JPH0656690A - Class ii protein of exosporium of neisseria meningitidis with immune carrier and reinforcement property - Google Patents

Abstract

PURPOSE: To enhance immune response to an antigen by administering outer membrane protein of Gram-negative bacteria, which has an immunological enhancement effect, cytokinin induction activity, mitogenic characteristics and immunological carrier characteristics. CONSTITUTION: Immune response to an antigen can be enhanced by administering pure protein purified from the outer membrane of Gram-negative bacteria or preferably, class II protein (major immunological enhancement protein (MIEP)) of the outer membrane of Neisseria meningitidis (N. meningitidis) serum group B. A preferred production process of the MIEP comprises: culturing N. meningitidis to obtain a cultured material; forming an protein complex of the outer membrane of N. meningitidis from the cultured material by using a well-known method; and isolating and purifying the MIEP from the protein complex by using SDS(sodium dodecyl sulfate)- polyacrylamide gel electrophoresis. Also, another preferred production process comprises: incorporating DNA encoding the MIEP derived from N. meningitidis into vectors; and producing the MIEP in host cells transformed by the vectors.

Description

Detailed Description of the Invention

[0001] Neisseria m.
The outer membrane protein complex (OMPC) of eningitidis is used as an immune carrier in a vaccine for humans. OMPC is a variety of proteins and lipopolysaccharides (LPS
Or endotoxin).

OMPCs have immunopotentiating properties and increase the antibody response to an antigen when the antigen is chemically coupled to it. OMPC is currently used as a human infant vaccine against infectious agents such as Haemophilus influenzae, and polyribosyl ribitol phosphate (PRP) is OMPC.
When covalently bound to H. IgG and memory immune responses against influenza PRP can be expressed in infants.

Although OMPC is a mixture of various proteins and lipids, it has not been known that the components of OMPC impart a beneficial immunopotentiating effect to the coupled antigen. However, some potentially negative aspects of using OMPC in human vaccines are LPS-related reactions. Furthermore, in the OMPC-antigen complex, the antigen is OM
It is quite heterogeneous because it is complexed with any of the protein moieties that make up PC, and the total protein content per dose of the multivalent vaccine is very high.

[0004] It is an object of the present invention to provide a substantially pure class II protein which is a major immune enhancing protein (MIEP) derived directly from the outer membrane of Neisseria meningitidis without any other Neisseria meningitidis outer membrane component. is there. It is another aspect of the present invention to provide a substantially pure recombinant MIEP of the outer membrane of Neisseria meningitidis which is produced in recombinant host cells completely free of all other Neisseria meningitidis proteins. Is the purpose. Another object of the invention is effective for enhancing the immune response to an antigen consisting of either MIEP directly purified from the outer membrane of Neisseria meningitidis or recombinant MIEP of Neisseria meningitidis produced in recombinant host cells. Providing an immune carrier protein. Another object of the present invention is to provide a protein having immunomitogenic activity consisting of either MIEP purified directly from the outer membrane of Neisseria meningitidis or recombinant MIEP of Neisseria meningitidis produced in a recombinant host cell. Is to provide. Another object of the present invention is to provide for cytokines such as Il-2 consisting of either MIEP purified directly from the outer membrane of Neisseria meningitidis or recombinant MIEP of Neisseria meningitidis produced in recombinant host cells. It is to provide a protein having the ability to induce production. Another object of the present invention is to provide a vaccine composition comprising either recombinant MIEP or MIEP directly purified from the outer membrane of Neisseria meningitidis. These and other objects will be apparent from the description below.

The present invention is directed to other contaminated N. Meningitidis outer membrane protein and class II major immunopotentiating protein (MIEP) of Neisseria meningitidis outer membrane in substantially pure form without LPS. MIEP of the present invention
Was purified directly from the outer membrane of Neisseria meningitidis cells or recombinant M of Neisseria meningitidis.
It has immune carrier activity, cytokine (II-2) inducing activity and mitogenic activity, whether derived from IEP producing recombinant host cells. The MIEP of the present invention is
Immunopotentiation in that when coupled with an antigen the antibody response to the coupled antigen is increased or the antigen is converted to a T-dependent antigen which ensures that IgG class immunoglobulins are produced. You can Antigens coupled to MIEP of the invention include viral proteins, bacterial proteins and polysaccharides, synthetic peptides, other immune antigens and weak or non-immunogenic antigens.

[0006] Certain substances that consist of only IgM class antibodies and express a memory-free immune response by themselves are chemically coupled to an antigenic moiety that assists T lymphocytes for immunoglobulin production by IgM and IgG antibodies and memory. It is known that it can be converted into a complete immune antigen that expresses. This immune phenomenon is called the "carrier effect", weak or non-immunogenic moieties and strong antigenic substances are called "haptens" and "carriers", respectively.

When hapten-carrier or polysaccharide-carrier complexes are injected into animals, B lymphocytes form antibodies, some of which are specific for haptens and bind to them, others are specific for carriers and bind to it. . Another aspect of the carrier effect is that subsequent contact with the hapten-carrier complex results in a strong antibody response to the hapten. This is called a memory or recollection response.

"Helper T lymphocytes" for carrier effect
Including certain T lymphocyte-mediated functions, referred to as The carrier molecule stimulates helper T lymphocytes to partially assist the formation and memory response of anti-hapten IgG class antibody-producing B lymphocytes.

Helper T lymphocytes are involved in the production by B lymphocytes of antibodies specific for one type of antigen called a "T dependent" antigen, but not another antigen called a "T independent" antigen. Usually involved. The carrier molecule can convert a weakly T-independent or non-immunogenic hapten into a strongly T-dependent antigen molecule. Furthermore, the memory response is a hapten-
It follows the subsequent contacts to the carrier complex and consists mainly of IgG, which is characteristic of T-dependent rather than T-independent antigens.

The availability of carrier molecules is not limited to use with T-independent antigens, but can also be used with T-dependent antigens. An antibody response to a T-dependent antigen is enhanced by coupling the antigen with a carrier, even if the antigen itself may develop an antibody response.

Certain other molecules generally have the ability to stimulate the entire immune system. These molecules are called "mitogens", which include plant proteins and bacterial products. Mitogens can proliferate T and / or B lymphocytes and broadly enhance many aspects of the immune response, including increased phagocytosis, increased resistance to infection, increased tumor immunity and increased antibody production.

The production of Il-2 by one T helper lymphocyte can promote the proliferation and activity of other lymphocytes. Il-2 production by T helper cells can be induced when T cells are activated by some substance or antigen by antigen producing cells. The effects of Il-2 include, but are not limited to, T cell proliferation progression and B cell proliferation and differentiation. Many infectious pathogens may themselves express protective antibodies that bind to and kill or detoxify or kill or detoxify the pathogen and its byproducts. Upon recovery from these diseases, long lasting immunity is usually acquired by protective antibodies against the highly antigenic component of the infectious agent.

Protective antibodies are part of the natural defense mechanism of humans and many other animals and are present in blood as well as other tissues and body fluids. Expressing protective antibodies against infectious agents and / or their by-products without causing disease is the primary function of most vaccines.

N. OMPC from Meningitithis is O
It has been used successfully to induce an antibody response in humans when MPCs chemically couple with T cell independent antigens including bacterial polysaccharides. OMPC contains several bacterial outer membrane proteins and bacterial lipids. In addition, OMPC has a liposome three-dimensional structure.

The efficacy of OMPC as an immune carrier is 1
It was believed to depend on more than one bacterial membrane protein, bacterial lipid, liposome three-dimensional structure or a combination of bacterial protein, lipid and liposome structures. Applicants have determined that one of the proteins, MIEP, possesses the immunocarrier and immunopotentiating properties of OMPC vesicles, while other N.P. It has been found to be effective in a purified form that is free of Meningitidis membrane proteins and lipopolysaccharide.

Applicants have also discovered that MIEP functions similarly to OMPC in inducing an antibody response to the polysaccharide when chemically coupled to the bacterial polysaccharide. The applicants have reported that MIEP It was further discovered that it is a class II protein of the outer membrane of Meningitidis.
N. The class II protein of Meningitidis is a porin protein [Murakami, K. et al. Et al., 1989, Infection and Immity
unity), vol. 57, pp. 2318-23]. Porins are found in the outer membrane of all grass-negative bacteria. The present invention relates to N. It is readily apparent to those skilled in the art that any outer membrane protein from any Gram-negative bacterium, as long as it has an immune carrier and immunopotentiating activity, is encompassed by the present invention, as exemplified by MIEP of Meningitidis.
Examples of Gram-negative bacteria include, but are not limited to, Neisseria, Escherichia, Pseudomonas (Pse
udomonas), Hemophilus, Salmonella (S
almonella), Shigella, Bordetell
a), Klebsiella, Serratia,
There are species of the genus Yersinia, Vibrio and Enterobacter.

MIEP is used to enhance the antibody response to highly antigenic, weakly antigenic and non-antigenic substances. The terms “antigen” and “antigenic substance” as used interchangeably herein refer to one or more non-viable, immunogenic, weakly immunogenic, non-immunogenic or decellularized of a bacterial, viral or other source. Contains sensitizing (anti-allergic) substances. The antigen component consists of dry powder, an aqueous phase such as an aqueous solution or suspension and others including mixtures thereof, non-viable, immunogenic,
Contains weakly immunogenic, non-immunogenic or desensitizing substances.

The aqueous phase conveniently comprises the antigenic substance in a parenterally acceptable liquid. For example, the aqueous phase may be in the form of a vaccine in which the antigen is dissolved in a balanced salt solution, physiological saline solution, phosphate buffer, tissue culture solution or other medium in which the organism is grown. The aqueous phase may contain preservatives and / or substances conventionally incorporated in vaccine formulations. MIE
Adjuvant emulsions containing P-complex antigen are manufactured using techniques well known in the art.

Antigens include but are not limited to bacteria, viruses, mammalian cells and other eukaryotic cells (including parasites),
It may be in the form of a purified or partially purified antigen including an antigen derived from fungus or rickettsia. The antigen is not particularly limited and may be pollen, dust, dandruff or allergens including extracts thereof. Alternatively, the antigen is not particularly limited and may be in the form of a toxic substance or venom including a toxic substance or venom derived from harmful insects or reptiles. The antigen may be a synthetic peptide, a fragment of a larger polypeptide, or may be in the form of a submoiety of any of the molecules or components derived from bacteria, mammalian cells, fungi, viruses, rickettsiae, allergens, toxins or venoms. .. In all cases, the antigens are those microorganisms used to produce a particular protein, peptide, microorganism, extract or antigen, toxicant, venom when their toxic or detrimental properties are reduced or destroyed and when introduced into a suitable host. It is useful for inducing active immunity through the production of antibodies against the product of, or in the case of allergens, reducing allergic symptoms caused by a specific allergen.

The antigens may be used alone or in combination, for example multi-bacterial antigens, multi-virus antigens, multi-mycoplasma antigens, multi-rickettsiae antigens, multi-bacterial or viral toxoids, multi-allergens, multi-proteins, multi-peptides or of said products. Any combination is M
Can be combined with IEP.

[0021] Particularly important antigens are not particularly limited, and B. B. pertussis, Leptospira pomona (Lepto)
spira pomona) and ictero haemorr
hagiae), S. S. paratyphi A and B,
C. C. diphtheriae, C.I. C. tetan
i), C.I. Botulinum, C.I. C. perfringens, C.I. C. feseri as well as other gas gangrene bacteria B. Anthracis,
Y. Y. pestis, P. Martoshi fern (P. multocid)
a), V. V. cholerae, Neseria meningitidis, N. et al. N. gonorrheae, Haemophilus
Influenza, Treponema pal dam
lidum) and the like; mammalian cells including tumor cells, virus-infected cells, genetically engineered cells, cultured cells or cells grown in tissue extracts without particular limitation; human cells without particular limitation T lymphocytic virus (majority type), human immunodeficiency virus (many variants and types), poliovirus (majority type), human papillomavirus (majority type), adenovirus (majority type), parainfluenza virus (majority type) ), Measles, mumps, respiratory syncytial virus, influenza virus (various types), transport fever virus (SF)
₄ ), viruses including western and eastern equine encephalomyelitis virus, Japanese B encephalomyelitis, Russian spring-summer encephalomyelitis, swine fever virus, Newcastle disease virus, fowlpox, rabies, cats and dog distemper. Rickettsia including typhus fever and others in the typhus or spotted fever group without particular limitation; various spider and snake venoms or exceptionally limited ragweed, house dust, pollen extracts, grass pollen, etc. It is derived from any known allergen.

The polysaccharide of the present invention may be any bacterial polysaccharide having an acid group and is not limited to any particular type. An example of such a bacterial polysaccharide is Streptococcus pneamoniae.
(Pneumococcus) type 6A, 6B, 10A, 11A, 1
8C, 19A, 19f, 20, 22F and 23F polysaccharides; Group B Streptococcus type Ia, Ib,
II and III; Haemophilus influenzae serotype b polysaccharide; Neisseria meningitidis serogroup A,
There are B, C, X, Y, W135 and 29E polysaccharides; and E. coli K1, K12, K13, K92 and K100 polysaccharides. However, a particularly preferred polysaccharide is Rosenberg et al., Journal of Biological Chemistry, 236, 2845-2849, 196.
1 year [Rosenberg et al., J. Biol. Chem., 236, 284
5-2849 (1961)] and Zamenhof
H. et al., As described in Journal of Biological Chemistry, Vol. 203, pp. 695-704, 1953. Influenza Serum Type b Polysaccharide; Robbins et al., Infection and Immunity, Vol. 26, No. 3, 1116-112.
Staphylococcus pneumoniae type 6B or type 6A polysaccharides as described on page 2 (December 1979); J. Lee et al., Reviews of Infections Diseases, Volume 3, Volume 2
Issue, pp. 323-331, 1981 [CJ Lee et al.,
Reviews of Infectious Diseases, 3, No. 2,323
-331 (1981)], and pneumococcal type 19F polysaccharides; and O. Lahm et al., Adva Carbohydr Chem and Biochem, Vol. 33, Vol.
95-321, R.M. S. Edited by Tipson et al., Academic Press, 1976 (O.Larm et al., Adv.Carbohyd.C
hem. and Biochem., 33, 295-321, RS Tipson
et al., ed., Academic Press, 1976), a capsular polysaccharide selected from the group consisting of Pneumococcal type 23F polysaccharides.

MIEP is described in US Pat. No. 4,459,286.
And N. cerevisiae grown according to conventional methods as described in US Pat. No. 4,830,852. It can be purified from OMPCs obtained from a culture of Meningitidis. OMPC
Purification is described in U.S. Pat. Nos. 4,271,147, 4,45
It can be performed according to the method described in 9,286 and 4,830,852.

MIEP can also be obtained from recombinant DNA engineered host cells by expression of recombinant DNA encoding MIEP. The DNA encoding MIEP is N. Even from Meningitidis cells (Murakami, K. et al., 1989, Infection and
Immunity, Vol. 57, page 2318) or its DNA
May be synthetically produced using standard DNA synthesis techniques. M
The DNA encoding the IEP can be expressed in recombinant host cells including, but not limited to, bacterial, yeast, insect, mammalian or other animal cells that produce recombinant MIEP. The preferred method of the present invention for obtaining MIEP is purification of MIEP from OMPC and N.P. Recombinant D of MIEP-encoding DNA derived from Meningitidis
NA expression.

The purified MIEP was dissolved in vesicles of sodium dodecyl sulfate (SDS) and then subjected to SDS polyacrylamide gel electrophoresis (PAGE) to OMPC.
Manufactured from vesicles. MIEP was eluted from the gel, dialyzed against high pH buffer and concentrated. Standard methods of polyacrylamide gel electrophoresis can be used to purify MIEP from OMPC vesicles. Such methods are described in Molecular Cloning: Experimental Manual, Sambrook, J. et al. Et al., 1989, Cold Spring
Harbor Laboratory Press, New York [Molec
ular Cloning: A Laboratory Manual, Sambrook, J.et a
l., (1989), Cold Spring Harbor Laboratory Pre
ss, New York] and current protocols in molecular biology, 1987, Ausubel, F .; M. Et al., Willie & Sons, New York [Current Protocols
In Molecular Biology (1987), Ausubel FMet
al., editors, Wiley and Sons, New York].

Standard methods for eluting proteins from SDS polyacrylamide gels are described by Hanka Piller, M .; W.
And Roujan, E .; , 1986, purification of microgram amount of protein by polyacrylamide gel electrophoresis, method for micro-characterization of protein (edited by J. Sibilly),
Fumana Press, Clifton, NJ [H
unkapiller, MWand Lujan, E. (1986), Purificat
ion Of Microgram Quantities Of Proteins By Polyacr
ylamide Gel Electrophoresis, in Methods of Protein M
icrocharacterization (J. Shively editor) Humanna Pres
S. Clifton, NJ] and current protocols in molecular biology, 1987, Ausberg, F .; M. Edited by Willy and Sons, New York.

MIEP produced by this method is complexed with an antigen derived from bacteria, viruses, mammalian cells, rickettsiae, allergens, toxins or venoms, fungi, peptides, proteins, polysaccharides or any other antigen. Easily adapts to

Recombinant MIEP may be bacteria such as E. coli or yeast such as S. In N. cerevisiae, the genome N. It can be produced by expression of Meningitidis DNA. Genome D coding for MIEP
In order to obtain NA, the genomic DNA is N. Extracted from Meningitidis, Maniatis, T. Et al., 1978, Cell
(Cell), Volume 15, page 687, High Molecular Weight D
By random fragmentation of NA or by Smithies et al., 19
1978, Science, Volume 202, page 1248 [Smith
ies, et al. (1978), Science, 202, pp. 124.
8) Prepared for cloning by cleavage with a restriction endonuclease by the method of [8]. Then genomic DNA
Is incorporated into an appropriate cloning vector, such as lambda phage (see Sambrook, J. et al., 1989, Molecular Cloning: Experimental Manual, Cold Spring Harbor Press, NY). On the other hand, polymerase chain reaction (PCR) technology [Perkin Elmer
(Perkin Elmer)] is a specific DNA in genomic DNA
It can be used to amplify sequences [Rhox et al., 1989, Biotechnics, Vol. 8, p. 48].
(Roux et al., 1989, Biotechniques, 8, pp. 4)
8)]. In PCR processing, specific D in genomic DNA
Requires a DNA oligonucleotide capable of hybridizing to the NA sequence. N. The DNA sequence of a DNA oligonucleotide capable of hybridizing with MIEP DNA in Meningitidis genomic DNA is derived from the amino acid sequence of MIEP or from N. It can be determined with reference to the DNA sequence determined for the Meningitidis class II major membrane protein (Murakami, K. et al., 1989, Infection and Immunity, Vol. 57, 231).
Page 8).

Recombinant MIEP can be separated from other cellular proteins by the use of affinity columns made of monoclonal or polyclonal antibodies specific for MIEP. These affinity columns contain N- so that the antibody forms a covalent bond with the agarose gel bead support.
It is made by adding the antibody to a gel support Affigel-10 [Biorad] pre-activated with hydroxysuccinimide ester. The antibody is then coupled to the gel via an amide bond with a spacer arm. Then the remaining activated ester is 1
Disappeared with M ethanolamine HCl (pH 8). The column is rinsed with water to remove unconjugated antibody or foreign proteins and then washed with 0.23 M glycine HCl (pH 2.6). The column is then equilibrated with phosphate buffer (pH 7.3) and MIEP-containing cell culture supernatant or cell extract is slowly passed through the column. The column is then washed with phosphate buffer until the optical density (A ₂₈₀ ) drops to background, after which the protein is eluted with 0.23M glycine HCl (pH 2.6). The protein is then dialyzed against phosphate buffer.

The complex of the present invention can be any stable polysaccharide-M.
It may be an IEP complex or any other antigen-MIEP complex including synthetic peptide antibodies. Synthetic peptides are antigenic for any antigen, including antigenic determinants from bacteria, rickettsia, viruses (including human immunodeficiency virus), mammalian cells or other eukaryotic cells including parasites, toxins or venoms or allergens. It may also have one or more groups. The antigen-MIEP complex is coupled with a polysaccharide and a genus spacer including a thioether group and a primary amine that form a hydrolytically labile covalent bond with MIEP. However, the presently preferred complex is of the formula Ps-
A-ES-B-Pro or Ps-A'-S-E'-
It is a complex represented by B'-Pro, in which case Ps
Represents a polysaccharide or any other antigen; Pro represents the bacterial protein MIEP; AESB and A'-S.
-E'-B 'comprises a second group spacer containing a hydrolytically stable covalent thioether bond and forming a covalent bond (such as a hydrolytically labile ester or amide bond) with the macromolecules Pro and Ps. Spacer AE-S-
In B, S is sulfur; E is the conversion product of the parent thio group reacted with the thiol group,

[Chemical 1] (Wherein R is H or CH ₃ ; p is 1 to 3); A is

[Chemical 2] [Wherein W is O or NH; m is 0 to 4; n is 0 to 3; Y is CH ₂ , O, S, and NR '.
Or CHCO ₂ H (R ′ is H or C ₁ -C ₂ alkyl); provided that when Y is CH ₂ , both m and n are not zero, and Y is O or S. m is 2
Above, n represents 2 or more]; B is - (CH _{2) p} CH
(Z) (CH ₂₎ a _q D-(in the above formulas q is a 0 to 2; Z is _{NH 2, NHC (= O)} R ', is COOH or H; R' and p are as above Are synonymous; D is C =
O, NR 'or NH-C (= O) ( CH 2) 2 C (=
O)). Next, in the spacer A'-SE'-B ', S is sulfur; A'is -C (= W) NH.
(CH ₂ ) _a R ″ —, where a is 1 to 4;
R ″ is CH ₂ or NHC (═O) C (−Y ′) (CH
₂ ) _p (Y ′ is NH ₂ or NHCOR ′); W, p and R ′ are as defined above]; E ′ is a conversion product of a parent thio group reacted with a thiol group. Represented by -C (-R) H- (R has the same meaning as above),
B'is -C (= O)-; or E'is

[Chemical 3] In and, B 'is _{- (CH 2) p C (} = O) - (p is 1
3). Furthermore, the second group spacer A-E-S-B
And A'-S-E'-B ', E-S-B and A'-
The S-E 'component is determinable and quantifiable, and this identity indicates that the side-chain of the thioether sulfur derived from the covalently modified polysaccharide is attached to the side-chain of the complex-derived spacer and the covalent atom of the complex bond. It reflects the value.

Complex Ps-AESB according to the invention
-Pro has components especially carbon dioxide, 1,4-butanediamine and S-carboxymethyl-N-acetylhomocysteine; carbon dioxide, 1,5-pentanediamine and S
-Carboxymethyl-N-acetylhomocysteine; carbon dioxide, 3-oxa-1,5-pentanediamine and S-carboxymethyl-N-acetylhomocysteine;
Carbon dioxide, 1,4-butanediamine and S-carboxymethyl-N-acetylcysteine; carbon dioxide, 1,
3-propanediamine and S-carboxymethyl-N-
Benzoyl homocysteine; carbon dioxide, 3-aza-
1,5-pentanediamine and S-carboxymethyl-
N-acetyl cysteine; and carbon dioxide, 1,2-
It may contain a spacer which is a derivative of ethanediamine, glycine and S- (succin-2-yl) -N-acetylhomocysteine. Complex Ps- according to the invention
A'-SE'-B'-Pro has carbon dioxide and S-carboxymethyl cysteamine; carbon dioxide and S- (α-carboxyethyl) cysteamine; carbon dioxide and S-carboxymethyl homocysteamine; carbon dioxide. , S- (succin-2-yl) cysteamine and glycine; and carbon dioxide and a spacer which is a derivative of S-carboxymethyl cysteine.

In the process of the present invention, the polysaccharide is (a)
Dissolving it in a non-hydroxyl organic solvent, then (b) activating it with a bifunctional reagent, (c) reacting this activated polysaccharide with a bis-nucleophile, and finally further if necessary (D) Covalently modified by functionalizing the modified polysaccharide by reaction with (i) an electrophilic (eg, parent thiol) site forming reagent or (ii) a thiol group forming reagent. Conversely, the protein is reacted with (i) a thiol group-forming reagent or (ii) a parent thiol site-forming reagent, and then the covalently modified polysaccharide and the functionalized protein are reacted with each other to form a stable covalent complex. The final mixture is purified to remove unreacted polysaccharide and protein.

The process of the present invention involves the selection of a nucleophile or bis-nucleophile that reacts with an activated polysaccharide to form a covalently modified polysaccharide with side-chain electrophilic sites or side-chain thiol groups, whereby It obviates the need to further functionalize the bis-nucleophilic modified polysaccharide before reacting the covalently modified polysaccharide with the covalently modified protein. Moreover, functionalization of the protein to either sub-form may be done in more than one step depending on the choice of reactants in these steps.

In the first step of covalently modifying the polysaccharide, the solid polysaccharide must be dissolved. The polysaccharide should be dissolved in a non-aqueous (non-hydroxyl) solvent because the nucleophilic alcoholic hydroxyl group of the polysaccharide should not chemically compete with the hydroxyl of water for electrophilic reagents in aqueous solution. Suitable solvents include dimethylformamide, dimethylsulfoxide, dimethylacetamide, formamide, N, N'-dimethylimidazolidinone and other similar polar aprotic solvents, preferably dimethylformamide.

In addition to the use of these solvents, polysaccharides having oxyhydrogens such as phosphate mono- and diesters (eg H. influenza type b capsular polysaccharide which is a ribose ribitol phosphate polymer) are suitable. The polysaccharide is easily solubilized in the solvent by converting to a different salt form. Acidic hydrogen in these polymers is tri- or tetra (C ₁ -C ₅ ) alkylammonium, 1-azabicyclo [2.2.2] octane, 1,8-diazabicyclo [5.4.0] undec-7-. It may be replaced by an ene or similar cation, especially a large hydrophobic cation such as tri- or tetra (C ₁ -C ₅ ) alkylammonium, the tri- or tetraalkylammonium or similar of the resulting phosphorylated polysaccharide. The salt dissolves in the solvent at about 17 to 50 ° C., with stirring for 1 minute to 1 hour.

The partially hydrolyzed H. Influenza serum type B polysaccharide was converted to the tetrabutylammonium salt and then dissolved in dimethylsulfoxide [Egan et al., Journal of American Chemical Society, 104, 2898, 1982].
(Egan et al., J. Amer. Chem. Soc., 104, 2898, 1
982)], but this product is no longer antigenic and is therefore useless in vaccine manufacture. Conversely, Applicants have determined that the complete unhydrolyzed polysaccharide is obtained by passing the polysaccharide in its tetraalkylammonium form through a strong acid cation exchange resin, or preferably by carefully neutralizing the polysaccharide with tetraalkylammonium hydroxide in the above procedure. Is lysed, which preserves the presence of the polysaccharide for immunogenic vaccines.

The next step is to covalently attach to a polysaccharide lacking a functional group on a polysaccharide other than a hydroxyl group that is sufficiently reactive with the reagents normally or practically used to functionalize the unit for which attachment is desired. To overcome other important physicochemical limitations. Activation of a polysaccharide to form an activated polysaccharide, reaction with a bis-nucleophile to form a nucleophilic functionalized polysaccharide, and functionalization with either an electrophilic moiety or a thiol group forming reagent are all for conjugation It relates to the covalent modification of polysaccharides during manufacturing to allow them to form functional groups.

In the next step, the solubilized polysaccharide is difunctionalized at about 0 to 50 ° C. with stirring within a significant weight ratio of active agent to polysaccharide in the range of 1: 5 to 1:12 for 10 minutes to 1 hour. It is activated by reaction with a reagent. Traditionally, this activation has been carried out by the reaction of polysaccharides with cyanogen bromide. However, the "prone" cyanogen bromide activated derivative for vicinal diols only showed temporary stability during dialysis against phosphate buffer. Therefore, although activation with cyanogen bromide is still possible with the present invention, this reagent is rarely utilized for activation of polysaccharides and is not preferred. Alternatively the carboxylic acid derivative Preferred bifunctional reagents for activating the polysaccharide ^{R 2 -C (= O) -R} 3
Where R ² and R ³ are each independently an azolyl such as imidazolyl; a halide; or a phenyl ester such as p-nitrophenyl or polyhalophenyl.

A particularly preferred reagent, carbonyldiimidazole, reacts with a hydroxyl group to form the polysaccharide imidazolyl urethane, and aryl chloroformates, including, for example, nitrophenyl chloroformate, yield mixed polysaccharide carbonates. In each case, the resulting activated polysaccharide is very sensitive to nucleophiles such as amines and is therefore converted into the respective urethanes.

In the next step, the activated polysaccharide is an amine, especially a diamine, such as H ₂ N (CH ₂ ) _m Y
(CH ₂₎ is _n -NH ₂ [m is 0 to 4; n is 0 to 3
Y is CH ₂ , O, S, NR ′, CHCO ₂ H (R ′ is H or C ₁ -C ₂ alkyl); provided that when Y is CH ₂ , both m and n are Both do not become zero, and when Y is O or S, m is 2 or more and n is 2 or more] and a large excess of amine (ie, 50 to 50 with respect to the activator used, for example). The reaction is carried out in the presence of a 100-fold molar excess of amine). The reaction solution is kept in an ice bath for 15 minutes to 1 hour, and then at about 17-40 ° C for 1 hour.
Hold for 5 minutes to 1 hour.

Activated polysaccharides are diamines, eg 1,
When reacted with 4-butanediamine, it produces a urethane-type polysaccharide with side-chain amines, which may then be further functionalized by acylation. Mixed carbonates also readily react with diamines to produce side chain amine groups.
On the other hand, the activated polysaccharide is a monohaloacetamide of a diaminoalkane, such as 4-bromoacetamidobutylamine [W. B. Lawson et al., Hoppe Sailors Zeissrift Fur Physiologie Chemie, Vol. 349, pp. 251, 1968 (WB Lawson et a
l., Hoppe Seyler's Z. Physiol. Chem., 349, 251,
1968)]].
Alternatively, the activated polysaccharide may be reacted with an aminothiol such as cysteamine (aminoethanethiol) or cysteine to yield a polysaccharide with side chain thiol groups, examples of which derivatives are well known in the peptide synthesis art. .
In both cases, no additional functionalization is required prior to coupling the covalently modified polysaccharide with the modified bacterial "carrier" protein.

In the final step of producing the polysaccharide, further functionalization of the polysaccharide, if necessary, reacts the nucleophilic functionalized polysaccharide with a reagent that forms an electrophilic (ie, parent thio) site or a reagent that forms a thiol group. You may take the shape.

Suitable reagents for use in forming the electrophilic site are, for example, X'C (= O) CH (-R) X (R
Is H or CH ₃ ; X is Cl, Br or I;
X'is acylated to an α-haloacetyl or α-halopropionyl derivative such as nitrophenoxy, dinitrophenoxy, pentachlorophenoxy, pentafluorophenoxy, halide, O- (N-hydroxysuccinimidyl) or azide. Reaction, especially chloroacetic acid or α-bromopropionic acid, and the reaction is pH 8-11.
(Maintained within this range by addition of base if necessary), at a temperature of about 0 to 35 ° C. for 10 minutes to 1 hour.
Amino-derivatized polysaccharides have the following maleimido groups in order to obtain appropriately functionalized polysaccharides that are susceptible to thio substitution:

[Chemical 4] (Wherein p is 1 to 3) to form an activated maleimide amino acid [O. Keller et al., Helvetica Kimika Actor, Vol. 58, p. 531, 1975 (O. Keller et.
al., Helv. Chim. Acta, 58, 531, 1975)], such as p-nitrophenyl bromoacetate.
-Haloacetylating agents or α-haloketone carboxylic acid derivatives, for example

[Chemical 5] [Ber., Vol. 67, p. 1204, 1934]
May be acylated with. Suitable reagents for use in forming the thiol group include, for example, thiolactones such as

[Chemical 6] (In the above formula, R ⁴ is C ₁ -C ₄ alkyl or C ₆ H ₅ (-
NHCOR ⁵ ) or mono- or bicyclic aryl such as C ₁₀ H ₁₃ ; p is 1-3; R ⁵ is C _1-.
C ₄ alkyl or _{C 6 H 5), - O} 3 SSCH 2
(CH ₂ ) _m CH—COX ′ (m is 0 to 4; X ′
Is synonymous with the above) and then an acylating agent such as HS
Treatment with CH ₂ CH ₂ OH; or C ₂ H ₅ —S—S—C
H ₂ (CH ₂ ) _m CH (NHCOR ⁵ ) COX ′ (m,
R ⁵ and X ′ have the same meanings as above), followed by treatment with dithiothreitol. Such a reaction is carried out under a nitrogen atmosphere at about 0 to 35 ° C. and pH 8 to 11 (pH is kept within this range by addition of a base if necessary) for 1 to 24 hours.
For example, amino-derivatized polysaccharides are used to obtain suitable functionalized polysaccharides.

[Chemical 7] May be reacted with.

By these steps, Ps-AE ^*
-Or Ps-A'-SH-form of a covalently modified polysaccharide (wherein E ^* is -CCHX or

[Chemical 8] And A, A ′, R, X and p have the same meaning as above.)
Is manufactured.

Another functionalization for coupling a protein to a polysaccharide is the reaction of the protein with one or more reagents that form a thiol group or one or more that forms an electrophilic (ie parent thio) center. There is a reaction between reagents and proteins. In a complexed preparation with an electrophilic functionalized polysaccharide, the protein is combined with one or more reagents that form a thiol group, such as the acylating reagents used to form thiol groups on the polysaccharides described above in 1 or 2 It is made to react in a step. The thiolated protein is used to obtain a thiolated protein by Atassi et al., Biokimika Ed Biophysica Actor, vol. 670, p. 300, 1981.
Year [Atassi et al., Biochem.et Biophys.Acta, 670,
300 (1981)], the carboxy-activated protein may be produced by amination with aminothiols. In a preferred embodiment of this process step, N-acetylhomocysteine thiolactone is used to remove side chain amino groups (ie lysyl groups) of the protein at about 0-35 ° C., pH 8-11 for 5 minutes to 2 hours using equal weights of reagents. Acylate directly with. E'B '

[Chemical 9] If, the conditions and method for producing the functionalized protein are as in the previous case where the partner polysaccharide is produced by reaction with activated maleimidic acid.

In the complex production with a covalently modified bacterial polysaccharide having a side chain thiol group, the protein is, for example, HCH.
_{2 C (= O) -X '} , and XCH (CH ₃₎ -C (=
O) X ′ (X and X ′ are as defined above) and

[Chemical 10] Acylation is performed with an electrophilic center-forming reagent such as an acylating agent including (X 'is as defined above). Suitable proteins with electrophilic centers include, for example, activated maleimidic acids, such as

[Chemical 11] Some proteins are produced by acylation of side chain lysylamino groups with reagents such as or the reaction of carboxy-activated proteins with monohaloacetyl derivatives of diamines. In both production reactions, the temperature is 0-35 ° C. for 5 minutes to 1 hour and the pH is 8-11.

The formation of the complex may be carried out under nitrogen atmosphere at pH 7-9, at about 17-40 ° C. for about 6-24 hours to obtain a covalent complex for 6-24 hours with any suitable equivalence ratio of side chain electrophilic centers. It is a simple problem of reacting the covalently modified polysaccharide with the bacterial protein MIEP which has a side chain thiol group. As an example of such a reaction, an activated polysaccharide reacted with 4-bromoacetamidobutylamine is reacted with a protein reacted with N-acetylhomocysteine thiolactone to form a complex:

[Chemical 12] And an amino-derivatized polysaccharide reacted with activated maleimidic acid is reacted with a carboxy-activated protein aminated with aminothiol to form a complex:

[Chemical 13] (Y ″ in the above formula is a C ₂ -C ₈ alkyl group).

Similarly, any covalently modified polysaccharide with side chain thiol groups may be reacted with the bacterial protein MIEP having a side chain electrophilic center to obtain a covalent complex. Examples of such reactions are:

[Chemical 14] Wherein the activated polysaccharide that has reacted with the aminothiol is then reacted with the carboxy-activated protein that has reacted with the monohaloacetyl derivative of the diamine to form a complex.

The reaction of the conjugate with a low molecular weight thiol such as n-acetylcysteamine serves this purpose when the excess electrophilic activity of the haloacetyl group needs to be eliminated. The use of this reagent n-acetylcysteamine also allows confirmation as to the haloacetyl moiety used,
The reason for this is that the S-carboxymethyl cysteamine formed is uniquely detected by the Spackman, Moore and Stein methods.

These complexes are then removed at about 1 to 20 ° C. to remove non-covalently bound polysaccharides and proteins using a covalent valence assay on the Genus Spacer (see below) as a way to track the desired biological activity. Centrifuge at about 100,000 xg using a fixed angle rotor for 2 hours or undergo any of various other purification procedures including gel permeation, ion exclusion chromatography, gradient centrifugation or other different adsorption chromatography. To be done.

Furthermore, the separation of the reagents may be carried out by size exclusion chromatography on a column or, in the case of very large insoluble proteins, the separation may be carried out by ultracentrifugation.

Analysis of the complex to ascertain the covalent valence, and thus the stability of the complex, was performed on the complex (preferably 1
Hydrolysis is carried out for 20 hours at 10 ° C. (with 6N HCl), followed by quantitative analysis for the amino acids of the hydrolysis-stable spacer containing thioether bonds and the constituent amino acids of the protein. The amino acid contributions of the protein are removed, if necessary, by comparison with an appropriate amino acid standard for the protein involved and the remaining amino acid values reflect the covalent valency of the complex, or the spacer amino acids are It may be considered that it appears other than the amino acid standard of. Covalent valence assays are also useful in monitoring purification procedures that mark increasing concentrations of bioactive components. In the above example, Ps-AE- in peptide bonds and other hydrolytically labile bonds.
Cleavage of the S-B-Pro molecule results in PsC (= O) NH
CH ₂ CH ₂ CH ₂ CH ₂ NHC (= O) CH ₂ SCH
₂ CH ₂ CH (-NHCOCH ₃₎ The hydrolysis of Copro S- carboxymethyl homocysteine HO ₂ CC
_{H 2 SCH 2 CH 2 CH (} -NH 2) to release CO ₂ H;

[Chemical 15] In the hydrolysis of aminodicarboxylic acid HO ₂ CCH ₂ CH
(-CO ₂ H) releases the SCH ₂ CH ₂ NH _2; PsC
_{(= O) NHCH 2 CH 2} SCH 2 C (= O) NH (C
_{H 2) 4 NHC (= O} ) CH 2 CH 2 C (= O) Pro
The hydrolysis of S-carboxymethylcysteamine H ₂
Releases NCH ₂ CH ₂ SCH ₂ CO ₂ H. Chromatographic methods such as Spachman, Moore and Stain are then conveniently applied to determine the ratio of amino acid components.

Optimal IgG antibody production requires coordination of B and T lymphocytes with specificity for the antigen of interest. T lymphocytes cannot recognize polysaccharides, but anti-polysaccharide IgG when a protein that can be recognized by T cells is covalently linked to polysaccharides.
It can assist the antibody response. In mice, this requirement exists not only for the primary but also for the secondary antibody response and is carrier specific, that is, secondary only if the T helper cells are immediately sensitized with the carrier protein used in the secondary immunization. An antibody response occurs. Therefore, PRP
The ability of mice to generate a secondary antibody response to the protein complex depends on the presence of primed T lymphocytes specific for the carrier protein.

Demonstration of the ability of MIEP to be carrier-primed for anti-PRP antibody responses was performed in mice that were adoptively primed with PRP covalently linked to the heterologous carrier diphtheria toxoid (DT). Adoptive transfer
PR of lymphocytes primed with MIEP alone
It was used to investigate whether it was sufficient to generate effective helper T cell activity for anti-PRP antibody formation in response to P-OMPC. A comparable secondary anti-PRP antibody response was expressed in PRP-OMPC when MIEP- or OMPC-primed lymphocytes were transferred, indicating that T cell recognition of OMPC is present in the MIEP moiety. Shows.

The PRP-MIEP complex was tested for immunogenicity in mice and infant rhesus monkeys. The immune response in both of these animal models shares imperfections with human infants in their ability to generate antibody responses against T-independent antigens such as bacterial polysaccharides. These animals are commonly used as models for the evaluation of human infant immune responses to various antigens.

The one or more conjugate vaccines according to the invention are prophylactic or therapeutic against infectious agents including bacteria, rickettsia, parasites and viruses or against toxins or toxins, allergens and mammalian or other eukaryotic cells. Used in mammalian species for active or passive protection. Active protection is achieved by injecting an effective amount of an antigen (eg, PRP) capable of producing a measurable amount of antibody (eg, 2-50 μg) as the MIEP-complexed form of each complex administered per dose. The use of adjuvants (eg alum) is also within the scope of the invention. Passive protection refers to whole antisera obtained from animals pre-administered with MIEP conjugate or a globulin or other antibody containing fraction of the antisera with or without a pharmaceutically acceptable carrier such as sterile saline solution. It is performed by injecting. Such globulin can be obtained from whole antisera by chromatography, salt or alcohol fractionation or electrophoresis. Passive protection may be achieved by standard monoclonal antibody manipulations or by immunizing a suitable mammalian host.

In a preferred embodiment of the invention, the conjugates are used for active immune vaccination of humans, in particular infants and small children, immunocompromised individuals (eg asplenic and post-chemotherapy patients) and the elderly. For further stabilization, these conjugates should be prepared in the presence of lactose (eg PRP 20μ before use).
It may be freeze-dried with l / lactose (g / ml 4 mg / ml).

The preferred dose level is H.
MIE as a complex of influenza serum type B polysaccharide
If necessary, the amount of each MIEP complex or derivative thereof administered to correspond to about 2 to 20 μg of PRP in the P-complex form, H. MI of influenza serum type B polysaccharide
The EP conjugate or derivative thereof may be administered once or twice more.

The present invention will be further clarified with reference to the following examples, which are intended to be illustrative, not limiting. Example 1 Neisseria meningitidis B11 serum type 2 OM
Manufacture of PC A. Fermentation 1. Neisseria meningitidis group B11 A tube containing a freeze-dried culture of Neisseria meningitidis [Washington, D .; C. Walter Reed Army Institute of Research (W
alter Reed Army Institute of Research; WRAIR)
M. Obtained from Dr. M. Artenstein], and opened Eugonbroth (BBL)
Was added. Mueller Hinton (Mueller Hinton)
ton) Streaks are applied on the agar slope and 5% CO _{2 at} 37 ℃
Incubate for 36 hours at 10% growth
It was recovered in skim milk medium [Difco] and partly frozen at -70 ° C. The identification of the organism was confirmed by agglutination with a specific antiserum manufactured by WRAIR and a typed serum manufactured by Zifco.

Thaw the vial of the second passage and thaw 10
A piece of Columbia sheep blood serum (Columbis Sheep Blood) agar plate (CBAB-BBL) was streaked.
The plates were incubated for 18 hours at 37 ° C. under 5% CO _2, after which the growth was supplemented with 10% skim milk medium 100.
It was collected in 0.5 ml, taken out in 0.5 ml aliquots, and frozen at -70 ° C. The organism was confirmed as positive by agglutination with specific antisera, sugar fermentation and Gram stain.

Vials of this subculture were thawed, diluted with Mueller-Hinton broth and streaked onto 40 Mueller-Hinton agar plates. Incubate the plate for 18 hours at 37 ° C. under 6% CO ₂ .
The culture was then recovered in 17 ml of 10% skim milk medium, divided into 0.3 ml volumes and frozen at -70 ° C. Organisms were confirmed as positive by Gram stain, aggregation with specific antisera and oxidase test.

2. Fermentation and recovery of cell paste a. Inoculum Production-Inoculum was grown from one frozen vial of Neisseria meningitidis group B, B-11 (passage 4). Inoculate 10 Mueller-Hinton agar slopes, recover from 6 to about 18 hours, and
6.35 Used as inoculum for 250 ml flasks of Gotschlich's yeast dialysate medium. OD
_{The 660} was adjusted to 0.18 and incubated until the OD ₆₆₀ was 1-1.8. 1 ml of this culture was used to inoculate 5 of each 2 liters. Erlenmeyer flasks (each containing 1 liter of medium; see below) were incubated on a shaker at 37 ° C and 200 rpm.
OD was monitored hourly after inoculation. Broth culture 4
Liters occurred at OD ₆₆₀ = 1.28.

70 liter seed fermentor-sterilized with about 4 liters of seed culture containing about 40 liters of complete production medium
A 0 liter fermentor was inoculated (see below). The conditions for 70 liter fermentation are 37 ℃, 185 rpm, 10 liter /
It was about 2 hours under the introduction of min air and a constant pH control of about pH 7.0. For this batch, the final OD _{66 0}
Was 0.732 after 2 hours.

800 L Production Fermentor-Seed Culture Approx. 4
0 liter was used to inoculate a sterile 800 liter fermentor containing 568.2 liters of complete production medium (see below). Batch temperature is 37 ℃, 100 rpm, 60 liters / mi
Inoculated under a constant pH control of n air introduction and pH 7.0. The final OD for this batch was 5.58, 13 hours after inoculation.

3. Erlenmeyer flask and 70
And 800 liter fermenter complete medium fraction AL-glutamic acid 1.5 g / liter NaCl 6.0 g / liter anhydrous Na ₂ HPO ₄ 2.5 g / liter NH ₄ Cl 1.25 g / liter KCl 0.09 g / liter L-Cysteine HCl 0.02 g / l Fraction B (Gottschlich yeast dialysate):

Difco yeast extract 1280 g distilled water 6.
Dissolved in 4 liters. The solution is two Amicon DC-3 equipped with three H10SM cartridges.
It was dialyzed with a 0 hollow fiber dialysis unit. MgSO ₄ · 7H
384 g of ₂ O and 3200 g of dextrose were dissolved in the dialysate and the total volume was made up to 15 liters with distilled water. The pH was adjusted to 7.4 with NaOH, sterilized by passing through a 0.22μ filter and transferred to a fraction A containing fermentor.

For Erlenmeyer flasks: Fraction A
1 liter and 25 ml of fraction B were added and the pH was adjusted to 7.0-7.2 with NaOH. For a 70 liter fermentor: 41.8 liters of fraction A and 900 ml of fraction B were added and the pH was adjusted to 7.0-7.2 with NaOH. 800
For a liter fermentor: add 553 liters of fraction A and 15.0 liters of fraction B and adjust pH to 7.1 with NaOH.
Adjusted to 7.2.

D. Recovery and Inactivation After the fermentation was completed, phenol was added to another container, and then the cell broth was transferred to a final phenol concentration of about 0.5%. The substance is added until the culture is no longer viable (approximately 24
Time) Keep at room temperature with gentle stirring.

E. Centrifugation After about 24 hours at 4 ° C., 614.4 liters of inactivated culture was centrifuged in a Sharples continuous flow centrifuge.
Cell paste weight after phenol treatment was 3.8
It was 75 kg.

B. OMPC isolation step 1 Concentration and diafiltration Concentrate the phenol inactivated culture to approximately 30 liters,
It was diafiltered with sterile distilled water using a 0.2μ hollow fiber filter (ENKA).

Step 2 Extract Equal volume of 2 × TED buffer (0.1 M Tris 0.01 M, pH 8.5 containing 0.5% sodium deoxycholate).
EDTA buffer) was added to the concentrated diafiltered cells.
The suspension was transferred to a temperature controlled tank for OMPC extraction for 30 minutes at 56 ° C with stirring. The extract is placed in a Sharples continuous flow centrifuge at a flow rate of about 80 ml / min, about 4 ° C. and about 18,000.
It was centrifuged at rpm. The viscous supernatant was then collected and stored at 4 ° C. The extracted cell pellet was re-extracted with TED buffer as described above. Supernatants were pooled and stored at 4 ° C.

Step 3 Concentration by Ultracentrifugation The pooled extracts were pooled with AG-Tech 0.
Transferred to a temperature controlled vessel connected to a 1 micron polysulfone filter. The temperature of the extract was kept at 25 ° C in the vessel throughout the concentration process. Sample 11 to 24 psi
It was concentrated 10 times the average transmembrane pressure of (about 0.8 to 1.7 kg / cm ² ).

Step 4 Recovery and Washing of OMPC The reservoir of Step 3 was flowed in a continuous flow centrifuge at a flow rate of 300.
~ 500ml / min, about 70 ℃, about 160,000xg (3
After centrifugation at 5,000 rpm, the supernatant was discarded. The OMPC pellet was suspended in TED buffer (190 ml of buffer; 20 ml / g pellet), and steps 2 and 4 were repeated twice (step 3 omitted).

Step 5 Recovery of OMPC Product The washed pellet from step 4 was suspended in 100 ml of distilled water with a glass rod and a Dounce homogenizer to ensure complete suspension. The aqueous OMPC suspension is then filter sterilized by passing through a 0.22μ filter and TE
The D buffer was exchanged for water by diafiltration against sterile distilled water through a 0.1μ hollow fiber filter.

Example 2 H. Production of influenza type b capsular polysaccharide (PRP) Inoculum and seed production Step A: Lyophilized tube of Haemophilus influenzae type b [Loss accepted from New York State University
(Cultivated from (Ross) 768) was suspended in 1 ml of sterile Haemophilus inoculum (see below) and this suspension was applied to 9 chocolate agar slopes (BBL). The pH of the inoculum medium was adjusted to 7.2 ± 0.1 (typical value was pH 7.23) and the medium solution was sterilized by autoclaving at 121 ° C for 25 minutes before use. After 20 hours of incubation at 37 ° C. in a candle jar, the growth of each plate was resuspended in 1-2 ml of Haemophilus inoculum and the paired slopes were pooled. Hemophilus inoculum Raw medium g / l Soybean peptone 10 NaCl 5 NaH ₂ PO ₄ 3.1 Na ₂ HPO ₄ 13.7 K ₂ HPO ₄ 2.5 Distilled water Up to the required amount

Resuspended cells from each pair of slopes were plated with three 250 ml of hemophilus seeds and approximately 100 ml of production medium.
A ml Erlenmeyer flask was inoculated. The 250 ml flask was incubated at 37 ° C. for about 3 hours until an OD ₆₆₀ of about 1.3 was reached. Two liter flasks (below) were inoculated with these cultures.

Step B: 2 liter non-baffled Erlenmeyer flask-Using 5 ml of the culture of "step A" (above), each containing about 1.0 liter of complete Haemophilus species and production medium (see below). Each of the five 2 liter flasks prepared was inoculated. The flask was then incubated on a rotary shaker at 37 ° C at about 200 rpm for about 3 hours. Typical OD at the end of incubation
_{The 660} value was about 1.0. Complete Haemophilus species and production medium per liter NaH ₂ PO ₄ 3.1g / l Na ₂ HPO ₄ 13.7g / l soy peptone 10 g / l yeast extract dialysate filtered material (1) 10 g / l K ₂ HPO ₄ 2.5g / Liter NaCl 5.0 g / liter glucose (2) 5.0 g / liter nicotinamide adenine dinucleotide (NAD) (3) 2 mg / liter hemin (4) 5 mg / liter

Salts and soybean peptone were dissolved in a small amount of hot non-pyrogenic water and adjusted to the final volume with hot non-pyrogenic water. Then, the fermenter or the flask is sterilized by autoclaving at 121 ° C. for about 25 minutes, and after cooling, the yeast extract diafiltrate (1), glucose (2), NAD (3) and hemin (4) are flask or fermented before inoculation. Aseptically added to the bath. (1) Yeast extract diafiltrate: Yeast extract from a brewer [100 g of Amber was dissolved in 1 liter of distilled water, and ultrafiltered with an Amicon DC-30 hollow fiber unit equipped with a 50 kd cutoff H10 × 50 cartridge. The filtrate was collected and sterilized by passing through a 0.22μ filter. (2) Glucose was prepared as a sterile 25% solution in distilled water. (3) 0.22μ of stock solution containing 20mg / ml of NAD
It was sterilized by passing through a filter and added aseptically just before inoculation. (4) Add a stock solution of 3 × hemin to 0.1 M NaOH.
It was prepared by dissolving 200 mg in 10 ml, and the volume was adjusted to 100 ml with sterile distilled water. The solution was sterilized at 121 ° C. for 20 minutes and aseptically added to the final medium before inoculation.

Step C: 70 liter seed fermentor-about 3 liters of complete hemophilus seed and production medium (prepared as above) with 3 liters of the product of step B and UCON.
A fermentor containing 17 ml of B625 antifoam was inoculated. The pH at the time of inoculation was 7.4. Stage D: 800 liter production fermentor-Using approximately 40 liters of "stage C" product to an 800 liter fermentor containing 570 liters of hemophilus species and production medium (prepared as described above) set to required volume. Inoculate and UCO
72 ml NLB 625 antifoam was added.

The fermentation was maintained at 37 ° C. with 100 rpm agitation,
OD ₆₆₀ and pH levels were measured about every 2 hours until OD ₆₆₀ was stable for 2 hours, after which fermentation was terminated (typical final OD ₆₆₀ was about 1.2 after about 20 hours). Recovery and deactivation Deactivation was carried out by collecting a batch of about 600 liters in a "Kill tank" containing 12 liters of 1% methylosal. Clarification After 18 hours of inactivation at 4 ° C., the batch was placed in a 4 inch bowl Sharples continuous flow centrifuge at a flow rate (1.3-3.0 liters / min) adjusted to maintain product clarity. It was centrifuged. The supernatant obtained after centrifugation (15,000 rpm) was used for product recovery.

Isolation and concentration by ultrafiltration Supernatants from two production fermentations were pooled and stored at 20 50 kd
Cut-off hollow fiber cartridge (4.5 m ² membrane area;
Romicon XM-5 equipped with 2.0Lpm air flow and 20psi)
Concentrate at 2-8 ° C in a 0 ultrafiltration unit. Concentration means about 1900 liters is 57.4 after about 4.5 hours.
It was like being concentrated to a liter. The filtrate was discarded.

48% and 61% ethanol precipitation 95% ethanol 5 in 57.4 liters of ultrafiltration pool.
3 liters were added dropwise at 4 ° C. with stirring over 1 hour to a final concentration of 48 vol% ethanol. Mix the mixture at 4 ° C for another 2
After stirring for a period of time to completely settle, the supernatant was collected after passing through a single 4-inch Sharples continuous-flow centrifuge at 15,000 rpm and a flow rate of about 0.4 liter / min. The pellet was discarded and the clarified liquid was made up to 82% ethanol by the addition of 40.7 liters of 95% ethanol over 1 hour. The mixture was stirred for an additional 3 hours to allow complete precipitation.

Recovery of the second pellet The obtained 48% ethanol-soluble-82% ethanol-insoluble precipitate was collected by centrifugation at 15,000 rpm in a 4-inch Sharples continuous flow centrifuge at a flow rate of about 0.24 liters / min to obtain 82%. The ethanol supernatant was discarded. The crude product yield was about 1.4 kg of wet paste.

Calcium chloride extraction 1.4 kg of 82% ethanol-insoluble substance
aymax) cold distilled water 24.3 at 2-8 ° C. in a dispersion container
Mixed with liters. Add 2M CaCl ₂
24.3 liters of 2H ₂ O was added, and the mixture was stirred at 4 ° C for 1 hour.
Incubated for 5 minutes. Then the container is 1M CaC
l ₂ · 2H ₂ and washed with O 2 liters to a final volume of about 50 liters. Precipitation of 23% ethanol 50 liters of CaCl ₂ extract was added dropwise to 16.7 liters of 95% ethanol over 30 minutes at 4 ° C. with stirring to obtain 25% ethanol. After stirring for an additional 17 hours, the mixture was collected by passing through a Sharples continuous flow centrifuge at 4 ° C. The supernatant was collected and the pellet was discarded. 38% ethanol precipitation and recovery of crude product paste 25% ethanol soluble supernatant was added 38% by dropwise addition of 13.9 liters of 95% ethanol over 30 minutes with stirring.
It was ethanol. Then, the mixed solution was left for 1 hour under stirring and then for 14 hours without stirring for complete precipitation. The resulting mixture was then placed in a 4-inch Sharples continuous flow centrifuge at 15,000 rpm (flow rate 0.2 liter / mi
n) and the crude precipitate H. Influenza polysaccharide was collected.

Milling Centrifugal pellets containing 1 to 3 liters of absolute ethanol in a 1 gallon Waring Blender
And blended at maximum speed for 30 seconds. Blending continued for 30 seconds on and 30 seconds off until a hard white powder resulted. The powder was collected on a Buchner funnel equipped with a Teflon filter disc and washed in situ twice with 1 liter absolute ethanol and twice with 2 liters acetone. The material was then dried under reduced pressure at 4 ° C. for 24 hours to give about 337 g (dry weight) of product.

Phenol extraction About 168 g (about half of the total) dry matter from the milling step was added to 0.4 at pH 6.9 with the aid of a Demax dispersion vessel.
Resuspended in 12 liters of 88M sodium acetate. The sodium acetate solution was immediately extracted with 4.48 liters of fresh phenol aqueous solution prepared as follows: pH 6.9.
590 ml of 0.488 M sodium acetate of 8 phenol (Marine Clotz
(Mallinckrodt) crystals] Each of the 1.5 kg bottles was added, mixed and suspended. Each phenol extract was centrifuged for 2.5 hours at 30,000 rpm and 4 ° C. in a K2 ultracentrifuge (Electronucleonics).
The aqueous effluent was extracted three more times with fresh phenol aqueous solution as described above. The phenol phase was discarded.

Ultrafiltration The aqueous phase (12.2 liters) from the first phenol extraction is diluted with 300 liters of cold distilled water and Amicon D
Carryover phenol was removed by diafiltration on a C-30 ultrafiltration system using three H10P1010 kd cutoff cartridges at 4 ° C. When the Amicon unit was washed and the washing liquid was added to the stored liquid, the final volume was 31.
It was 5 liters. The ultrafiltrate was discarded.

67% ethanol precipitation 0.81 liter of 2.0 M CaCl ₂ was added to 31.5 liter of dialysate from the previous step (final CaCl ₂
The concentration was 0.05 M), and while the solution was rapidly stirred for 1 hour, 48.5 liters of 95% ethanol was added dropwise.
It was 2% ethanol. After stirring for 4 hours, 1 at 4 ℃
After standing for 2 hours, the supernatant was sucked out, and the precipitate was placed in a 4-inch Sharples continuous-flow centrifuge (15,000 rpm) at 4 ° C.
And collected by centrifugation at 45 min. The resulting polysaccharide pellets were triturated with 2 liters of absolute ethanol in a 1-gallon Waring blender using a pulse for 30 seconds, collected with a Buchner funnel equipped with a Teflon filter disc, and then in-situ 4 times with 1 liter of absolute ethanol and 1 liter of acetone. It was washed twice with. The sample was then dried in a tared dish under reduced pressure at 4 ° C. for 20 hours. The yield was about 102 g dry powder. The pooled material from all phenol extractions yielded 2 total dry powders.
It was 12.6 g.

Ultracentrifugation in 29% ethanol and recovery of the final product 212.6 g of the dry powder from above are dissolved in 82.9 liters of distilled water, into which 2M CaCl ₂ .2H ₂ O has been added.
(0.05 M CaCl ₂ , polysaccharide 2.5 mg / ml) 2.1
3 liters were added and the mixture was brought to 29% ethanol by dropwise addition of 29.86 liters 95% ethanol over 30 minutes. Mix the mixture into a K2 ultracentrifuge (30,000 rpm) equipped with a K3 titanium bowl and Kll Noryl core.
And a flow rate of 150 ml / min) and immediately clarified by centrifugation at 4 ° C. Discard the pellet and add 38 by adding 17.22 liters of 95% ethanol over 30 minutes with stirring.
% Ethanol. After stirring for a further 30 minutes, the mixture was left unstirred for 17 hours at 4 ° C. and the precipitate collected at 15,000 rpm in a 4-inch Sharples continuous flow centrifuge (required 45 minutes).

The resulting paste was transferred to a 1 gallon Waring blender containing 2 liters of absolute ethanol and blended at maximum speed with 4 or 5 cycles of 30 seconds on for 30 seconds off until a hard white powder formed. Collect this powder in a Buchner funnel equipped with a Zitex Teflon disc and add 0.5% fresh absolute ethanol on the spot.
It was continuously washed twice with 1 liter, once with 1 liter and twice with 1 liter of acetone. The product was removed from the funnel and transferred to a tared dish for drying under vacuum at 4 ° C. (25 hours). The final yield of product was 79.1 g dry weight.

Example 3 Clonin of genomic DNA encoding for MIEP
Guphenol inactivated N. Meningitidis cells (Example 1
(See reference) About 0.1 g was added to a fresh tube. Phenol-inactivated cells were resuspended in 567 μl of TE buffer (10 mM Tris HCl, pH 8.0, 1 mM EDTA). Resuspended cells in 30% 10% SDS and 20 mg / m
l Proteinase K [Sigma] 3 μl was added. Mix the cells and incubate at 37 ° C for about 1 hour,
Then 100 μl of 5M NaCl was added and mixed thoroughly. Then 80 μl of 1% cetyltrimethylammonium bromide (CTAB) in 0.7 M NaCl was added and mixed thoroughly and incubated at 65 ° C. for 10 minutes. An equal volume (about 0.7-0.8 ml) of chloroform / isoamyl alcohol (24: 1 ratio each) was added and mixed thoroughly and centrifuged at about 10,000 xg for about 5 minutes. The water (upper) phase was transferred to a new tube and the organic phase was discarded. Add an equal volume of phenol / chloroform / isoamyl alcohol (25: 24: 1 each) to the aqueous phase and mix thoroughly.
Centrifuge at 50,000 xg for about 5 minutes. The water (upper) phase was transferred to a new tube, and 0.6 times volume (about 420 μl) of isopropyl alcohol was added and mixed thoroughly to precipitate DN.
A was centrifuged at 10,000 xg for 10 minutes. Discard the supernatant,
The pellet was washed with 70% ethanol. The DNA pellet was dried and resuspended in 100 μl TE buffer, which was Meningitidis genomic DNA.

Two kinds of DNA oligonucleotides corresponding to the 5'end of the MIEP gene and the 3'end of the MIEP gene were synthesized (Murakami, EC et al., 1989,
Infection and Immunity, 57, 2318-23). The sequence of the DNA oligonucleotide specific to the 5'end of the MIEP gene is 5'-ACTA.
GTTGCAATGAAAAATCCCTG-3 ',
Regarding the 3'end of the MIEP gene, 5'-GAATT
It was CAGATAGTAGAATTTGTT-3 '.
These DNA oligonucleotides are described in N. 10 ng of Meningitidis genomic DNA was used as a primer for polymerase chain reaction (PCR) amplification of MIEP gene. The PCR amplification step was performed according to the manufacturer's instructions (Perkin Elmer).

The amplified MIEP DNA was then cut with the restriction endonucleases SpeI and EcoRI. 1.3 kilobases including the complete coding region of MIEP
The (kb) DNA fragment was isolated by 1.5% agarose gel electrophoresis and recovered from the gel by electroelution [Current Protocols in Molecular Biology, 1987, Ausubel,
R. M. Brent, R .; Kingston, R.S. E. ，
Moore, D.C. D. Smith, J .; A. , Seidman,
J. G. And Stroul, K .; Editing, Green Publishing Associates. (Carrent Protocols in Molecular
Biology, (1987), Ausubel, RM, Brent, R., Kingst
on, RE, Moore, DD, Smith, JA, Seidman, JGand Stru
hl, K., eds., Greene Publishing Assoc.)].

Plasmid vector pUC-19 was added to Spe
Digested with I and EcoRI. Gel-purified SpeI
-EcoRI MIEP DNA to SpeI-EcoR
It was ligated into the IpUC-19 vector and used to transform E. coli strain DH5. 1.3 kbp MIEP DNA
Transformants containing the containing pUC-19 vector were identified by restriction endonuclease mapping and MIEP DN
A was sequenced to confirm its identity.

Example 4 pc1 / 1. Construction of the Gal10p (B) ADH1t vector The Gal10 promoter is Sau3A and HindII.
The plasmid YEp52 [Broch et al., 1983, Experimental manipulation of gene expression, Inouye, M.
(Edit), Academic Press, pp. 83-117 (B
roach, et al., (1983) in Experimental Manipula
tion of Gene Expression, Inouye, M (Ed), Academic Pre
ss, pp.83-117)]. The ADH1 terminator is the vector p obtained by gel purification of the 0.35 kbp fragment obtained by HindIII and SpeI cleavage.
GAP. tADH2 [Niskern et al., 1986, Gene, 46, 135-141 (Kniskerm et al.,
(1986), Gene, 46, pp. 135-141)]. Gel-purified puc18ΔHindIII vector obtained by digesting two fragments with BamHI and SphI (HindIII site was removed by digesting pUC18 with HindIII, blunt-ending with Klenow fragment of E. coli DNA polymerase I, and ligating with T4 DNA ligase). Was ligated with T4 DNA ligase to prepare the parent vector pGal 10-tADH1. This is Gal 10p. The only Hind at the ADH1t binding site
It has a III cloning site.

PGal 10. The only Hi of tADH1
The ndIII cloning site is pGal 10. tAD
H1 was cleaved with HindIII, the cleaved DNA was gel purified, and the following HindIII-B was digested with T4 DNA ligase.
amH1 linker: 5′-AGCTCGGATCCG-3 ′ 3′-GCCTAGGCTCGA-5 ′ was changed to a unique BamHI cloning site. The resulting plasmid pGal 10
(B) tADH1 loses the HindIII site and is the only B
had formed the amH1 cloning site.

Gal 10p. The tADH1 fragment was Sma
PGal 10 (B) tADH1 upon I and SphI digestion
, Blunt-ended with T4 DNA polymerase and gel purified. Yeast shuttle vector pC1 / 1
[Blake et al., 1984, Proceeding of
National Academy of Science USA, Vol. 81, pp. 4642-4646 (Brake et al., (19
84), Proc. Nat'l. Acad. Sci. USA, 81, pp. 4642.
-4646)] was cleaved with SphI, blunt-ended with T4 DNA polymerase, and amplified. T this fragment
The vector was ligated with 4 DNA ligase. The ligation mixture was then used to transform E. coli HB101 cells to ampicillin resistance and transformants were single-stranded ³² P labeled H.
Screened by hybridization with the indIII-BamHI linker. New vector assembly Pc
i11. Gal 10p (B) ADH1t is HindII
Confirmed by I and BamHI cleavage.

Example 5 Yeast MIEP with MIEP + Leader DNA Sequence
Construction of the current vector A DNA fragment containing the complete coding region of MIEP was designated as SpeI.
And pUC19. It was formed by cleavage of MIEP # 7, gel purification of MIEP DNA, blunt termination with T4 DNA polymerase. Yeast internal expression vector pC1 / 1. Gal 10p (B) ADH1
t was cut with BamHI, dephosphorylated with calf intestinal alkaline phosphatase, and blunt-ended with T4 DNA polymerase. The DNA was gel purified to remove uncleaved vector.

A 1.1 kbp blunt-ended fragment of MIEP was blunt-ended with pc1 / 1. Gal 10p (B) A
The DH1t vector was ligated, and the ligation mixture was used to transform competent E. coli DH5 cells to ampicillin resistance. The transformants were designed to be homologous with sequences overlapping the MIEP-vector junction ³²
P-labeled DNA oligonucleotide: 5 '. ． ． AAGC
TCGGATCCCATGTTGCAATG. ． ． It screened by the hybrid formation with 3 '. DNA
Is produced from a hybridizing positive transformant, and Kp
Digested with nI and SalI to give MIEP fragment Gal
It was confirmed that the orientation was appropriate for expression from 10 promoters. Further confirmation of DNA assembly is Gal 10
The MIEP coding region was obtained from the promoter by dideoxy sequencing.

Expression of MIEP by the transformants was detected by Western blot analysis. Recombinant MIEP produced in the transformants co-migrated with MIEP purified from OMPC vesicles on polyacrylamide gels and immunoreacted with MIEP-specific antibodies.

Example 6 Yeast MIEP Genes with 5'Modified MIEP DNA Sequences
Construction of current vector HindIII site, conserved yeast 5'untranslated leader (NT
L), methionine initiation codon (ATG), mature MIEP
A DNA oligonucleotide containing the first 89 codons (starting with Asp at position +20) and a KpnI site (position +89) was generated using the polymerase chain reaction (PCR) technique. PCR uses plasmid pUC1 as template
9MIEP42 # 7 and the following DNA oligomers as primers were performed as indicated by the manufacturer [Perkin Elmer Cetus]: 5'CTAAGCTTAACAAAATGGACGTT.
ACCTTGTACGGTACAATT 3'and 5'ACGGTACCCGAAGCCGCCTTTCAA
G3 '

To remove the 5'region of the MIEP clone, plasmid pUC19MIEP42 # 7 was cloned into KpnI.
And HindIII, and the 3,4 kbp vector fragment was agarose gel purified. The 280 bp PCR fragment was cut with KpnI and HindIII, agarose gel purified and ligated with the 3,4 kbp vector fragment. Transformants of E. coli HB101 (BRL) were screened by DNA oligonucleotide hybridisation and DNA from positive transformants was analyzed by restriction enzyme digestion. The 280 bp PCR-forming DNA of the positive transformants was sequenced to ensure that the mutation was not introduced in the PCR step. The resulting plasmid is yeast NTL,
It contains a HindIII-EcoRI insert consisting of the MIEP whole open reading frame (ORF) starting at the ATG codon and the Asp codon (amino acids +20).

The yeast MIEP expression vector was constructed as follows. pGAL10 / pc1 / 1 and pGAP / p
C1 / 1 vector [Vlasuk, G. P. Et al. 1
989, J. B. C. , Volume 264, Volume 12, 106
12, 12, 112] was digested with BamHI, blunt-ended with the Klenow fragment of DNA polymerase I, and dephosphorylated with calf intestinal alkaline phosphatase. Klenow-treated and gel-purified yeast NT of these linear vectors
HindII containing L, ATG and MIEP ORFs
Ligated with I-EcoRI fragment to give pGal 10 / p
c1 / MIEP and pGAP / pGAP / pC1 / MI
EP was formed.

Saccharomyces cerevisiae strain U9 (gal
10pgal 4 ^-) plasmid pGal10 / p / pC1 /
Transformed with MIEP. Recombinant clones are isolated, M
Tested for IEP expression. Clones were grown in synthetic medium (leu ⁻ ) containing 2% glucose (w / v) at 37 ° C. with shaking to an OD ₆₆₀ of about 6.0. Then, galactose was added to 2% (w / v) to increase MIEP expression to Gal 1
It was derived from the 0 promoter. The cells were grown for an additional 45 hours after galactose induction to an OD _{600 of} about 9.0. The cells were then harvested by centrifugation. The cell pellet was washed with distilled water and frozen.

Western Broth for Recombinant MIEP
For Tsu door yeast to examine whether or not the expression of MIEP, was subjected to Western blot analysis. 12%, 1 mm, 10-1
A 5 well Novex Laemmli gel was used. Yeast cells were disrupted with glass beads in H ₂ O (sodium dodecyl sulfate (SDS) is used at 2% in the disruption process). 10,000 xg of cell debris
It was removed by centrifugation at 1 minute.

Supernatant was mixed with sample running buffer as described above for polyacrylamide gel purification of MIEP. Samples were run at 35 mA using OMPC as a reference control until the bromophenol dye marker came out of the gel. Proteins were transferred on a 0.45μ pore size nitrocellulose paper with a Novex transfer device. After transfer, the nitrocellulose paper was blocked with 5% bovine serum albumin in phosphate buffer for 1 hour and then diluted 1: 1000 with rabbit anti-MIEP antiserum (generated by gel-purified MIEP immunization using standard procedures). 15 ml) was added. After overnight incubation at room temperature, 15 ml of 1: 1000 alkaline phosphatase conjugated goat anti-rabbit IgG was added. After incubation for 2 hours, Fast Red TR salt (FAST RED
TR SALT) (Sigma) and Naphthol-AS-M
Blots were developed with X phosphate (Sigma).

Example 7 Bacterial Expression of Recombinant MIEP Plasmid pUC19-MIEP containing a 1.3 kilobase pair MIEP gene insert was cut with the restriction endonucleases SpeI and EcoRI. The 1.1 kbp fragment was isolated and purified on an agarose gel by standard techniques known in the art. The plasmid pTACSD containing the two cistron TAC promoters and the unique EcoRI site is
It was cut with coRI. The blunt ends were treated with T4 DNA polymerase [Boehringer Mannheim to produce 1.3 kbp MIEP according to the manufacturer's instructions.
Blunt-ended 1.3 kbp MIEP DNA formed with both DNA and pTACSD vector was ligated to the blunt-ended vector with T4 DNA ligase (Boehringer Mannheim) according to the manufacturer's instructions. E. coli strain DH using the ligated DNA according to the manufacturer's instructions
5a IQMAX (BRL) was transformed. Transformed cells with kanamycin 25 μg / ml and penicillin 50 μg / ml
The plate was placed on an agar plate containing ml and incubated at 37 ° C. for about 15 hours. DNA with a sequence homologous to MIEP
Oligonucleotides were labeled with ³² P and used to screen nitrocellulose filters containing denatured colonies eluted from plates of transformants using standard DNA hybridization techniques. Hybridization positive colonies were mapped with a restriction endonuclease to examine the orientation of the MIEP gene.

Expression of MIEP by the transformants was detected by Western blot analysis. Recombinant MIEP produced in the transformants co-migrated with MIEP purified from OMPC vesicles on polyacrylamide gels and immunoreacted with MIEP-specific antibodies.

Example 8 Preparation of MIEP purified from OMPC liposomes or recombinant cells by polyacrylamide gel electrophoresis 18 × 14 cm, 3 mm thick acrylamide / BIS (3
7.5: 1) Gel was used. The concentrating gel was 4% polyacrylamide and the separating gel was 12% polyacrylamide. About 5 μg of OMPC protein or recombinant host cell protein was used per gel. OMPC 1 ml
Sample buffer (4% glycerol, 300 mM DT)
0.5 ml of T, 100 mM Tris, 0.001% bromophenol blue, pH 7.0) was added. 105 ℃
Heat for 20 minutes and cool to room temperature before loading on the gel. The gel was run under cooling at 200-400 mA until bromophenol blue reached the bottom of the gel. Vertical strips of gel were cut (about 1-2 cm wide) and stained with copper coumasino acetate (0.1%). MIE strip
It was destained until the P band (about 38 kd) was visible. The strip is then placed in its original gel position and MIE
The P region was cut out from the rest of the gel with a knife.

The excised area was cut into a cube (about 5 mm) and eluted with 0.01 M Tris buffer at pH 0.1.
After two elution cycles, the eluates were evaluated for purity by SDS-PAGE. The eluate was combined with the eluate of the common pool and 4 for 60 mM ammonia-formic acid at pH 10.
It was dialyzed for 8 hours. Alternatively, the eluted protein can be dialyzed against 50% acetic acid in water. After dialysis, the eluted protein was evaporated to dryness. The material was further purified by passing through a PD10 sizing column [Pharmacia, Piscataway, NJ] and stored at room temperature.

Example 9 Carrying MIEP in a shared PRP-OMPC complex
A. Active immunization : Male C3H / HeN mice [Charles Riv, Wilmington, Mass.
er)] PRP covalently bound to OMPC suspended in 0.5 ml of 0.01M phosphate buffer (PBS) (PRP)
-OMPC; containing 2.5 μg of PRP and 17 μg of OMPC) or PRP coupled to DT (PRP-D
T; PRP 2.5-7.5 μg and DT 1.8-5.4
μg) [Conaft of Willowdale, Ontario
Immunization with intracavitary (IP) with Laboratories. Second group of male C3H-HeN
Mice have 17 μg MIEP, 17 μg OMPC or OM
Either 17 μgm of PC-IAA (OMPC derivatized with N-acetylhomocysteine thiolactone and capped with iodoacetamide) was received. Cell donors for adoptive transfer experiments were separated for 21 days, and IP immunization was performed twice, and spleen cells were collected 10 days after the secondary immunization. Adoptive transfer receptors undergo 500R systemic γ-irradiation from a ¹³⁷ Cs source and immediately PRP-DT and OMPC, MIEP or OMPC
-Male C3H / HeN mice reconditioned by intravenous injection of 8x10 ⁷ spleen cells from each of two syngeneic donors primed separately with IAA. Control mice received 8 × 10 ⁷ spleen cells from one donor mouse primed with PRP-OMPC and an equal number of spleen cells from an unprimed donor mouse.

ELISA for anti-PRP antibodies: Reactive amines are described in Marburg et al., US Pat. No. 4,8.
No. 82,317, H. C. purified by treatment with carbonyldiimidazole and reaction with butanediamine as described in US Pat. Introduced into influenza PRP. The derivatized PRP was chromatographed on Sephadex G-25 in 0.1 M sodium bicarbonate buffer, pH 8.4. N-Hydroxysuccinimide biotin (Pierce Chemical, Rockford, IL) in dimethyl sulfoxide was added to the eluate to a final concentration of 0.3 mg / ml, and 4 Reacted for hours. Unreacted N-hydroxysuccinimide biotin was removed by gel filtration on Sephadex G-25 in PBS. Coster
tar) (Cambridge, MA) Polyvinyl chloride ELISA plate with 100% ambient temperature and humidity
Overnight at 10 μg / ml avidin (Pierce Chemical) 50 in 0.1 M sodium bicarbonate buffer, pH 9.5.
Coated with μg / well. The plate was washed 3 times with 0.05 M Tris buffer containing 0.05% Tween 20 (TBS-T) at pH 8.5, and was subjected to TBS-T + 0.1% gelatin (for blocking at room temperature and 100% humidity for 1 hour). Buffer). Plates were blotted without washing, 15-40 μg / ml PRP-biotin at 50 μg / well in PBS was added and the plates were incubated for 1 hour. Add TBS-T to the plate before adding the sample.
It was washed 3 times. Samples were added to blocking buffer at 2-fold serial dilutions and incubated at ambient temperature and 100% humidity for 2 hours. Plates were then washed 3 times with TBS-T and appropriate alkaline phosphatase conjugated anti-immunoglobulin diluted in blocking buffer was added. The antibodies used were goat anti-mouse IgM [Jackson Immuno Research, West Grove, PA].
unoresearch)], IgG (Fc) (Jackson Immunoresearch), IgG1 (gamma) (BRL, Gaithersburg, MD), IgG2a (gamma) (BR
L), IgG2b (gamma) [Southern Biotechnology Associates (Souther, Birmingham, Alabama)
Biotechnology Associates)], IgG3 (gamma)
(Southern Biotechnology Associates) and goat anti-rabbit IgG (Jackson Immunoresearch). The plates were incubated for 2 hours at 100% ambient temperature and humidity, washed with blocking buffer, and substrate developed for p-nitrophenyl phosphate [1 mg / ml in 1M diethanolamine; Kirkegaard & Perry, Gaithersburg, MD]. (Kirkegaard and Perr
y)]. Dilutions were considered positive if the sample absorbance was greater than the average absorbance of 8 reagent blanks plus 3 times the standard deviation and the difference in absorbance between serial dilutions was 0.01 or greater. The endpoint titer was defined as the reciprocal of the highest dilution that gave a positive reaction in ELISA as described above. Logarithms of reciprocal titers were compared between treatment groups by two-way analysis of variance [Lindman, R .; H. Et al., 1980, Introduction to Bivariate and Multivariate Analysis, Scott Foresman (Published), New York (Lindeman, RH et al., (1980), Introdac
tion to Bivariate and Multivariate Analysis, Scott
Foresman (pub.), New Yrk)].

RIA for Anti-PRP Antibody Quantification : Anti-PR
Experimental samples of sera tested for the amount of P-antibodies using fetal bovine serum as diluent 1: 2.1: 5 and 1: 2
Diluted to 0. 25 μl of each diluted serum sample was added to 0.5 μlm
Duplicate transfer to RIA vials (Sarstedt). ^{12 5} a solution of labeled PRP with phosphate buffer as the diluent with I 300 to 800 counts / min (cpm) /
Diluted to 50 μlm. Diluted ¹²⁵ I-PRP5
0 μl was transferred to each RIA vial, mixed well and incubated at 4 ° C. for about 15 hours. 75 μl of a saturated solution of ammonium sulfate was added to each RIA vial at 4 ° C., mixed well and incubated at 4 ° C. for 1 hour. Then RI
The A vial was centrifuged at 10,000 xg for 10 minutes, the supernatant was discarded, and the cpm of the pellet was measured by a gamma counter (LKB).

A standard curve consisting of serial 2-fold dilutions of antiserum containing known amounts of anti-PRP antibody was prepared as described above,
It was examined in parallel with experimental serum samples. The amount of anti-PRP antibody in the standard curve was between 14 μg / ml as the maximum antibody amount and 0.056 μg / ml as the minimum antibody amount. All samples were run in duplicate.

The average cpm of duplicate samples was compared to a standard curve to calculate the amount of anti-PRP antibody present in the experimental serum samples. Antibody response of adoptive transfer receptors: PRP-DT and MIEP,
Receptors for spleen cells separately primed with OMPC or IAA-OMPC show significant amounts of serum IgG within 4 days.
1 and IgG2a anti-PRP antibody produced PRP-O
It responded to MPC immunization (see Figure 1). MIEP, OMP
Irradiated mice reconditioned with carrier-primed spleen cells with C or IAA-OMPC had more PRP-OMP than control mice that received PRP-DT primed spleen cells but not OMPC-primed.
It had significantly higher IgG1 (p <0.001) and IgG2a (p <0.04) anti-PRP antibody titers after C immunization. PRP-DT and MIEP, OMPC or IAA-
Serum antibody responses to PRP-OMPC immunization in mice that received splenocytes primed separately with OMPC were comparable to those that received splenocytes primed with PRP-OMPC (days 6-13). Of I
p> 0.12 for gG1 antibody and I on days 9-13
p> 0.5 for the gG2a antibody). The antibody response is PR
It was not observed when irradiated mice reconstituted with P-DT primed and MIEP or OMPC primed spleen cells were immunized with PRP without protein carrier. Statistical analysis is two-way analysis of variance (ANOVA)
(Lindman, RH, et al., Introducing Bivariate and Multivariate Analysis, 1980, Scott Foresman, New York). These results demonstrate that mouse functionalized MIEP as well as OMPCs that induce carrier T helper cells respond to the formation of anti-PRP IgG antibodies.

Example 10 MIEP mitogenic activity MIEP purified from Meningitidis OMPC was tested for mitogenic activity in a lymphoproliferative assay. Murine spleen lymphocytes are C3H / HeN, C3H / F
Obtained from eJ, C3H / HeJ or Balb / c mice. Mice are untreated or already PRP-OMPC
Had been inoculated in. Spleen cells were passed through a sterile fine mesh screen to remove interstitial debris, and K medium [RPMI 16
40 (Gibco) + 10% fetal bovine serum (Armou
r)), 2 mM glutamine (Gibco), 10 mM Hepes (Gibco), 100 μg / ml penicillin / 100 μg / ml streptomycin (Gibco) and 50 μM β-mercaptoethanol (Biorad)]. After pipetting into disrupted clots of cells, the suspension is 5x at 300xg.
Centrifuge for minutes and pellet the red blood cell buffer [90%
0.16M NH ₄ Cl (Fisher), 1
The cells were resuspended in 0% 0.7 M Tris-HCl (Sigma), pH 7.2 for 2 minutes at room temperature with 0.1 ml / ml buffer.
The cells were sublayered with 5 ml of fetal bovine serum, centrifuged at 4000 xg for 10 minutes, and then washed twice with K medium, and then 5 x in K medium.
Resuspended at 10 ⁶ cells / ml. These cells were plated in triplicate (100 μl / well) in 96-well plates with 100 μlm of protein or peptide sample.

N. Example 7 of MIEP of Meningitidis
Purified as described above. Control proteins contained bovine serum albumin, PRP-OMPC, OMPC itself and lipopolysaccharide (endotoxin). All samples were 1, 6.5, 13, 26, 52, 105 and 130
Diluted with K medium to a concentration of μg / ml, then added as above so that their final concentration was half their original concentration. Triple wells were also incubated with each type of cell suspended in K medium alone to establish a baseline for cell growth.

On the 3rd, 5th or 7th day of culture, the wells were treated with 1 mCi /
25 μl containing ³ H-thymidine (Amersham) 25 μl
Pulse labeled with. Wells were harvested 16-18 hours later with a Skatron harvester,
Counts / min (cpm) were measured with a liquid scintillation counter. The net change in cpm was calculated by subtracting the average number of cpm measured per well by cells in K medium alone from the average of experimental cpm. The stimulation index was determined by dividing the mean experimental cpm by the mean cpm of control wells.

As shown in FIG. 2, OMPC and PR
Lymphocytes from mice already vaccinated with MIEP vaccine as well as P-OMPC were expanded. This mitogenic activity is caused by LPS where MIEP does not contain detectable lipopolysaccharide (LSP) as measured in the rabbit pyrogenic assay and the proliferative effect is present in silver-stained polyacrylamide gels at sub-detectable levels. It did not seem to be caused by LPS, since it was larger than that in the case of

Example 11 N.V. H. to Meningitidis MIEP Influenza type b PRP double Goka chemical conjugation of polysaccharide was performed according to the method disclosed in U.S. Patent No. 4,882,317. 0.1M at pH 11.5
10 mg MIEP in 3 ml borate buffer was mixed with 10 mg ethylenediaminetetraacetic acid disodium salt (EDTA, Sigma Chemicals) and 4 mg dithiothreitol (Sigma Chemicals). The protein solution was thoroughly flushed with N ₂ . 125 mg of N-acetylhomocysteine thiolactone (Aldrich Chemicals) was added to the MIEP solution and the mixture was incubated at room temperature for 16 hours. Then add it to 0.1 M containing 4 mM EDTA, pH 9.5.
It was dialyzed twice against 24 liters of borate buffer under N ₂ at room temperature for 24 hours. The thiolated protein was then analyzed for thiol content by Ellman's reagent (Sigma Chemicals) and the protein concentration determined by Bradford.
(Bradford) reagent (Pierce Chemicals). For the conjugation of MIEP to PRP, a 1.5-fold excess (wt / wt) of bromoacetylated H. Influenza serum type b PRP was added to the MIEP solution and the pH was adjusted to 1N N
Adjusted to 9-9.5 with aOH. The mixture was incubated under N ₂ at room temperature for 6-8 hours. After the reaction time has elapsed, N-
Acetylcysteamine (Chemical Dynamics) 25
μl was added to the mixture and left at room temperature under N ₂ for 18 hours.
Acidify the complex solution with 1N HCl to pH 3-4.
Centrifuge at 10,000 xg for 10 minutes. 1 ml of supernatant is FPLC
The complex was applied directly to a column of Sperose 6B [1.6 x 50 cm, Pharmacia] and P
Elute with BS. Polysaccharide-protein complex (PRP-
The emission volume peaks containing MIEP) were pooled. The complex solution was then filtered through a 0.22μ filter for sterilization.

Example 12 Demonstration of Immunogenicity of PRP-MIEP Complex Immunization: Male Bal b / c mice (Charles River, Wilmington, Mass.) With 2.5 μg of PRP in 0.5 ml of preformed alum. I with PRP covalently linked to MIEP as described in Example 11
P immunized. Control mice were PRP / CRM [Anderson, M .; E. Et al., 1985, Journal of Pediatrics, vol. 107, 346-351.
Page (Anderson, ME et al., (1985), J. Pediatri.
cs. 107, pp. 346-351)] (PRP 2.5μ
g / CRM 6.25 μg; 1/4 of human dose), PRP-
DT (PRP 2.5 μg / DT 1.8 μg; fixed amount of PR
1/10 of the human dose such that P is used) and PRP
Immunized with the corresponding amount of PRP administered as OMPC (2.5 μg PRP / 35 μg OMPC; ¼ of human dose).

Infant Rhesus monkeys aged 6 to 13.5 weeks were immunized with PRP-MIEP complex adsorbed to alum. Each monkey received 0.25 ml of complex from two different injection sites with a total dose of 0.5 ml. 0.28 and 5 monkeys
Immunization was performed on day 6 and blood samples were taken every 2-4 weeks.

The antibody response is the ELIS described in Example 9.
As measured by A, this distinguishes the class and subclass of immunoglobulin response. R to quantify total anti-PRP antibody
IA (see Example 9) was also used to assess monkey response. The antibody response of the receptor of the PRP-MIEP complex is shown in FIG.
Indicated by.

The results show that the PRP-MIEP complex was IgG.
It is shown that an immune response consisting of anti-PRP antibody and memory response can be expressed in mice. This is in contrast to PRP-CRM and PRP-DT, which express no measurable anti-PRP antibody. Therefore, MIEP functions as an immunological carrier protein for PRP and can exhibit an anti-PRP antibody response when covalently bound to the PRP antigen. Therefore, purified MIEP is an effective immunogenic carrier protein that replaces heterologous OMPC in the manufacture of bacterial polysaccharide conjugate vaccines.

Example 13 Interleukin-2-induced CTLL cells after contact with MIEP (available from American Type Culture Collection as ATCC TIB214)
[Gillis, S. And Smith, K .; , 1977, Nature, 268, 154-156 (Gillis, S. and
Smith, K. (1977) Nature, 268, pp. 154-
156)] with 10% Defined fetal bovine serum [HyClone], 2 μM L-glutamine (Gibco), 100 μg / ml penicillin, 100 μM streptomycin (Gibco), 20 μM 2-mercaptoethanol (Bio-Rad). ), Maintained in RPMI 1640 (Gibco) supplemented with 10% rat T cell clones (Collaborative Research). CTLL cells were seeded every 1-2 days at 1-2 × 10 ⁴ cells / ml. Supernatants tested for IL-2 have MIEP50
μg / ml, PRP-OMPC 50 μg / ml, bovine serum albumin (Pierce) 50 μg / ml or peripheral blood lymphocytes at 4 × 10 ⁶ cells / ml in a 6-well plate (Costar) containing equal volumes of medium alone. It was obtained by culturing. Supernatants were harvested in culture at intervals of 2, 3 or 4 days and frozen until assayed. Assays for IL-2 are described in Gillis et al., Journal of Immunology, Volume 120,
It was performed as described in pages 2027-2032, 1978. Two-fold serially diluted supernatants were prepared and 100 μl were added to wells containing 4000 CTLL cells that had been depleted in the above medium without rat T-cell clones for 1 hour. All samples were prepared in triplicate in 96 well plates (Costar). The plates were incubated overnight at 37 ° C., 8% CO ₂ . Each well was pulse-labeled with 1 μCi of ³ H thymidine (Amersham) for 10 hours, and Beta Plate filtermate
(Pharmacia / LKB), beta plate 1
Read with 205 (LKB Instruments). IL-
Two standard curves were simultaneously prepared using recombinant human IL-2 [Cellular Products, Inc.]. Quantitative measurement of IL-2 is described by Gillis et al., Journal of Immunology, Volume 120, 2027-2032.
Page, calculated using the method of 1978. Recombinant IL-
IL-2 at 1 U / ml was determined by probit analysis using 2 as 50% of maximal ³ H-thymidine incorporation.
The test supernatant was also expressed as the maximum ³ H-thymidine incorporation rate at which U / ml of IL-2 was determined.

FIG. 4 shows that the results of this experiment demonstrate the ability of MIEP to induce an increase in Il-2 levels. The results shown in Figure 4 were derived from the 3rd day.

[Brief description of drawings]

FIG. 1 PRP-DT and MIEP, OMPC or IAA
-The antibody response of adoptive transfer receptors that received spleen cells primed separately with OMPC was ELIS in blood samples taken on the day after immunization with PRP-OMPC.
Measured by A.

FIG. 2. Lymphocyte proliferation assay for MIEP mitogenic activity in vitro. ³ H- in cell DNA
Increased thymidine uptake is due to bovine serum albumin (BSA), P
It was measured after contacting the cells with RP-OMPC, OMPC or MIEP.

FIG. 3: The PRP-MIEP complex was tested for immunogenicity in mice and infant rhesus monkeys. Antibody response was measured by ELISA and RIA.

FIG. 4 Il-2 by mouse spleen cells in culture after contact with MIEP as an example of induction of cytokine production.
Induction of production. Results were obtained using samples from the 3 day culture point.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] August 12, 1993

[Procedure Amendment 2]

[Document name to be corrected] Drawing

[Correction target item name] All drawings

[Correction method] Change

[Correction content]

[Figure 1]

[Fig. 2]

[Figure 4]

[Figure 3]

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification number Internal reference number FI Technical indication location A61K 39/02 ADS 9284-4C 39/12 9284-4C 39/35 9284-4C 39/385 9284- 4C // C07K 15/04 8619-4H C12N 15/31 C12P 21/00 A 8214-4B C 8214-4B (A61K 37/02 39:00) 9284-4C (C12P 21/00 C12R 1:36) 7804- 4B (C12P 21/00 C12R 1:19) (C12P 21/00 C12R 1: 865) (72) Inventor Margaret A. Riu United States, 19010 Pennsylvania, Rosemont, Kushman Road 4 (72) Inventor Arthur Friedman United States, 18966 Pennsylvania, Churchville, Frog Hollow Road 121 (72) Inventor Joseph Wai. Thailand United States, 19034 Pennsylvania, Fort Washington, Cinnamon Drive 1370 (72) Inventor John Jay. Donnelly United States, 19083 Pennsylvania, Havertown, Briarwood Drive 1505

Claims (15)

[Claims] 1. A method for increasing the immune response to an antigen, which method comprises administering a protein in a substantially pure form purified from the outer membrane of Gram-negative bacteria. 2. The method according to claim 1, which comprises administration of the Neisseria meningitidis serogroup B outer membrane class II protein in a substantially pure form. 3. The method of claim 2, further comprising administering an antigen. 4. The antigen is a bacterium, a virus, a mammalian cell,
4. Derived from fungi, rickettsiae, allergens, toxins or venoms, synthetic peptides and polypeptide fragments.
The method described. 5. A method for increasing the immune response to an antigen, which method comprises administering a recombinant protein of the outer membrane of Gram-negative bacteria produced in a recombinant host cell. 6. A recombinant class of Neisseria meningitidis serogroup B outer membrane produced in a recombinant host cell.
The method according to claim 5, which comprises administration of II protein. 7. The method of claim 6, further comprising administering an antigen. 8. The antigen is a bacterium, virus, mammalian cell,
8. Derived from fungi, rickettsia, allergens, toxins or venoms, synthetic peptides and polypeptide fragments.
The method described. 9. A method for increasing the level of a cytokine in a mammal comprising administering a protein in a substantially pure form purified from the outer membrane of Gram-negative bacteria. 10. The method of claim 9, which comprises administration of the Neisseria meningitidis serogroup B outer membrane class II protein in a substantially pure form. 11. The method of claim 9, comprising administering recombinant Neisseria meningitidis serogroup B outer membrane recombinant class II protein produced in a recombinant host cell. 12. Interleukin-in mammals
A method for increasing the level of 2, comprising administering a protein in a substantially pure form purified from the outer membrane of Gram-negative bacteria. 13. The method of claim 12, which comprises administering a recombinant protein of the outer membrane of Gram-negative bacteria produced in a recombinant host cell. 14. Interleukin-in mammals
A method for increasing the level of 2 comprising the administration of a Neisseria meningitidis serogroup B adventitial class II protein in a substantially pure form. 15. Interleukin-in mammals
15. The method of claim 14, comprising administering recombinant Neisseria meningitidis serogroup B outer membrane recombinant class II protein produced in a recombinant host cell to increase the level of 2.