JPH07111891A - Expression of recombinant bile salt activated lipase in high yield - Google Patents

Abstract

PURPOSE:To enable the expression of a recombinant bile salt activated lipase useful for the treatment of pancreatic insufficiency, etc., in high yield by culturing a specific transformant under specific condition. CONSTITUTION:A gene coding a secretory signal is linked to a defective gene fragment obtained by deleting a part or total of the gene coding an amino acid sequence consisting of 16 repeated structures containing a peptide composed of 11 amino acid residues existing in the carboxy-terminal region of a gene sequence coding a bile salt activated lipase. The obtained gene is integrated to an EcoRI site of a plasmid pHIL301 and Pichia pastoris GSl15 strain is transformed by the plasmid. The transformant is proliferated at about 30 deg.C and a dissolved oxygen content of 30-50% and cultured in a methanol-containing medium at 15-25 deg.C and a dissolved oxygen content of <20% to effect the induction and expression of bile salt activated lipase in the medium. The recombinant bile salt activated lipase can be expressed in high yield by this process.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a recombinant bile salt-activating lipase, a gene encoding the lipase, a recombinant plasmid having the gene, a transformant carrying the plasmid, and a recombinant bile salt activity. The present invention relates to a method for producing a modified lipase.

[0002]

BACKGROUND OF THE INVENTION Bile salt-activated lipase (hereinafter sometimes referred to as BAL) is one of lipid hydrolase (lipase) and is a digestive tract. It is secreted by the pancreas and is also found in milk. BAL is activated by bile salts in the small intestine, and completely hydrolyzes triglyceride into fatty acids and glycerin, and also hydrolyzes cholesterol and vitamin esters.

[0003] BAL deficiency causes growth failure in infants due to indigestion of milk fat. Therefore, food additives containing BAL have been proposed (Japanese Patent Laid-Open No. 1-231848).
issue). In addition, administration of BAL caused cystic fibrosis.
It is expected that symptoms of pancreatic insufficiency such as fibrosis) will be reduced from the viewpoint of lipid digestion. However, when extracting BAL from milk, for example, the cost required for securing and refining breast milk as a raw material, and contamination by viruses. Due to problems such as nation, it is not easy to secure a sufficient amount. Therefore, the production of BAL using gene recombination technology is expected, and BAL has already been isolated and purified from milk (Wa
ng and Johnson: Anal. Biochem. 133, 457-461 (198
3)). Further, a cDNA encoding BAL is also known. From the sequence, it has been revealed that the BAL protein consists of 722 amino acids, and a repeating structure consisting of 16 times 11 amino acids is present at the C-terminus (WO91 / 152).
No. 34).

However, a recombinant BAL using the above cDNA and a method for producing the same have not been found yet.

Therefore, it has been desired to develop the above recombinant BAL and a method for expressing it in high yield.

[0006]

[Means for Solving the Problems] As one of the yeast heterologous protein expression systems, Pichia pasto (Pichia pasto)
ris, hereinafter referred to as Pichia yeast) is known as a host (JP-A-61-108383, JP-A-61-173781).
No. 63-44899, JP-A No. 1-128790, etc., and specific examples of substance production include streptokinase (JP-A No.
62-296881), TNF (JP-A-63-164891), HIV
24kDA gag protein (JP-A-2-20286), human IL-2 (JP-A-2-104292), hepatitis B pre
S2 protein (JP-A-2-84176, JP-A-2-27990) and the like are known. Based on these findings, the present inventors have used BAL cDNA with Pichia yeast as a host,
As a result of diligent research on the large-scale production of BAL, they succeeded in producing recombinant BAL for the first time.

That is, the present inventors have found that the 16-fold repeating structure existing in the C-terminal region of BAL protein is a recombinant B
When the expression was examined by deleting the repetitive structure, which was considered to be related to the expression of AL protein, BAL in which a part or all of the repetitive structure was deleted (hereinafter sometimes referred to as defective BAL) has a repetitive structure of 16 times. It was found that the expression was about 10 to 100 times more efficiently than that of BAL having Moreover, BAL in which this repeating structure is partially or completely deleted, that is, the C-terminal repeating structure is 0 to 15 times, BAL has pH stability, temperature stability, heparin-binding ability, and decomposition of various fatty acid triglycerides. Natural BAL in various properties such as speed and decomposition of infant formula
Since it is not different from the above, it was also found to be a useful one which can be used similarly to natural BAL.

The present inventors have also found that it is preferable that the above recombinant bile salt-activated lipase has a specific 5 amino acid sequence at its N-terminus.

That is, in the present invention, 1 to 15 amino acid sequences selected from amino acid sequences (1) to (7) described in SEQ ID NO: 2 are bound to the amino acid sequence of SEQ ID NO: 1 and the C-terminal of the amino acid sequence. From the amino acid sequence (1) to (7) described in SEQ ID NO: 2 at the C-terminal of the amino acid sequence, or the amino acid sequence in which the amino acid sequence described in SEQ ID NO: 3 is bound to the N-terminal of the amino acid sequence. A recombinant BAL represented by an amino acid sequence in which 1 to 15 selected amino acid sequences are bound and the amino acid sequence of SEQ ID NO: 3 is bound to the N-terminus.

The present invention also provides a gene encoding the above recombinant BAL; a recombinant plasmid having the gene; and a transformant carrying the recombinant plasmid.

Furthermore, the present invention provides a method for producing recombinant BAL, which comprises culturing a transformant carrying the recombinant plasmid, and collecting the transformant from the culture.

On the other hand, when BAL is expressed by Pichia yeast in fermenter culture, a much higher expression level can be obtained by setting a lower culture temperature and a lower dissolved oxygen content than the usual optimum expression conditions. I found it.

That is, the present invention relates to the plasmid pHL3.
DN encoding a secretory signal at the EcoRI site of 01
Bile salt-activated lipase is expressed by fermenter culture using Pichia pastoris GS115 strain transformed with a recombinant plasmid incorporating a structural gene for bile salt-activated lipase linked to A. In the method, the culture temperature is 15 to 25 ° C.,
The present invention also provides a method for highly efficient expression of bile salt-activated lipase, which is characterized in that the amount of dissolved oxygen is 20% or less.

To produce the recombinant BAL of the present invention, B
Based on the full-length cDNA of AL, the recombinant BAL of the present invention
The gene encoding the gene may be prepared, incorporated into various known vector systems to obtain a recombinant plasmid, which is transformed into a host typified by yeast, and the obtained transformant may be cultured.

As the BAL cDNA for obtaining the recombinant plasmid in the present invention, cDNA is prepared from a cDNA library (Clontech) prepared from lactating human breast tissue according to the method described in WO91 / 15234. Alternatively, it may be chemically synthesized from the sequence described in WO91 / 15234.

Defective BAL is a cDN obtained by removing from the full-length cDNA of BAL the part encoding 1 to 16 times of the 16 times repeating structure of the C-terminal region of BAL protein.
A is used. BAL in which the amino acid sequence of SEQ ID NO: 3 is bound to the N-terminus is 5'of the full-length BAL cDNA.
A nucleotide sequence encoding the amino acid sequence may be attached to the side. There is no limitation on the method for obtaining such cDNA.
CDNA may be prepared according to the method described in WO91 / 15234, from which 1 to 16 repeated structures may be removed.
It may be chemically synthesized, and a defective cD naturally generated during the growth of a plasmid vector containing the cDNA in a host.
NA may be used. In addition, 1 to 15 repeating structures of the C-terminal region of recombinant BAL are (1) to SEQ ID NO: 2 to
The sequences of (7) may be combined in any order.

The host-vector system used for the expression of the recombinant BAL of the present invention is the above-mentioned JP-A-61-108383, JP-A-61-173781, JP-A-63-44899 and JP-A-1-48383. 12879
Pichia GS115, which is a Pichia yeast lacking the histidinol dehydrogenase activity described in No. 0, etc.
(Deposit No. NRRL Y-15851) was used as the host and pA08
No. 04 (extracted and prepared from the Escherichia coli strain of deposit number NRRL B-18114) into which the kanamycin resistance gene was introduced, pHIL3
01 (see JP-A-2-104292) is preferably used as an expression vector.

In order to produce the recombinant BAL of the present invention using these, the recombinant BAL cDN is first added to EcoRI which is a unique site of the expression vector pHIL301.
A recombinant expression vector having A inserted therein is prepared (FIG. 1).

To transform Pichia yeast, the cell wall is digested with an enzyme to give spheroplasts, which are then mixed with the recombinant expression vector in the presence of calcium ions and polyethylene glycol. Further, spheroplasts are regenerated by culturing in a selective medium lacking histidine and a selective medium containing kanamycin to grow colonies.

In expressing the recombinant BAL protein, the transformed Pichia yeast strain was sufficiently grown at about 30 ° C. under aerobic conditions, and then the temperature was about 15 to 25 ° C. in an expression medium containing methanol. And reduce the amount of dissolved oxygen (DO) to 20
The expression of the recombinant BAL protein is induced by adjusting the amount to be not more than%.

When such culture conditions are used, the expression level of full-length BAL (natural BAL) described in WO91 / 15234 is also increased.

[0022]

INDUSTRIAL APPLICABILITY According to the present invention, BAL by gene recombination having a performance equivalent to that of natural BAL can be expressed with high efficiency, simply and inexpensively.

[0023]

EXAMPLES The present invention will be described in detail below with reference to examples, but the present invention is not limited thereto.

Example 1 (Production of Recombinant BAL) (1) Construction of BAL Expression Vector Full-length BAL cDNA was prepared according to the method described in WO91 / 15234, and inserted into the PstI site of plasmid pBR322 for recombination. A plasmid was obtained. E. coli M
The plasmid was introduced into C1061 and propagated, and the plasmid was transferred to Birnboim.
Et al. (Birnboim and Doby, Nucleic Acids Researc
h, 7, 1513 (1979)). On the other hand, a cDNA obtained by removing a part of the repeating structure of the C-terminal region of the BAL protein from the BAL cDNA was prepared from 9 of the repeating structures spontaneously generated by growing a plasmid containing the BAL cDNA in E. coli. A batch-deficient BAL cDNA was selected and obtained. From the BAL cDNA thus obtained, the portion encoding the secretory signal of BAL itself and its 5 ′ upstream were removed, and instead, the DNA encoding the secretory signal of baker's yeast invertase (SUC2) was ligated. This BAL cDNA was incorporated into the EcoRI site of the expression vector pHIL301 to obtain a recombinant expression vector (Fig. 1). That is, pHIL3
01 was digested with EcoRI, treated with alkaline phosphatase and dephosphorylated.

(2) Cell Proliferation GTS115 colonies were mixed with 10 ml of YPD medium (1 L composition: yeast extract 10 g, peptone 20 g and 2).
0 g of glucose) and inoculated with shaking at 30 ° C. until saturated to obtain a seed culture. In a 500 ml culture flask, 200 ml of YPD medium was added, and the seed culture was added to 10 ml.
μl was added, and the mixture was cultivated at 30 ° C. with stirring until the absorbance at 600 nm of the culture reached 0.2 to 0.3. After completion of the culture, the cells were collected by centrifugation at 1500 xg for 5 minutes at room temperature. This cell was used for the following transformation.

(3) Preparation of spheroplast The collected cells were washed once with 10 ml of sterilized water and 1500 ×
Centrifuge at room temperature for 5 minutes at room temperature and discard the supernatant. Then 10 ml
Fresh SED (1 M sorbitol, 25 mM EDT
Wash once with A and 50 mM DTT), 5 at 1500 × g
After centrifuging at room temperature for minutes, the supernatant was discarded. 10 ml of 1M
Was washed once with sorbitol, and centrifuged at 1500 xg for 5 minutes at room temperature, and the supernatant was discarded. 10 ml of SCE buffer (9.
The cells were suspended in 1 g of sorbitol, 1.47 g of sodium citrate and 0.168 g of EDTA dissolved in 50 ml of water and adjusted to pH 5.8 with hydrochloric acid. Subsequently, a 60 mg solution of 3 mg / ml of thymolyase (Zymolyas
e, Miles Laboratories) 7.5 μl was added, and the mixture was gently stirred and kept at 30 ° C. for 10 minutes to digest the cell wall. Collect the formed spheroplasts and collect 10 ml of 1
M sorbitol was added and the mixture was centrifuged at 1,000 × g for 5 minutes. The supernatant is discarded and 10 ml of CaS (1 M sorbitol, 10 mM CaCl ₂ and 10 mM Tris-HCl (pH
It was washed once with 7.5)) and suspended in 0.6 ml of CaS.

(4) Transformation 10 μg of the recombinant expression vector containing the BAL cDNA was completely digested with Bg1II to give a linear form, which was treated with TE buffer (0.01 M containing 1.0 mM EDTA, pH 7.4). The suspension was suspended in 10 μl of Tris buffer and placed in a sterile polypropylene tube of 12 × 75 mm, 100 μl of spheroplast was added, and the mixture was incubated at room temperature for about 20 minutes. Then P
EG solution (20% polyethylene glycol 3350, 1
0 mM CaCl ₂ and 10 mM Tris-HCl (pH 7.4))
Add 1 ml and incubate at room temperature for about 15 minutes.
The supernatant was discarded by centrifuging at 00 × g for 5 minutes. SOS solution (1 M sorbitol, 10 mM CaCl ₂ and 33.3)
% YPD medium), and incubated at room temperature for 30 minutes, and then 850 μl of 1M sorbitol solution was added.

(5) Regeneration of spheroplast Regenerated agar medium (1 L composition: yeast nitrogen base with
ammonium sulfate 6.7g, biotin 400μg,
182 g sorbitol, 10 g dextrose, 1 agar
0 g, glutamine, methionine, lysine, leucine and isoleucine 50 mg each, histidine assay medium (Dif
2 ml of ico) was dissolved in an autoclave and poured into a plate to be solidified. On the other hand, recycled agar 10
ml was dissolved in an autoclave, 10 or 990 μl of a transformation sample was added while keeping it at 45 ° C., and the mixture was poured onto the solidified regenerated agar. The plate was incubated at 30 ° C for 3-5 days.

(6) Identification of BAL-producing clones His + transformants were obtained by collecting colonies that had grown on the regenerated agar medium (without histidine). The transformant was used as BMGY medium (1 L composition: calcium phosphate buffer (pH 6.0) 100 ml, yeast ni).
trogen base with ammonium sulfate 13.4 g, biotin 400 μg, yeast extract 10 g, glycerol 10
ml, peptone 20 g), after culturing for 2 days, the medium was BMMY
The cells were cultured for 2 days in a medium (BMGY medium supplemented with 5 ml of methanol in place of glycerin). After centrifugation, 10 μl of the culture supernatant was collected, subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and subjected to Western blot hybridization with an anti-BAL antibody. From this result, the transformant into which the full-length BAL cDNA was introduced was approximately 110 kd BAL corresponding to full-length BAL.
In the transformant into which the BAL cDNA in which the repeat structure was deleted 9 times was introduced, B was deleted in which the repeat structure was deleted 9 times.
It was confirmed that about 85 kd of BAL corresponding to AL was produced. In addition, BA in which the repeating structure was deleted 9 times
It was also revealed that L was expressed about 10 to 100 times more than full-length BAL. All of the remaining culture supernatant was collected, purified by affinity column chromatography using heparin as a carrier to purify the defective BAL, and the amino acid at the N-terminus was analyzed.
It was revealed that 5 amino acids, r-Met-Thr-Gly-Ser, were added.

Example 2 (Production of defective BAL whose N-terminus is the same as mature BAL)

In order to produce BAL having the same amino acid sequence as the natural BAL lacking these 5 amino acids, the secretion signal of the yeast invertase gene SUC2 (Table 1),

[0032]

[Table 1]

As shown in Table 2, only the base sequence was changed to the recognition site (AGCGCT) of the restriction enzyme Aor51HI without changing the two amino acid sequences immediately upstream of the secretory signal cleavage site.

[0034]

[Table 2]

Furthermore, having this restriction enzyme site at the N-terminus,
In addition, a BAL gene lacking the C-terminal 9-fold repeating structure was constructed and ligated with the SUC2 secretion signal as described above.

This base sequence was inserted into the expression vector pHIL301 by the same method as described above, and the GS115 strain was transformed with the obtained recombinant expression vector. BAL is expressed in the obtained transformant, and the culture supernatant is used as it is for SD.
When subjected to S-PAGE, a protein secreted at the position of the expected molecular weight was detected. The presence of a protein activated by taurocholate was confirmed by measuring the esterase activity. Furthermore, BAL was purified from the culture supernatant by affinity column chromatography using heparin as a carrier, and N-terminal amino acid analysis was carried out. From N-terminal to 10 amino acids, mature BAL c
It was in agreement with the sequence expected from the DNA sequence. Therefore, this recombinant BAL had an amino acid sequence (1-615) in which the C-terminal 9-fold repeating structure was deleted from the amino acid sequence of mature BAL shown in SEQ ID NO: 7, and the recombinant BAL obtained in Example 1 was obtained. Differs from that in the absence of the 5 amino acids set forth in SEQ ID NO: 3 at the N-terminus.

Example 3 (High-efficiency expression by fermenter culture) (1) Increase in copy number of BAL expression vector Among 107 BAL-producing strains lacking the repeated structure obtained in the above 9 times, GS115 was selected. In order to obtain a strain in which many BAL genes were introduced into the chromosome, kanamycin resistance (1.5 mg / ml) was selected, and two resistant strains (# 53 and # 57) were obtained. Genomic DNA was extracted from these resistant strains and the copy number of the inserted BAL gene was examined by Southern blot hybridization. As a result, 6 copies were found in # 53 and 14 copies were found in # 57.
A copy insertion was confirmed. BAL was expressed in # 53 by the same method as described above, and the culture supernatant was directly subjected to SDS-PAGE to examine the expression level of BAL. As a result, it was found that the expression was about 10 times that of the strain in which only one copy of the BAL gene was introduced. It was observed. This # 53 was used for BAL expression in the following fermenter.

(2) High-efficiency expression in fermentor culture 5 L of medium was added to 3 jars each having a volume of 10 L (composition per liter was 50.0 g of glycerol, H ₃ PO ₄ (85
%) 21 ml, CaSO ₄ .2H ₂ O 0.9 g, K ₂ SO
_{4 14.28g, MgSO 4 · 7H 2} O 11.7g, K
OH 3.9 g, peptone 10.0 g, yeast extract 5.
0 g, trace metals and inorganic solutions (composition per liter is
_{FeSO 4 · 7H 2 O 65.0g,} CuSO 4 · 5H 2 O
_{6.0g, ZnSO 4 · 7H 2 O} 20g, MnSO
₄ 3.0 g, H ₂ SO ₄ 5.0 ml) 1.0 ml),
The culture was started by adding 150 ml of the preculture solution of # 53 cultured in YPD medium. The culture conditions were as follows. Temperature: 30 ° C. Agitation: 500 rpm (however, increased to 999 rpm when dissolved oxygen (DO) control) Air supply: 3 L air / min DO control: 30-50% pH control: 5.6-6.2 or higher conditions After culturing at 25% for 25 hours, glycerol was added to the medium at a rate of 40 to 50 g / hour for 18 hours.
Incubated for a period of time (a total of 873.4 g of glycerol was added). Then for each of the three jars
Induction of BAL protein was performed by adding methanol, and
Culture was performed for 7 days under the conditions shown in.

[0039]

[Table 3]

FIG. 2 shows the changes in the expression level of BAL when the expression induction was performed under the respective conditions of jar 1 to jar 3. As shown in FIG. 2, the expression level of BAL under the conditions of jar 1, jar 2 and jar 3 was about 1 each.
It was 00 mg / L, about 250 mg / L and about 170 mg / L. The temperature is 30 ° C. and the DO control is 30 to 5
The expression level of BAL is about 30 mg / L when the expression is induced in a fermenter under the same conditions as above except that the content is 0%. By culturing at a low temperature or in an environment in which the amount of dissolved oxygen is limited, It was shown that the expression level of BAL was increased. The expression level of BAL was calculated back from the esterase activity of the culture supernatant (the specific activity of the purified recombinant BAL product was 1
11 unit / mg). The esterase activity was 2 mM taurocholic acid and 2 mM paranitrophenylacetic acid (PAN).
A 0.1 M phosphate buffer (pH 7.5) containing A) was used as a reaction solution to measure the PANA degradability by the culture supernatant.
In the measurement, 1 μl of the culture supernatant was added to 1 ml of the reaction solution, the mixture was reacted at 25 ° C. for 10 minutes, and the absorbance at 400 nm was observed. The activity of decomposing PANA by 1 nmole per minute was defined as 1 munit.

Example 4 (Comparison with natural BAL) Recombinant BAL obtained in the present invention and BAL in human breast milk
(Hereinafter, referred to as breast milk BAL) As the following test results show, (1) Immunological properties (2) Effects of taurocholic acid concentration, NaCl concentration, substrate concentration, reaction pH and reaction temperature on lipase activity (3) pH stability (4) Temperature Stability (5) Degree of inhibition of enzyme activity by various inhibitors (6) Binding ability to heparin (7) Degradation rate of triglycerides of various fatty acids, there was almost no difference between recombinant BAL and breast milk BAL.

Recombinant BAL and human milk BAL were obtained by the method of Wang (Anal. Biochem. 105, 398-402 (19) from BAL-expressing Pichia yeast (# 53) expression culture supernatant and human milk, respectively.
80), Anal. Biochem. 133, 457-461 (1983)) and Blaeck.
Berg et al. (Eur. J. Biochem. 116, 221-225 (198
According to 1)), it was prepared using a cholate sepharose column and a heparin sepharose column.

The lipase activity was measured by measuring the decomposition of triglycerides (about 80% of the fatty acids were oleic acid) of olive oil in emulsion, using a pH stat device manufactured by Radiometer. 5 for reaction
% Olive oil, 30 mM NaCl and 20 mM taurocholic acid, the reaction temperature was 37 ° C. and the pH was 8.2.

A. Immunological properties Using partially purified IgG of rabbit serum immunized with breast milk BAL, human skim milk, recombinant BAL and breast milk BAL, the antigenicity of recombinant BAL and breast milk BAL was examined by the double diffusion method. The sedimentation lines of BAL and breast milk BAL showed a partial fusion type. From this, it was revealed that recombinant BAL also has a common antigenicity with breast milk BAL, but lacks part of the antigenicity of breast milk BAL. In addition, after the partially purified IgG was mixed with breast milk BAL or recombinant BAL and allowed to settle at room temperature for 1 hour, the lipase activity remaining in the supernatant was measured. As a result, recombinant BAL had a residual lipase activity higher than that of breast milk BAL. It was 10-20% higher.

B. Enzyme chemistry Taurocholic acid concentration, NaCl concentration, substrate concentration, reaction
When the effects of pH and reaction temperature on lipase activity were examined, recombinant BAL and breast milk BAL were found in all of them.
There was no significant difference between Regarding the pH stability when treated at 37 ° C for 1 hour at various pHs, the residual activity was 80% or more at pH 4-9. Also, the pH is 8.2
Regarding the temperature stability (remaining activity of 80% or more at 40 ° C. or lower) when treated at various temperatures for 1 hour, almost no difference was observed between the recombinant BAL and the breast milk BAL. In addition, the effects on various inhibitors were examined by using cholinesterase inhibitor eserine, serine protease inhibitors DFP and PMSF, phenylboric acid which may compete with substrates, and protamine which inhibits enzyme proteins in general. , As shown in Table 4.

[0046]

[Table 4]

For DFP and PMSF, both B
Pre-treatment with AL at 25 ° C. for 30 minutes. Further, phenylboric acid and protamine sulfate were added to the reaction solution. As shown in Table 4, the degree of activity inhibition of these inhibitors at specific concentrations was almost the same in recombinant BAL and breast milk BAL.

D. Ability to bind to heparin BAL is present by adsorbing to a heparin-like substance on the surface of the small intestine, where it degrades cholesterol ester and further contributes to the intracellular transport of cholesterol and fatty acids. There is. Therefore, the binding of BAL to heparin seems to be useful for the functional expression of BAL. Recombinant BAL and breast milk BAL were each adsorbed on a heparin column (Tosoh Heparin-5PW (φ7.5 mm × 7.5 cm) and washed with a buffer solution, and then monitored by absorbance at 280 nm with a linear concentration gradient of 0 to 1 M NaCl. When the elution positions of the recombinant BAL and the breast milk BAL were compared, both were almost at the same position (almost in the middle of the linear gradient concentration) From this, the recombinant BAL and the breast milk BAL were changed to heparin. Were determined to have the same binding ability.

E. Decomposition rate of triglycerides of various fatty acids The decomposition rates of tripalmitoleic acid glyceride, trioleic acid glyceride, trilinoleic acid glyceride, trilinolenic acid glyceride and tridocosahexaenoic acid glyceride by recombinant BAL and breast milk BAL were measured. The results are shown in Table 5 assuming that the decomposition rate of trioleic acid glyceride by breast milk BAL is 100%.

[0050]

[Table 5]

From this table, the rate of triglyceride decomposition of various fatty acids of recombinant BAL was almost the same as that of breast milk BAL.

[0052]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 538 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ala Lys Leu Gly Ala Val Tyr Thr Glu Gly Gly Phe Val Glu Gly Val 5 10 15 Asn Lys Lys Leu Gly Leu Leu Gly Asp Ser Val Asp Ile Phe Lys Gly 20 25 30 Ile Pro Phe Ala Ala Pro Thr Lys Ala Leu Glu Asn Pro Gln Pro His 35 40 45 Pro Gly Trp Gln Gly Thr Leu Lys Ala Lys Asn Phe Lys Lys Arg Cys 50 55 60 Leu Gln Ala Thr Ile Thr Gln Asp Ser Thr Tyr Gly Asp Glu Asp Cys 65 70 75 80 Leu Tyr Leu Asn Ile Trp Val Pro Gln Gly Arg Lys Gln Val Ser Arg 85 90 95 Asp Leu Pro Val Met Ile Trp Ile Tyr Gly Gly Ala Phe Leu Met Gly 100 105 110 Ser Gly His Gly Ala Asn Phe Leu Asn Asn Tyr Leu Tyr Asp Gly Glu 115 120 125 Glu Ile Ala Thr Arg Gly Asn Val Ile Val Val Thr Phe Asn Tyr Arg 130 135 140 Val Gly Pro Leu Gly Phe Leu Ser Thr Gly Asp Ala Asn Leu Pro Gly 145 150 155 160 Asn Tyr Gly Leu Arg Asp Gln His Met Ala Ile Ala Trp Val Lys Arg 165 170 175 Asn Ile Ala Ala Pla Gly Gly Asp Pro Asn Asn Ile Thr Leu Phe Gly 180 185 190 Glu Ser Ala Gly Gly Ala Ser Val Ser Leu Gln Thr Leu Ser Pro Tyr 195 200 205 Asn Lys Gly Leu Ile Arg Arg Ala Ile Ser Gln Ser Gly Val Ala Leu 210 215 220 Ser Pro Trp Val Ile Gln Lys Asn Pro Leu Phe Trp Ala Lys Lys Val 225 230 235 240 Ala Glu Lys Val Gly Cys Pro Val Gly Asp Ala Ala Arg Met Ala Gln 245 250 255 Cys Leu Lys Val Thr Asp Pro Arg Ala Leu Thr Leu Ala Tyr Lys Val 260 265 270 Pro Leu Ala Gly Leu Glu Tyr Pro Met Leu His Tyr Val Gly Phe Val 275 280 285 Pro Val Ile Asp Gly Asp Phe Ile Pro Ala Asp Pro Ile Asn Leu Tyr 290 295 300 Ala Asn Ala Ala Asp Ile Asp Tyr Ile Ala Gly Thr Asn Asn Met Asp 305 310 315 320 Gly His Ile Phe Ala Ser Ile Asp Met Pro Ala Ile Asn Lys Gly Asn 325 330 335 Lys Lys Val Thr Glu Glu Asp Phe Tyr Lys Leu Val Ser Glu Phe Thr 340 345 350 Ile Thr Lys Gly Leu Arg Gly Ala Lys Thr Thr Phe Asp Val Tyr Thr 355 360 365 Glu Ser Trp Ala Gln Asp Pro Ser Gln Glu Asn Lys Lys Lys Thr Val 370 375 380 Val Asp Phe Glu Thr As p Val Leu Phe Leu Val Pro Thr Glu Ile Ala 385 390 395 400 Leu Ala Gln His Arg Ala Asn Ala Lys Ser Ala Lys Thr Tyr Ala Tyr 405 410 415 Leu Phe Ser His Pro Ser Arg Met Pro Val Tyr Pro Lys Trp Val Gly 420 425 430 Ala Asp His Ala Asp Asp Ile Gln Tyr Val Phe Gly Lys Pro Phe Ala 435 440 445 Thr Pro Thr Gly Tyr Arg Pro Gln Asp Arg Thr Val Ser Lys Ala Met 450 455 460 Ile Ala Tyr Trp Thr Asn Phe Ala Lys Thr Gly Asp Pro Asn Met Gly 465 470 475 480 Asp Ser Ala Val Pro Thr His Trp Glu Pro Tyr Thr Thr Glu Asn Ser 485 490 495 Gly Tyr Leu Glu Ile Thr Lys Lys Met Gly Ser Ser Ser Met Lys Arg 500 505 510 Ser Leu Arg Thr Asn Phe Leu Arg Tyr Trp Thr Leu Thr Tyr Leu Ala 515 520 525 Leu Pro Thr Val Thr Asp Gln Glu Ala Thr 530 535

SEQ ID NO: 2 Sequence length: 11 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence (1) Pro Val Pro Pro Thr Gly Asp Ser Glu Ala Thr (2) Pro Val Pro Pro Thr Gly Asp Ser Glu Thr Ala (3) Pro Val Pro Pro Thr Gly Asp Ser Gly Ala Pro (4) Pro Val Pro Pro Thr Gly Asp Ala Gly Pro Pro (5) Pro Val Thr Pro Thr Gly Asp Ser Glu Thr Ala ( 6) Pro Val Pro Pro Thr Gly Asp Ser Glu Ala Ala (7) Pro Val Pro Pro Thr Asp Asp Ser Lys Glu Ala

SEQ ID NO: 3 Sequence length: 5 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Sequence Ser Met Thr Gly Ser

SEQ ID NO: 4 Sequence length: 1614 Sequence type: Nucleic acid Number of sequences: Single-stranded Sequence type: cDNA sequence GCGAAGCTGG GCGCCGTGTA CACAGAAGGT GGGTTCGTGG AAGGCGTCAA TAAGAAGCTC 60 GGCCTCCTGG GTGACTCTGT GGACATCTTC AAGGGCATCCCCGAAGACCCCCCCACGAGCCCC CCTTCGCAGC TC TC CAAGAACTTC 180 AAGAAGAGAT GCCTGCAGGC CACCATCACC CAGGACAGCA CCTACGGGGA TGAAGACTGC 240 CTGTACCTCA ACATTTGGGT GCCCCAGGGC AGGAAGCAAG TCTCCCGGGA CCTGCCCGTT 300 ATGATCTGGA TCTATGGAGG CGCCTTCCTC ATGGGGTCCG GCCATGGGGC CAACTTCCTC 360 AACAACTACC TGTATGACGG CGAGGAGATC GCCACACGCG GAAACGTCAT CGTGGTCACC 420 TTCAACTACC GTGTCGGCCC CCTTGGGTTC CTCAGCACTG GGGACGCCAA TCTGCCAGGT 480 AACTATGGTC TTCGGGATCA GCACATGGCC ATTGCTTGGG TGAAGAGGAA TATCGCGGCC 540 TTCGGGGGGG ACCCCAACAA CATCACGCTC TTCGGGGAGT CTGCTGGAGG TGCCAGCGTC 600 TCTCTGCAGA CCCTCTCCCC CTACAACAAG GGCCTCATCC GGCGAGCCAT CAGCCAGAGC 660 GGCGTGGCCC TGAGTCCCTG GGTCATCCAG AAAAACCCAC TCTTCTGGGC CAAAAAGGTG 720 GCTGAGAA GG TGGGTTGCCC TGTGGGTGAT GCCGCCAGGA TGGCCCAGTG TCTGAAGGTT 780 ACTGATCCCC GAGCCCTGAC GCTGGCCTAT AAGGTGCCGC TGGCAGGCCT GGAGTACCCC 840 ATGCTGCACT ATGTGGGCTT CGTCCCTGTC ATTGATGGAG ACTTCATCCC CGCTGACCCG 900 ATCAACCTGT ACGCCAACGC CGCCGACATC GACTATATAG CAGGCACCAA CAACATGGAC 960 GGCCACATCT TCGCCAGCAT CGACATGCCT GCCATCAACA AGGGCAACAA GAAAGTCACG 1020 GAGGAGGACT TCTACAAGCT GGTCAGTGAG TTCACAATCA CCAAGGGGCT CAGAGGCGCA 1080 AAGACGACCT TTGATGTCTA CACCGAGTCC TGGGCCCAGG ACCCATCCCA GGAGAATAAG 1140 AAGAAGACTG TGGTGGACTT TGAGACCGAT GTCCTCTTCC TGGTGCCCAC CGAGATTGCC 1200 CTAGCCCAGC ACAGAGCCAA TGCCAAGAGT GCCAAGACCT ACGCCTACCT GTTTTCCCAT 1260 CCCTCTCGGA TGCCCGTCTA CCCCAAATGG GTGGGGGCCG ACCATGCAGA TGACATTCAG 1320 TACGTTTTCG GGAAGCCCTT CGCCACCCCC ACGGGCTACC GGCCCCAAGA CAGGACAGTC 1380 TCTAAGGCCA TGATCGCCTA CTGGACCAAC TTTGCCAAAA CAGGGGACCC CAACATGGGC 1440 GACTCGGCTG TGCCCACACA CTGGGAACCC TACACTACGG AAAACAGCGG CTACCTGGAG 1500 ATCACCAAGA AGATGGGCAG CAGCTCCATG AAGCGGAGCC TGAGAACCAA CTTCCTGCGC 1560 TACTGGACCC TCACCTA TCT GGCGCTGCCC ACAGTGACCG ACCAGGAGGC CACC 1614

SEQ ID NO: 5 Sequence length: 33 Sequence type: Nucleic acid Number of sequences: Single-stranded Sequence type: DNA sequence (1) CCT GTG CCC CCC ACA GGG GAC TCC GAG GCA ACT (2) CCC GTG CCC CCC ACG GGT GAC TCC GAG ACC GCC (3) CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC CCC (4) CCC GTG CCG CCC ACG GGT GAC TCC GGC GCC CCC (5) CCC GTG CCG CCC ACG GGT GAC GCC GGG CCC CCC (6) CCC GTG ACC CCC ACG GGT GAC TCC GAG ACC GCC (7) CCT GTG CCC CCC ACG GGT GAC TCT GAG GCT GCC (8) CCT GTG CCC CCC ACA GAT GAC TCC AAG GAA GCT

SEQ ID NO: 6 Sequence length: 15 Sequence type: Nucleic acid Number of sequences: Single-stranded Sequence type: DNA sequence TCAATGACA GGTTCA

SEQ ID NO: 7 Sequence length: 2166 Sequence type: Nucleic acid Topology: Linear Sequence number: Single-stranded Sequence type: cDNA sequence GCG AAG CTG GGC GCC GTG TAC ACA GAA GGT GGG TTC GTG GAA GGC GTC Ala Lys Leu Gly Ala Val Tyr Thr Glu Gly Gly Phe Val Glu Gly Val 5 10 15 AAT AAG AAG CTC GGC CTC CTG GGT GAC TCT GTG GAC ATC TTC AAG GGC Asn Lys Lys Leu Gly Leu Leu Gly Asp Ser Val Asp Ile Phe Lys Gly 20 25 30 ATC CCC TTC GCA GCT CCC ACC AAG GCC CTG GAA AAT CCT CAG CCA CAT Ile Pro Phe Ala Ala Pro Thr Lys Ala Leu Glu Asn Pro Gln Pro His 35 40 45 CCT GGC TGG CAA GGG ACC CTG AAG GCC AAG AAC TTC AAG AAG AGA TGC Pro Gly Trp Gln Gly Thr Leu Lys Ala Lys Asn Phe Lys Lys Arg Cys 50 55 60 CTG CAG GCC ACC ATC ACC CAG GAC AGC ACC TAC GGG GAT GAA GAC TGC Leu Gln Ala Thr Ile Thr Gln Asp Ser Thr Tyr Gly Asp Glu Asp Cys 65 70 75 80 CTG TAC CTC AAC ATT TGG GTG CCC CAG GGC AGG AAG CAA GTC TCC CGG Leu Tyr Leu Asn Ile Trp Val Pro Gln Gly Arg Lys Gln Val Ser Arg 85 90 95 GAC CTG CCC GTT ATG ATC TGG ATC TAT GGA GGC GCC TTC CTC ATG GGG Asp Leu Pro Val Met Ile Trp Ile Tyr Gly Gly Ala Phe Leu Met Gly 100 105 110 TCC GGC CAT GGG GCC AAC TTC CTC AAC AAC TAC CTG TAT GAC GGC GAG Ser Gly His Gly Ala Asn Phe Leu Asn Asn Tyr Leu Tyr Asp Gly Glu 115 120 125 GAG ATC GCC ACA CGC GGA AAC GTC ATC GTG GTC ACC TTC AAC TAC CGT Glu Ile Ala Thr Arg Gly Asn Val Ile Val Val Thr Thr Phe Asn Tyr Arg 130 135 140 GTC GGC CCC CTT GGG TTC CTC AGC ACT GGG GAC GCC AAT CTG CCA GGT Val Gly Pro Leu Gly Phe Leu Ser Thr Gly Asp Ala Asn Leu Pro Gly 145 150 155 160 AAC TAT GGT CTT CGG GAT CAG CAC ATG GCC ATT GCT TGG GTG AAG AGG Asn Tyr Gly Leu Arg Asp Gln His Met Ala Ile Ala Trp Val Lys Arg 165 170 175 AAT ATC GCG GCC TTC GGG GGG GAC CCC AAC AAC ATC ACG CTC TTC GGG Asn Ile Ala Ala Pla Gly Gly Asp Pro Asn Asn Ile Thr Leu Phe Gly 180 185 190 GAG TCT GCT GGA GGT GCC AGC GTC TCT CTG CAG ACC CTC TCC CCC TAC Glu Ser Ala Gly Gly Ala Ser Val Ser Leu Gln Thr Leu Ser Pro Tyr 195 200 205 AAC AAG GG C CTC ATC CGG CGA GCC ATC AGC CAG AGC GGC GTG GCC CTG Asn Lys Gly Leu Ile Arg Arg Ala Ile Ser Gln Ser Gly Val Ala Leu 210 215 220 AGT CCC TGG GTC ATC CAG AAA AAC CCA CTC TTC TGG GCC AAA AAG GTG Ser Pro Trp Val Ile Gln Lys Asn Pro Leu Phe Trp Ala Lys Lys Val 225 230 235 240 GCT GAG AAG GTG GGT TGC CCT GTG GGT GAT GCC GCC AGG ATG GCC CAG Ala Glu Lys Val Gly Cys Pro Val Gly Asp Ala Ala Arg Met Ala Gln 245 250 255 TGT CTG AAG GTT ACT GAT CCC CGA GCC CTG ACG CTG GCC TAT AAG GTG Cys Leu Lys Val Thr Asp Pro Arg Ala Leu Thr Leu Ala Tyr Lys Val 260 265 270 CCG CTG GCA GGC CTG GAG TAC CCC ATG CTG CAC TAT GTG GGC TTC GTC Pro Leu Ala Gly Leu Glu Tyr Pro Met Leu His Tyr Val Gly Phe Val 275 280 285 CCT GTC ATT GAT GGA GAC TTC ATC CCC GCT GAC CCG ATC AAC CTG TAC Pro Val Ile Asp Gly Asp Phe Ile Pro Ala Asp Pro Ile Asn Leu Tyr 290 295 300 GCC AAC GCC GCC GAC ATC GAC TAT ATA GCA GGC ACC AAC AAC ATG GAC Ala Asn Ala Ala Asp Ile Asp Tyr Ile Ala Gly Thr Asn Asn Met Asp 305 310 315 320 GGC CAC ATC TTC GCC A GC ATC GAC ATG CCT GCC ATC AAC AAG GGC AAC Gly His Ile Phe Ala Ser Ile Asp Met Pro Ala Ile Asn Lys Gly Asn 325 330 335 AAG AAA GTC ACG GAG GAG GAC TTC TAC AAG CTG GTC AGT GAG TTC ACA Lys Lys Val Thr Glu Glu Asp Phe Tyr Lys Leu Val Ser Glu Phe Thr 340 345 350 ATC ACC AAG GGG CTC AGA GGC GCA AAG ACG ACC TTT GAT GTC TAC ACC Ile Thr Lys Gly Leu Arg Gly Ala Lys Thr Thr Phe Asp Val Tyr Thr 355 360 365 365 GAG TCC TGG GCC CAG GAC CCA TCC CAG GAG AAT AAG AAG AAG ACT GTG Glu Ser Trp Ala Gln Asp Pro Ser Gln Glu Asn Lys Lys Lys Thr Val 370 375 380 GTG GAC TTT GAG ACC GAT GTC CTC TTC CTG GTG CCC ACC GAG ATT GCC Val Asp Phe Glu Thr Asp Val Leu Phe Leu Val Pro Thr Glu Ile Ala 385 390 395 400 CTA GCC CAG CAC AGA GCC AAT GCC AAG AGT GCC AAG ACC TAC GCC TAC Leu Ala Gln His Arg Ala Asn Ala Lys Ser Ala Lys Thr Tyr Ala Tyr 405 410 415 CTG TTT TCC CAT CCC TCT CGG ATG CCC GTC TAC CCC AAA TGG GTG GGG Leu Phe Ser His Pro Ser Arg Met Pro Val Tyr Pro Lys Trp Val Gly 420 425 430 GCC GAC CAT GCA GAT GAC ATT CAG TAC G TT TTC GGG AAG CCC TTC GCC Ala Asp His Ala Asp Asp Ile Gln Tyr Val Phe Gly Lys Pro Phe Ala 435 440 445 ACC ACC CCC ACG GGC TAC CGG CCC CAA GAC AGG ACA GTC TCT AAG GCC ATG Thr Pro Thr Gly Tyr Arg Pro Gln Asp Arg Thr Val Ser Lys Ala Met 450 455 460 ATC GCC TAC TGG ACC AAC TTT GCC AAA ACA GGG GAC CCC AAC ATG GGC Ile Ala Tyr Trp Thr Asn Phe Ala Lys Thr Gly Asp Pro Asn Met Gly 465 470 475 480 GAC TCG GCT GTG CCC ACA CAC TGG GAA CCC TAC ACT ACG GAA AAC AGC Asp Ser Ala Val Pro Thr His Trp Glu Pro Tyr Thr Thr Glu Asn Ser 485 490 495 GGC TAC CTG GAG ATC ACC AAG AAG ATG GGC AGC AGC TCC ATG AAG CGG Gly Tyr Leu Glu Ile Thr Lys Lys Met Gly Ser Ser Ser Met Lys Arg 500 505 510 AGC CTG AGA ACC AAC TTC CTG CGC TAC TGG ACC CTC ACC TAT CTG GCG Ser Leu Arg Thr Asn Phe Leu Arg Tyr Trp Thr Leu Thr Tyr Leu Ala 515 520 525 CTG CCC ACA GTG ACC GAC CAG GAG GCC ACC CCT GTG CCC CCC ACA GGG Leu Pro Thr Val Thr Asp Gln Glu Ala Thr Pro Val Pro Pro Thr Gly 530 535 540 GAC TCC GAG GCA ACT CCC GTG CCC CCC ACG GGT GAC TCC G AG ACC GCC Asp Ser Glu Ala Thr Pro Val Pro Pro Thr Gly Asp Ser Glu Thr Ala 545 550 555 560 CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC CCC CCC GTG CCG CCC ACG Pro Val Pro Pro Thr Gly Asp Ser Gly Ala Pro Pro Val Pro Pro Thr 565 570 575 GGT GAC TCC GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC Gly Asp Ser Gly Ala Pro Pro Val Pro Pro Thr Gly Asp Ser Gly Ala 580 585 590 CCC CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC CCC CCC GTG CCG CCC Pro Pro Val Pro Pro Thr Gly Asp Ser Gly Ala Pro Pro Val Pro Pro 595 600 605 ACG GGT GAC TCC GGG GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC GGG Thr Gly Asp Ser Gly Ala Pro Pro Val Pro Pro Thr Gly Asp Ser Gly 610 615 620 GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC GGC GCC CCC CCC GTG CCG Ala Pro Pro Val Pro Pro Thr Gly Asp Ser Gly Ala Pro Pro Val Pro 625 630 635 640 CCC ACG GGT GAC GCC GGG CCC CCC CCC GTG CCG CCC ACG GGT GAC TCC Pro Thr Gly Asp Ala Gly Pro Pro Pro Val Pro Pro Thr Gly Asp Ser 645 650 655 GGC GCC CCC CCC GTG CCG CCC ACG GGT GAC TCC GGG GCC CCC CCC GTGGly Ala Pro Pro Val Pro Pro Thr Gly Asp Ser Gly Ala Pro Pro Val 660 665 670 ACC CCC ACG GGT GAC TCC GAG ACC GCC CCC GTG CCG CCC ACG GGT GAC Thr Pro Thr Gly Asp Ser Glu Thr Ala Pro Val Pro Pro Thr Gly Asp 675 680 685 TCC GGG GCC CCC CCT GTG CCC CCC ACG GGT GAC TCT GAG GCT GCC CCT Ser Gly Ala Pro Pro Val Pro Pro Thr Gly Asp Ser Glu Ala Ala Pro 690 695 700 GTG CCC CCC ACA GAT GAC TCC AAG GAA GCT CAG ATG CCT GCA GTC ATT Val Pro Pro Thr Asp Asp Ser Lys Glu Ala Gln Met Pro Ala Val Ile 705 710 715 720 AGG TTT Arg Phe

[Brief description of drawings]

FIG. 1 is a view showing an example of the recombinant peptide of the present invention.

FIG. 2 is a diagram showing changes in the expression level of BAL depending on the conditions of fermenter culture.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] December 22, 1994

[Procedure Amendment 1]

[Document name to be amended] Statement

[Correction target item name] Full text

[Correction method] Change

[Correction content]

[Document name] Statement

Title: Method for high-yield expression of recombinant bile salt-activated lipase

[Claims]

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a high-yield expression method of recombinant bile salt-activated lipase.

[0002]

BACKGROUND OF THE INVENTION Bile salt-activated lipase (Bile salt-activa)
Ted Lipase; sometimes referred to as BAL below)
Is a lipid hydrolase (lipase), which is secreted by the pancreas in the digestive tract and is also found in milk. BAL is activated by bile salts in the small intestine, and completely hydrolyzes triglyceride into fatty acids and glycerin, and also hydrolyzes cholesterol and vitamin esters.

Insufficiency of BAL causes growth failure in infants due to indigestion of milk fat, so that a food additive containing BAL has been proposed (Japanese Patent Laid-Open No. 1-2318).
No. 48). In addition, cystic fibrosis (c
It is expected that symptoms of pancreatic insufficiency such as cystic fibrosis) will be reduced from the viewpoint of lipid digestion,
For example, when trying to extract BAL from milk, there are problems such as the cost required for securing the milk as a raw material, the cost required for purification, and virus contamination, and it is not easy to secure a sufficient amount. Therefore, B using genetic recombination technology
AL is expected to be produced, and BAL has already been isolated and purified from milk (Wang and Johnton:
Anal. Biochem. 133,457-461
(1983)), and cDNA encoding BAL is also known. From the sequence, it has been revealed that the BAL protein consists of 722 amino acids, and that the C-terminal has a repeating structure consisting of 16 11 amino acids (WO91 / 15234).

However, a method for secreting and expressing recombinant BAL using the above-mentioned cDNA in a medium in a high yield has not yet been found.

Therefore, it has been desired to develop a method for expressing the recombinant BAL in a high yield.

[0006]

[Means for Solving the Problems] As one of yeast expression systems for heterologous proteins, Pichia pastoris (Pichia)
Pastoris, hereinafter referred to as Pichia yeast) is known as a host (Japanese Patent Laid-Open No. 61-1083).
83, JP 61-173781, JP 63-4.
No. 4899, JP-A-1-128790, etc., and specific examples of substance production include streptokinase (JP-A-6-62).
2-296881), TNF (Japanese Patent Laid-Open No. 63-1648).
91), HIV 24kDA gag protein (JP-A-2-20286), human IL-2 (JP-A-2-104).
292), hepatitis B preS2 protein (JP-A-2-
No. 84176, JP-A-2-27990) and the like are known. The present inventors have completed the present invention as a result of earnest research on a high-yield expression method of recombinant BAL using BAL cDNA using Pichia yeast as a host based on these findings.

That is, the present inventors have found that the 16-fold repeating structure existing in the C-terminal region of BAL protein is a recombinant B
When the expression was examined by deleting the repetitive structure, which was considered to be related to the expression of AL protein, BAL in which a part or all of the repetitive structure was deleted (hereinafter sometimes referred to as defective BAL) has a repetitive structure of 16 times. It was found that the expression was about 10 to 100 times more efficiently than that of BAL having Moreover, BAL in which this repeating structure is partially or wholly deleted, that is, the C-terminal repeating structure is 0 to 15 times, BAL has pH stability, temperature stability, heparin binding ability, and decomposition of various fatty acid triglycerides. Natural BA in various properties such as speed, decomposition of infant formula, etc.
Since it is not different from L, it was also found to be useful, which can be used similarly to natural BAL.

[0008] Further, when the above-mentioned Pichia pastoris system is used for the expression of recombinant BAL, the present inventors have added an expression vector (plasmid pHIL301) containing a promoter and a terminator of the alcohol oxidase gene derived from the Pichia yeast chromosome. Incorporating the BAL gene in which the above-mentioned repetitive structure is partially or wholly deleted, Pichia yeast is transformed, and when expressing the recombinant BAL using the transformant, after sufficiently transforming the transformant, methanol is used. Inducing BAL by inducing BAL in a high yield, in order to express BAL in a high yield, the culture temperature at the growth stage is about 3%, which is different from the culture conditions at the growth stage and the induction stage.
It is appropriate that the temperature is 0 ° C and the amount of dissolved oxygen is about 30 to 50%, but the culture temperature is 15 to 25 ° C and the amount of dissolved oxygen is 20 at the induction stage.
% Or less is suitable, and it has been found that a high yield of expression amount can be obtained in this way.

That is, the present invention provides an amino acid sequence having a 16-fold repeating structure in which a peptide consisting of 11 amino acid residues existing in the carboxy-terminal region of the gene sequence encoding bile salt-activated lipase is used as a unit. Pichia pastoris transformed with a recombinant plasmid in which a defective gene fragment obtained by deleting a part or all of the gene encoding the gene and a gene encoding a secretory signal are ligated into the EcoRI site of the plasmid pHIL301. (Pichia pastoris)
Using a transformant of the GS115 strain, the transformant was grown under conditions of about 30 ° C. and dissolved oxygen of 30 to 50%, and then grown in a medium containing methanol at 15 to 25 ° C. and dissolved oxygen of 20% or less. The present invention provides a method for high-yield expression of recombinant bile salt-activated lipase, which comprises culturing under conditions to induce bile salt-activated lipase inducible expression in a medium.

The above recombinant bile salt-activated lipase has the same activity as natural BAL even if it has a specific 5 amino acid sequence at its N-terminus.

The recombinant BAL of the present invention has the amino acid sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 at the C-terminus.
An amino acid sequence formed by binding 1 to 15 amino acid sequences selected from the written amino acid sequences (1) to (7), and an amino acid sequence formed by binding the amino acid sequence set forth in SEQ ID NO: 3 to the N-terminus of the amino acid sequence. Or C of the amino acid sequence
1 to 15 amino acid sequences selected from the amino acid sequences (1) to (7) described in SEQ ID NO: 2 are bound to the ends, and the amino acid sequence described in SEQ ID NO: 3 is bound to the N-terminus. May be.

The cDNA used in the present invention is a cDNA library prepared from lactating human breast tissue (Cl
ontech) to clone cDNA according to the method described in WO91 / 15234.
It may be chemically synthesized from the sequence described in O91 / 15234.

As described above, the defective gene fragment is a gene fragment obtained by removing the portion encoding the 1 to 16 times of the 16-fold repeating structure of the C-terminal region of the BAL protein from the full-length BAL cDNA. In addition, in the gene corresponding to BAL in which the amino acid sequence of SEQ ID NO: 3 is bound to the N-terminus, the base sequence encoding the amino acid sequence may be bound to the 5'side of the full-length cDNA of BAL. For such a defective gene fragment, BAL cDNA was prepared according to the method described in WO91 / 15234,
The repeated structure for 6 times may be removed, or it may be chemically synthesized, and the defective cD naturally generated during the growth of the plasmid vector containing the cDNA in the host.
NA may be used. In addition, 1 to 15 repeating structures of the C-terminal region of recombinant BAL are (1) to SEQ ID NO: 2 to
The sequences of (7) may be combined in any order.

The host-vector system used for the expression of the recombinant BAL of the present invention is described in the above-mentioned JP-A-61-183838.
3, JP-A-61-173781, JP-A-63-44.
Pichia GS115 (deposition number NRRLY), which is a Pichia yeast lacking histidinol dehydrogenase activity, described in Japanese Patent Application Laid-Open No. 899 and JP-A-1-128790.
PHIL in which a kanamycin resistance gene was introduced into pA0804 (extracted and prepared from an Escherichia coli strain with deposit number NRRL B-18114) using -15851) as a host.
It is preferable to use 301 (see JP-A-2-104292) as an expression vector.

Recombinant BA used in the present invention using these
In order to produce L, a gene in which the defective gene fragment and the secretion signal gene are ligated is added to the expression vector pHI.
A recombinant expression vector inserted into EcoRI, which is the unique site of L301, is prepared (FIG. 1). As the secretion signal gene, BAL itself may be used, but baker's yeast (Saccharomyces cer)
evisiae) invertase secretion signal (SU
DNA encoding C2) is preferred.

To transform Pichia yeast, the cell wall is digested with an enzyme to give spheroplasts, which are then mixed with the recombinant expression vector in the presence of calcium ions and polyethylene glycol. Furthermore, spheroplasts are regenerated in a selection medium lacking histidine, and cultured in a medium containing kanamycin to select colonies that grow.

In expressing the recombinant BAL protein, the transformed Pichia yeast strain was treated at about 30.degree.
After sufficiently proliferating under a condition of -50%, the temperature is lowered to about 15-25 ° C in an expression medium containing methanol to adjust the dissolved oxygen amount to 20% or less, and the expression of recombinant BAL protein is induced with methanol. It is preferable to add a protein such as peptone to the expression medium in addition to methanol.

Using such culture conditions, not only BAL lacking the C-terminal repeating structure but also WO91 / 15
The expression level of full-length BAL (natural BAL) described in No. 234 also increases.

[0019]

INDUSTRIAL APPLICABILITY According to the present invention, BAL by gene recombination having an activity equivalent to that of natural BAL can be expressed with high efficiency.

[0020]

EXAMPLES The present invention will be described in detail below with reference to examples, but the present invention is not limited thereto.

Example 1 (Production of Recombinant BAL) (1) Construction of BAL Expression Vector Full-length BAL cDNA was prepared according to the method described in WO91 / 15234, and was inserted into the PstI site of plasmid pBR322 for recombination. A plasmid was obtained. This was introduced into Escherichia coli MC1061 and propagated, and the plasmid was prepared by the method of Birnboim et al.
d Doby, Nucleic Acids Rese
arch, 7, 1513 (1979)). On the other hand, a cDNA obtained by removing a part of the repeating structure of the C-terminal region of BAL protein from BAL cDNA is
A BAL cDNA lacking 9 out of 16 repeat structures spontaneously generated by growing a plasmid containing BAL cDNA in E. coli was obtained. From the BAL cDNA thus obtained, the portion encoding the secretory signal of BAL itself and the untranslated region 5'upstream thereof were removed, and instead, baker's yeast (Saccharomyces cerevisiae) was obtained.
DNA encoding the invertase secretion signal (SUC2) in e) was ligated. This BAL cDNA was incorporated into the EcoRI site of the expression vector pHIL301 to obtain a recombinant expression vector (Fig. 1). That is, pHI
L301 was digested with EcoRI, treated with alkaline phosphatase and dephosphorylated, and BALc was added to this vector.
The DNA was inserted.

(2) Cell Proliferation GS115 colonies were mixed with 10 ml of YPD medium (1 L composition: yeast extract 10 g, peptone 20 g and 2).
0 g of glucose) and inoculated with shaking at 30 ° C. until saturated to obtain a seed culture. 200 ml of YPD medium was put into a 500 ml culture flask, 10 μl of the seed culture was added thereto, and the mixture was cultivated at 30 ° C. with stirring until the absorbance of the culture solution at 600 nm was 0.2 to 0.3.
After completion of the culture, the cells were collected by centrifugation at 1500 xg for 5 minutes at room temperature. This cell was used for the following transformation.

(3) Preparation of spheroplast The collected cells were washed once with 10 ml of sterilized water, and 1500
The supernatant was discarded by centrifugation at × g for 5 minutes at room temperature. Then 10
Wash once with ml fresh SED (1 M sorbitol, 25 mM EDTA and 50 mM DTT), 1500
The supernatant was discarded by centrifugation at × g for 5 minutes at room temperature. 10 more
It was washed once with 1 ml of 1 M sorbitol and centrifuged at 1500 xg for 5 minutes at room temperature and the supernatant was discarded. 10 ml SCE
The cells were suspended in a buffer solution (9.1 g of sorbitol, 1.47 g of sodium citrate and 0.168 g of EDTA dissolved in 50 ml of water and adjusted to pH 5.8 with hydrochloric acid). Then 3 mg / ml of thymolyase 60,0
00 solution (Zymolyase. Miles Labo
7.5 μl) (manufactured by Ratories Co., Ltd.) was added, and the mixture was slowly stirred and kept at 30 ° C. for 10 minutes to digest the cell wall. The formed spheroplasts were collected, 10 ml of 1 M sorbitol was added, and the mixture was centrifuged at 1,000 × g for 5 minutes. The supernatant was discarded, washed once with 10 ml of CaS (1 M sorbitol, 10 mM CaCl ₂ and 10 mM Tris-HCl (pH 7.5)), and suspended in 0.6 ml of CaS.

(4) Transformation 10 μg of the recombinant expression vector containing BAL cDNA was completely digested with BglII to give a linear form, and this was made into TE buffer [0.01 M containing 1.0 mM EDTA (pH 7.
4) Tris buffer solution] suspended in 10 μl and 12 × 75 m
Steroplast 10 in a sterile polypropylene tube
0 μl was added and incubated at room temperature for about 20 minutes.
Then PEG solution [20% polyethylene glycol 33
50 ml of 10 mM CaCl ₂ and 10 mM Tris-hydrochloric acid (pH 7.4)] was added, and the mixture was incubated at room temperature for about 15 minutes, centrifuged at 700 × g for 5 minutes, and the supernatant was discarded. SOS solution (1M sorbitol, 10 mM Ca
Cl ₂ and 33.3% YPD medium) and added at room temperature to 30
After incubation for min, 850 μl of 1M sorbitol solution was added.

(5) Regeneration of spheroplast Regenerated agar medium [1L composition: yeast nitrog
en base with ammonium sul
Fate 6.7 g, biotin 400 μg, sorbitol 182 g, dextrose 10 g, agar 10 g, glutamine, methionine, lysine, leucine and isoleucine 50 mg each, histidine assay medium (Difc).
o) 2 g] 10 ml was dissolved in an autoclave and poured into a plate to be solidified. On the other hand, regenerated agar 1
0 ml was dissolved in an autoclave, 10 or 990 μl of the transformation sample was added while keeping it at 45 ° C., and the mixture was poured onto the solidified regenerated agar. The plate was incubated at 30 ° C for 3-5 days.

(6) Identification of BAL-producing clones His + transformants were obtained by collecting colonies that had grown on a regenerated agar medium (without histidine). The transformant was transformed into BMGY medium [1 L composition: 1
100 ml of M potassium phosphate buffer solution (pH 6.0), y
east nitrogen base with a
mmonium sulphate 13.4 g, biotin 400 μg, yeast extract 10 g, glycerol 10 m
1, peptone 20 g] for 2 days, the medium was BMMY
The cells were cultured for 2 days in a medium (BMGY medium supplemented with 5 ml of methanol in place of glycerin). After centrifugation, 10 μl of the culture supernatant was collected and subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) to obtain anti-BA.
Western blot hybridization with L antibody was performed. From this result, the transformant into which the full-length BAL cDNA was introduced was approximately 110 k corresponding to the full-length BAL.
It was confirmed that the transformant into which the BAL of d had been deleted for 9 repeats was introduced into the transformant, which produced a BAL of about 85 kd corresponding to the BAL for which 9 repeats were deleted. In addition, BAL in which the repeating structure was deleted 9 times was about 10 to 100 more than full-length BAL.
It was also revealed that the secretory expression was doubled. All the remaining culture supernatant was collected and subjected to affinity column chromatography using heparin as a carrier to remove defective BAL.
Was purified and subjected to N-terminal amino acid analysis. Ser-Met-Thr-Gly-Se was found on the N-terminal side of the protein.
It was found that 5 amino acids, r, were added.

Example 2 (Production of defective BAL whose N-terminus is the same as mature BAL)

In order to produce BAL having the same amino acid sequence as the natural BAL lacking these 5 amino acids, the secretion signal of the yeast invertase gene SUC2 (Table 1),

[0029]

[Table 1]

As shown in Table 2, only the base sequence was changed to the recognition site (AGCGCT) of the restriction enzyme Aor51HI without changing the two amino acid sequences immediately upstream of the cleavage site of arrow.

[0031]

[Table 2]

Furthermore, having this restriction enzyme site at the N-terminus,
In addition, a BAL gene lacking the C-terminal 9-fold repeating structure was constructed and ligated with the SUC2 secretion signal as described above.

This base sequence was inserted into the expression vector pHIL301 by the same method as described above, and the GS115 strain was transformed with the obtained recombinant expression vector. BAL is expressed in the obtained transformant, and the culture supernatant is used as it is for SD.
When subjected to S-PAGE, a protein secreted at the position of the expected molecular weight was detected. The presence of a protein activated by taurocholate was confirmed by measuring the esterase activity. Furthermore, BAL was purified from the culture supernatant by affinity column chromatography using heparin as a carrier, and N-terminal amino acid analysis was carried out. From N-terminal to 10 amino acids, mature BAL c
It was in agreement with the sequence expected from the DNA sequence. Therefore, this recombinant BAL has the amino acid sequence of mature BAL shown in SEQ ID NO: 7 with a C-terminal 9-fold repeating structure or a deleted amino acid sequence (1-615), and the recombinant BAL obtained in Example 1 was obtained. Differs from that in the absence of the 5 amino acids set forth in SEQ ID NO: 3 at the N-terminus.

Example 3 (High-efficiency expression by fermenter culture) (1) Increase in copy number of BAL expression vector From the 107 BAL-producing strains in which the repeated structure was deleted 9 times, GS115 was selected. In order to obtain a strain in which many BAL genes were introduced into the chromosome, kanamycin resistance (1.5 mg / ml) was selected, and two resistant strains (# 53 and # 57) were obtained. Genomic DNA was extracted from these resistant strains and the copy number of the inserted BAL gene was examined by Southern blot hybridization. As a result, it was confirmed that 6 copies were inserted in # 53 and 14 copies were inserted in # 57. BAL was expressed in # 53 in the same manner as above, and the culture supernatant was directly subjected to SDS-PAG.
When the expression level of BAL was examined over E, about 10-fold expression was observed as compared with the strain in which only one copy of BAL gene was introduced. This # 53 was used for BAL expression in the following fermenters.

(2) High-efficiency expression in fermentor culture 5 liters of medium for 3 liters of 10 liters each [composition per liter is 50.0 g of glycerol, H ₃ PO ₄ (8
5%) 21 ml, CaSO ₄ .2H ₂ O 0.9 g, K
_{2 SO 4 14.28g, MgSO 4 ·} 7H 2 O 1
1.7g, KOH3.9g peptone 10.0 g, yeast extract 5.0 g, composition per trace metals and minerals solution (1L _{is, FeSO 4 · 7H 2 O 65.0g} , CuSO
_{4 · 5H 2 O 6.0g, ZnSO} 4 · 7H 2 O 20
g, MnSO ₄ 3.0 g, H ₂ SO ₄ 5.0 ml)
1.0 ml] was added, and 150 ml of the preculture liquid # 53 cultured in YPD medium was added to start the culture. The culture conditions were as follows. Temperature: 30 ° C. Stirring: 500 rpm (however, it was raised to 999 rpm during dissolved oxygen (DO) control) Air supply: 3 L air / min DO control: 30 to 50% pH control: 5.6 to 6.2 or higher conditions After culturing at 25% for 25 hours, glycerol was added to the medium at a rate of 40 to 50 g / hour for 18 hours.
Incubated for a period of time (a total of 873.4 g of glycerol was added). Then for each of the three jars
Induction of BAL protein was performed by adding methanol, and
Culture was performed for 7 days under the conditions shown in.

[0036]

[Table 3]

FIG. 2 shows the transition of the expression level of BAL when the expression induction was performed under the respective conditions of jar 1 to jar 3. As shown in FIG. 2, the expression level of BAL under the conditions of jar 1, jar 2 and jar 3 was about 1 each.
00 mg / L, about 250 mg / L and about 170 mg / L
Met. The expression level of BAL when expression was induced in a fermenter under the same conditions as above except that peptone and yeast extract were not added to the medium, the temperature was 30 ° C., and the DO control was 30 to 50%. It was about 30 mg / L, and it was shown that the expression level of BAL was increased by adding the protein to the medium and culturing at a low temperature or in an environment in which the amount of dissolved oxygen was limited. The expression level of BAL was calculated back from the esterase activity of the culture supernatant (recombinant BAL
The specific activity of the purified product is 111 unit / mg). The esterase activity was determined by measuring the PANA decomposing ability of the culture supernatant using 0.1 M phosphate buffer (pH 7.5) containing 2 mM taurocholic acid and 2 mM paranitrophenylacetic acid (PANA) as a reaction solution. 1m for measurement
1 μl of culture supernatant was added to 1 l of reaction solution, and
After reacting for minutes, the absorbance at 400 nm was observed. P
The activity to decompose 1 nmole of ANA in 1 minute
It was set.

Example 4 (Comparison with natural BAL) Recombinant BAL obtained in the present invention and BAL in human breast milk
(Hereinafter, referred to as breast milk BAL) As shown in the following test results, (1) immunological properties (2) effects of taurocholic acid concentration, NaCl concentration, substrate concentration, reaction pH and reaction temperature on lipase activity (3) pH stability (4) temperature Stability (5) Degree of inhibition of enzyme activity by various inhibitors (6) Binding ability to heparin (7) Degradation rate of triglycerides of various fatty acids, there was almost no difference between recombinant BAL and breast milk BAL.

Recombinant BAL and human milk BAL were obtained from the expression culture supernatant of BAL-expressing Pichia yeast (# 53) and human milk, respectively, by the method of Wang (Anal. Biochem.
105, 398-402 (1980), Anal. Bi
ochem. 133, 457-461 (1983)) and the method of Bläckberg et al. (Eur. J. Bio).
chem. 116, 221-225 (1981)), using a cholate sepharose column and a heparin sepharose column.

The lipase activity was measured by decomposing triglycerides (about 80% of fatty acids were oleic acid) of olive oil emulsified using a pH meter apparatus manufactured by Radiometer. 5% olive oil in the reaction mixture,
It contained 30 mM NaCl and 20 mM taurocholic acid, the reaction temperature was 37 ° C., and the pH was 8.2.

A. Immunological properties Using partially purified IgG of rabbit serum immunized with breast milk BAL, human skim milk, recombinant BAL and breast milk BAL, the antigenicity of recombinant BAL and breast milk BAL was examined by the double diffusion method. The sedimentation lines of BAL and breast milk BAL showed a partial fusion type. From this, it was revealed that recombinant BAL also has a common antigenicity with breast milk BAL, but lacks part of the antigenicity of breast milk BAL. In addition, after the partially purified IgG was mixed with breast milk BAL or recombinant BAL and allowed to settle at room temperature for 1 hour, the lipase activity remaining in the supernatant was measured. As a result, recombinant BAL had a residual lipase activity higher than that of breast milk BAL. It was 10-20% higher.

B. Enzymatic chemistry The effects of taurocholic acid concentration, NaCl concentration, substrate concentration, reaction pH and reaction temperature on lipase activity were investigated.
No significant difference with L was seen. Various p at 37 ℃
Regarding the pH stability when treated with H for 1 hour, the residual activity was 80% or more at pH 4 to 9. Also,
Regarding the temperature stability (80% or more of residual activity at 40 ° C or lower) when treated at various temperatures for 1 hour at pH 8.2, almost no difference was observed between the recombinant BAL and the breast milk BAL. In addition, the effects on various inhibitors were as follows: cholinesterase inhibitor eserine, serine protease inhibitors DFP and PMSF, phenylboric acid that may compete with the substrate, and protamine that is not a specific inhibitor. When examined, it was as shown in Table 4.

[0043]

[Table 4]

Regarding DFP and PMSF, both B
Pre-treatment with AL at 25 ° C. for 30 minutes. Further, phenylboric acid and protamine sulfate were added to the reaction solution. As shown in Table 4, the degree of activity inhibition of these inhibitors at specific concentrations was almost the same in recombinant BAL and breast milk BAL.

D. Ability to bind to heparin BAL is present by adsorbing to a heparin-like substance on the surface of the small intestine, where it degrades cholesterol ester and further contributes to the intracellular transport of cholesterol and fatty acids. There is. Therefore, the binding of BAL to heparin seems to be useful for the functional expression of BAL. Recombinant BAL and breast milk BAL were each treated with a heparin column (Tosoh Heparin-5PW (φ
(7.5 mm × 7.5 cm) and washed with a buffer solution, and then a linear concentration gradient of 0-1 nm NaCl of 280 nm
Elution was carried out while monitoring the absorbance. When the elution position was compared between the recombinant BAL and the breast milk BAL, they were almost at the same position (almost in the middle of the linear gradient). From this, it was determined that the recombinant BAL and the breast milk BAL have the same binding ability to heparin.

E. Decomposition rate of triglycerides of various fatty acids The decomposition rates of tripalmitoleic acid glyceride, trioleic acid glyceride, trilinoleic acid glyceride, trilinolenic acid glyceride and tridocosahexaenoic acid glyceride by recombinant BAL and breast milk BAL were measured. The results are shown in Table 5 assuming that the decomposition rate of trioleic acid glyceride by breast milk BAL is 100%.

[0047]

[Table 5]

From this table, the rate of triglyceride decomposition of various fatty acids of recombinant BAL was almost the same as that of breast milk BAL.

[0049]

[Sequence list]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[Brief description of drawings]

FIG. 1 is a view showing an example of the recombinant peptide of the present invention.

FIG. 2 is a diagram showing changes in the expression level of BAL depending on the conditions of fermenter culture.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI technical display location C12R 1:84) (C12N 1/19 C12R 1:84)

Claims (7)

[Claims] 1. An amino acid sequence as set forth in SEQ ID NO: 1 and an amino acid in which 1 to 15 amino acid sequences selected from the amino acid sequences (1) to (7) as set forth in SEQ ID NO: 2 are bound to the C-terminal of the amino acid sequence. A sequence, an amino acid sequence obtained by binding the amino acid sequence of SEQ ID NO: 3 to the N-terminal of the amino acid sequence, or an amino acid sequence (1) to (7) described in SEQ ID NO: 2 at the C-terminal of the amino acid sequence. A recombinant bile salt-activated lipase represented by the amino acid sequence having 1 to 15 amino acid sequences bound to each other and the amino acid sequence of SEQ ID NO: 3 bound to the N-terminus. 2. A recombinant bile salt-activating lipase gene encoding the amino acid sequence according to claim 1. 3. The base sequence of SEQ ID NO: 4, and the base sequence (1) to the base sequence of SEQ ID NO: 5 at the 5'end of the base sequence.
A base sequence formed by combining 1 to 15 base sequences selected from (8), a base sequence formed by connecting the base sequence of SEQ ID NO: 6 to the 3'end of the base sequence, or 5 of the base sequence. A base sequence in which 1 to 15 base sequences selected from the base sequences (1) to (8) described in SEQ ID NO: 5 are bound to the 3 ′ end and the base sequence described in SEQ ID NO: 6 is bound to the 3 ′ end The recombinant bile salt-activated lipase gene according to claim 2, which is represented. 4. A recombinant plasmid having the gene according to claim 2. 5. A transformant carrying a recombinant plasmid having the gene according to claim 2. 6. The recombinant bile salt-activated lipase according to claim 1, wherein the transformant carrying the recombinant plasmid having the gene according to claim 2 is cultured and collected from the culture. Manufacturing method. 7. EcoRI of plasmid pHIL301
Pichia pastoris (Pi) transformed with a recombinant plasmid incorporating a structural gene for bile salt-activated lipase in which a DNA encoding a secretory signal is ligated to the site.
chia pastoris) GS115 strain is used to express bile salt-activated lipase by fermenter culture, the culture temperature is 15 to 25 ° C, and the dissolved oxygen content is 2
A highly efficient expression method of bile salt-activated lipase, which is characterized in that it is 0% or less.