on an agar medium in a petri dish containing 100 μg / ml of kanamycin and cultured at 22 ° C. to select progeny plants resistant to kanamycin to obtain transformed Arabidopsis thaliana. Further, the transformed Arabidopsis thaliana was cultivated for 2 months and seeded. Using the seeds obtained from this transformed Arabidopsis thaliana, the activity of ACCase was determined by the method of Nikolau et al. (Arch. Bioch.
em. Biophys. , 211, 605-612 (1
981)). 0.1 M Tris-HCl buffer (pH 8), 1 mM ATP, 2.5 mM M
gCl ₂ , 50 mM KCl, 30 mM NaH ¹⁴ CO
A reaction mixture containing ₃ , 1 mM dithiothreitol and 0.3 mM acetyl-CoA was prepared and shaken at 30 ° C. for 5 minutes. Spot this solution on filter paper, and use hot air to
¹⁴ CO ₃ ⁻ was evaporated, and the radioactivity of the remaining reaction product was measured using a toluene scintillator. As a result, in the seeds obtained from the transformed Arabidopsis thaliana, Sense A
The activity of ACCase was increased by the addition of the CCase gene.

(9) Suppression of ACCase expression Genome D containing the Arabidopsis ACCase-1 gene
The NA fragment was used to construct an antisense ACCase gene (FIG. 8). The ACCase-1 gene fragment contained in the pATgACC-1b is a restriction enzyme Xba.
Cleavage with I gave a 1.8 kb genomic DNA fragment.
This genomic DNA fragment was used as the binary vector pBI12.
1 (R. Jefferson et al., EMBO
J. , 6,3901-3907 (1987)) at the XbaI site located downstream of the promoter,
Those capable of synthesizing a transcript RNA complementary to the mRNA encoding the Case enzyme protein are selected, and antisense
The ACCase gene was used (FIG. 8). In FIG. 8, the upper line shows a physical map of the Arabidopsis thaliana ACCase-1 gene.

The transformed Arabidopsis thaliana into which the antisense / ACCase gene was introduced was prepared by the Agrobacterium-mediated gene introduction method according to the method described above. Seeds were obtained from this transformed Arabidopsis thaliana, and the activity of ACCase was measured according to the method described above. As a result, it was shown that the activity of ACCase was reduced and the expression of ACCase was suppressed by the antisense / ACCase gene.

[0075]

Example 2 Arabidopsis ACCase-1mRN
Isolation of A (1) Preparation of mRNA of Arabidopsis thaliana and construction of cDNA library Total RNA was prepared from the foliage of Arabidopsis thaliana cultivated in a greenhouse for 4.5 weeks according to the guanidine method. From the obtained total RNA, mRNA was purified by oligo dT cellulose column chromatography.

Using this mRNA as a template, a cDNA synthesis kit (manufactured by Amersham) was used to synthesize cDNA using an oligo dT primer, a random primer and a reverse transcriptase. Ec was obtained by using a ligation kit (Takara Shuzo) on both ends of the obtained double-stranded cDNA.
The oRI adapter was ligated. This was ligated to an arm of a λgt11 vector cut with EcoRI, and then an in vitro packaging kit (G, Stratagene, G
A large number of recombinant λ phages were obtained by packaging lambda phage using igapackII Gold) and infecting Escherichia coli Y1090 strain. This was used as an Arabidopsis cDNA library.
The size of the library was 1.7 × 10 ⁶ .

(2) cD of Arabidopsis ACCASE
Isolation of NA clone and its expression Targeting the cDNA library of Arabidopsis thaliana,
Arabidopsis ACCase cDNA clones were screened by plaque hybridization. The probe contains the above-mentioned Arabidopsis ACCa.
Genomic clone pAT occupying most of se-1 gene
gACC-1b was used.

As a result, cDNA clones showing a plurality of positives were obtained. For each cDNA clone, the insert fragment was excised with EcoRI and subcloned into a plasmid vector. 11 kinds of restriction enzymes (Bam
HI, BglII, EcoRI, EcoRV, Hinc
II, HindIII, PstI, SalI, Sst
I, XbaI, XhoI) was used to create a physical map of the insert fragment of the cDNA clone, and the correspondence between the clones was investigated. The obtained cDNA clone is
It could not cover the full length of the cDNA. Therefore, using these cDNA clones as probes, new cDNA
By repeating the work of isolating NA clones,
The full-length ACCase cDNA was covered with a cDNA clone. A physical map of the ACCase cDNA is shown in FIG.

In FIG. 9, the thin line at the bottom of the physical map shows the region covered by the isolated individual cDNA clones. Moreover, the part shown by the square is the region encoding ACCase.

The nucleotide sequences of the inserted fragments of these cDNA clones were determined. The result is shown in SEQ ID NO: 21 of the sequence listing. The nucleotide sequence of the cDNA encodes 2254 amino acids (SEQ ID NO: 22), and the biotin carboxylase domain (SEQ ID NO: 15 in the sequence listing) and biotin carboxyl carrier protein domain (SEQ ID NO: 15) obtained from the analysis of the genomic DNA described above. Sequence number 2 in the sequence listing
It was confirmed that the region corresponding to each sequence of 0) was included. In addition, the amino acid sequences of the "Cas" of "rat", "chicken", and "yeast" which have been reported have been reported.
When compared to the amino acid sequence encoded by the e gene, the degree of identity was 38.9%, 38.1%, 3 respectively.
Although it was as low as 9.4%, biotin carboxylase domain, biotin carboxyl carrier protein
The domains and transcarboxylase domains showed common similarities, and the arrangements of these domains were also in good agreement. These results show that the obtained cDNA
This confirms that A encodes an Arabidopsis ACCase.

(3) ACCase by introduction of cDNA
Expression enhancement of Arabidopsis thaliana ACCase cDNA was used to construct a constitutively strong sense ACCase gene (FIG. 10). In order to obtain a cDNA fragment containing the entire base sequence encoding the enzyme protein of ACCase, 8 kinds of cDNA clones (pATcACC-a, pATcA) were obtained.
CC-b, pATcACC-c, pATcACC-d,
pATcACC-e, pATcACC-f, pATcA
CD divided into CC-g, pATcACC-h)
After ligating NA, it was partially digested with a restriction enzyme HindIII to obtain a 6.95 kb cDNA fragment. Binary vector pBI121 (R. Jefferson e
t al. , EMBO J .; , 6,3901-3907
(1987)), the XbaI site and the EcoRI site located downstream of the constitutive strong expression promoter (cauliflower mosaic virus 35S promoter) were cleaved, and the 6950b cDNA fragment was blunt-ended and inserted into the blunt-ended product. , Sense A with strong constitutive expression
It was designated as CCase gene (FIG. 10). This sense AC
The Case gene is superior to the sense / ACCase gene constructed using the above-mentioned genomic DNA fragment in that gene expression is increased because the promoter is modified, and the gene region does not contain introns. The short length facilitates the introduction of the gene into the host chromosome.

Sense / ACCase with constitutive strong expression
A transgenic Arabidopsis thaliana in which a gene was introduced was prepared by an Agrobacterium-mediated gene introduction method. First, the sense / ACCase expression vector that expresses the constitutive strong expression described above is used as an Agrobacterium (Agrobacterium).
Escherichia coli, transposable element plasmid pRK201 having a sense / ACCase expression vector for constitutively strong expression in order to transfer it to Rium tumefaciens).
A mixed culture of Escherichia coli having 3 and Agrobacterium was mixed with 100 μg / ml rifampicin and 25 μg / m 2.
1 Constitutive strong expression was performed on LB agar medium (1% bactotryptone, 0.5% yeast extract, 0.5% sodium chloride, 1.2% bacto agar) containing kanamycin at 28 ° C for 2 days. A colony of Agrobacterium to which kanamycin resistance was imparted by transfer of a sense / ACCase expression vector was selected. Then sense
10 Agrobacterium carrying ACCase gene
LB liquid medium containing 1 μg / ml rifampicin and 25 μg / ml kanamycin (1% bactotryptone,
28 with 0.5% yeast extract, 0.5% sodium chloride)
A culture solution was prepared by culturing at 16 ° C for 16 hours.

On the other hand, for Arabidopsis thaliana, seeds were sown on an agar medium in a petri dish and grown at 22 ° C. for 20 days,
The flower buds were excised immediately after being pulled. At the cut end of this Arabidopsis thaliana, which has the above-mentioned constitutive strong expression, Sense / ACCa
A culture solution of Agrobacterium containing the se expression vector was injected using a syringe to infect Agrobacterium. The infected plants were cultivated for one month and seeded. The seeds were sown on an agar medium in a petri dish containing 100 μg / ml of kanamycin and cultured at 22 ° C. to select progeny plants resistant to kanamycin to obtain transformed Arabidopsis thaliana. The transformed Arabidopsis thaliana was cultivated and seeded for 2 months.

Using the seeds obtained from this transformed Arabidopsis thaliana, the activity of ACCase was examined by Nikolau.
Et al. (Arch. Biochem. Biophy.
s. , 211, 605-612 (1981)). 0.1 M Tris-HCl buffer (pH
8), 1 mM ATP, 2.5 mM MgCl ₂ , 50
A reaction mixture containing mMKCl, 30 mM NaH ¹⁴ CO ₃ , 1 mM dithiothreitol and 0.3 mM acetyl CoA was prepared and shaken at 30 ° C. for 5 minutes. The reaction mixture was spotted on a filter paper, unreacted H ¹⁴ CO ₃ ⁻ was evaporated with warm air, and the radioactivity of the remaining reaction product was measured using a toluene scintillator. As a result, in the seeds obtained from the transformed Arabidopsis thaliana, the above-mentioned genome D was obtained by the addition of the sense / ACCase gene that strongly expresses constitutively.
The activity of ACCase was further increased as compared with the seed of transformed Arabidopsis thaliana to which the sense / ACCase gene was constructed, which was constructed using the NA fragment.

[0085]

Industrial Applicability According to the present invention, a gene fragment encoding the ACCase gene or a part thereof can be obtained. By introducing these fragments into plants, ACCas
It is possible to increase the enzymatic activity of e to determine an increase in fat content.

ACCas obtained by the present invention
An antisense gene for the ACCase gene can be constructed using a DNA fragment containing all or part of the e gene. It is possible to suppress ACCase activity by introducing this into plants.

[0087]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single-stranded Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence TATCCGGTGA TNATTAAAGC 20

SEQ ID NO: 2 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence TATCCGGTCA TNATTAAGGC 20

SEQ ID NO: 3 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Sequence Type: Other Nucleic Acid (Synthetic Oligonucleotide) Sequence TATCCGGTGA TNATCAAAGC 20

SEQ ID NO: 4 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single-stranded Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence TATCCGGTTA TNATCAAGGC 20

SEQ ID NO: 5 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Sequence Type: Other Nucleic Acid (Synthetic Oligonucleotide) Sequence TATCCGGTGA TNATAAAAGC 20

SEQ ID NO: 6 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence TATCCGGTCA TNATAAAGGC 20

SEQ ID NO: 7 Sequence Length: 21 Sequence Type: Nucleic Acid Number of Strands: Single Strand Sequence Type: Other Nucleic Acid (Synthetic Oligonucleotide) Sequence ATCAGAAGGT CGTNGAAGAA G 21

SEQ ID NO: 8 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single-stranded Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence ATCAGAAGGT CGTNGAAGAG G 21

SEQ ID NO: 9 Sequence Length: 21 Sequence Type: Nucleic Acid Number of Strands: Single Strand Sequence Type: Other Nucleic Acid (Synthetic Oligonucleotide) Sequence ATCAGAAGGT CGTNGAGGAA G 21

SEQ ID NO: 10 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single-stranded Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence ATCAGAAGGT CGTNGAGGAG G 21

SEQ ID NO: 11 Sequence Length: 21 Sequence Type: Nucleic Acid Number of Strands: Single Strand Sequence Type: Other Nucleic Acid (Synthetic Oligonucleotide) Sequence CATTTCAGTG ACNGGATGTT C 21

SEQ ID NO: 12 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence CATTTCAGTG ACNGGGTGTT C 21

SEQ ID NO: 13 Sequence Length: 21 Sequence Type: Nucleic Acid Number of Strands: Single Strand Sequence Type: Other Nucleic Acid (Synthetic Oligonucleotide) Sequence CATTTCAGTG ACNGGATGCT C 21

SEQ ID NO: 14 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence CATTTCAGTG ACNGGGTGCT C 21

SEQ ID NO: 15 Sequence length: 927 Sequence type: Nucleic acid Number of strands: Double stranded Sequence type: Genomic DNA Origin organism name: Arabidopsis thaliana Sequence features Characteristic symbols: CDS Existence Location: 1..53 Method of determining features: S Characteristic symbol: intron Presence position: 54..134 Method of determining features: P Characteristic symbol: CDS Location: 135..227 Characteristic determination Method: S Feature symbol: intron Location: 228..359 Feature determination method: P Feature symbol: CDS Location: 360..455 Feature determination method: S Feature symbol: intron Location: 456..636 Method of determining features: P Characteristic symbol: CDS Location of existence: 637..810 Method of determining features: S Characteristic symbol: intron Location of existence: 811..903 Characteristic was determined Method: P Characteristic symbol: CDS Location: 904..927 Method of determining characteristic: S Other information: Hind III Recognition sequence Location: 258..263 Method by which the feature was determined: S Other information: XbaI recognition sequence Location: 368..373 Method by which the feature was determined: S Other information: PstI recognition sequence Location: 823. .828 Characterization Method: S-Sequence TATCGGTGATAATCAAA GCA TCG TGG GGT GGT GGT GGT AAA GGA ATC 47 Ser Val Ile Ile Lys Ala Ser Trp Gly Gly Gly Gly Lys Gly Ile 1 5 10 15 AGG AAG GTCAGCTTCT GTAGATATGC CTTTTGATTG TGGACTAAGCCGATT Lys ATAAGTACTT ATTCTGGTTT TAAATTTATA G GTT CAT AAT GAT GAT GAG GTT 155 Val His Asn Asp Asp Glu Val 20 AGG GCT CTA TTC AAG CAA GTT CAG GGT GAG GTC CCA GGC TCA CCA ATA 203 Arg Ala Leu Phe Lys Glu Val Pron Gly Glu Gly Ser Pro Ile 25 30 35 40 TTC ATA ATG AAG GTT GCG TCA CAG GTATGGCTCC TTAACTATAT CTCTTGATCG 257 Phe Ile Met Lys Val Ala Ser Gln 45 AAGCTTAGCT GAGTTCTTAT CTGGTTACTu TACTAGAGAA TTTAAAGTAG TAATGCATTG 317 CTTTTCTTTATT CAT 50 GAG GTC CAG CTG CTC TGT GAC AAG CAT G GA AAT GTT TCA GCT CTG CAT 419 Glu Val Gln Leu Leu Cys Asp Lys His Gly Asn Val Ser Ala Leu His 55 60 65 AGC CGT GAT TGT AGC GTC CAG AGA AGA CAT CAA AAG GTTTGTTAGT 465 Ser Arg Asp Cys Ser Val Gln Arg Arg His Gln Lys 70 75 80 GGTTGATTCT GGATTTTTAA TTGTCTGGTT AGTGGTTATA TAGAAAAACA TTCTGTCCAT 525 TTATTCTTAT ATAGTTATAT ACATCAATTT TTGTTCTCCA ACTGAGTTAT AGTCCCTTTT 585 AGCGCATTGC AAATTATTGC ATGAGCTCTT ACCTTATCGT TTGTATCGTA G ATC ATA 642 Ile Ile GAG GAG GGT CCA ATT ACT GGT CGT CCG CCA GAA ACT GTC AAG AAA CTT 690 Glu Glu Gly Pro Ile Thr Gly Arg Pro Pro Glu Thr Val Lys Lys Leu 85 90 95 GAA CAA GCA GCT AGA AGG TTG GCT AAG AGT GTT AAC TAT GTT GGA GCT 738 Glu Gln Ala Ala Arg Arg Leu Ala Lys Ser Val Asn Tyr Val Gly Ala 100 105 110 GCT ACT GTT GAG TAT CTC TAC AGT ATG GAC ACT GGG GAG TAC TAC TTC 786 Ala Thr Val Glu Tyr Leu Tyr Ser Met Asp Thr Gly Glu Tyr Tyr Phe 115 120 125 130 TTA GAG CTT AAC CCT CGC TTA CAG GTTGGTTTCA TACTGCAGCT TTTTGCGTTG 840 Leu Glu Leu Asn Pro Arg Leu Gln 135 AAATATATTG AAGGTCCGGA CTTGAAAATT GAATGACTTG TTTAACTTGA TGTTTGAGGT 900 CAG GTT GAG CAC CCT GTC ACT GAA ATG 927 Val Glu His Pro Val Thr Glu Met 140 145

SEQ ID NO: 16 Sequence length: 19 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence TGATCATCTT CATAACYTC 19

SEQ ID NO: 17 Sequence length: 19 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence TGATCATCTT CATGGCYTC 19

SEQ ID NO: 18 Sequence length: 19 Sequence type: Nucleic acid Number of strands: Single stranded Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence TGACCATCTT CATGACYTC 19

SEQ ID NO: 19 Sequence length: 19 Sequence type: Nucleic acid Number of strands: Single-stranded Sequence type: Other nucleic acid (synthetic oligonucleotide) Sequence TGACCATCTT CATAGCYTC 19

SEQ ID NO: 20 Sequence length: 292 Sequence type: Nucleic acid Number of strands: Double stranded Sequence type: Genomic DNA Origin Biological name: Arabidopsis thaliana Characteristic of sequence: Characteristic symbol: CDS Existence Location: 1..42 Method of determining features: S Characteristic symbol: intron Presence position: 43..139 Method of determining features: P Characteristic symbol: CDS Location of existence: 140..292 Characteristic determination Method: S-sequence GGA ACT CGT CTT CTC ATT GAT GGA AGA ACT TGT TTG CTA CAG 42 Gly Thr Arg Leu Leu Ile Asp Gly Arg Thr Cys Leu Leu Gln 1 5 10 GTTTCTGCTA ATTTTTACGTGTGTTTACCA TTTTACTTCA CGTTTCTCA ATCCTTTTATA 102A GAT CCA TCA 157 Asn Asp His Asp Pro Ser 15 20 AAG TTA ATG GCT GAG ACA CCG TGC AAG TTG ATG AGG TAT TTG ATT TCC 205 Lys Leu Met Ala Glu Thr Pro Cys Lys Leu Met Arg Tyr Leu Ile Ser 25 30 35 GAC AAC AGC AAT ATT GAC GCT GAT ACG CCT TAT GCC GAA GTT GAG GTC 253 Asp Asn Ser Asn Ile Asp Ala Asp Thr Pro Tyr Ala Glu Val Glu Val 40 45 50 ATG AAG ATG TGC ATG CCA CTT CTT TCA CCT GCT TCA GGA 292 Met Lys Met Cys Met Pro Leu Leu Ser Pro Ala Ser Gly 55 60 65

SEQ ID NO: 21 Sequence length: 7340 Sequence type: Nucleic acid Number of strands: Double stranded Sequence type: cDNA to mRNA Origin Organism name: Arabidopsis thaliana Sequence features Characteristic symbols: CDS the location: 408..7169 method to determine the characteristics: P sequence TCCCCAAATC TCTCGAAGCA GAGACTCGCA TAGTCTCTGA AGTCATCTAT AATCTGCTCG 60 CTTAGAAAAC CGCCGTATTC ATCTTCAAGA TCCTGTGGTA TGTCCCAATG AAAGATAGTA 120 ACAAGAGGAG TGATTTCATT GGCTAAGAGT TCATCAATAA CATCATTGTA AAACTTAATT 180 CCTTCTTCAC TAACTCCTCT ATCCCTTTTG CCATAAGGTA GAACTCGTGG CCAAGCAATG 240 GAAAGCCGAA ACGAATCCAT GTTTATATCC TTCATTCTCT TAATATCTTC CTCTCTGTTA 300 TTCTTTAGCT AAACACCCAC AATTCTGGCC TTCTCTGATG CCTCTTTAAG CCAATTTGTA 360 TCTCTGCTTC CTTACAAGAT ATATCTGAAG CTTAAAGGGC AGTGACA ATG GCT GGC 416 Met Ala Gly 1 TCG GTT AAC GGG Aly Gn Aly Gn CLA GAT Asn Tyr Glu 5 10 15 ACG GTG TCT CAA GTG GAT GAG TTC TGT AAA GCA CTT AGA GGG AAA AGG 510 Thr Val Ser Gln Val Asp Glu Phe Cys Lys Ala Leu Arg Gly Lys Arg 20 25 30 35 CCG ATC CAT AGT ATT TTG ATA GCT AAC AAT GGA ATG GCG GCT GTG AAG 558 Pro Ile His Ser Ile Leu Ile Ala Asn Asn Gly Met Ala Ala Val Lys 40 45 50 TTT ATA CGT AGT GTC AGA ACA TGG GCT TAT GAA ACA TTT GGT ACG GAA 606 Phe Ile Arg Ser Val Arg Thr Trp Ala Tyr Glu Thr Phe Gly Thr Glu 55 60 65 AAA GCC ATA TTG TTG GTG GGG ATG GCA ACC CCT GAA GAC ATG CGG ATC 654 Lys Ala Ile Leu Leu Val Gly Met Ala Thr Pro Glu Asp Met Arg Ile 70 75 80 AAT GCG GAG CAT ATC AGA ATC GCT GAT CAG TTT GTT GAG GTT CCC GGA 702 Asn Ala Glu His Ile Arg Ile Ala Asp Gln Phe Val Glu Val Pro Gly 85 90 95 GGA ACC AAC AAT AAC AAT TAT GCT AAC GTT CAG CTG ATT GTG GAG ATG 750 Gly Thr Asn Asn Asn Asn Tyr Ala Asn Val Gln Leu Ile Val Glu Met 100 105 110 115 GCT GAA GTA ACA CGC GTG GAT GCA GTT TGG CCT GGT TGG GGT CAT GCA 798 Ala Glu Val Thr Arg Val Asp Ala Val Trp Pro Gly Trp Gly His Ala 120 125 130 TCT GAA AAC CCC GAA TTA CCT GAT GCC CTA GAT GCA AAA GGA ATC ATA 846 Ser Glu Asn Pro Glu Leu Pro Asp Ala Leu Asp Ala Lys Gly Ile Ile 135 140 145 TTT CTT GGT CCT CCA GCA TCT TCA ATG GCA GCA CTG GGA GAT AAG ATT 894 Phe Leu Gly Pro Pro Ala Ser Ser Met Ala Ala Leu Gly Asp Lys Ile 150 155 160 GGT TCT TCG TTG ATT GCA CAA GCT GCT GAT GTA CCC ACT CTG CCA TGG 942 Gly Ser Ser Leu Ile Ala Gln Ala Ala Asp Val Pro Thr Leu Pro Trp 165 170 175 AGT GGT TCC CAT GTT AAA ATA CCT CCT AAT AGC AAC TTG GTA ACC ATC 990 Ser Gly Ser His Val Lys Ile Pro Pro Asn Ser Asn Leu Val Thr Ile 180 185 190 195 CCA GAG GAG ATC TAC CGG CAA GCA TGT GTC TAC ACA ACT GAA GAA GCG 1038 Pro Glu Glu Ile Tyr Arg Gln Ala Cys Val Tyr Thr Thr Glu Glu Ala 200 205 210 ATT GCT AGC TGT CAA GTT GTC GGT TAC CCA GCA ATG ATC AAA GCA TCG 1086 Ile Ala Ser Cys Gln Val Val Gly Tyr Pro Ala Met Ile Lys Ala Ser 215 220 225 TGG GGT GGT GGT GGT AAA GGA ATC AGG AAG GTT CAT AAT GAT GAT GAG 1134 Trp Gly Gly Gly Gly Lys Gly Ile Arg Lys Val His Asn Asp Asp Glu 230 235 240 GTT AGG GCT CTA TTC AAG CAA GTT C AG GGT GAG GTC CCA GGC TCA CCA 1182 Val Arg Ala Leu Phe Lys Gln Val Gln Gly Glu Val Pro Gly Ser Pro 245 250 255 ATA TTC ATA ATG AAG GTT GCG TCA CAG AGT CGG CAT CTA GAG GTC CAG 1230 Ile Phe Ile Met Lys Val Ala Ser Gln Ser Arg His Leu Glu Val Gln 260 265 270 275 CTG CTC TGT GAC AAG CAT GGA AAT GTT TCA GCT CTG CAT AGC CGT GAT 1278 Leu Leu Cys Asp Lys His Gly Asn Val Ser Ala Leu His Ser Arg Asp 280 285 290 TGT AGC GTC CAG AGA AGA CAT CAA AAG ATC ATA GAG GAG GGT CCA ATT 1326 Cys Ser Val Gln Arg Arg His Gln Lys Ile Ile Glu Glu Gly Pro Ile 295 300 305 ACT GTG GCT CCG CCA GAA ACT GTC AAG AAA CTT GAA CAA GCA GCT AGA 1374 Thr Val Ala Pro Pro Glu Thr Val Lys Lys Leu Glu Gln Ala Ala Arg 310 315 320 AGG TTG GCT AAG AGT GTT AAC TAT GTT GGA GCT GCT ACT GTT GAG TAT 1422 Arg Leu Ala Lys Ser Val Asn Tyr Val Gly Ala Ala Thr Val Glu Tyr 325 330 335 CTC TAC AGT ATG GAC ACT GGG GAG TAC TAC TTC TTA GAG CTT AAC CCT 1470 Leu Tyr Ser Met Asp Thr Gly Glu Tyr Tyr Phe Leu Glu Leu Asn Pro 340 345 350 355 CGC TTA CA G GTT GAG CAT CCT GTC ACT GAG TGG ATT GCC GAG ATA AAT 1518 Arg Leu Gln Val Glu His Pro Val Thr Glu Trp Ile Ala Glu Ile Asn 360 365 370 CTT CCT GCT GCC CAA GTT GCT GTG GGG ATG GGA ATT CCT CTC TGG CAA 1566 Leu Pro Ala Ala Gln Val Ala Val Gly Met Gly Ile Pro Leu Trp Gln 375 380 385 ATC CCT GAG ATA AGA CGG TTC TAT GGA ATA GAA CAT GGT GGA GGT TAT 1614 Ile Pro Glu Ile Arg Arg Phe Tyr Gly Ile Glu His Gly Gly Gly Tyr 390 395 400 GAT TCT TGG CGA AAA ACA TCT GTT GTA GCC TTC CCT TTT GAT TTT GAT 1662 Asp Ser Trp Arg Lys Thr Ser Val Val Ala Phe Pro Phe Asp Phe Asp 405 410 415 AAA GCT CAA TCT ATA AGG CCA AAA GGT CAT TGT GTG GCT GTA CGT GTG 1710 Lys Ala Gln Ser Ile Arg Pro Lys Gly His Cys Val Ala Val Arg Val 420 425 430 435 ACA AGT GAG GAT CCT GAT GAC GGG TTC AAA CCA ACC AGC GGT AGA GTT 1758 Thr Ser Glu Asp Pro Asp Asp Gly Phe Lys Pro Thr Ser Gly Arg Val 440 445 450 CAG GAG TTG AGT TTT AAG AGC AAG CCA AAT GTG TGG GCG TAC TTC TCT 1806 Gln Glu Leu Ser Phe Lys Ser Lys Pro Asn Val Trp Ala Tyr Phe Ser 455 460 465 GTC AAG TCT GGT GGA GGC ATC CAC GAG TTC TCG GAT TCC CAG TTT GGA 1854 Val Lys Ser Gly Gly Gly Ile His Glu Phe Ser Asp Ser Gln Phe Gly 470 475 480 CAT GTT TTT GCA TTT GGG GAA TCC AGA GCC CTG GCG ATA GCG AAT ATG 1902 His Val Phe Ala Phe Gly Glu Ser Arg Ala Leu Ala Ile Ala Asn Met 485 490 495 GTT CTT GGG CTA AAA GAA ATT CAG ATC CGT GGA GAA ATT AGG ACT AAC 1950 Val Leu Gly Leu Lys Glu Ile Gln Ile Arg Gly Glu Ile Arg Thr Asn 500 505 510 515 GTT GAC TAC ACG ATC GAC CTT TTA CAT GCT TCT GAT TAC CGT GAT AAC 1998 Val Asp Tyr Thr Ile Asp Leu Leu His Ala Ser Asp Tyr Arg Asp Asn 520 525 530 AAA ATT CAC ACT GGT TGG TTG GAT AGT AGG ATT GCT ATG CGG GTC AGA 2046 Lys Ile His Thr Gly Trp Leu Asp Ser Arg Ile Ala Met Arg Val Arg 535 540 545 GCT GAG AGG CCT CCA TGG TAT CTC TCT GTT GTC GGC GGA GCT CTC TAT 2094 Ala Glu Arg Pro Pro Trp Tyr Leu Ser Val Val Gly Gly Ala Leu Tyr 550 555 560 AAA GCA TCA GCG ACC AGT GCT GCT GTG GTT TCA GAT TAC GTT GGT TAT 2142 Lys Ala Ser Ala Thr Ser Ala Ala Val Val Ser Asp Tyr Val Gly Tyr 565 570 575 CTG GAG AAG GGG CAA ATC CCT CCA AAG CAT ATA TCT CTT GTA CAT TCT 2190 Leu Glu Lys Gly Gln Ile Pro Pro Lys His Ile Ser Leu Val His Ser 580 585 590 595 CAA GTG TCT CTG AAT ATT GAA GGA AGT AAA TAT ACG ATT GAT GTA GTC 2238 Gln Val Ser Leu Asn Ile Glu Gly Ser Lys Tyr Thr Ile Asp Val Val 600 605 610 CGG GGT GGA TCA GGA ACC TAC AGG CTA AGA ATG AAC AAG TCA GAA GTG 2286 Arg Gly Gly Ser Gly Thr Tyr Arg Leu Arg Met Asn Lys Ser Glu Val 615 620 625 GTA GCA GAA ATA CAC ACT CTA CGT GAT GGA GGT CTG TTG ATG CAG TTG 2334 Val Ala Glu Ile His Thr Leu Arg Asp Gly Gly Leu Leu Met Gln Leu 630 635 640 GAT GGC AAA AGC CAT GTG ATA TAT GCA GAG GAA GAA GCT GCA GGA ACT 2382 Asp Gly Lys Ser His Val Ile Tyr Ala Glu Glu Glu Ala Ala Gly Thr 645 650 655 CGT CTT CTC ATT GAT GGA AGA ACT TGT TTG CTA CAG AAT GAC CAC GAT 2430 Arg Leu Leu Ile Asp Gly Arg Thr Cys Leu Leu Gln Asn Asp His Asp 660 665 670 675 CCA TCA AAG TTA ATG GCT GAG ACA CCG TGC AAG TTG ATG AGG TAT TTG 2478 Pro Ser Lys Leu Met Ala G lu Thr Pro Cys Lys Leu Met Arg Tyr Leu 680 685 690 ATT TCC GAC AAC AGC AAT ATT GAC GCT GAT ACG CCT TAT GCC GAA GTT 2526 Ile Ser Asp Asn Ser Asn Ile Asp Ala Asp Thr Pro Tyr Ala Glu Val 695 700 705 GAG GTC ATG AAG ATG TGC ATG CCA CTT CTT TCA CCT GCT TCA GGA GTT 2574 Glu Val Met Lys Met Cys Met Pro Leu Leu Ser Pro Ala Ser Gly Val 710 715 720 ATC CAT TTT AAA ATG TCT GAA GGA CAA GCC ATG CAG GCT GGT GAA CTT 2622 Ile His Phe Lys Met Ser Glu Gly Gln Ala Met Gln Ala Gly Glu Leu 725 730 735 ATA GCC AAT CTT GAT CTT GAT GAT CCT TCT GCT GTA AGA AAG GCC GAA 2670 Ile Ala Asn Leu Asp Leu Asp Asp Pro Ser Ala Val Arg Lys Ala Glu 740 745 750 755 CCC TTC CAT GGA AGT TTC CCA AGA TTA GGG CTT CCA ACT GCA ATA TCC 2718 Pro Phe His Gly Ser Phe Pro Arg Leu Gly Leu Pro Thr Ala Ile Ser 760 765 770 GGT AGA GTT CAT CAG AGA TGT GCC GCA ACA TTA AAT GCT GCA CGC ATG 2766 Gly Arg Val His Gln Arg Cys Ala Ala Thr Leu Asn Ala Ala Arg Met 775 780 785 ATT ATT CTT GCT GGC TAT GAG CAT AAA GTA GAT GAG GTT GTT CAA GAC TTA 2814 Ile Le u Ala Gly Tyr Glu His Lys Val Asp Glu Val Val Gln Asp Leu 790 795 800 CTT AAT TGC CTT GAT AGC CCT GAA CTC CCA TTT CTT CAG TGG CAA GAG 2862 Leu Asn Cys Leu Asp Ser Pro Glu Leu Pro Phe Leu Gln Trp Gln Glu 805 810 815 TGC TTT GCA GTT CTG GCG ACA CGA CTA CCT AAA AAT CTC AGG AAC ATG 2910 Cys Phe Ala Val Leu Ala Thr Arg Leu Pro Lys Asn Leu Arg Asn Met 820 825 830 835 CTA GAA TCA AAG TAT AGG GAA TTT GAG AGT ATT TCC AGA AAC TCT TTG 2958 Leu Glu Ser Lys Tyr Arg Glu Phe Glu Ser Ile Ser Arg Asn Ser Leu 840 845 850 ACC ACC GAT TTC CCT GCC AAA CTT TTA AAA GGC ATT CTT GAG GCA CAT 3006 Thr Thr Asp Phe Pro Ala Lys Leu Leu Lys Gly Ile Leu Glu Ala His 855 860 865 TTA TCT TCT TGT GAT GAG AAA GAG AGA GGT GCC CTT GAA AGG CTC ATT 3054 Leu Ser Ser Cys Asp Glu Lys Glu Arg Gly Ala Leu Glu Arg Leu Ile 870 875 880 GAA CCA TTG ATG AGC CTT GCA AAA TCT TAT GAA GGT GGT AGA GAA AGT 3102 Glu Pro Leu Met Ser Leu Ala Lys Ser Tyr Glu Gly Gly Arg Glu Ser 885 890 895 CAT GCC CGT GTT ATT GTT CAT TCT CTC TTT GAA GAA TAT CTA TCA GTA 3150 His Ala Arg Val Ile Val His Ser Leu Phe Glu Glu Tyr Leu Ser Val 900 905 910 915 GAA GAA TTA TTC AAT GAT AAC ATG CTG GCT GAT GTT ATA GAA CGC ATG 3198 Glu Glu Leu Phe Asn Asp Asn Met Leu Ala Asp Val Ile Glu Arg Met 920 925 930 CGT CAG CTA TAC AAG AAA GAT CTG TTG AAA ATT GTG GAT ATA GTG CTC 3246 Arg Gln Leu Tyr Lys Lys Asp Leu Leu Lys Ile Val Asp Ile Val Leu 935 940 945 TCA CAC CAG GGC ATA AAA AAC AAA AAC AAA CTC GTT CTC CGG CTC ATG 3294 Ser His Gln Gly Ile Lys Asn Lys Asn Lys Leu Val Leu Arg Leu Met 950 955 960 GAG CAG CTT GTT TAC CCT AAT CCT GCT GCT TAC AGA GAT AAA CTT ATT 3342 Glu Gln Leu Val Tyr Pro Asn Pro Ala Ala Tyr Arg Asp Lys Leu Ile 965 970 975 CGA TTC TCA ACA CTT AAC CAT ACT AAC TAC TCT GAG TTG GCG CTC AAG 3390 Arg Phe Ser Thr Leu Asn His Thr Asn Tyr Ser Glu Leu Ala Leu Lys 980 985 990 995 GCG AGT CAA TTA CTT GAA CAG ACC AAA CTA AGT GAG CTT CGT TCA AAC 3438 Ala Ser Gln Leu Leu Glu Gln Thr Lys Leu Ser Glu Leu Arg Ser Asn 1000 1005 1010 ATT GCT AGA AGC CTT TCA GAG TT A GAA ATG TTT ACA GAG GAC GGA GAA 3486 Ile Ala Arg Ser Leu Ser Glu Leu Glu Met Phe Thr Glu Asp Gly Glu 1015 1020 1025 AAT ATG GAT ACT CCC AAG AGG AAA AGT GCC ATT AAT GAA AGA ATA GAA 3534 Asn Met Asp Thr Pro Lys Arg Lys Ser Ala Ile Asn Glu Arg Ile Glu 1030 1035 1040 GAT CTT GTA AGC GCA TCT TTA GCT GTT GAA GAC GCT CTC GTG GGA CTA 3582 Asp Leu Val Ser Ala Ser Leu Ala Val Glu Asp Ala Leu Val Gly Leu 1045 1050 1055 TTT GAC CAT AGC GAT CAC ACA CTT CAA AGA CGG GTT GTT GAG ACT TAT 3630 Phe Asp His Ser Asp His Thr Leu Gln Arg Arg Val Val Glu Thr Tyr 1060 1065 1070 1075 ATT CGC AGA TTA TAC CAG CCC TAC GTC GTT AAA GAT AGC GTG AGG ATG 3678 Ile Arg Arg Leu Tyr Gln Pro Tyr Val Val Lys Asp Ser Val Arg Met 1080 1085 1090 CAG TGG CAC CGT TCT GGT CTT CTT GCT TCC TGG GAG TTC CTA GAG GAG 3726 Gln Trp His Arg Ser Gly Leu Leu Ala Ser Trp Glu Phe Leu Glu Glu 1095 1100 1105 CAT ATG GAA AGA AAA AAC ATT GGC TTA GAC GAT CCC GAC ACA TCT GAA 3774 His Met Glu Arg Lys Asn Ile Gly Leu Asp Asp Pro Asp Thr Ser Glu 1110 1115 1120 AAA GGA TTG GTT GAG AAG CGT AGT AAG AGA AAA TGG GGG GCT ATG GTT 3822 Lys Gly Leu Val Glu Lys Arg Ser Lys Arg Lys Trp Gly Ala Met Val 1125 1130 1135 ATA ATC AAA TCT TTG CAG TTT CTT CCA AGT ATA ATA AGT GCA GCA TTG 3870 Ile Ile Lys Ser Leu Gln Phe Leu Pro Ser Ile Ile Ser Ala Ala Leu 1140 1145 1150 1155 AGA GAA ACA AAG CAC AAC GAC TAT GAA ACT GCC GGA GCT CCT TTA TCT 3918 Arg Glu Thr Lys His Asn Asp Tyr Glu Thr Ala Gly Ala Pro Leu Ser 1160 1165 1170 GGC AAT ATG ATG CAC ATT GCT ATT GTG GGC ATC AAC AAC CAG ATG AGT 3966 Gly Asn Met Met His Ile Ala Ile Val Gly Ile Asn Asn Gln Met Ser 1175 1180 1185 CTG CTT CAG GAC AGT GGG GAT GAA GAC CAA GCT CAG GAA AGA GTA AAC 4014 Leu Leu Gln Asp Ser Gly Asp Glu Asp Gln Ala Gln Glu Arg Val Asn 1190 1195 1200 AAG TTG GCC AAA ATT CTT AAA GAG GAA GAA GTG AGT TCA AGC CTC TGT 4062 Lys Leu Ala Lys Ile Leu Lys Glu Glu Glu Val Ser Ser Ser Leu Cys 1205 1210 1215 TCT GCC GGT GTT GGT GTA ATC AGC TGT ATA ATT CAG CGA GAT GAA GGA 4110 Ser Ala Gly Val Gly Val Ile Ser Cys Ile Ile Gln Arg Asp Glu Gly 1220 1225 1230 1235 CGA ACA CCC ATG AGA CAT TCT TTC CAT TGG TCG TTG GAG AAA CAG TAT 4158 Arg Thr Pro Met Arg His Ser Phe His Trp Ser Leu Glu Lys Gln Tyr 1240 1245 1250 TAT GTA GAA GAG CCG TTG CTG CGT CAT CTT GAA CCT CCT CTG TCC ATT 4206 Tyr Val Glu Glu Pro Leu Leu Arg His Leu Glu Pro Pro Leu Ser Ile 1255 1260 1265 TAC CTT GAG TTG GAT AAG CTG AAA GGA TAC TCA AAT ATA CAA TAT ACG 4256 Tyr Leu Glu Leu Asp Lys Leu Lys Gly Tyr Ser Asn Ile Gln Tyr Thr 1270 1275 1280 CCT TCT CGA GAT CGT CAA TGG CAT CTG TAT ACT GTT ACA GAC AAG CCA 4304 Pro Ser Arg Asp Arg Gln Trp His Leu Tyr Thr Val Thr Asp Lys Pro 1285 1290 1295 GTG CCA ATC AAG AGG ATG TTC CTG AGA TCT CTT GTT CGA CAG GCT ACA 4352 Val Pro Ile Lys Arg Met Phe Leu Arg Ser Leu Val Arg Gln Ala Thr 1300 1305 1310 1315 ATG AAC GAT GGA TTT ATA TTG CAG CAA GGG CAG GAT AAG CAG CTT AGC 4400 Met Asn Asp Gly Phe Ile Leu Gln Gln Gly Gln Asp Lys Gln Leu Ser 1320 1325 1330 CAA ACA CTG ATC TCC ATG GCG TTT ACG TCG AAA TGT GT T CTG AGG TCT 4448 Gln Thr Leu Ile Ser Met Ala Phe Thr Ser Lys Cys Val Leu Arg Ser 1335 1340 1345 TTG ATG GAT GCC ATG GAG GAA CTG GAA CTG AAT GCC CAT AAT GCT GCA 4496 Leu Met Asp Ala Met Glu Glu Leu Glu Leu Asn Ala His Asn Ala Ala 1350 1355 1360 ATG AAA CCA GAT CAC GCA CAT ATG TTT CTT TGC ATA TTG CGT GAG CAG 4544 Met Lys Pro Asp His Ala His Met Phe Leu Cys Ile Leu Arg Glu Gln 1365 1370 1375 CAG ATA GAT GAT CTT GTG CCT TTC CCC AGG AGA GTT GAA GTG AAT GCG 4592 Gln Ile Asp Asp Leu Val Pro Phe Pro Arg Arg Val Glu Val Asn Ala 1380 1385 1390 1395 GAG GAT GAA GAA ACT ACA GTT GAA ATG ATC TTA GAA GAA GCA GCA CGA 4640 Glu Asp Glu Glu Thr Thr Val Glu Met Ile Leu Glu Glu Ala Ala Arg 1400 1405 1410 GAG ATA CAT AGA TCT GTT GGA GTG AGA ATG CAT AGG TTG GGC GTG TGC 4688 Glu Ile His Arg Ser Val Gly Val Arg Met His Arg Leu Gly Val Cys 1415 1420 1425 GAG TGG GAA GTG CGG CTG TGG TTG GTG TCC TCT GGA CTG GCA TGT GGT 4736 Glu Trp Glu Val Arg Leu Trp Leu Val Ser Ser Gly Leu Ala Cys Gly 1430 1435 1440 GCT TGG A GG GTT GTG GTT GCA AAC GTG ACA GGC CGT ACA TGC ACT GTC 4784 Ala Trp Arg Val Val Val Ala Asn Val Thr Gly Arg Thr Cys Thr Val 1445 1450 1455 CAC ATA TAC CGA GAA GTT GAA ACT CCT GGA AGA AAC AGT TTA ATC TAC 4832 His Ile Tyr Arg Glu Val Glu Thr Pro Gly Arg Asn Ser Leu Ile Tyr 1460 1465 1470 1475 CAC TCA ATA ACC AAG AAG GGA CCT TTG CAT GAA ACA CCA ATC AGT GAT 4880 His Ser Ile Thr Lys Lys Gly Pro Leu His Glu Thr Pro Ile Ser Asp 1480 1485 1490 CAA TAT AAG CCC CTG GGA TAT CTC GAC AGG CAA CGT TTA GCA GCA AGG 4928 Gln Tyr Lys Pro Leu Gly Tyr Leu Asp Arg Gln Arg Leu Ala Ala Arg 1495 1500 1505 AGG AGT AAC ACT ACT TAT TGC TAT GAC TTC CCG TTG GCA TTT GGG ACA 4976 Arg Ser Asn Thr Thr Tyr Cys Tyr Asp Phe Pro Leu Ala Phe Gly Thr 1510 1515 1520 GCC TTG GAA CTG TTG TGG GCA TCA CAA CAC CCA GGA GTT AAG AAA CCA 5024 Ala Leu Glu Leu Leu Trp Ala Ser Gln His Pro Gly Val Lys Lys Pro 1525 1530 1535 TAT AAG GAT ACT CTG ATC AAT GTT AAA GAG CTT GTA TTC TCA AAA CCA 5072 Tyr Lys Asp Thr Leu Ile Asn Val Lys Glu Leu Val Phe Ser Lys Pro 1540 1545 1550 1555 GAA GGT TCT TCG GGT ACA TCT CTA GAT CTG GTT GAA AGA CCA CCC GGT 5120 Glu Gly Ser Ser Gly Thr Ser Leu Asp Leu Val Glu Arg Pro Pro Gly 1560 1565 1570 CTC AAC GAC TTT GGA ATG GTT GCC TGG TGC CTA GAT ATG TCG ACC CCA 5168 Leu Asn Asp Phe Gly Met Val Ala Trp Cys Leu Asp Met Ser Thr Pro 1575 1580 1585 GAG TTT CCT ATG GGG CGG AAA CTT CTC GTG ATT GCG AAT GAT GTC ACC 5216 Glu Phe Pro Met Gly Arg Lys Leu Leu Val Ile Ala Asn Asp Val Thr 1590 1595 1600 TTC AAA GCT GGT TCT TTT GGT CCT AGA GAG GAC GCG TTT TTC CTT GCT 5264 Phe Lys Ala Gly Ser Phe Gly Pro Arg Glu Asp Ala Phe Phe Leu Ala 1605 1610 1615 GTT ACT GAA CTC GCT TGT GCC AAG AAG CTT CCC TTG ATT TAC TTG GCA 5312 Val Thr Glu Leu Ala Cys Ala Lys Lys Leu Pro Leu Ile Tyr Leu Ala 1620 1625 1630 1635 GCA AAT TCT GGT GCC CGA CTT GGG GTT GCT GAA GAA GTC AAA GCC TGC 5360 Ala Asn Ser Gly Ala Arg Leu Gly Val Ala Glu Glu Val Lys Ala Cys 1640 1645 1650 TTC AAA GTT GGA TGG TCG GAT GAA ATT TCC CCT GAG AAT GGT TTT CAG 5408 P he Lys Val Gly Trp Ser Asp Glu Ile Ser Pro Glu Asn Gly Phe Gln 1655 1660 1665 TAT ATA TAC CTA AGC CCT GAA GAC CAC GAA AGG ATT GGA TCA TCT GTC 5456 Tyr Ile Tyr Leu Ser Pro Glu Asp His Glu Arg Ile Gly Ser Ser Val 1670 1675 1680 ATT GCC CAT GAA GTA AAG CTC TCT AGT GGG GAA ACT AGG TGG GTG ATT 5504 Ile Ala His Glu Val Lys Leu Ser Ser Gly Glu Thr Arg Trp Val Ile 1685 1690 1695 GAT ACG ATC GTT GGC AAA GAA GAT GGT ATT GGT GTA GAG AAC TTA ACA 5552 Asp Thr Ile Val Gly Lys Glu Asp Gly Ile Gly Val Glu Asn Leu Thr 1700 1705 1710 1715 GGA AGT GGG GCC ATA GCG GGT GCT TAC TCA AAG GCA TAC AAT GAA ACT 5600 Gly Ser Gly Ala Ile Ala Gly Ala Tyr Ser Lys Ala Tyr Asn Glu Thr 1720 1725 1730 TTT ACT TTA ACC TTT GTT AGT GGA AGA ACG GTT GGA ATT GGT GCT TAT 5648 Phe Thr Leu Thr Phe Val Ser Gly Arg Thr Val Gly Ile Gly Ala Tyr 1735 1740 1745 CTT GCC CGC CTA GGT ATG CGG TGC ATA CAG AGA CTT GAT CAG CCG ATC 5696 Leu Ala Arg Leu Gly Met Arg Cys Ile Gln Arg Leu Asp Gln Pro Ile 1750 1755 1760 ATC TTG ACT GGC TTC TCT ACA C TC AAC AAG TTA CTT GGG CGT GAG GTC 5744 Ile Leu Thr Gly Phe Ser Thr Leu Asn Lys Leu Leu Gly Arg Glu Val 1765 1770 1775 TAT AGC TCT CAC ATG CAA CTG GGT GGC CCG AAA ATC ATG GGC ACA AAT 5792 Tyr Ser Ser His Met Gln Leu Gly Gly Pro Lys Ile Met Gly Thr Asn 1780 1785 1790 1795 GGT GTT GTT CAT CTT ACA GTC TCA GAT GAT CTT GAA GGC GTA TCA GCA 5840 Gly Val Val His Leu Thr Val Ser Asp Asp Leu Glu Gly Val Ser Ala 1800 1805 1810 ATT CTC AAC TGG CTC AGC TAC ATT CCT GCT TAC GTG GGT GGT CCT CTT 5888 Ile Leu Asn Trp Leu Ser Tyr Ile Pro Ala Tyr Val Gly Gly Pro Leu 1815 1820 1825 CCT GTT CTT GCC CCT TTA GAT CCA CCG GAG AGA ATT GTG GAG TAT GTC 5936 Pro Val Leu Ala Pro Leu Asp Pro Pro Glu Arg Ile Val Glu Tyr Val 1830 1835 1840 CCA GAG AAC TCT TGC GAC CCA CGA GCG GCT ATA GCT GGG GTC AAA GAC 5984 Pro Glu Asn Ser Cys Asp Pro Arg Ala Ala Ile Ala Gly Val Lys Asp 1845 1850 1855 AAT ACC GGT AAA TGG CTT GGA GGT ATC TTT GAT AAA AAT AGT TTC ATT 6032 Asn Thr Gly Lys Trp Leu Gly Gly Ile Phe Asp Lys Asn Ser Phe Ile 186 0 1865 1870 1875 GAG ACT CTT GAA GGC TGG GCA AGG ACG GTA GTG ACT GGT AGA GCC AAG 6080 Glu Thr Leu Glu Gly Trp Ala Arg Thr Val Val Thr Gly Arg Ala Lys 1880 1885 1890 CTC GGG GGA ATA CCC GTT GGA GTT GTT GCA GTT GAG ACA CAG ACT GTC 6128 Leu Gly Gly Ile Pro Val Gly Val Val Ala Val Glu Thr Gln Thr Val 1895 1900 1905 ATG CAG ATC ATC CCA GCC GAT CCT GGA CAG CTT GAC TCT CAT GAA AGA 6176 Met Gln Ile Ile Pro Ala Asp Pro Gly Gln Leu Asp Ser His Glu Arg 1910 1915 1920 GTG GTT CCG CAA GCA GGG CAA GTC TGG TTT CCT GAT TCA GCG GCC AAG 6224 Val Val Pro Gln Ala Gly Gln Val Trp Phe Pro Asp Ser Ala Ala Lys 1925 1930 1935 ACT GCT CAA GCG CTT ATG GAT TTC AAC CGG GAA GAG CTT CCA TTG TTT 6272 Thr Ala Gln Ala Leu Met Asp Phe Asn Arg Glu Glu Leu Pro Leu Phe 1940 1945 1950 1955 ATC CTA GCG AAC TGG AGA GGG TTT TCA GGT GGG CAG AGA GAT CTT TTC 6320 Ile Leu Ala Asn Trp Arg Gly Phe Ser Gly Gly Gln Arg Asp Leu Phe 1960 1965 1970 GAA GGA ATA CTT CAG GCA GGT TCA ACT ATA GTA GAA AAT CTG AGA ACC 6368 Glu Gly Ile Leu Gln A la Gly Ser Thr Ile Val Glu Asn Leu Arg Thr 1975 1980 1985 TAT CGT CAG CCA GTG TTT GTG TAC ATC CCA ATG ATG GGA GAG CTG CGC 6416 Tyr Arg Gln Pro Val Phe Val Tyr Ile Pro Met Met Gly Glu Leu Arg 1990 1995 2000 GGT GGA GCG TGG GTT GTT GTT GAC AGC CAG ATA AAT TCG GAT TAT GTT 6464 Gly Gly Ala Trp Val Val Val Asp Ser Gln Ile Asn Ser Asp Tyr Val 2005 2010 2015 GAA ATG TAT GCT GAT GAA ACA GCT CGT GGA AAT GTG CTT GAG CCA GAA 6512 Glu Met Tyr Ala Asp Glu Thr Ala Arg Gly Asn Val Leu Glu Pro Glu 2020 2025 2030 2035 GGG ACA ATA GAG ATA AAA TTT AGA ACA AAA GAG CTA TTA GAG TGC ATG 6560 Gly Thr Ile Glu Ile Lys Phe Arg Thr Lys Glu Leu Leu Glu Cys Met 2040 2045 2050 GGA AGG TTG GAC CAG AAG CTA ATC AGT CTG AAA GCA AAA CTG CAA GAT 6608 Gly Arg Leu Asp Gln Lys Leu Ile Ser Leu Lys Ala Lys Leu Gln Asp 2055 2060 2065 GCC AAG CAA AGC GAG GCC TAT GCA AAC ATC GAG CTT CTC CAG CAA CAG 6656 Ala Lys Gln Ser Glu Ala Tyr Ala Asn Ile Glu Leu Leu Gln Gln Gln 2070 2075 2080 ATT AAA GCC CGA GAG AAA CAG CTT TTA CCA GTT TAT A TC CAA ATC GCC 6704 Ile Lys Ala Arg Glu Lys Gln Leu Leu Pro Val Tyr Ile Gln Ile Ala 2085 2090 2095 ACC AAA TTT GCA GAA CTT CAT GAC ACT TCC ATG AGA ATG GCT GCA AAG 6752 Thr Lys Phe Ala Glu Leu His Asp Thr Ser Met Arg Met Ala Ala Lys 2100 2105 2110 2115 GGA GTG ATC AAA AGT GTT GTG GAA TGG AGC GGC TCG CGG TCC TTC TTC 6798 Gly Val Ile Lys Ser Val Val Glu Trp Ser Gly Ser Arg Ser Phe Phe 2120 2125 2130 TAC AAA AAG CTC AAT AGG AGA ATC GCT GAG AGC TCT CTT GTG AAA AAC 6848 Tyr Lys Lys Leu Asn Arg Arg Ile Ala Glu Ser Ser Leu Val Lys Asn 2135 2140 2145 GTA AGA GAA GCA TCT GGA GAC AAC TTA GCA TAT AAA TCT TCA ATG CGT 6896 Val Arg Glu Ala Ser Gly Asp Asn Leu Ala Tyr Lys Ser Ser Met Arg 2150 2155 2160 CTG ATT CAG GAT TGG TTC TGC AAC TCT GAT ATT GCA AAG GGG AAA GAA 6944 Leu Ile Gln Asp Trp Phe Cys Asn Ser Asp Ile Ala Lys Gly Lys Glu 2165 2170 2175 GAA GCT TGG ACA GAC GAC CAA GTG TTC TTT ACA TGG AAG GAC AAT GTT 6992 Glu Ala Trp Thr Asp Asp Gln Val Phe Phe Thr Trp Lys Asp Asn Val 2180 2185 2190 2195 AGT AAC TAC GAG TTG AAG CTG AGC GAG TTG AGA GCG CAG AAA CTA CTG 7040 Ser Asn Tyr Glu Leu Lys Leu Ser Glu Leu Arg Ala Gln Lys Leu Leu 2200 2205 2210 AAC CAA CTT GCA GAG ATT GGG AAT TCC TCA GAT TTG CAA GCT CTG CCA 7088 Asn Gln Leu Ala Glu Ile Gly Asn Ser Ser Asp Leu Gln Ala Leu Pro 2215 2220 2225 CAA GGA CTT GCT AAT CTT CTA AAC AAG GTG GAG CCG TCG AAA AGA GAA 7136 Gln Gly Leu Ala Asn Leu Leu Asn Lys Val Glu Pro Ser Lys Arg Glu 2230 2235 2240 GAG CTG GTG GCT GCT ATT CGA AAG GTC TTG GGT TGACTGATAT CGAAGACTTT 7189 Glu Leu Val Ala Ala Ila Arle Lyg Val Leu Gly 2245 2250GTTGCCATTCATTTACTAGTAGTATCA CCAAGAAAGA TGGACATTTA AAGTTTGCTT GTGTCCCC AACAAAAAAA A 7340

SEQ ID NO: 22 Sequence length: 2254 Sequence type: Amino acid Origin organism name: Arabidopsis thaliana Sequence Met Ala Gly Ser Val Asn Gly Asn His Ser Ala Val Gly Pro Gly Ile 1 5 10 15 Asn Tyr Glu Thr Val Ser Gln Val Asp Glu Phe Cys Lys Ala Leu Arg 20 25 30 Gly Lys Arg Pro Ile His Ser Ile Leu Ile Ala Asn Asn Gly Met Ala 35 40 45 Ala Val Lys Phe Ile Arg Ser Val Arg Thr Trp Ala Tyr Glu Thr Phe 50 55 60 Gly Thr Glu Lys Ala Ile Leu Leu Val Gly Met Ala Thr Pro Glu Asp 65 70 75 80 Met Arg Ile Asn Ala Glu His Ile Arg Ile Ala Asp Gln Phe Val Glu 85 90 95 Val Pro Gly Gly Thr Asn Asn Asn Asn Tyr Ala Asn Val Gln Leu Ile 100 105 110 Val Glu Met Ala Glu Val Thr Arg Val Asp Ala Val Trp Pro Gly Trp 115 120 125 Gly His Ala Ser Glu Asn Pro Glu Leu Pro Asp Ala Leu Asp Ala Lys 130 135 140 Gly Ile Ile Phe Leu Gly Pro Pro Ala Ser Ser Met Ala Ala Leu Gly 145 150 155 160 Asp Lys Ile Gly Ser Ser Leu Ile Ala Gln Ala Ala Asp Val Pro Thr 165 170 175 Leu Pro Trp Ser Gly Ser His Val Lys Ile Pro Pro Asn Ser Asn Leu 180 185 190 Val Thr Ile Pro Glu Glu Ile Tyr Arg Gln Ala Cys Val Tyr Thr Thr 195 200 205 Glu Glu Ala Ile Ala Ser Cys Gln Val Val Gly Tyr Pro Ala Met Ile 210 215 220 Lys Ala Ser Trp Gly Gly Gly Gly Lys Gly Ile Arg Lys Val His Asn 225 230 235 240 Asp Asp Glu Val Arg Ala Leu Phe Lys Gln Val Gln Gly Glu Val Pro 245 250 255 Gly Ser Pro Ile Phe Ile Met Lys Val Ala Ser Gln Ser Arg His Leu 260 265 270 Glu Val Gln Leu Leu Cys Asp Lys His Gly Asn Val Ser Ala Leu His 275 280 285 Ser Arg Asp Cys Ser Val Gln Arg Arg His Gln Lys Ile Ile Glu Glu 290 295 300 Gly Pro Ile Thr Val Ala Pro Pro Glu Thr Val Lys Lys Leu Glu Gln 305 310 315 320 Ala Ala Arg Arg Leu Ala Lys Ser Val Asn Tyr Val Gly Ala Ala Thr 325 330 335 Val Glu Tyr Leu Tyr Ser Met Asp Thr Gly Glu Tyr Tyr Phe Leu Glu 340 345 350 Leu Asn Pro Arg Leu Gln Val Glu His Pro Val Thr Glu Trp Ile Ala 355 360 365 Glu Ile Asn Leu Pro Ala Ala Gln Val Ala Val Gly Met Gly Ile Pro 370 375 380 Leu Trp Gln IlePro Glu Ile Arg Arg Phe Tyr Gly Ile Glu His Gly 385 390 395 400 Gly Gly Tyr Asp Ser Trp Arg Lys Thr Ser Val Val Ala Phe Pro Phe 405 410 415 Asp Phe Asp Lys Ala Gln Ser Ile Arg Pro Lys Gly His Cys Val Ala 420 425 430 Val Arg Val Thr Ser Glu Asp Pro Asp Asp Gly Phe Lys Pro Thr Ser 435 440 445 Gly Arg Val Gln Glu Leu Ser Phe Lys Ser Lys Pro Asn Val Trp Ala 450 455 460 Tyr Phe Ser Val Lys Ser Gly Gly Gly Ile His Glu Phe Ser Asp Ser 465 470 475 480 Gln Phe Gly His Val Phe Ala Phe Gly Glu Ser Arg Ala Leu Ala Ile 485 490 495 Ala Asn Met Val Leu Gly Leu Lys Glu Ile Gln Ile Arg Gly Glu Ile 500 505 510 Arg Thr Asn Val Asp Tyr Thr Ile Asp Leu Leu His Ala Ser Asp Tyr 515 520 525 Arg Asp Asn Lys Ile His Thr Gly Trp Leu Asp Ser Arg Ile Ala Met 530 535 540 Arg Val Arg Ala Glu Arg Pro Pro Trp Tyr Leu Ser Val Val Gly Gly 545 550 555 560 Ala Leu Tyr Lys Ala Ser Ala Thr Ser Ala Ala Val Val Ser Asp Tyr 565 570 575 Val Gly Tyr Leu Glu Lys Gly Gln Ile Pro Pro Lys His Ile Ser Leu 580 585 590 Val His Ser GlnVal Ser Leu Asn Ile Glu Gly Ser Lys Tyr Thr Ile 595 600 605 Asp Val Val Arg Gly Gly Ser Gly Thr Tyr Arg Leu Arg Met Asn Lys 610 615 620 Ser Glu Val Val Ala Glu Ile His Thr Leu Arg Asp Gly Gly Leu Leu 625 630 635 640 Met Gln Leu Asp Gly Lys Ser His Val Ile Tyr Ala Glu Glu Glu Ala 645 650 655 Ala Gly Thr Arg Leu Leu Ile Asp Gly Arg Thr Cys Leu Leu Gln Asn 660 665 670 Asp His Asp Pro Ser Lys Leu Met Ala Glu Thr Pro Cys Lys Leu Met 675 680 685 Arg Tyr Leu Ile Ser Asp Asn Ser Asn Ile Asp Ala Asp Thr Pro Tyr 690 695 700 Ala Glu Val Glu Val Met Lys Met Cys Met Pro Leu Leu Ser Pro Ala 705 710 715 720 Ser Gly Val Ile His Phe Lys Met Ser Glu Gly Gln Ala Met Gln Ala 725 730 735 Gly Glu Leu Ile Ala Asn Leu Asp Leu Asp Asp Pro Ser Ala Val Arg 740 745 750 Lys Ala Glu Pro Phe His Gly Ser Phe Pro Arg Leu Gly Leu Pro Thr 755 760 765 Ala Ile Ser Gly Arg Val His Gln Arg Cys Ala Ala Thr Leu Asn Ala 770 775 780 Ala Arg Met Ile Leu Ala Gly Tyr Glu His Lys Val Asp Glu Val Val 785 790 795 800 Gln Asp Leu LeuAsn Cys Leu Asp Ser Pro Glu Leu Pro Phe Leu Gln 805 810 815 Trp Gln Glu Cys Phe Ala Val Leu Ala Thr Arg Leu Pro Lys Asn Leu 820 825 830 Arg Asn Met Leu Glu Ser Lys Tyr Arg Glu Phe Glu Ser Ile Ser Arg 835 840 845 Asn Ser Leu Thr Thr Asp Phe Pro Ala Lys Leu Leu Lys Gly Ile Leu 850 855 860 Glu Ala His Leu Ser Ser Cys Asp Glu Lys Glu Arg Gly Ala Leu Glu 865 870 875 880 Arg Leu Ile Glu Pro Leu Met Ser Leu Ala Lys Ser Tyr Glu Gly Gly 885 890 895 Arg Glu Ser His Ala Arg Val Ile Val His Ser Leu Phe Glu Glu Tyr 900 905 910 Leu Ser Val Glu Glu Leu Phe Asn Asp Asn Met Leu Ala Asp Val Ile 915 920 925 Glu Arg Met Arg Gln Leu Tyr Lys Lys Asp Leu Leu Lys Ile Val Asp 930 935 940 Ile Val Leu Ser His Gln Gly Ile Lys Asn Lys Asn Lys Leu Val Leu 945 950 955 960 Arg Leu Met Glu Gln Leu Val Tyr Pro Asn Pro Ala Ala Tyr Arg Asp 965 970 975 Lys Leu Ile Arg Phe Ser Thr Leu Asn His Thr Asn Tyr Ser Glu Leu 980 985 990 Ala Leu Lys Ala Ser Gln Leu Leu Glu Gln Thr Lys Leu Ser Glu Leu 995 1000 1005 Arg Ser Asn Ile Al a Arg Ser Leu Ser Glu Leu Glu Met Phe Thr Glu 1010 1015 1020 Asp Gly Glu Asn Met Asp Thr Pro Lys Arg Lys Ser Ala Ile Asn Glu 1025 1030 1035 1040 Arg Ile Glu Asp Leu Val Ser Ala Ser Leu Ala Val Glu Asp Ala Leu 1045 1050 1055 Val Gly Leu Phe Asp His Ser Asp His Thr Leu Gln Arg Arg Val Val 1060 1065 1070 Glu Thr Tyr Ile Arg Arg Leu Tyr Gln Pro Tyr Val Val Lys Asp Ser 1075 1080 1085 Val Arg Met Gln Trp His Arg Ser Gly Leu Leu Ala Ser Trp Glu Phe 1090 1095 1100 Leu Glu Glu His Met Glu Arg Lys Asn Ile Gly Leu Asp Asp Pro Asp 1105 1110 1115 1120 Thr Ser Glu Lys Gly Leu Val Glu Lys Arg Ser Lys Arg Lys Trp Gly 1125 1130 1135 Ala Met Val Ile Ile Lys Ser Leu Gln Phe Leu Pro Ser Ile Ile Ser 1140 1145 1150 Ala Ala Leu Arg Glu Thr Lys His Asn Asp Tyr Glu Thr Ala Gly Ala 1155 1160 1165 Pro Leu Ser Gly Asn Met Met His Ile Ala Ile Val Gly Ile Asn Asn 1170 1175 1180 Gln Met Ser Leu Leu Gln Asp Ser Gly Asp Glu Asp Gln Ala Gln Glu 1185 1190 1195 1200 Arg Val Asn Lys Leu Ala Lys Ile Leu Lys Glu Glu Glu Val Ser Ser 1205 1210 1215 Ser Leu Cys Ser Ala Gly Val Gly Val Ile Ser Cys Ile Ile Gln Arg 1220 1225 1230 Asp Glu Gly Arg Thr Pro Met Arg His Ser Phe His Trp Ser Leu Glu 1235 1240 1245 Lys Gln Tyr Tyr Val Glu Glu Pro Leu Leu Arg His Leu Glu Pro Pro 1250 1255 1260 Leu Ser Ile Tyr Leu Glu Leu Asp Lys Leu Lys Gly Tyr Ser Asn Ile 1265 1270 1275 1280 Gln Tyr Thr Pro Ser Arg Asp Arg Gln Trp His Leu Tyr Thr Val Thr 1285 1290 1295 Asp Lys Pro Val Pro Ile Lys Arg Met Phe Leu Arg Ser Leu Val Arg 1300 1305 1310 Gln Ala Thr Met Asn Asp Gly Phe Ile Leu Gln Gln Gly Gln Asp Lys 1315 1320 1325 Gln Leu Ser Gln Thr Leu Ile Ser Met Ala Phe Thr Ser Lys Cys Val 1330 1335 1340 Leu Arg Ser Leu Met Asp Ala Met Glu Glu Leu Glu Leu Asn Ala His 1345 1350 1355 1360 Asn Ala Ala Met Lys Pro Asp His Ala His Met Phe Leu Cys Ile Leu 1365 1370 1375 Arg Glu Gln Gln Ile Asp Asp Leu Val Pro Phe Pro Arg Arg Val Glu 1380 1385 1390 Val Asn Ala Glu Asp Glu Glu Thr Thr Val Glu Met Ile Leu Glu Glu 1395 1400 1405 Ala Ala Arg Glu Il e His Arg Ser Val Gly Val Arg Met His Arg Leu 1410 1415 1420 Gly Val Cys Glu Trp Glu Val Arg Leu Trp Leu Val Ser Ser Gly Leu 1425 1430 1435 1440 Ala Cys Gly Ala Trp Arg Val Val Val Ala Asn Val Thr Gly Arg Thr 1445 1450 1455 Cys Thr Val His Ile Tyr Arg Glu Val Glu Thr Pro Gly Arg Asn Ser 1460 1465 1470 Leu Ile Tyr His Ser Ile Thr Lys Lys Gly Pro Leu His Glu Thr Pro 1475 1480 1485 Ile Ser Asp Gln Tyr Lys Pro Leu Gly Tyr Leu Asp Arg Gln Arg Leu 1490 1495 1500 Ala Ala Arg Arg Ser Asn Thr Thr Tyr Cys Tyr Asp Phe Pro Leu Ala 1505 1510 1515 1520 Phe Gly Thr Ala Leu Glu Leu Leu Trp Ala Ser Gln His Pro Gly Val 1525 1530 1535 Lys Lys Pro Tyr Lys Asp Thr Leu Ile Asn Val Lys Glu Leu Val Phe 1540 1545 1550 Ser Lys Pro Glu Gly Ser Ser Gly Thr Ser Leu Asp Leu Val Glu Arg 1555 1560 1565 Pro Pro Gly Leu Asn Asp Phe Gly Met Val Ala Trp Cys Leu Asp Met 1570 1575 1580 Ser Thr Pro Glu Phe Pro Met Gly Arg Lys Leu Leu Val Ile Ala Asn 1585 1590 1595 1600 Asp Val Thr Phe Lys Ala Gly Ser Phe Gly Pro Arg Glu Asp Ala Phe 1605 1610 1615 Phe Leu Ala Val Thr Glu Leu Ala Cys Ala Lys Lys Leu Pro Leu Ile 1620 1625 1630 Tyr Leu Ala Ala Asn Ser Gly Ala Arg Leu Gly Val Ala Glu Glu Val 1635 1640 1645 Lys Ala Cys Phe Lys Val Gly Trp Ser Asp Glu Ile Ser Pro Glu Asn 1650 1655 1660 Gly Phe Gln Tyr Ile Tyr Leu Ser Pro Glu Asp His Glu Arg Ile Gly 1665 1670 1675 1680 Ser Ser Val Ile Ala His Glu Val Lys Leu Ser Ser Gly Glu Thr Arg 1685 1690 1695 Trp Val Ile Asp Thr Ile Val Gly Lys Glu Asp Gly Ile Gly Val Glu 1700 1705 1710 Asn Leu Thr Gly Ser Gly Ala Ile Ala Gly Ala Tyr Ser Lys Ala Tyr 1715 1720 1725 Asn Glu Thr Phe Thr Leu Thr Phe Val Ser Gly Arg Thr Val Gly Ile 1730 1735 1740 Gly Ala Tyr Leu Ala Arg Leu Gly Met Arg Cys Ile Gln Arg Leu Asp 1745 1750 1755 1760 Gln Pro Ile Ile Leu Thr Gly Phe Ser Thr Leu Asn Lys Leu Leu Gly 1765 1770 1775 Arg Glu Val Tyr Ser Ser His Met Gln Leu Gly Gly Pro Lys Ile Met 1780 1785 1790 Gly Thr Asn Gly Val Val His Leu Thr Val Ser Asp Asp Leu Glu Gly 1795 1800 1805 Val Ser Ala Ile Le u Asn Trp Leu Ser Tyr Ile Pro Ala Tyr Val Gly 1810 1815 1820 Gly Pro Leu Pro Val Leu Ala Pro Leu Asp Pro Pro Glu Arg Ile Val 1825 1830 1835 1840 Glu Tyr Val Pro Glu Asn Ser Cys Asp Pro Arg Ala Ala Ile Ala Gly 1845 1850 1855 Val Lys Asp Asn Thr Gly Lys Trp Leu Gly Gly Ile Phe Asp Lys Asn 1860 1865 1870 Ser Phe Ile Glu Thr Leu Glu Gly Trp Ala Arg Thr Val Val Thr Gly 1875 1880 1885 Arg Ala Lys Leu Gly Gly Ile Pro Val Gly Val Val Ala Val Glu Thr 1890 1895 1900 Gln Thr Val Met Gln Ile Ile Pro Ala Asp Pro Gly Gln Leu Asp Ser 1905 1910 1915 1920 His Glu Arg Val Val Pro Gln Ala Gly Gln Val Trp Phe Pro Asp Ser 1925 1930 1935 Ala Ala Lys Thr Ala Gln Ala Leu Met Asp Phe Asn Arg Glu Glu Leu 1940 1945 1950 Pro Leu Phe Ile Leu Ala Asn Trp Arg Gly Phe Ser Gly Gly Gln Arg 1955 1960 1965 Asp Leu Phe Glu Gly Ile Leu Gln Ala Gly Ser Thr Ile Val Glu Asn 1970 1975 1980 Leu Arg Thr Tyr Arg Gln Pro Val Phe Val Tyr Ile Pro Met Met Gly 1985 1990 1995 2000 Glu Leu Arg Gly Gly Ala Trp Val Val Val Asp Ser Gln Ile Asn Ser 2005 2010 2015 Asp Tyr Val Glu Met Tyr Ala Asp Glu Thr Ala Arg Gly Asn Val Leu 2020 2025 2030 Glu Pro Glu Gly Thr Ile Glu Ile Lys Phe Arg Thr Lys Glu Leu Leu 2035 2040 2045 Glu Cys Met Gly Arg Leu Asp Gln Lys Leu Ile Ser Leu Lys Ala Lys 2050 2055 2060 Leu Gln Asp Ala Lys Gln Ser Glu Ala Tyr Ala Asn Ile Glu Leu Leu 2065 2070 2075 2080 Gln Gln Gln Ile Lys Ala Arg Glu Lys Gln Leu Leu Pro Val Tyr Ile 2085 2090 2095 Gln Ile Ala Thr Lys Phe Ala Glu Leu His Asp Thr Ser Met Arg Met 2100 2105 2110 Ala Ala Lys Gly Val Ile Lys Ser Val Val Glu Trp Ser Gly Ser Arg 2115 2120 2125 Ser Phe Phe Tyr Lys Lys Leu Asn Arg Arg Ile Ala Glu Ser Ser Leu 2130 2135 2140 Val Lys Asn Val Arg Glu Ala Ser Gly Asp Asn Leu Ala Tyr Lys Ser 2145 2150 2155 2160 Ser Met Arg Leu Ile Gln Asp Trp Phe Cys Asn Ser Asp Ile Ala Lys 2165 2170 2175 Gly Lys Glu Glu Ala Trp Thr Asp Asp Gln Val Phe Phe Thr Trp Lys 2180 2185 2190 Asp Asn Val Ser Asn Tyr Glu Leu Lys Leu Ser Glu Leu Arg Ala Gln 2195 2200 2205 Lys Leu Leu Asn Gl n Leu Ala Glu Ile Gly Asn Ser Ser Asp Leu Gln 2210 2215 2220 Ala Leu Pro Gln Gly Leu Ala Asn Leu Leu Asn Lys Val Glu Pro Ser 2225 2230 2235 2240 Lys Arg Glu Glu Leu Val Ala Ala Ile Arg Lys Val Leu Gly 2245 2250 2254

[0109]

[Brief description of drawings]

FIG. 1 shows a comparison of amino acid sequences of regions in which similarities are recognized between biotin carboxylase domains of ACCase derived from various organisms.

FIG. 2 Arabidopsis ACCase gene (ACC
physical map of genomic clones of case-1, ACCase-2, ACCase-3).

FIG. 3: Amino acid sequence “BC in the biotin carboxyl carrier protein domain of ACCase”
The comparison between organisms of "CP" is shown.

FIG. 4 shows the results of Southern hybridization with genomic DNA of Arabidopsis thaliana strain Columbia (C) and Landsberg strain (L) using an amplified fragment of 927 bp derived from a part of the Arabidopsis ACCase-1 gene as a probe. Fig.

FIG. 5 shows an RFLP map of chromosome 1 of Arabidopsis thaliana and a locus of the ACCase-1 gene.

FIG. 6: Physical map of a genomic clone containing the rapeseed ACCase gene.

FIG. 7 shows the construction of a sense / ACCase gene expression vector.

FIG. 8 shows the construction of an antisense / ACCase gene expression vector.

FIG. 9: Physical map of a cDNA clone of Arabidopsis ACCase.

FIG. 10 shows the construction of a sense / ACCase gene expression vector.

[Explanation of symbols]

In FIG. 4, “M” in the figure indicates a DNA molecular weight marker.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Office reference number FI technical display location C12N 9/00 9359-4B

Claims (13)

[Claims] 1. A DNA fragment amplified by the polymerase chain reaction using plant genomic DNA or cDNA as a template, wherein the polymerase chain reaction is followed by SEQ ID NOs: 1 to 6 in the sequence listing.
Which encodes a part of acetyl-CoA carboxylase, which is obtained by using as a primer one selected from the oligonucleotides shown in 1) and one selected from the oligonucleotides shown in SEQ ID NOS: 11 to 14 of the sequence listing. Gene fragment to do. 2. The gene fragment according to claim 1, wherein the plant is a cruciferous plant. 3. The gene fragment according to claim 2, which has the nucleotide sequence represented by SEQ ID NO: 15 in the sequence listing. 4. Acetyl C selected from a plant gene library by hybridization using the gene fragment according to any one of claims 1 to 3 as a probe.
oA carboxylase A gene encoding the entire amino acid sequence. 5. The gene according to claim 4, wherein the plant is a cruciferous plant. 6. An Escherichia coli FERM P-13792 strain, an Escherichia coli FERM P-13793 strain and an Escherichia coli FERM P strain.
Arabidopsis genomic clones pATgACC-1a and pATgACC-1 which are respectively retained by strain 13794
The gene according to claim 5, which has a sequence contained in b and pATgACC-1c. 7. The gene according to claim 5, wherein the plant of the family Cruciferae is Arabidopsis thaliana and has the physical map shown in FIG. 2 (b). 8. The gene according to claim 5, wherein the plant of the family Cruciferae is Arabidopsis thaliana and has the physical map shown in FIG. 2 (c). 9. A gene encoding the entire amino acid sequence of acetyl CoA carboxylase selected from a plant gene library by hybridization using all or part of the gene of claim 4 as a probe. 10. The plant is oilseed rape, FIG.
The gene according to claim 9, which has the physical map shown in (a) or (b). 11. A DNA fragment encoding acetyl-CoA carboxylase having the amino acid sequence set forth in SEQ ID NO: 22 in the Sequence Listing. 12. The DNA fragment according to claim 11, which has a sequence represented by nucleotide numbers 408 to 7169 in SEQ ID NO: 21 of the sequence listing. 13. The gene fragment according to claim 1 to 3, the gene according to claim 4 to 10 and claim 11 or 12.
A transformed plant body in which the expression level of acetyl-CoA carboxylase is changed by introducing at least a part of any of the described DNA fragments into a plant.