AU2021107694A4 - A method of detecting small rna - Google Patents

Abstract

The present invention relates to a method of analyzing and detecting small RNA. In particular, the present invention can also analyze even RNA having a short base sequence, and quantitatively detect the RNA with high sensitivity and accuracy, and thus can be widely used for diagnosis of various diseases such as infectious diseases and cancer. 1/5 Figures Fig. 1 Small RNA sensing Small RNA 43' 5' 5' 3' Polymerization 3' 5 51-P Nuclease treatment 5' 3' Amplification 3' 5' 5- 1P5'-P 5'-P Ligation of amplicon d-g d-,9 d-,9 5'-P 5'-P 51-P Ligation of Nanopore adapter Nanopore Sequencing Fig. 2 Amplification of Nanopore module 5' 3' Nanopore Sensor5 @Amine modificatioin Barcode Small RNA sensing site

Description

1/5

Figures

Fig. 1

Small RNA sensing

43' Small RNA

5' 5' 3' Polymerization

3' 5

Nuclease treatment 51-P 5' 3' Amplification 3' 5'

5- 1P5'-P 5'-P Ligation of amplicon d-g d-,9 d-,9 5'-P 5'-P 51-P

Ligation of Nanopore adapter

Nanopore Sequencing

Fig. 2 Amplification of Nanopore module 3' Nanopore Sensor55' @Amine modificatioin Barcode Small RNA sensing site

A METHOD OF DETECTING SMALL RNA CROSS-REFERENCE TO RELATED APPLICATION

This application claims priority to and the benefit of Korean Patent

Application No. 2020-0055429, filed on May. 8, 2020 the disclosure of which is

incorporated herein by reference in its entirety.

TECHNICAL FIELD

The present invention relates to a method of analyzing and detecting small

RNA. In particular, the present invention can analyze even RNA having a short

base sequence, and quantitatively detect the RNA with high sensitivity and accuracy,

and thus can be widely used for diagnosis of various diseases such as infectious

diseases and cancer.

BACKGROUND ART

As the quality of life is improved, interest in early diagnosis of diseases has

increased and because molecular diagnostic technology directly detects genetic

information of a pathogen which causes a disease, the molecular diagnostic

technology has been attracting much attention as a technology capable of solving the

disadvantages of an immunological diagnostic technology which detects the indirect

factors of a disease based on the existing antibody/antigen reaction.

Further, recently, as the coronavirus infection-19 (COVID-19) has been

greatly spreading, the outbreak has caused many deaths worldwide, and the World

Health Organization (WHO) even declared the outbreak a pandemic. In the case of

diseases caused by such an RNA virus, a high mutation incidence causes more

damage, and early diagnosis of whether a patient has been infected is further required.

Meanwhile, small RNA such as miRNA is protein-non-coding RNA which is present in vivo, and may act on the post-transcriptional process of a specific gene to regulate the expression of the corresponding gene. In particular, small RNA is recognized as an important genetic element which regulates biological functions such as cell cycle, differentiation, development, metabolism, carcinogenesis, and aging to mediate the homeostasis of an organism, and in particular, the formation of an abnormal network thereof may exhibit a fatal defect in terms of cell physiology.

Further, an expression pattern of small RNA such as miRNA in blood shows

a strong advantage in early and predictive detection of cancer because the small RNA

sensitively reacts in the early stage of cancer. In addition, since various cancers can

be tested with simple blood sampling, the burden imposed on the body of a patient

can be reduced. Furthermore, in the diagnosis of various intractable diseases such

as Alzheimer's disease and Parkinson's disease in addition to the aforementioned

infections and cancers, there is an increasing need for developing a technology

capable of diagnosing the diseases early by rapidly detecting small RNA with high

sensitivity.

DESCRIPTION OF EMBODIMENTS TECHNICAL PROBLEM

The technical problem to be solved by the present invention is to provide a

method of detecting small RNA.

Also, the technical problem to be solved by the present invention is to

provide a sensor DNA for detecting small RNA.

TECHNICAL SOLUTION

According to an aspect of the present invention relates to a method of

detecting small RNA, the method including: a) hybridizing sensor DNA including a complementary sequence of target small RNA to be detected with the target small

RNA; b) performing polymerization with a polymerase using a module region of the

sensor DNA as a template and the target small RNA as a primer; c) amplifying and

producing an amplicon using the module region of the sensor DNA and a primer

corresponding to a strand polymerized in step b); and d) analyzing a sequence of the

amplicon.

In one embodiment, the sensor DNA may have a modified amine region at

the 3' end. Such modification may prevent polymerization of the sensor DNA from

occurring in the process of polymerization by the polymerase in step b).

Accordingly, a modified form can be applied as long as it can prevent the

polymerization of the sensor DNA, and the form is not limited.

In one embodiment, the primer in step c) may have a phosphate bound to the

5' end. The primer in step c) is used to produce an amplicon through an

amplification reaction, and a base sequence of the primer can be applied without

limitation as long as the base sequence can be bound to a strand to be amplified

through the phosphate bound to the 5' end.

That is, the base sequence may be changed depending on the target small

RNA to be detected or the module region of the sensor DNA.

In one embodiment, when a plurality of amplicons are produced in step c),

the method may further include: d) ligating the produced amplicons.

Through the ligation, the base sequence of the small RNA may be analyzed

even with the Oxford Nanopore sequencing system (Oxford Nano) in the related art,

which cannot analyze short base sequences.

In one embodiment, after the ligation of the amplicons, the method may

further include: attaching adenine (A) to the 3' end by adding a dATP and a DNA polymerase thereto, and as the DNA polymerase, a Taq polymerase may be used, but the present invention is not limited thereto.

In one embodiment, step d) may additionally include: after ligation of

amplicons, binding an adaptor for sequencing to both ends of the ligated amplicons.

The adaptor is capable of being recognized by a sequencing device, and may be

bound by changing the adaptor depending on a sequencing device to be applied, such

as an Oxford Nanopore sequencing device and a next generation sequencing (NGS)

device.

In one embodiment, the method may further include: analyzing a sequence

of the ligated amplicons after step d). In step e), the sequencing may be Nanopore

sequencing.

The nanopore sequencing may mean typical 'nanopore sequencing'. The

'nanopore sequencing' refers to a technique for discriminating various bases by

measuring the difference in electrical conductivity while passing a strand of DNA

through a biological pore. Since the nanopore sequencing analyzes a base sequence

while passing the sequence through pores, the nanopore sequencing has a

disadvantage in that a short base sequence cannot be analyzed, and thus cannot be

applied to the detection and analysis of small RNA.

The present invention enables small RNA to be detected and analyzed by

ligating amplicons to provide a level of length which can be analyzed even through

the nanopore sequencing. Furthermore, the present invention may be applied

without limitation to a sequencing technique.

In one embodiment, the sensor DNA may include a unique barcode region.

The barcode region is unique according to the type of target small RNA, and may

correspond to the presence and number of target small RNAs by confirming the presence of the barcode region and the number of barcodes to be detected.

In one embodiment, the amplicon may be amplified by including a barcode

region of the sensor DNA. When a unique barcode region different from the type of

target small RNA is present in the sensor DNA, each amplicon produced during the

process in which the amplicon is amplified and produced may be an amplicon in

which a unique barcode region included in all sensor DNAs is included.

In one embodiment, the 'detection' may be capable of quantitatively

detecting up to the number of target small RNAs by measuring the number of

amplicons.

In one embodiment, the number of amplicons may be confirmed by

measuring the number of barcodes included in the amplicons.

In an exemplary embodiment of the present invention, it was confirmed that

a quantitative number of target small RNAs could be detected with high accuracy

and sensitivity even when multiple sensors for multiple target small RNAs are mixed

(FIG. 6), and furthermore, it was confirmed that a quantitative number of target small

RNAs could be detected with high accuracy and sensitivity by introducing sensor

DNA for target small RNA to be confirmed even in an RNA sample extracted from

blood (FIG. 7).

In particular, the method of detecting small RNA of the present invention

and the configuration of the sensor DNA used for detection have very low detection

limits at the femtomolar (fmol) and attomolar (amol) levels, and thus show that both

sensitivity and accuracy are remarkably excellent compared to those of the small

RNA detection technique in the related art.

Another aspect of the present invention relates to sensor DNA for detecting

small RNA in which a) a small RNA sensing region including a complementary sequence of target small RNA; b) a module region which is a template such that polymerization can be performed using the sensed target small RNA as a primer; and c) an amine region at the 3' end; are modified.

In one embodiment, the module region may include a unique barcode region.

The 'barcode region' is as described above.

In one embodiment, the sensor may be a nanopore sensor. The 'nanopore

sensor' is a nanopore-based sensor, and means that nanopore sequencing may be

applied.

ADVANTAGEOUS EFFECTS OF INVENTION

The method of detecting small RNA of the present invention and the

configuration of the sensor DNA used for detection have very low detection limits at

the femtomol (fmol) and atomol (amol) levels, and both sensitivity and accuracy are

remarkably excellent compared to those of the small RNA detection technique in the

related art.

Accordingly, the present invention can be effectively utilized even for

diagnosis at the very early stage and latent stage of a disease by enabling molecular

diagnosis at a fine level to overcome the detection limits of existing technology, such

as diagnosis of whether a disease occurs in an individual such as a human, what stage

has the disease progressed to, and whether the individual is infected with a virus at

the latent stage.

The effect of the present invention is not limited to the aforementioned

effects, and it should be understood to include all possible effects deduced from the

configuration of the invention described in the detailed description or the claims of

the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 illustrates a schematic view of a method of detecting small RNA

according to an exemplary embodiment of the present invention. After sensor DNA

senses and binds to target small RNA, sequencing for detecting the small RNA is

performed.

FIG. 2 illustrates a structural view of sensor DNA according to an exemplary

embodiment of the present invention.

FIG. 3 illustrates the results of confirming that miR210, which is an

exemplary detection target, is accurately detected using the sensor of the present

invention.

FIG. 4 illustrates the results of confirming the sensitivity of a small RNA

detection technique using the sensor DNA of the present invention in a blood sample;

FIG. 5 illustrates the results of confirming the quantitative detection ability

when multiple sensors are mixed for one type of target small RNA.

FIG. 6 illustrates the results of confirming the quantitative detection ability

when multiple sensors are mixed for multiple small RNAs.

FIG. 7 illustrates the results of confirming the quantitative detection ability

of the target small RNA in an RNA sample extracted from blood.

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS

Hereinafter, the present invention will be described in detail through the

Examples. However, the following Examples are only for exemplifying the present

invention, and the present invention is not limited by the following Examples.

Example 1. Polymerization, amplification and sequencing using sensor

DNA

After small RNA as a target and sensor DNA were added, a polymerization

reaction was performed at 95°C for 30 seconds and 63°C for 10 minutes using a

DNA polymerase (XenoT-POL). Thereafter, the sensor and the RNA were digested

using an endonuclease. The sensor DNA includes a sensing region including a

sequence complementary to the target small RNA, and the sensing region senses the

target small RNA and hybridizes with the target small RNA, and is named 'sensor

DNA' in the present invention. The sensor DNA may include a barcode region, and

the number of target small RNAs may be quantitatively measured by counting only

the barcode region.

Thereafter, amplicon(s) was(were) produced by PCR using a primer having a

phosphate bound to the 5' end for amplification of the module region of the sensor

DNA and the polymerized strand. The PCR may be performed in the same manner

as in typical PCR, and the temperature conditions, cycle number, and the like of the

PCR may be appropriately modified and applied depending on the polymerized

strand and a sequence of a primer bound to the polymerized strand.

Thereafter, after the produced amplicons were ligated using a DNA ligase,

the ligated amplicons were subjected to sequencing.

The sensor DNA is a nanopore-based sensor, and sequencing (nanopore

sequencing) using a nanopore may be applied to the sequencing. Specifically, after

a nanopore adaptor is bound to the ligated amplicons, nanopore sequencing may be

performed, and the nanopore sequencing may be performed according to a manual of

a known product using the known product. For example, after a sample is loaded

onto a Minion chip which is a nanopore sequencing device, the sequencing may be

performed.

The accuracy and sensitivity of the detection method of the present invention

was confirmed by the following experimental examples, and experiments were

exemplarily performed using miRNA21, miRNA210, and miRNA486 as targets. A

sequence of the target miRNA is as summarized in the following Table 1.

5 [Table 1]

SEQ ID NO Type of target Sequence of target miRNA miRNA 1 hsa-miR-21-5p UAGCUUAUCAGACUGAUGUUGA 2 hsa-miR-210-3p CUGUGCGUGUGACAGCGGCUGA 3 |hsa-miR-486-5p |UCCUGUACUGAGCUGCCCCGAG A sequence of a sensing region of sensor DNA for detecting the exemplary

target miRNA is as summarized in the following Table 2. The sequence of the

present sensing region may be modified if necessary, and is not limited to the present

example.

10 [Table 2]

SEQ ID NO Type of target Sequence (5'-3') of sensing region of sensor miRNA DNA 4 hsa-miR-21-5p TCAACATCAGTCTGATAAGCTA 5 has-miR-210-3p TCAGCCGCTGTCACACGCACAG 6 hsa-miR-486-5p CTCGGGGCAGCTCAGTACAGGA A sequence of a module region of sensor DNA for detecting the exemplary

target miRNA is as summarized in the following Table 3. A sequence of a barcode

region included in the module region is underlined. The sequence of the present

module region may be modified if necessary, and is not limited to the present

15 example.

[Table 3]

SEQ Type of Sequence (5'-3') of module region of sensor DNA ID target NO miRNA hsa- AACAATACCACGACCACCGACAACTACACGCTACAGTCG 7 miR- CATACGAGATCGTGATGTGACTGGAGTTGCTTGGCTCTGG TGTATTGGT 2 1 -5 p hsa- AACAATACCACGACCACCGACAACTACACGCTACAGTCGCATACGAGAT 8 miR- ACATCGGTGACT GGAGTTGCTTGGCTCTGG TGTATTGGT 2 1 0- 3 p hsa- AACAATACCACGACCACCGACAACTACACGCTACAGTCGCATACGAGAT 9 miR- TTAGGCGTGACT GGAGTTGCTTGGCTCTGG TGTATTGGT 486-5p A sequence of a barcode region of sensor DNA for detecting the exemplary target miRNA is as summarized in the following Table 4. The sequence of the present barcode region may be modified if necessary, and is not limited to the present example.

5 [Table 4]

SEQ ID NO Type of target miRNA Sequence (5'-3') of barcode region of sensor DNA 10 hsa-miR-21-5p CGTGAT 11 hsa-miR-210-3p ACATCG 12 hsa-miR-486-5p TTAGGC As the module region includes the barcode region and is connected to the

sensing region as described above, the module region can be classified by the sensing

region and/or the barcode region.

In addition, exemplarily, a sequence of a primer having a phosphate bound to

10 the 5' end used for amplification of a module region of sensor DNA and a

polymerized strand is as follows. The present primer is only characterized as

having a phosphate bound to the 5' end, and a sequence of the primer may be

modified if necessary, and is not limited to the present example.

[Table 5]

SEQID Type of primer Sequence (5'-3') of primer NO 13 Forward primer [phosphate]AACAATACCACGACCACCGACAAC 14 Reverse primer [phosphate]ACCAATACACCAGAGCCAAGCAAC 15 Experimental Example 1. Confirmation of accuracy of small RNA detection technique using sensor DNA of present invention (when sensor DNA is mixed)

After 20 fmol of miR210 as target small RNA and 20 fmol of each of Sensor

21 (sensor DNA including an miRNA21 sensing region) and Sensor 210 (sensor

DNA including an miR210 sensing region) were mixed, it was confirmed whether

target miRNA was accurately detected even in a state in which various types of

sensor DNAs were mixed using the method in Example 1.

First, after Sensor 21 and Sensor 210 each at a concentration of 20 fmol were

suitably mixed under experimental conditions, 2 1 of a reaction buffer (200 mM

Tris-HCl, 100 mM (NH4 )2 SO 4 , 100 mM KCl, 20 mM MgSO4, 1% Triton X-100, and

(pH 8.8 at 25C)), 1 1 of 10 mM dNTP, and 2 units of XenoT-POL were added

thereto, and then the resulting mixture was heated at 95°C for 30 seconds, and then

incubated at 63°C for 10 minutes. A reaction sample was cleaned up using the

MEGAquick-spin TM Plus Total Fragment DNA Purification Kit, and eluted with 60

1 of distilled water. 20 1 of the sample was mixed with a nuclease mixture (40

mM sodium acetate, pH 4.5 at 25°C), 300 mM NaCl, 2 mM ZnSO4 and 200 units of

an S Inuclease)), and the resulting mixture was incubated at 37°C for 11 minutes.

Thereafter, the mixture was cleaned up using the MEGAquick-spinTMPlus Total

Fragment DNA Purification Kit, and eluted with 60 1 of distilled water. PCR was

performed under conditions of one cycle of 98°C for 2 minutes and 30 cycles of

98°C for 10 seconds and 64.5°C for 10 seconds using primers having a phosphate

bound to the 5' end. After a PCR product was electrophoresed on a 15%

polyacrylamide gel (19:1), the results were confirmed using Gel Doc.

As a result, as illustrated in FIG. 3, it was confirmed that even when sensor

DNA which does not correspond to target small RNA was mixed, miRNA210, which

is the target small RNA, could be accurately sensed and detected by Sensor 210, and

it was confirmed that a non-specific reaction with Sensor 21 did not appear.

These results show that a small RNA detection technique using the sensor

DNA of the present invention can maintain accuracy even when various types of

sensors are mixed.

Experimental Example 2. Confirmation of sensitivity of small RNA

detection technique using sensor DNA of present invention in blood sample

RNA was purified and extracted from a human blood sample using an

miRNeasy serum/plasma kit (Qiagen). It was confirmed whether target miRNA

was accurately detected using the method of Example 1.

Specifically, after 800 ng of RNA purified from blood was mixed with 200

amol of each of Sensor 21, Sensor 210 and Sensor 486 (sensor DNA including an

miRNA486 sensing region), 2 1 of a reaction buffer (200 mM Tris-HCl, 100 mM

(NH4)2SO4, 100 mM KCl, 20 mM MgSO4, 1% Triton X-100, (pH 8.8 at 25C)), 1

of 10 mM dNTP, and 2 units of XenoT-POL were added thereto, and then the

resulting mixture was heated at 95°C for 30 seconds, and then incubated at 63°C for

10 minutes. A reaction sample was cleaned up using the MEGAquick-spinTMPlus

Total Fragment DNA Purification Kit, and eluted with 60 1 of distilled water. 20 [

of the sample was added to a nuclease mixture (40 mM sodium acetate, pH 4.5 at

25 °C, 300 mM NaCl, 2 mM ZnSO4 and 200 units of an Sl nuclease), and the

resulting mixture was incubated at 37°C for 11 minutes. Thereafter, the mixture

was cleaned up using the MEGAquick-spin TMPlus Total Fragment DNA Purification

Kit, and eluted with 60 1 of distilled water. PCR was performed under conditions

of one cycle of 98°C for 2 minutes and 30 cycles of 98°C for 10 seconds and 64.5°C

for 10 seconds using primers having a phosphate bound to the 5' end. After a PCR

product was electrophoresed on a 15% polyacrylamide gel (19:1), the results were

confirmed using Gel Doc.

As a result, as illustrated in FIG. 4, it was confirmed that small RNA could

be sensed when present even though the concentration of the sensor was remarkably

low as 200 amol, so that it was confirmed that the detection limit was very low and

high sensitivity could be exhibited.

Experimental Example 3. Confirmation of quantitative detection

activity of small RNA detection technique using sensor DNA of present

invention

3-1. Confirmation of quantitative detection ability when multiple sensors for

one type of target small RNA are mixed

After 20 fmol of miRNA21 as target small RNA and 20 fmol of each of

Sensor 21 and Sensor 210 were mixed, it was verified whether the detection of target

miRNA could be quantitatively confirmed even in a state where various types of

sensor DNAs were mixed using the method of Example 1. After 20 fmol each of

Sensor 21, Sensor 210 and miRNA21 were suitably mixed under experimental

conditions, 2 1 of a reaction buffer (200 mM Tris-HCl, 100 mM (NH4)2SO4, 100

mM KCl, 20 mM MgSO4, 1% Triton X-100, and (pH 8.8 at 25°C)), 1 1 of 10 mM

dNTP, and 2 units of XenoT-POL were added thereto, and then the resulting mixture

was heated at 95°C for 30 seconds, and then incubated at 63°C for 10 minutes. A

reaction sample was cleaned up using the MEGAquick-spinTMPlus Total Fragment

DNA Purification Kit, and eluted with 60 [ of distilled water. 20 [ of the sample

was added to a nuclease mixture (40 mM sodium acetate, pH 4.5 at 25 °C, 300 mM

NaCl, 2 mM ZnSO4 and 200 units of an SInuclease), and the resulting mixture was

incubated at 37°C for 11 minutes. Thereafter, the mixture was cleaned up using the

MEGAquick-spin TMPlus Total Fragment DNA Purification Kit, and eluted with 60 1d

of distilled water. PCR was performed under conditions of one cycle of 98°C for 2 minutes and 30 cycles of 98°C for 10 seconds and 64.5°C for 10 second using primers having a phosphate bound to the 5' end, and the amplicons were cleaned up.

Thereafter, after 500 units of a T3 DNA ligase was added to 500 ng of the amplicons

under conditions of 66 mM Tris-HCl, 10 mM MgCl 2 , 1 mM ATP, 1 mM DTT, and

7.5% polyethylene glycol (PEG 6000) (pH 7.6 at 25°C), the resulting mixture was

incubated at 25°C for 10 minutes. Thereafter, after the mixture was cleaned up, 50

pl of a mixture was produced by mixing 40 1 of the eluted DNA, 1 1 of 1 mM

dATP, 1 ul (5 units) of a taq DNA polymerase, 5 1 of a reaction buffer (200 mM

Tris-HC/pH 8.8), 500 mM KCl, 25 mM MgC2, 100 mM -Mercaptoethanol and

distilled water, and then incubated at 72°C for 20 minutes. A dATP tailed DNA

product was cleaned up using the MEGAquick-spinTM Plus Total Fragment DNA

Purification Kit. Thereafter, processes of adaptor ligation (SQK-LSK109) for

nanopore sequencing, clean-up using AMPure XP beads, priming the flow cell, and

loading the flow cell were performed according to a nanopore sequencing protocol.

Thereafter, a detection result was confirmed by counting barcode region sequences of

Sensor 21 and Sensor 210 in the obtained nanopore sequencing file.

As a result, as illustrated in FIG. 5, as a result of counting the barcode

regions of the sensor DNAs, 666,860 miRNA21s were measured, and it was

confirmed that 2,293 miRNA2Os appeared as the background.

The aforementioned results show that the technique of the present invention

can measure the number of target small RNAs with high sensitivity and accuracy

even at an extremely low concentration of femtomol (fmol) and quantitatively detect

the target small RNAs.

3-2. Confirmation of quantitative detection ability when multiple sensors for

multiple target small RNAs are mixed

miRNA21 and miRNA210, as target RNAs, were mixed at different

concentrations of 7 fmol and 20 fmol, respectively, and 20 fmol each of Sensor2l

and Sensor210 were mixed. Thereafter, it was verified whether the detection of the

target miRNA could be quantitatively confirmed even in a state in which various

types of sensor DNAs are mixed along with multiple target small RNAs using the

method of Example 1.

20 fmol each of Sensor 21 and Sensor 210 were mixed with 7 fmol of

miRNA21 and 20 fmol of miRNA210, and the process of the following nanopore

sequencing is the same as that described in 3-1. Thereafter, a detection result was

confirmed by counting barcode region sequences of Sensor 21 and Sensor 210 in the

obtained nanopore sequencing file.

As a result, as illustrated in FIG. 6, in the case of miRNA21 mixed at a

relatively low concentration of 7 fmol, 76,891 miRNA21s were measured, and in the

case of miRNA210 mixed at a concentration of 20 fmol, 179,261 miRNA210s were

measured.

The aforementioned results show that even when small RNAs are present at

different concentrations, the technique of the present invention enables quantitative

detection by reflecting the concentration or content included in the sample rather

than simply detecting only the presence or absence thereof.

3-3. Confirmation quantitative detection ability of target small RNA in RNA

sample extracted from blood

RNA was purified and extracted from a human blood sample using an

miRNeasy serum/plasma kit (Qiagen).

800 ng of the RNA purified from blood was mixed with 200 amol each of

Sensor 21, Sensor 210, and Sensor 486, and thereafter, it was verified whether the

detection of the target miRNA could be quantitatively confirmed using the method of

Example 1. The process of the following nanopore sequencing is the same as that

described in 3-1. Thereafter, a detection result was confirmed by counting barcode

region sequences of Sensor 21, Sensor 210 and Sensor 486 in the obtained nanopore

sequencing file.

As a result, as illustrated in FIG. 7, 5,279 miRNA21s, 682 miR210s, and

342,538 miRNA486s were measured depending on the concentration of each type of

miRNA present in the blood.

The aforementioned results show that the technique of the present invention

can rapidly diagnose the normal stage, the stage when a disease is developed, the

latent stage, the onset stage, and the like at a molecular level as the presence of the

small RNA which is an index for infections caused by viruses, bacteria, and the like,

cancers, and the like is measured at a quantitative level rather than a simple detection

thereof.

In particular, the method of detecting small RNA of the present invention

and the configuration of the sensor DNA used for detection have very low detection

limits at the femtomolar (fmol) and attomolar (amol) levels, and thus show that both

sensitivity and accuracy are remarkably excellent compared to those of the small

RNA detection technique in the related art.

As described above, the present invention can be applied even to diagnosis at

the very early stage and latent stage of a disease by enabling molecular diagnosis at a

fine level to overcome the detection limits of an existing technology, such as

diagnosis of whether a disease occurs in an individual such as human, what stage the disease progresses to, and whether the individual is infected with a virus at the latent stage.

The above-described description of the present invention is provided for

illustrative purposes, and those skilled in the art to which the present invention

pertains will understand that the present invention can be easily modified into other

specific forms without changing the technical spirit or essential features of the

present invention.

Therefore, it should be understood that the above-described embodiments are

only exemplary in all aspects and are not restrictive. For example, each constituent

element which is described as a singular form may be implemented in a distributed

form, and similarly, constituent elements which are described as being distributed

may be implemented in a combined form.

The scope of the present invention is represented by the claims to be

described below, and it should be interpreted that the meaning and scope of the

claims and all the changes or modified forms derived from the equivalent concepts

thereof fall within the scope of the present invention.

Claims (14)

WHAT IS CLAIMED IS:

1. A method of detecting small RNA, the method comprising: a) hybridizing

sensor DNA comprising a complementary sequence of target small RNA to be detected

with the target small RNA;

b) performing polymerization with a polymerase using a module region of the

sensor DNA as a template and the target small RNA as a primer;

c) amplifying and producing an amplicon using the module region of the sensor

DNA and a primer corresponding to a strand polymerized in step b); and

d) analyzing a sequence of the amplicon.

2. The method of claim 1, wherein the sensor DNA has a modified amine region

at the 3' end.

3. The method of claim 1, wherein the primer in step c) has a phosphate bound

to the 5' end.

4. The method of claim 1, further comprising, when a plurality of amplicons are

produced in step c), d) ligating the produced amplicons.

5. The method of claim 4, wherein step d) additionally comprises: after ligation

of amplicons, binding an adaptor for sequencing to both ends of the ligated amplicons.

6. The method of claim 4, further comprising: e) analyzing a sequence of the

ligated amplicons after step d).

7. The method of claim 6, wherein in step e), the sequencing is nanopore

sequencing.

8. The method of claim 1, wherein the sensor DNA comprises a unique barcode

region.

9. The method of claim 1, wherein the amplicon is amplified by comprising a

barcode region of the sensor DNA.

10. The method of claim 9, wherein the detection is capable of quantitatively

detecting up to the number of target small RNAs by measuring the number of amplicons.

11. The method of claim 10, wherein the number of amplicons is confirmed by

measuring the number of barcodes comprised in the amplicons.

12. Sensor DNA for detecting small RNA comprising:

a) a small RNA sensing region comprising a complementary sequence of target

small RNA;

b) a module region which is a template such that polymerization is capable of

being performed using the sensed target small RNA as a primer; and

c) an amine region at the 3' end; are modified.

13. The sensor DNA of claim 12, wherein the module region comprises a unique

barcode region.

14. The sensor DNA of claim 12, wherein the sensor is sequenced by a nanopore

system.