JPH06341956A - Measurement of adenyl-containing substance - Google Patents

Abstract

PURPOSE:To quantitatively and qualitatively determine an adenyl-containing substance easily, specifically, and with high sensitivity by obtaining luminous activity from a chemoluminescent substance, which is derived from the reaction of an adenyl with a specific substance, and utilizing this activity as an index. CONSTITUTION:An adenyl included in an object to be measured such as adenine, adenosine, DNA, or RNA, which is included in a sample of blood or body fluid, is made to react with an active substance having an expression of R<1>-CO-R<2> in order to derive a chemoluminescent substance. In the expression, R<1> denotes hydrogen atom and an alkyl, alkenyl, or alkinyl containing 1 to 12 carbon atoms, while R<2> denotes an aldehyde or a radical expressed by a formula -CH(XR<3>) (X'R<4>) where X and X' are radicals selected from oxygen atom or selenium atom. The luminous activity obtained from a chemoluminescent substance thus derived is utilized as an index in measuring a substance to be determined qualitatively or quantitatively.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for measuring a substance containing an adenyl group. More specifically, the present invention relates to a method of chemically modifying an adenyl group in a measurement target substance and qualitatively or quantifying the measurement target substance using chemiluminescence activity as an index.

[0002]

2. Description of the Related Art Substances containing an adenyl group include adenine, adenosine, adenosine phosphate compounds, DNA and R
There are NA and the like, and they play an important role in the living body as components such as coenzymes, high-energy phosphate compounds, and genes. Conventionally, adenine and adenosine cannot be fractionally measured with other nucleic acid bases such as guanine and guanosine without a separation operation by chromatography, so that they had to rely on complicated high performance liquid chromatography (HPLC). In addition, a method utilizing ultraviolet absorption around 260 nm is generally used for measuring nucleic acid, but there is a problem in measurement sensitivity and specificity. In recent years, a fluorescent dye method using ethidium bromide has been developed.However, due to the difference in the three-dimensional structure of nucleic acid, the fluorescence intensity fluctuates greatly, making accurate quantification difficult, and ethidium bromide is a strong carcinogen. Therefore, special handling was required. Kuroda et al. At the 41st Annual Meeting of the Japan Society for Analytical Chemistry, phenylglyoxal (PG) was made to act on adenine to induce a luminescent substance, which was made to emit light by adding NaOH in the presence of H ₂ O ₂ to emit light. It was announced that adenine can be quantified from its activity. This method is adenine-specific and useful, but it has a problem that the amount of luminescence per adenine is low and the blank value in the absence of adenine is high.

[0003]

An object of the present invention is to measure a substance containing an adenyl group in a simple, specific and highly sensitive manner.

[0004]

[Means for Solving the Problems] The inventors have introduced a chemiluminescent substance by causing a reactive substance to act on an adenyl group in a substance to be measured, and qualitatively or quantitatively determine the adenyl group-containing substance from the luminescence amount. In the measuring method, a new measuring method using a reactive substance of the following general formula significantly reduces the blank value, and found that high-sensitivity measurement is possible,
The present invention has been completed.

That is, according to the present invention, a chemiluminescent substance is induced by reacting a reactive substance of the following formula 1 with an adenyl group in a substance to be measured, and the luminescent activity obtained from the chemiluminescent substance is used as an index. Provided is a method for measuring an adenyl group-containing substance, which qualitatively or quantitatively measures the substance to be measured. R ¹ —CO—R ² ... Formula 1 wherein R ¹ is a hydrogen atom; an alkyl group, an alkenyl group or an alkynyl group containing 1 to 12 carbon atoms, wherein R ¹ is a carboxyl group. Hydroxyl group; amino group; amide group; sulfonamide group; sulfide group; sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azide group;
At least one group selected from the group consisting of alkylamino groups, alkyl groups, alkenyl groups, alkynyl groups or alkoxy groups containing 4 carbon atoms; polyalkoxy groups; aryl groups; aryloxy groups and heterocyclic groups. It may be substituted or condensed, and the group itself which substitutes or condensed R ¹ is a carboxyl group; a hydroxyl group; an amino group; an amide group; a sulfonamide group; a sulfide group, a sulfoxide group; a sulfone group; a nitro group. Group; halide atom; mercapto group; carbonyl group; azido group; 1
An alkylamino group, an alkyl group, an alkenyl group, an alkynyl group or an alkoxy group containing 12 carbon atoms;
It may be substituted or condensed with at least one group selected from the group consisting of a polyalkoxy group; an aryl group; an aryloxy group and a heterocyclic group. R ² is an aldehyde group or a group represented by —CH (XR ³ ) (X ′ R ⁴ ), and X and X ′ are an oxygen atom, a sulfoxide group, a sulfone group, a sulfur atom, a selenoxide group, selenium. The groups are selected from atoms and may be the same or different from each other. R ³ and R ⁴ are hydrogen atoms; 1 to 12
An alkyl group, an alkenyl group or an araquinyl group containing 1 carbon atom, or an aryl group containing 1 to 16 carbon atoms, wherein R ³ and R ⁴ are a carboxyl group; a hydroxyl group; an amino group; an amido group. Sulfonamide group; sulfide group; sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group Or an alkoxy group; a polyalkoxy group; an aryl group; may be substituted or condensed with at least one group selected from the group consisting of an aryloxy group and a heterocyclic group, and R ³ and R ⁴ Substituent or condensed ring itself is carboxyl group; hydroxyl group; amino group; amide group; sulfonamide A sulfide group, a sulfoxide group; a sulfone group; a nitro group; a halide atom; a mercapto group; a carbonyl group; an azido group; an alkylamino group having 1 to 12 carbon atoms, an alkyl group, an alkenyl group, an alkynyl group or an alkoxy group; It may be substituted or condensed with at least one group selected from the group consisting of a polyalkoxy group; an aryl group; an aryloxy group and a heterocyclic group, and R ³ and R ⁴ are the same or different from each other. May be. Further, the R ³ and R ⁴
May partly bond to each other to form a ring.

Further, the substance to be measured is adenine,
Adenosine, adenosine phosphate compound, DNA or R
Provided is a method for measuring the above-mentioned substance containing an adenyl group which is NA. And the reactive substance is methylglyoxal, methylglyoxal dimethyl acetal, ethyl glyoxal, ethylglyoxal dimethyl acetal, n-butyl glyoxal, n-butyl glyoxal dimethyl acetal, n-octyl glyoxal, n-octyl glyoxal dimethyl acetal. Is preferred. Further, the chemiluminescent substance is added with a reaction initiator without adding an oxidizing agent in the presence of a luminescent solvent such as dimethylformamide, isopropanol, acetonitrile, dioxane or dimethylsulfoxide to measure the luminescent activity. A method for measuring the described adenyl group-containing substance is provided. Furthermore, in a DNA probe method for detecting a target nucleic acid in a sample using a capture probe that complementarily binds to the target nucleic acid, a reactive substance of the following formula 2 is reacted with the adenyl group of the target nucleic acid or its amplification product. A method for inducing a chemiluminescent substance and qualitatively or quantitatively measuring the target nucleic acid using the luminescent activity obtained from the chemiluminescent substance as an index is provided. Then, in a method for measuring a target nucleic acid in which a target nucleic acid in a sample is amplified and detected by a nucleic acid amplification method using a polymerase, the reactive substance is reacted with the adenyl group of the target nucleic acid or its amplification product to generate chemiluminescence. Provided is a method for inducing a substance, and qualitatively or quantitatively measuring the target nucleic acid using the luminescence activity obtained from the chemiluminescent substance as an index. Then, in an immunological measurement method of detecting by using an immune reaction of a test substance in a sample, a polymerase is used as a target nucleic acid of an antibody labeled with a substance having an adenyl group and / or a nucleic acid of an antibody labeled with a nucleic acid. Amplification by the nucleic acid amplification method using polymerase as the target nucleic acid of the antigen labeled with the adenyl group of the amplification product obtained by the nucleic acid amplification method or with a substance having an adenyl group and / or the nucleic acid of the antigen labeled with the nucleic acid The chemiluminescent substance is induced by reacting the reactive substance of the above formula 2 with the adenyl group of the obtained amplification product, and the target nucleic acid is qualitatively determined using the luminescent activity obtained from the chemiluminescent substance as an index. Alternatively, there is provided a method for measuring an adenyl group-containing substance, which comprises quantitatively measuring and measuring the test substance.

The present invention will be described in detail below.

The measuring method of the present invention measures a sample containing a substance to be measured. As such a sample,
Examples thereof include blood, body fluids, urine, tissues, culture fluids of microorganisms and extracts thereof, and amplification products such as polymerase chain reaction (PCR) of nucleic acids contained therein. The substance to be measured in the measuring method of the present invention is a substance containing an adenyl group, such as adenine, adenosine, adenosine phosphate compound, DNA or RN.
A and the like are typical, but can be applied to the measurement of artificial modified nucleic acid containing an adenyl group.

The reactive substance used in the measuring method of the present invention is a substance represented by the formula 1, and R ¹ and R ² are any groups selected from the following substituents. R in ¹ -CO-R ² ...... Formula 1 Formula, R ¹ represents a hydrogen atom; an alkyl group containing 1 to 12 carbon atoms, an alkenyl or alkynyl group, wherein R ¹ represents a carboxyl group; Hydroxyl group; amino group; amide group; sulfonamide group; sulfide group; sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azide group;
At least one group selected from the group consisting of alkylamino groups, alkyl groups, alkenyl groups, alkynyl groups or alkoxy groups containing 4 carbon atoms; polyalkoxy groups; aryl groups; aryloxy groups and heterocyclic groups. It may be substituted or condensed, and the group itself which substitutes or condensed with R ¹ is a carboxyl group; a hydroxyl group; an amino group; an amide group; a sulfonamide group; a sulfide group; a sulfoxide group; a sulfone group; a nitro group. Group; halide atom; mercapto group; carbonyl group; azido group; 1
An alkylamino group, an alkyl group, an alkenyl group, an alkynyl group or an alkoxy group containing 12 carbon atoms;
It may be substituted or condensed with at least one group selected from the group consisting of a polyalkoxy group; an aryl group; an aryloxy group and a heterocyclic group.

R ² is an aldehyde group or --CH (X
R ³ ) (X ′ R ⁴ ) is a group represented by X and X ′.
Are groups selected from an oxygen atom, a sulfoxide group, a sulfone group, a sulfur atom, a selenoxide group, and a selenium atom, which may be the same or different. R ³ and R ⁴ are a hydrogen atom; an alkyl group, an alkenyl group or an alkynyl group containing 1 to 12 carbon atoms, or 1 to
An aryl group containing 16 carbon atoms, wherein R ³ and R ⁴ are carboxyl group; hydroxyl group; amino group; amido group; sulfonamide group; sulfide group; sulfoxide group; sulfone group; nitro group; halide atom;
Mercapto group; carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; aryloxy group and heterocyclic group It may be substituted or condensed with at least one group selected from the group consisting of R ³ and R ⁴ , and the group itself which substitutes or condensed with R ³ and R ⁴ is a carboxyl group; a hydroxyl group; an amino group; an amido group. A sulfonamide group; a sulfide group, a sulfoxide group; a sulfone group; a nitro group; a halide atom; a mercapto group; a carbonyl group; an azido group; an alkylamino group containing 1 to 12 carbon atoms,
Alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; may be substituted or condensed with at least one group selected from the group consisting of aryloxy group and heterocyclic group, The R
³ and R ⁴ may be the same or different from each other.
Further, a part of R ³ and R ⁴ may be bonded to each other to form a ring.

R ¹ is a group which influences the resonance structure of the luminescent material to be induced, and can be selected from the above-mentioned substituent group. In particular, an alkyl group in which R ^{1 in} Formula 1 contains ¹ to 12 carbon atoms, particularly an alkyl group containing 1 to 8 carbon atoms, and further a methyl group, an ethyl group, a propyl group, a butyl group, pentyl. A group, a hexyl group, a heptyl group, and an octyl group are preferable because they have a low blank value. Provided that the R ¹ group is substituted or condensed, and R
^The group which substitutes or is condensed with 1 is the same as defined in Formula 1 above. R ² is a group directly bonded to an adenyl group, and is an aldehyde group or —CH
A group represented by (XR ³ ) (X ′ R ⁴ ), wherein X,
X ′, R ³ and R ⁴ can be selected from the above substituent group. Particularly, a group represented by —CH (XR ³ ) (X ′ R ⁴ ) has a low blank value, which is preferable.
However, X, X ′, R ³ and R ⁴ are the same as defined in the above formula 1. Suitable examples of the reactive substance include:
Methylglyoxal (MG), methylglyoxal dimethyl acetal (MGA), ethylglyoxal (EG), ethylglyoxal dimethylacetal (EGA), n-propylglyoxal, n-propylglyoxal dimethylacetal, n-butylglyoxal (BuG), n- Butyl glyoxal dimethyl acetal (BuGA), n-pentyl glyoxal, n-pentyl glyoxal dimethyl acetal, n-hexyl glyoxal, n-hexyl glyoxal dimethyl acetal, n-heptyl glyoxal, n-heptyl glyoxal dimethyl acetal, n-octyl glyoxal (OcG) ) And n-octylglyoxal dimethyl acetal (OcGA).

In the measuring method of the present invention, first, a substance to be measured is reacted with a reactive substance to induce a chemiluminescent substance. As the reaction solvent used in this reaction, a general polar solvent can be used, but isopropanol (i-
PrOH), ethanol, dimethyl sulfoxide (DM
SO) is particularly preferred. Further, this reaction is desirably carried out under acidic conditions, and hydrochloric acid and perchloric acid are particularly suitable as the acid catalyst. The reaction temperature is preferably higher than room temperature, and 70 to 100 ° C. is particularly suitable for rapid reaction.

Next, a luminescent solvent is added to the chemiluminescent substance generated by the above reaction, and further a reaction initiator to which a surfactant is appropriately added is added to emit light. Then, the amount of emitted light is measured for the chemiluminescent substance that has emitted light. As the luminescent solvent, a general polar solvent can be used, and specifically,
Examples thereof include i-PrOH, dimethylformamide (DMF), dioxane, acetonitrile, diglyme, dimethylsulfoxide (DMSO) and the like, and i-PrOH, dimethylformamide (DMF), acetonitrile, dioxane and DMSO are particularly preferable. Generally, an oxidant is required for the luminescence reaction of a chemiluminescent substance, and an oxidant such as H ₂ O ₂ may be added in the measuring method of the present invention. According to the measurement method of Kuroda et al.
It is preferable to add a certain amount of H ₂ O ₂ , and it is stated that a decrease in the amount of luminescence is observed at 10 mM or less. actually,
PG is used as a luminescent solvent for high performance liquid chromatography D
MF (peroxide concentration 0.001 up to as H ₂ O ₂
% Or a maximum of 0.28 mM), using 50 mM
With H ₂ O ₂ added and with no H ₂ O ₂ added (10 mM
When the following H ₂ O ₂ is included, the decrease in the amount of light emission and the signal noise ratio (S / N) in the latter are compared.
Ratio) was observed. On the other hand, in the measuring method of the present invention, contrary to the case of PG, the S / N ratio when H ₂ O _{2 was} not added (containing 10 mM or less of H ₂ O ₂ ) was higher than that when 50 mM of H ₂ O _{2 was} added. The ratio is improved. This is considered to be due to the extremely high efficiency of oxidization of the chemiluminescent substance generated in the process of the present invention, which is a characteristic that has not been found in the past.

NaOH as a reaction initiator of the luminescence reaction
Is preferred. Moreover, in order to adjust the light emission time, the light emission amount, etc., an additive such as an SH agent or a surfactant may be added. S
It is preferable to add 2-mercaptoethanol (2-ME) in an amount of about 3 to 20 mM as the H agent because a decrease in the blank value is recognized. As a method for detecting luminescence, a method using a photon counter, an X-ray film, or the like can be used, but a photon counter or the like is preferable because quantitative measurement can be performed. The measuring method using PG of Kuroda et al. Used an aromatic glyoxal compound in order to increase the luminescent activity of the luminescent substance to be induced, but surprisingly, the non-aromatic glyoxal compound of the present invention and its The method using the derivative has a much higher signal noise ratio (S / N ratio), and is capable of highly sensitive measurement with a low blank value. In addition, the luminescent substance generated in the course of the measuring method of Kuroda et al.
_Although the addition of ₂ O ₂ was required, the luminescent substance generated in the process of the measuring method of the present invention does not require the addition of high concentration of H ₂ O ₂ as in the method of Kuroda et al. S /
It has the characteristic of high N ratio. Further, as long as a usual solvent reagent is used as a luminescent solvent, H which is an oxidant is used.
The addition of ₂ O ₂ is unnecessary, and the measurement method of the present invention is an excellent method in terms of convenience of reagent preparation and cost.

The method of the present invention is specific to an adenyl group and is hardly affected by nucleobases such as thymine, cytosine, guanine and uracil and their derivatives. Methylated adenine, which is a derivative of adenine and exists naturally, cannot be detected as it is. The high specificity of the method of the present invention is due to the fact that a target nucleic acid as a measurement target in a sample is hybridized with a capture probe having a complementary sequence to the target nucleic acid, and the target nucleic acid is detected in a sequence-specific manner. It can be effectively used in the probe method. That is,
1) The capture probe is designed so as not to contain an adenyl group, 2) the base corresponding to the adenyl group of the capture probe is deleted, 3) the adenyl group in the capture probe is modified to an inactive group as described above, or Substituting, etc. to produce a capture probe such that the capture probe does not induce a chemiluminescent substance by reacting with a reactive substance, and the reaction product reacted with the sample is measured by the method of the present invention, Only the adenyl group derived from the target nucleic acid in the sample is detected. Also,
It is also possible to measure the adenyl group derived from the target nucleic acid by subtracting the luminescence amount derived from the capture probe from the detected luminescence amount using the capture probe containing the adenyl group as it is.

The reactive substance used in this method is represented by the following formula 2
Is a compound of. R ⁵ —CO—R ⁶ Formula 2 In the formula, R ⁵ is a hydrogen atom; an alkyl group, an alkenyl group or an alkynyl group containing 1 to 12 carbon atoms;
An aryl group containing 8 carbon atoms or a heterocyclic group having aromaticity, and the definition of the substituent in R ⁵ is the same as that in R ¹ described above. R ⁶ is an aldehyde group or a group represented by ^{-CH (XR 7) (X '} R 8). However, the definition of the substituents of R ^7, R ⁸ are described above R ²
And the definitions of X and X ′ are the same as those in R ² above. Also, R ⁵ is 1 to 1.
For details of the measuring method in the case of an aryl group containing 8 carbon atoms or a heterocyclic group having aromaticity,
See the patent application filed on February 26, 2005 entitled "Measuring Method for Adenine-Containing Substances" of the Invention.

In the conventional DNA probe method, the target nucleic acid bound to the capture probe is further reacted with a labeled probe or a labeled antibody, and the operation is complicated, but the measuring method using the DNA probe of the present invention Is a simple and useful method that is unprecedented since it can directly measure the target nucleic acid bound to the capture probe and does not require a labeling agent. For example, with a DNA synthesizer, the adenine portion is treated with Uni-Li.
nk ^TM AminoModifier (Clontech
(Manufactured by K.K.) and a capture probe substituted with a crosslinking reagent is prepared, and this is insolubilized in a microtiter plate into which an amino group has been introduced, using glutaraldehyde. A target nucleic acid can be detected by adding a sample to this plate for reaction, washing, and measuring by the measuring method of the present invention.

Furthermore, the measuring method of the present invention comprises the target nucleic acid in the reaction solution obtained by amplifying the target nucleic acid in the sample by a nucleic acid amplification method using a polymerase such as PCR, and its amplification product, Alternatively, it is also useful when applied to a target nucleic acid measuring method for measuring a target nucleic acid or its amplification product. That is, as an amplification primer for a target nucleic acid, it is designed so as not to contain an adenyl group for the purpose of not inducing a chemiluminescent substance like the above-mentioned capture probe, or the adenyl group is deleted or modified or substituted to be unadapted. Using activated DNA as an amplification primer, specific binding substances such as biotin and antigen that bind to the amplification primer (designed or modified in advance so as not to induce chemiluminescent substance of adenyl group like amplification primer) ), The target nucleic acid is subjected to PCR and amplified, and then the substance (avicin, antibody, etc.) to which the specific binding substance binds to the specific binding substance in the obtained reaction solution. React with insolubilized solid phase. After washing, if the substance represented by the above formula 2 is used as the reactive substance and the measurement is performed by the above method, the excess primer for the measurement does not emit light. Therefore, after amplification reaction, in the reaction solution by electrophoresis or the like. Target nucleic acid PC without separating the amplification product and the primer
Only luminescence from the R amplification product is detected.

It is also possible to introduce the specific binding substance into the PCR amplification product by using a nucleotide triphosphate other than adenosine labeled with a specific binding substance such as biotin or an antigen. When PCR is performed by the above-mentioned method, the excess primer and adenosine triphosphate do not bind to the substance (avicin etc.) to which the specific binding substance binds, and therefore only the luminescence derived from the target nucleic acid PCR amplification product is detected. In addition to the method shown above, P using an ultrafiltration membrane
A method of recovering only the CR amplification product or a method of using a resin carrier that specifically binds only the PCR amplification product can be applied.

With the progress of nucleic acid amplification methods such as the PCR method developed in recent years, the quantification of amplified nucleic acids is gaining importance in a wide range from basic research of biochemistry to clinical application in medicine. The measuring method of the present invention, these amplified nucleic acids, it is possible to easily measure in a short time, further, since the measured value depends on the amount of the adenyl group,
Unlike the fluorescent dye method, it is not affected by the difference in the three-dimensional structure of nucleic acids.

The measuring method of the present invention can be applied to methods other than the nucleic acid detecting method. That is, an adenine polymer can be used as a labeling substance for an antibody or an antigen in an immunological measurement method in which an immunological reaction of a test substance in a sample is detected. When a nucleic acid is used as the labeling substance, the nucleic acid is amplified by the PCR method and then the PCR is performed.
The amount of the test substance in the sample can be determined by measuring the amplified product by adenine luminescence. For example, to the adenyl group of the amplification product obtained by amplifying the nucleic acid of the antibody or nucleic acid labeled with the substance having an adenyl group or the nucleic acid of the antibody labeled with the mixture thereof by the nucleic acid amplification method using the polymerase as the target nucleic acid, or the adenyl group Based on the above formula 2
The reactive substance may be reacted to induce a chemiluminescent substance, and the test substance can be qualitatively or quantitatively measured using the luminescent activity obtained from the chemiluminescent substance as an index.

[0022]

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to Examples of the present invention.

Example 1 Adenine Luminescence Using Various Glyoxal Compounds Adenine (manufactured by Tokyo Kasei Co., Ltd.) was dissolved in a small amount of distilled water, and 5 × 10 ⁻⁴ M sample was prepared with i-PrOH. Phenylglyoxal, methylglyoxal,
Methylglyoxal dimethyl acetal, and Sert
Atosa method (Tetrahedron, 16 , 189-191 (1
961)), five kinds of glyoxal derivatives of ethyl glyoxal dimethyl acetal (EGA) and n-butyl glyoxal dimethyl acetal (BuGA) were dissolved in i-PrOH, and 0.
A 3M solution was prepared. 100 μl of the sample solution was placed in a glass vial, and 0.3 M glyoxal compound (MG, M
GA, EGA, BuGA or PG) i-PrOH solution and 1.2M hydrochloric acid i-PrOH solution 5 each
0 μl was added, the vessel was sealed, and heated at 100 ° C. for 1.5 hours. After cooling the obtained reaction liquid, chemiluminescence was measured by the following procedure using this reaction liquid. 10 μl of the reaction liquid was placed in a glass tube for measurement, 400 μl of DMF containing 50 mM hydrogen peroxide and 5 mM 2-ME was added and mixed. In addition, hydrogen peroxide and 2-M in 10 μl of reaction solution
Also prepared was the addition of 400 μl DMF without E. Here, DMF is DMF (peroxide concentration: H) for high performance liquid chromatography manufactured by Wako Pure Chemical Industries, Ltd.
_A maximum of 0.001% or a maximum of 0.28 mM was used as ₂ O ₂ . Further, this glass tube was set in a chemiluminescence analyzer (manufactured by LB952T / 16 Berthold), 300 μl of a 0.25 M sodium hydroxide aqueous solution was added to start luminescence, and immediately after the addition, 2
The light emission amount (RLU) per second was measured. Hydrogen peroxide (50
When DMF containing (mM) and 2-ME was used as a luminescent solvent, MG, MGA, EGA, BuGA, and PG exhibited luminescent activity (FIG. 1). On the other hand, hydrogen peroxide and 2-ME
When DMF not containing is used as the luminescent solvent, P
The decrease in the amount of light emission was observed in G, whereas in MG and MG
The blank value decreased in A, EGA, and BuGA, and the light emission amount increased in MGA, EGA, and BuGA (FIG. 2). Based on these results, hydrogen peroxide and 2-
Signal noise ratio (S with and without addition of ME)
/ N ratio) was compared (Table 1). The PG used as a comparative example showed a decrease in the S / N ratio when not added, whereas the MG, MGA, EGA and BuGA showed a significant increase in the S / N ratio when not added. . The S / N ratio of MG when hydrogen peroxide and 2-ME were not added was about twice that of the comparative example in which PG was used as the reactive substance and hydrogen peroxide and 2-ME were added to the luminescent solvent. Is about 6 times, EGA
Was about 5 times higher, and BuGA was about 4 times higher. The values in Table 1 are S /
The N ratio is shown.

[0024] Note) DMF: N, N-dimethylformamide manufactured by Wako Pure Chemical Industries, Ltd. (Grade: for high performance liquid chromatograph (Peroxide concentration: 0.002% maximum as H ₂ O ₂ , ie, 0.28 mM maximum) ))

(Example 2) Preparation of calibration curve of adenine using methylglyoxal dimethyl acetal After dissolving adenine with a small amount of distilled water, a sample of 0 to 5x10 ^-4 M was prepared with i-PrOH. Each sample solution 100
Into a glass vial, 50 μl each of 0.3 M MGA and 1.2 M hydrochloric acid in i-PrOH solution was added, sealed tightly, and heated at 100 ° C. for 2 hours. After cooling the obtained reaction liquid, chemiluminescence was measured by the following procedure using this reaction liquid. Take 20 μl of the reaction solution in a glass tube for measurement and add DMF400 containing 5 mM 2-ME.
μl was added and mixed. This glass tube is a chemiluminescence analyzer (LB952T / 16 Berthold)
Set to 30 0.25M aqueous sodium hydroxide solution
0 μl was added to start luminescence, and the amount of luminescence was measured for 2 seconds immediately after the addition. A calibration curve for adenine was prepared from the obtained luminescence amount, and as shown in FIG. 3, it was 5 × 10 ^−7.
A good linear relationship was observed between M and 5 × 10 ⁻⁴ M. 3, the horizontal axis represents the adenine concentration, and the vertical axis represents the value obtained by subtracting the luminescence amount of the blank containing no adenine from the luminescence amount of the solution containing adenine at each concentration.

Example 3 Measurement of Various Nucleic Acid Bases and Nucleic Acids In order to examine the substrate specificity of adenine luminescence using methylglyoxal, adenine, adenosine, Poly (A) (Boehringer Mannheim Co. Ltd.) was used as a substance containing an adenyl group. Product No. 108626), guanosine as a substance containing no adenyl group, Poly (U) (Boehringer Mannheim Co. Product No. 108928), Pol
y (dT) (Pharmacia product number 27-783
Each substance of 4) was dissolved in a small amount of distilled water and then diluted with i-PrOH so that the concentration of each substance was 1 × 10 ⁻⁴ M for adenine, adenosine and guanosine, and Poly (A), Pol.
The sample solution was prepared so that y (U) and Poly (dT) were 100 μg / ml. 100 μl of each sample solution
Was reacted according to the protocol of Example 2 and the amount of chemiluminescence was measured. As a result, as shown in FIG. 4, no luminescence due to a substance containing no adenyl group was observed.

Example 4 Effect of 2-ME in Luminescent Solvent A sample containing 0 (100 μg / ml) of Poly (A) was reacted according to Example 2, and the reaction solution obtained was used to react 2 in luminescent solvent. -The effect of ME was investigated. 10 μl of each reaction solution was put in a glass tube for measurement, and 2-ME (0 to 500 m
400 μl of DMF containing M) was added and mixed. When this glass tube was set in a chemiluminescence analyzer and the amount of luminescence was measured according to Example 2, the 2-ME concentration was 2.5-
The blank value decreased at 10 mM, and the S / N ratio was improved about 5 times as compared with that without addition of 2-ME (FIG. 5). Furthermore, when the results shown in FIG. 1 and FIG. 2 and the results shown in FIG. 5 are combined, the decrease in blank value and the improvement in S / N ratio observed in MG and MGA in FIG. It is considered that this is due to not adding.

Example 5 Preparation of Calibration Curve of PCR Amplification Product A method for quantitatively detecting a nucleic acid was examined by applying a specific measurement method for adenine. Escherichi
a coli (E. coli) genomic DNA ribosomal RNA gene sequence (EMBL accession
number: V00348), as shown in Table 2, as a sense-side primer, E0001 (SEQ ID NO: 1)
518-1537), E1000R (SEQ ID NO: 2498-2517) was selected as the antisense primer, and the DNA synthesizer (Applied Biosystem) was selected.
ms / DNA / RNA Synthesizer
394). E. coli (JM109,
From Takara Shuzo Co., Ltd.), genomic DNA was prepared according to the method of Kachino Yoshiyuki et al. (Preparation of bacterial DNA, experimental blotting method of gene / protein experiment, p.32, 1987, Soft Science), and the DNA was measured by absorbance at 260 nm. The concentration was calculated. 100 μl of a Taq reaction solution (10 mM Tris-HC was added to 100 ng of this sample).
1, pH 8.3, 1.5 mM MgCl ₂ , 50 mM K
Cl, 200 μM each dNTP, 0.2 μg each primer) 2.5 units of Amplitaq ^™ DN
A polymerase (Perkin-Elmer
Cetus) was added and a drop of mineral oil was added dropwise. P at 94 ° C for 1 minute, 55 ° C for 1 minute, 72 ° C for 2 minutes P
30 CR cycles, DNA thermal cycler (P
erkin-Elmer Cetus) and 1 kbD sandwiched between E0001 and E1000R.
NA (SEQ ID NO: 1518-2517) was amplified.

[0029]

Next, 100 μl of a phenol (saturated with 1 M Tris (pH 8.0))-chloroform (1: 1) solution was added to 100 μl of this reaction solution, and the mixture was stirred well, centrifuged (15000 rpm, 15 seconds), and then water. The phases were collected.
After extraction with a phenol-chloroform (1: 1) solution again, 100 μl of chloroform was added and well stirred, and the aqueous phase was collected. 3M sodium acetate (pH 5.2)
10 μl of ethanol and 220 μl of ethanol (−20 ° C.) were added, and the mixture was left overnight at −20 ° C. to precipitate an amplification product.
After centrifugation (15,000 rpm, 10 minutes), the supernatant is discarded and vacuum dried, and the obtained amplification product is dissolved in 10 μl of distilled water,
The DNA concentration was calculated by the absorbance at 260 nm. This solution was diluted with i-PrOH to obtain a sample solution. When the sample solution was reacted with MGA according to the protocol of Example 2 and the chemiluminescence amount was measured, the luminescence amount was proportional to the DNA concentration (FIG. 6).

(Example 6) Preparation of calibration curve of DNA using various glyoxal compounds C region gene sequence of hepatitis B genomic DNA (HBV-DNA) (GenBank accession number)
hepatitis B virus-specific primers B1 and B5R (amplification length 850b) selected from
p) (Table 3 below) was used to perform PCR. From HBe antigen-positive chronic hepatitis B patient plasma (serotype adr),
A. The method of Fujiyama et al. (Nucleic Ac
ids Research, p4601, 11 (1
3), 1983) to purify Dane particles and
V-DNA (3.2 kb) was isolated. This was cloned into a plasmid (pBR322), and the obtained recombinant (pBR-HBV) was purified and used as a sample. HBV-
Plasmid (p containing DNA (3.2 kb) inserted
BR-HBV) 100 ng as a sample, 100 μl of T
aq reaction solution (10 mM Tris-HCl, pH 8.
3, 1.5 mM MgCl ₂ , 50 mM KCl, 20
0 μM each dNTP, 0.2 μg each primer) 2.5 units of Amplitaq ^™ DNA po
lymase (Perkin-Elmer Cet
(manufactured by us) and then a drop of mineral oil is added,
A cycle of 1 minute at 4 ° C, 1 minute at 55 ° C, 1 minute at 72 ° C, 30 cycles of the DNA thermal cycler (Perkin-E
Amplification was performed using an Lmer Cetus). next,
Phenol (1M Tris (pH
(Saturated with 8.0))-Chloroform (1: 1) solution (100 μl) was added, stirred well, and centrifuged (15000 r).
(pm, 15 seconds), the aqueous phase was collected. After extraction with a phenol-chloroform (1: 1) solution again, 100 μl of chloroform was added and well stirred, and the aqueous phase was collected.
10 μl of 3M sodium acetate (pH 5.2),
After adding 220 μl of ethanol (−20 ° C.), −2
The amplification product was precipitated by leaving it at 0 ° C. overnight. After centrifugation (15
(000 rpm, 10 minutes), the supernatant is discarded and the residue is vacuum dried, and the obtained amplification product is dissolved in 10 μl of distilled water, and 260 nm
The DNA concentration was calculated from the absorbance of. This solution is diluted with distilled water to give 0, 10, 50, 100, 250, 500n
A sample solution of g / sample (2 μl) was prepared.

Next, 2 μl of each sample solution was electrophoresed using a 1% agarose gel containing 0.5 μg / ml ethidium bromide whose sensitivity is detected by the ethidium bromide method (FIG. 7). .

2 μl of each sample solution was placed in a glass vial, and 0.05 M glyoxal compound (MGA, EG
A) or 0.3M glyoxal compound (BuG
50 μl of each of A) and 1.2 M hydrochloric acid i-PrOH solution were added, and the bottles were sealed and heated at 100 ° C. for 1.5 hours. After cooling the obtained reaction liquid, chemiluminescence was measured by the following procedure using this reaction liquid. 10 μl of the reaction solution was placed in a glass tube for measurement, 400 μl of DMF containing 2 mM L-cysteine was added and mixed. This glass tube was attached to a chemiluminescence analyzer (LB952T / 16B
(manufactured by erthold), 300 μl of a 0.25 M sodium hydroxide aqueous solution was added to start luminescence, and luminescence intensity was measured for 2 seconds immediately after the addition. The luminescence intensity of these is proportional to the DNA concentration, and the detection sensitivity is about 250 ng / sample for MGA and about 10 n for EGA and BuGA.
g / sample (FIGS. 8, 9 and 10).

[0034]

[Table 1]

(Example 7) Application to measurement of PCR amplification product i) Method using dUTP-biotin pBR-HBV 0 ng (negative control), 100 using primers B1 and B5R (amplification length 850 bp).
100 μl of T using ng (positive control) as a sample
aq reaction solution (10 mM Tris-HCl, pH 8.
3, 1.5 mM MgCl ₂ , 50 mM KCl, 100
μM dATP, dGTP, dCTP, 75 μM dT
TP, 25 μM biotin-16-dUTP (Boehringer Mannheim), 0.2 μg each primer)
2.5 units of Amplitaq ^™ DNA p
Olymerase (Perkin-Elmer Ce
(made by Tus), and then add 1 drop of mineral oil.
A cycle of 94 ° C for 1 minute, 55 ° C for 1 minute and 72 ° C for 1 minute was repeated 30 times using a DNA thermal cycler (Perkin-
Amplification was performed using Elmer Cetus). Positive control reaction solutions 6.25, 12.5, 25 and 5, respectively
0 μl was diluted to 100 μl each with 0.076 M phosphate buffer (PBS) containing 0.1 M NaCl to obtain a sample solution. A negative control reaction solution (25 μl) diluted with PBS was used for background measurement. Each sample placed in a glass vial, 500μg of streptavidin A Pidgin sensitized magnetic particles (BioMag ^R Streptavid
in, Advanced Magnetics) was added. After stirring for 1 hour at 37 ° C, 500 μl of P
After adding BS and separating the magnetic particles and the supernatant using a magnet separator (manufactured by Ciba Corning), the supernatant was removed.
After treatment at 100 ° C for 5 minutes to dryness, 0.3M MG
I-PrOH solution of A and i-PrO of 1.2 M hydrochloric acid
50 μl of each H solution was added, and the solution was sealed and heated at 100 ° C. for 1.5 hours. 2 m for each 10 μl of the resulting reaction solution
400 μl of ML-Cysteine / DMF solution was added,
The emission intensity was measured according to Example 6. Emission intensity is PC
It increased in proportion to the amount of R reaction solution (FIG. 11).

Ii) Method using a centrifuge tube with a DNA recovery filter pBR-HBV 0 pg, 0.1 pg, 10 pg, 10 using primers B1 and B5R (amplification length 850 bp)
PCR was performed under the same conditions as in Example 6 using 00 pg as a sample. 100 μl of this reaction solution was added to 400 μl of i-PrOH
Centrifuge tube with filter for DNA recovery washed with (S
After centrifugation (6400 rpm, 10 minutes) using UPREC ^™ -02, manufactured by Takara Shuzo Co., Ltd., i-PrOH 100 μ
1 to the tube and centrifuge again (6400 rpm, 1
It was washed for 0 minutes). Next, 20 μl of distilled water was added onto the filter of the tube to dissolve the recovered PCR amplification product. PCR amplification product solution 2 μl each 0.5
Electrophoresis was performed on a 1% agarose gel containing μl / ml ethidium bromide to confirm the band of the amplification product (FIG. 12). The amplification product was collected according to the amount of the sample. I-PrOH was added to 10 μl of each solution containing this amplification product.
90 μl was added and the amount of 0.
The reaction was performed with 3MMGA and the emission intensity was measured. As a result, the luminescence intensity increased in proportion to the amount of the sample (Fig. 1
3).

Example 8 Adenine light emission using various glyoxal compounds Methylglyoxal dimethyl acetal (MGA),
And Serratosa's method (Tetrahedron, 16, 185-
191 (1961)), ethyl glyoxal dimethyl acetal (EGA), n-butyl glyoxal dimethyl acetal (BuGA) and n-octyl glyoxal dimethyl acetal (OcGA).
4 kinds of glyoxal derivatives of 3 were dissolved in i-PrOH to prepare a 0.3 M solution of each derivative. Adenine was dissolved in a small amount of 0.1 N hydrochloric acid and diluted with i-PrOH to prepare 1 × 10 ⁻⁴ M samples. 100 μl of the sample solution was placed in a glass vial and the 0.3 M glyoxal compound (MGA, EGA, B prepared above was prepared.
uGA or OcGA) solution and 1.2M hydrochloric acid i-
Add 50 μl each of PrOH solution, stopper tightly,
Heated at ° C for 1 hour. After cooling the obtained reaction solution, chemiluminescence was measured by the following procedure using this reaction solution. Take 10 μl of the reaction solution in a measuring glass tube and add 5 mM 2-mercaptoethanol to DMF.
400 μl was added and mixed. This measurement sample tube was used as a chemiluminescence measuring instrument (LB952T / 16 Bert
(manufactured by Hold) and 300 μl of a 0.25 M aqueous sodium hydroxide solution was added to start light emission, and the amount of light emission was measured for 2 seconds immediately after the addition. As a result, luminescence activity was observed for all four glyoxal compounds (FIG. 14).

Example 9 Application to PCR Amplification Product Measurement 9-1 Amplification Product Length and Luminescence Intensity A method for quantitatively detecting nucleic acid was examined by applying a specific measurement method for adenine. Hepatitis B virus genomic DNA (HBV-DNA) C region gene sequence (Ge
nBank accession number: X0
1587), as shown in Table 3 of Example 6, five types of hepatitis B virus-specific sequences were selected. In order to efficiently incorporate adenine into the amplification product obtained by PCR, a primer in which thymine was linked to the 5'side by 10 mer was added to the DNA synthesizer (App
DNA / RNA manufactured by Lied Biosystems
Synthesizer 394).
Using 100 ng of pBR-HBV prepared in Example 6 as a sample, 100 μl of Taq reaction solution (10 mM Tris-
HCl, pH 8.3, 1.5 mM MgCl ₂ , 50 m
M KCl, 200 μM each dNTP, 0.2 μg each primer) 2.5 units of Amplitaq ^™
DNA polymerase (Perkin-El
mer Cetus) was added and a drop of mineral oil was added dropwise, 94 ° C for 1 minute, 55 ° C for 1 minute, 72 ° C for 1 minute.
35 minute cycles, DNA thermal cycler (P
erkin-Elmer Cetus) was used for amplification. 5 μl of each reaction product was added to 4% Nusieve ^™ -GTG containing 0.5 μg / ml ethidium bromide.
Electrophoresis was performed on an agarose gel (manufactured by FMC Bioproducts) to confirm the band of the amplification product.
As a result, an amplification product of the desired length was obtained with each of the four types of primer combinations (FIG. 15). Figure 15
Shows the results of electrophoresis for detecting PCR products with various primers.

Next, 80 μl of this reaction product was added to 5M N
25 μl of aCl and 84 μl of i-PrOH were added, and the mixture was allowed to stand on ice for 10 minutes to precipitate an amplification product. The amplification products were collected by centrifugation (15000 rpm, 10 minutes) and collected.
Dissolve with μl of distilled water and add 95 μl of i-PrOH
Was added to make a sample solution. 100μ each of the obtained sample solution
1 in a glass vial, 0.3 M PG and 1.
50 μl of 2M hydrochloric acid i-PrOH solution was added,
The container was sealed and heated at 100 ° C. for 1.5 hours. After cooling the obtained reaction liquid, chemiluminescence was measured by the following procedure using this reaction liquid. Reaction liquid 2 in the measuring glass tube
Take 0 μl of 50 mM hydrogen peroxide and 5 mM 2-
400 μl of DMF solution containing ME was added and mixed. Place the glass tube in a chemiluminescence analyzer (LB952T / 16
(Manufactured by Berthold Co., Ltd.), 300 μl of a 0.25 M sodium hydroxide aqueous solution was added to start luminescence, and luminescence intensity was measured for 2 seconds immediately after the addition. The emission intensity was proportional to the length of the obtained amplification product (Fig. 1
6).

9-2 Preparation of standard curve of PCR amplification product PCR was carried out using primers B1 and B5R (amplification length 850 bp) with pBR-HBV 0, 10 pg, 1 ng and 100 ng as samples under the same conditions as in Example 9-1. Then, 5 μl of each reaction product was electrophoresed on a 4% Nusieve ^™ -GTG agarose gel (manufactured by FMC Bioproducts) containing 0.5 μg / ml ethidium bromide to confirm the band of the amplification product (FIG. 17). . Figure 1
7 shows the result of electrophoresis for detecting the amplification product by the PCR method. The amplification product became thicker in proportion to the concentration of pBR-HBV in the sample. To 80 μl of this reaction product, 25 μl of 5M NaCl and 84 μl of i-PrOH were added, and the mixture was allowed to stand on ice for 10 minutes to precipitate an amplification product.
The amplification products were collected by centrifugation (15000 rpm, 10 minutes), dissolved in 5 μl of distilled water, and further 95 μl of i-
PrOH was added to prepare a sample solution. The obtained sample solution is
Reacted with PG according to the protocol of Example 9-1,
The emission intensity of chemiluminescence was measured. As a result, D in the sample
The amount of NA can be sufficiently measured at 10 pg, and the emission intensity after amplification increased as the amount of DNA increased (Fig. 1).
8).

[0041]

INDUSTRIAL APPLICABILITY By the measuring method of the present invention, a substance containing an adenyl group can be qualitatively or quantitatively added to S / S easily and specifically.
It has become possible to perform highly sensitive measurements with a high N ratio.

[0042]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA sequence (5'-3 ') AAATTGAAGAGTTTTGATCAT

SEQ ID NO: 2 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA sequence (5'-3 ') TGGATGTCAAGACCAGGTAA

SEQ ID NO: 3 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Synthetic DNA Sequence CTCTGCCTAATCATCTCATG

SEQ ID NO: 4 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA sequence CAAATTCTTTATACGGGGTCA

SEQ ID NO: 5 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single-strand Topology: Linear Sequence type: Synthetic DNA Sequence TCTAAGGCCTCCCGATATAG

SEQ ID NO: 6 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA Sequence AAGTAAGACAGGAAATGTGA

SEQ ID NO: 7 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA sequence TAGGATAGAACCTAGCAGGC

[Brief description of drawings]

FIG. 1 is a graph showing the luminescence amount of an adenine luminescent material using various reactive substances in a luminescent solvent containing hydrogen peroxide and 2-ME.

FIG. 2 is a graph showing the luminescence amount of an adenine luminescent material using various reactive substances in a luminescent solvent containing neither hydrogen peroxide nor 2-ME.

FIG. 3 is a graph showing a calibration curve for adenine.

FIG. 4 is a graph showing the reactivity of various nucleic acid bases and nucleic acids.

FIG. 5 is a graph showing the effect of 2-ME in a luminescent solvent.

FIG. 6 is a graph showing the relationship between the DNA concentration and the amount of luminescence of the amplification product prepared by the PCR method.

FIG. 7 is a drawing-substituting photograph showing electrophoresis of an amplification product prepared by the PCR method.

FIG. 8 is a graph showing the relationship between the DNA concentration and the amount of luminescence of an amplification product prepared by the PCR method when a methylglyoxal compound was used.

FIG. 9 is a graph showing the relationship between the DNA concentration and the amount of luminescence of an amplification product prepared by the PCR method in the case of using an ethylglyoxal compound.

FIG. 10: DNA of an amplification product prepared by the PCR method when a butylglyoxal compound is used
It is a graph which shows the relationship between density and the amount of light emission.

FIG. 11 is a graph showing the relationship between the concentration of an amplification product prepared by the PCR method and the amount of luminescence in the case of using dUTP-biotin.

FIG. 12 is a drawing-substitute photograph showing a result of electrophoresis.

FIG. 13 is a graph showing the relationship between the concentration of an amplification product prepared by the PCR method and the amount of luminescence in the case of using a centrifugal tube with a DNA recovery filter.

FIG. 14 is a graph showing the luminescence activity of various glyoxal compounds.

FIG. 15 is a drawing-substituting photograph showing a result of electrophoresis.

FIG. 16 is a graph showing the relationship between the chain length of the product by the PCR method and the amount of chemiluminescence.

FIG. 17 is a drawing-substituting photograph showing a result of electrophoresis.

FIG. 18 is a graph showing the relationship between the amount of DNA in a sample and the luminescence intensity of an amplification product by the PCR method.

Claims (9)

[Claims] 1. A chemiluminescent substance is induced by reacting a reactive substance of the following formula 1 with an adenyl group in the substance to be measured, and the substance to be measured is obtained by using the luminescent activity obtained from the chemiluminescent substance as an index. A method for measuring an adenyl group-containing substance, which comprises qualitatively or quantitatively measuring. R ¹ —CO—R ² ... Formula 1 wherein R ¹ is a hydrogen atom; an alkyl group, an alkenyl group or an alkynyl group containing 1 to 12 carbon atoms, wherein R ¹ is a carboxyl group; Hydroxyl group; amino group; amide group; sulfonamide group; sulfide group; sulfoxide group; sulfone group; nitro group; halide atom;
Mercapto group; carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; aryloxy group and heterocyclic group It may be substituted or condensed with at least one group selected from the group consisting of, and the group itself which substitutes or condensed with R ¹ is a carboxyl group; a hydroxyl group;
Amino group; amide group; sulfonamide group; sulfide group, sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azido group;
Alkylamino groups, alkyl groups, alkenyl groups, alkynyl groups or alkoxy groups containing 12 carbon atoms;
It may be substituted or condensed with at least one group selected from the group consisting of a polyalkoxy group; an aryl group; an aryloxy group and a heterocyclic group. R ² is an aldehyde group or a group represented by —CH (XR ³ ) (X ′ R ⁴ ), and X and X ′ are an oxygen atom, a sulfoxide group, a sulfone group, a sulfur atom, a selenoxide group, selenium. Any of the groups selected from the atoms, which may be the same or different from each other. R ³ and R ⁴ are a hydrogen atom; an alkyl group, an alkenyl group or an alkynyl group containing 1 to 12 carbon atoms; or an aryl group containing 1 to 16 carbon atoms, wherein R ³ and R ^{4 are} Is a carboxyl group; a hydroxyl group; an amino group; an amide group;
Sulfonamide group; sulfide group; sulfoxide group;
Sulfone group; Nitro group; Halide atom; Mercapto group;
Carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; aryloxy group and heterocyclic group It may be substituted or condensed with at least one selected group, and the group itself which substitutes or condensed with R ³ and R ⁴ is a carboxyl group; a hydroxyl group; an amino group; an amide group; a sulfonamide Group; sulfide group, sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azido group; 1-12
At least one group selected from the group consisting of alkylamino groups, alkyl groups, alkenyl groups, alkynyl groups or alkoxy groups containing 4 carbon atoms; polyalkoxy groups; aryl groups; aryloxy groups and heterocyclic groups. R ³ and R may be substituted or condensed.
⁴ may be the same or different from each other. Also, the R
Part of ³ and R ⁴ may be bonded to each other to form a ring. 2. The method for measuring an adenyl group-containing substance according to claim 1, wherein the substance to be measured is adenine, adenosine, an adenosine phosphate compound, DNA or RNA. 3. The method for measuring an adenyl group-containing substance according to claim 1, wherein in the formula of the reactive substance, R ¹ is ^one of the groups selected from the following group. An alkyl group containing 1 to 12 carbon atoms, wherein the alkyl group is a carboxyl group; a hydroxyl group; an amino group; an amide group; a sulfonamide group; a sulfide group; a sulfoxide group; a sulfone group; a nitro group; a halide atom. Mercapto group; carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; aryloxy group and heterocyclic group It may be substituted or condensed with at least one group selected from the group consisting of, and the group itself which substitutes or condensed with R ¹ is a carboxyl group; a hydroxyl group; an amino group; an amide group; Amide group; sulfide group, sulfoxide group; sulfone group; nitro group; halide atom; mercapto Carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; aryloxy group and heterocyclic group It may be substituted or condensed with at least one group selected from 4. The method for measuring an adenyl group-containing substance according to claim 1, wherein in the formula of the reactive substance, R ¹ is ^one of the groups selected from the following group. A methyl group, which is a carboxyl group; a hydroxyl group; an amino group;
Amide group; sulfonamide group; sulfide group; sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, Alkynyl group or alkoxy group; polyalkoxy group; aryl group; may be substituted or condensed with at least one group selected from the group consisting of aryloxy group and heterocyclic group, or substituted R ¹ Alternatively, the condensed ring itself is a carboxyl group; a hydroxyl group; an amino group; an amide group; a sulfonamide group; a sulfide group, a sulfoxide group; a sulfone group; a nitro group; a halide atom; a mercapto group; a carbonyl group; an azide group; 12
At least one group selected from the group consisting of alkylamino groups, alkyl groups, alkenyl groups, alkynyl groups or alkoxy groups containing 4 carbon atoms; polyalkoxy groups; aryl groups; aryloxy groups and heterocyclic groups. It may be substituted or condensed. 5. The reactive substance is methylglyoxal, methylglyoxal dimethyl acetal, ethyl glyoxal, ethylglyoxal dimethyl acetal, n-butyl glyoxal, n-butyl glyoxal dimethyl acetal, n-octyl glyoxal, n-octyl glyoxal dimethyl acetal. The method for measuring an adenyl group-containing substance according to any one of claims 1 to 4. 6. A luminescent activity is measured by adding a reaction initiator to the chemiluminescent substance in the presence of a luminescent solvent such as dimethylformamide, isopropanol, acetonitrile, dioxane or dimethylsulfoxide without adding an oxidizing agent. Item 3. A method for measuring an adenyl group-containing substance according to Item 1. 7. A DNA probe method for detecting a target nucleic acid in a sample using a capture probe that complementarily binds to the target nucleic acid, wherein the adenyl group of the target nucleic acid and / or its amplification product is represented by the following formula 2. A chemiluminescent substance is induced by reacting a reactive substance, and the target nucleic acid is qualitatively or quantitatively measured using the luminescent activity obtained from the chemiluminescent substance as an index. Measuring method. R ⁵ —CO—R ⁶ Formula 2 In the formula, R ⁵ is a hydrogen atom; an alkyl group, an alkenyl group or an alkynyl group containing 1 to 12 carbon atoms;
An aryl group containing 8 carbon atoms or a heterocyclic group having aromaticity, wherein R ⁵ is a carboxyl group; a hydroxyl group; an amino group; an amide group; a sulfonamide group; a sulfide group; a sulfoxide group; Sulfone group; Nitro group; Halide atom;
Mercapto group; carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; aryloxy group and heterocyclic group It may be substituted or condensed with at least one kind of group selected from the group consisting of, and the group itself which substitutes or condensed with R ⁵ is a carboxyl group; a hydroxyl group;
Amino group; amide group; sulfonamide group; sulfide group, sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azido group;
Alkylamino groups, alkyl groups, alkenyl groups, alkynyl groups or alkoxy groups containing 12 carbon atoms;
It may be substituted or condensed with at least one group selected from the group consisting of a polyalkoxy group; an aryl group; an aryloxy group and a heterocyclic group. R ⁶ is an aldehyde group or a group represented by —CH (XR ⁷ ) (X ′ R ⁸ ), and X and X ′ are an oxygen atom, a sulfoxide group, a sulfone group, a sulfur atom, a selenoxide group, selenium. Any of the groups selected from the atoms, which may be the same or different from each other. R ⁷ and R ⁸ are a hydrogen atom; an alkyl group, an alkenyl group or an alkynyl group containing 1 to 12 carbon atoms; or an aryl group containing 1 to 16 carbon atoms, wherein R ⁷ and R ^{8 are} Is a carboxyl group; a hydroxyl group; an amino group; an amide group;
Sulfonamide group; sulfide group; sulfoxide group;
Sulfone group; Nitro group; Halide atom; Mercapto group;
Carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; aryloxy group and heterocyclic group It may be substituted or condensed with at least one selected group, and the group itself which substitutes or condensed with R ⁷ and R ⁸ is a carboxyl group; a hydroxyl group; an amino group; an amide group; a sulfonamide Group; sulfide group, sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azido group; 1-12
At least one group selected from the group consisting of alkylamino groups, alkyl groups, alkenyl groups, alkynyl groups or alkoxy groups containing 4 carbon atoms; polyalkoxy groups; aryl groups; aryloxy groups and heterocyclic groups. R ⁷ and R may be substituted or condensed.
⁸ may be the same as or different from each other. Also, the R
Part of ⁷ and R ⁸ may be bonded to each other to form a ring. 8. A method for measuring a target nucleic acid in which a target nucleic acid in a sample is amplified and detected by a nucleic acid amplification method using a polymerase, wherein the reactive substance is reacted with an adenyl group of the target nucleic acid and / or its amplification product. A method for measuring an adenyl group-containing substance, which comprises qualitatively or quantitatively measuring the target nucleic acid using the luminescent activity obtained from the chemiluminescent substance as an index. R ⁵ —CO—R ⁶ Formula 2 In the formula, R ⁵ is a hydrogen atom; an alkyl group, an alkenyl group or an alkynyl group containing 1 to 12 carbon atoms;
An aryl group containing 8 carbon atoms or a heterocyclic group having aromaticity, wherein R ⁵ is a carboxyl group; a hydroxyl group; an amino group; an amide group; a sulfonamide group; a sulfide group; a sulfoxide group; Sulfone group; Nitro group; Halide atom;
Mercapto group; carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; aryloxy group and heterocyclic group It may be substituted or condensed with at least one kind of group selected from the group consisting of, and the group itself which substitutes or condensed with R ⁵ is a carboxyl group; a hydroxyl group;
Amino group; amide group; sulfonamide group; sulfide group, sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azido group;
Alkylamino groups, alkyl groups, alkenyl groups, alkynyl groups or alkoxy groups containing 12 carbon atoms;
It may be substituted or condensed with at least one group selected from the group consisting of a polyalkoxy group; an aryl group; an aryloxy group and a heterocyclic group. R ⁶ is an aldehyde group or a group represented by —CH (XR ⁷ ) (X ′ R ⁸ ), and X and X ′ are an oxygen atom, a sulfoxide group, a sulfone group, a sulfur atom, a selenoxide group, selenium. Any of the groups selected from the atoms, which may be the same or different from each other. R ⁷ and R ⁸ are a hydrogen atom; an alkyl group, an alkenyl group or an alkynyl group containing 1 to 12 carbon atoms; or an aryl group containing 1 to 16 carbon atoms, wherein R ⁷ and R ^{8 are} Is a carboxyl group; a hydroxyl group; an amino group; an amide group;
Sulfonamide group; sulfide group; sulfoxide group;
Sulfone group; Nitro group; Halide atom; Mercapto group;
Carbonyl group; azido group; alkylamino group containing 1 to 12 carbon atoms, alkyl group, alkenyl group, alkynyl group or alkoxy group; polyalkoxy group; aryl group; aryloxy group and heterocyclic group It may be substituted or condensed with at least one selected group, and the group itself which substitutes or condensed with R ⁷ and R ⁸ is a carboxyl group; a hydroxyl group; an amino group; an amide group; a sulfonamide Group; sulfide group, sulfoxide group; sulfone group; nitro group; halide atom; mercapto group; carbonyl group; azido group; 1-12
At least one group selected from the group consisting of alkylamino groups, alkyl groups, alkenyl groups, alkynyl groups or alkoxy groups containing 4 carbon atoms; polyalkoxy groups; aryl groups; aryloxy groups and heterocyclic groups. R ⁷ and R may be substituted or condensed.
⁸ may be the same as or different from each other. Also, the R
Part of ⁷ and R ⁸ may be bonded to each other to form a ring. 9. An immunological assay method for detecting an analyte by using an immune reaction of a test substance in a sample, wherein a polymerase using an antibody labeled with a substance having an adenyl group and / or a nucleic acid of an antibody labeled with a nucleic acid as a target nucleic acid. Nucleic Acid Amplification Using Polymerase as Target Nucleic Acid of Antigen Labeled with Adenyl Group of Amplification Product Obtained by Amplification by Nucleic Acid Amplification Method Using The chemiluminescent substance is induced by reacting the reactive substance of the formula 2 according to claim 7 with the adenyl group of the amplification product obtained by amplification by the method, and the luminescent activity obtained from the chemiluminescent substance A method for measuring an adenyl group-containing substance, which comprises qualitatively or quantitatively measuring the target nucleic acid by using as an index and measuring the test substance.