JPH06339399A - Primer for pathogenic mycota gene amplification - Google Patents

Abstract

PURPOSE:To efficiently detect in high sensitivity a pathogenic mycota such as Candida by amplifying, through PCR method, the ribosome RNA gene in the pathogenic mycota falling over a wide range of congeners thereof using a specific pair of synthesized DNA primers. CONSTITUTION:Using a pair of synthesized DNA primers represented, respectively, by the sequence table No.1 having a sequence of formula I and the sequence table No.2 having a sequence of formula II, the ribosome RNA gene in a pathogenic mycota falling over a wide range of congeners thereof is amplified by PCR method to detect the pathogenic mycota. A kit for detecting such pathogenic mycota can be obtained from the pair of synthesized DNA primers and a probe for detecting the DNA amplified.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for detecting ribosomal RNA genes of pathogenic fungi. The present invention also relates to a detection kit for detecting the gene.

[0002]

2. Description of the Related Art The number of immunocompromised patients has been increasing with the spread of advanced medical care. Deep (systemic) mycosis such as candidiasis and aspergillosis has become a medical problem as an important infectious disease that affects a high proportion of immunocompromised patients. However, the diagnosis of deep mycosis is extremely difficult,
Even today, various antifungal agents are being developed, and many patients die without treatment because no effective diagnostic method has been established yet. As a method of diagnosing deep mycosis that has been commercially available to date, there are a method of immunologically detecting a Candida antigen or an antibody, and a method of biochemically detecting a bacterial component or a metabolite of a pathogenic fungus. All of these methods have the problem of false positives in that they show significantly higher levels in patients with pathologically no fungal infections (including healthy people), and in terms of sensitivity, they are sufficient for clinical requests. It's not an answer. In recent years, a method for rapidly and specifically detecting a gene of only a specific pathogenic fungus by the PCR method has been developed. However, considering the current diversification of deep mycosis-causing bacteria, only a specific bacterial species is detected. PCR to detect DNA
The method alone is not a diagnostic method that is directly linked to treatment. That is, the types of bacteria that can be detected are limited, and
Even if detection can be attempted only for the bacterial species for which the primer has been developed, one limited sample must be divided and operated for the bacterial species to be detected.
Therefore, the operation becomes complicated, and in practice, the amount of the sample per bacterial species to be detected is small, and thus the risk of false negative is high. Therefore, there is a demand for establishment of a method capable of rapidly and specifically diagnosing a broad range of pathogenic fungal infections.

[0003]

The PCR method is the most sensitive gene detection method at present, which enables rapid and convenient amplification of an arbitrary gene by using a specific primer pair. Although the characteristics of various pathogenic fungi are defined by their genes, PCs can be prepared by using primer pairs corresponding to characteristic gene regions common to each pathogenic fungus.
If the R method can be performed and a characteristic gene common to various pathogenic fungi can be detected, the presence of such a bacterium can be confirmed. The inventor is common to pathogenic fungi, and
A sequence not common to humans and other mammals was found in the ribosomal RNA gene (DNA) of pathogenic fungi.
Therefore, PCR using a sequence common and specific to various pathogenic fungi in the ribosomal RNA gene as a primer pair
If the gene can be amplified by the method and the gene can be detected with high sensitivity and speed, the presence of a pathogenic fungus can be easily determined. That is, an object of the present invention is to provide a method for detecting a characteristic ribosomal RNA gene common to pathogenic fungi in a sample and a kit used therefor.

[0004]

Means for Solving the Problems To outline the present invention, the first invention is as follows: Candida, Hansenula, Saccharomyces, Trichosporon, Cryptococcus, Aspergillus, Penicillium, Blastomyces,
Regarding a method for detecting a wide range of pathogenic fungi including genus Coccidioides and genus Pneumocystis, SEQ ID NO: 1 in the sequence listing
And detecting the ribosomal RNA gene of the fungus by the PCR method using the synthetic primer pairs represented by 2 and 2. A second invention relates to a kit for detecting a pathogenic fungus, which is a detection kit for detecting the pathogenic fungus using the method of the first invention, wherein the ribosomal RNA gene of the pathogenic fungus is detected by PCR. It is characterized by comprising the above-mentioned synthetic primer pair for amplification and a probe for detecting the amplified DNA.

The sequences of characteristic primer pairs common to pathogenic fungi in the ribosomal RNA gene can be determined by the following procedure. (1) Of the gene sequences registered in the gene sequence data bank (GenBank), 18S ribosomal RNA genes (DNA) of various pathogenic fungi, humans and Escherichia coli are compared between their respective nucleotide sequences, and various types shown in Table 1 are shown. It limits sequence regions that are common to pathogenic fungi and not to humans (accession number M10098) and E. coli (accession number M24996).

Table 1 Aspergillus fumigatus M55626 Penicillium notatum M55628 Candida albicans M60302 Candida guillier mondei M60304 Candida kefil M60303 Candida kruzyi M60306 Candida lusitanie M60306 Candida lusitanie M60306 Candida lucitanie M60306 candida Hansenula polymorpha M60310 Saccharomyces cerevisiae V01335 Cryptococcus neoformans M55625 Blastomyces dermatitis M55624 Koxydioides imitis M55627 Nuomocystis carinii X12708

(2) A primer pair DNA sequence (sequence listing sequence) capable of specifically amplifying only the 18S ribosomal RNA gene of all the pathogenic fungi shown in Table 1 from the above-mentioned sequence region specific to the pathogenic fungus. Numbers 1 and 2) are determined. The primer can be synthesized as an oligonucleotide DNA by a DNA synthesizer and can be purified by HPLC.

The pathogenic fungal DNA to be detected can be prepared from a pathogenic fungal infected sample such as blood. Regarding the PCR method, a gene amplification kit containing Taq polymerase and an automatic gene amplification device are commercially available. By using this and the primer pair of the present invention, an amplification reaction of pathogenic fungal DNA can be performed. . In the PCR method, for example, a thermostable tack polymerase is used as an enzyme, a process of denaturing DNA (94 ° C.), a primer DN
Only the target gene can be exponentially amplified by repeating the temperature cycle consisting of the process of annealing A (55 ° C.) and the process of enzymatic synthesis of the DNA complementary strand (72 ° C.) any number of times. For example, if the temperature cycle is repeated 25 times, the target DNA is amplified about 100,000 times. In order to detect DNA with higher sensitivity than a trace amount sample, this P
The CR method is the most effective method. Ribosome R after amplification
The NA gene can be detected by, for example, agarose gel electrophoresis,
It can be performed using polyacrylamide gel electrophoresis, spot method, Southern blotting method and the like. In the case of spot method and Southern blotting method, D
The NA sequence may be selected as a probe. One example is probe 1 of SEQ ID NO: 3 in the sequence listing.

The probe DNA is the above-mentioned primer DNA.
It can be synthesized and purified in the same manner as in. Labeling the probe DNA enables highly sensitive detection. The labeling method is not limited to the radioisotope labeling method, and any known method such as an enzyme label including an avidin / biotin label and a fluorescent labeling method including a chemiprobe label may be used. The ribosomal RNA gene of the pathogenic fungus can be subjected to PCR reaction using the primers actually selected, and can be detected with high sensitivity by electrophoresis, Southern hybridization, or the like.

Thus, the pathogenic fungus can be detected with high sensitivity by the PCR method using the primer pair designed from the nucleotide sequence unique to the ribosomal RNA gene of the pathogenic fungus. Further, according to the present invention, a kit for preparing a pair of primers for amplifying a ribosomal RNA gene region of a pathogenic fungus and a probe for detecting the amplified DNA region is prepared as a kit, thereby facilitating the detection of the pathogenic fungus. You can The reagent used in the kit may be in the form of a solution, a freeze-dried product, or a state immobilized on a plate or the like. As described above, the present invention enables early detection of pathogenic fungi, which leads to early treatment thereof.

[0011]

The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

Example 1 Detection of ribosomal RNA genes of major pathogenic fungi Candida albicans and Aspergillus fumigatus by PCR method (1) Synthesis and purification of primers (DNA) and probes (DNA) Shown primer (DNA)
Also, the synthesis and purification of the probe (DNA) was requested to Kurabo Industries (Kurashiki Spinning Co., Ltd.) and Biomedical Department. (2) Preparation of genomic DNA of Candida albicans TIMM0169 Candida albicans culture, spheroplast preparation and genomic DNA preparation are performed according to the method of Abe et al.
November 10, 2010, published by Soft Science Co., Ltd., Yoshiyuki Kuchino et al., "Gene / protein / experimental operation blotting method" (first edition)], and finally culture solution 1
About 100 μg of genomic DNA was obtained from 5 ml. (3) Preparation of Aspergillus fumigatus JCM1738 Genomic DNA The culture of Aspergillus fumigatus and the preparation of genomic DNA were carried out by the method of Bainbridge et al. [Bainbridge BW et.al.
MS Microbiology Letters 66: 113-118, 1990.], and finally about 25 μg of Genome D from 1.5 ml of culture solution.
I got NA. (4) Amplification of Candida albicans TIMM0169 and Aspergillus fumigatus JCM1738 ribosomal RNA gene-specific regions by PCR method 10-DNA of Candida albicans TIMM0169 prepared in Example 1- (2) and (3), Aspergillus Fumigatus JCM1738 DNA 10 ng, human DNA 1 μg prepared by a known method, bovine DN
A 1 μg and E. coli DNA 10 ng 0.5
Transfer to a tube for ml and use 10 μl of 10 × amplification buffer (100 mM Tris-HCl pH 8.3, 500 mM).
KCl, 15 mM MgCl ₂ , 0.01% (w / v) gelatin), 8 μl of dNTP mixture (dATP, dGTP,
dTTP, dCTP; 100 mM each), 1 μl of 30 pmol
/ Μl primer 1, 1 μl of 30 pmol / μl primer 2 and 0.5 μl of 5 units / μl tack polymerase were added, and sterile water was further added to make a 100 μl solution. After adding 100 μl of mineral oil to the upper layer of this reaction solution, an amplification reaction was carried out by an automatic gene amplifier thermal cycler. The reaction conditions are: denaturation at 94 ° C. for 5 minutes, denaturation at 94 ° C. for 1 minute → priming annealing at 55 ° C. for 2 minutes → synthesis reaction cycle at 72 ° C. for 1 minute, 25 cycles, then 72 The reaction was carried out at 0 ° C for 10 minutes. After the reaction, take 5 μl of the reaction solution in the lower layer and 1.2
% Agarose gel electrophoresis was performed and the DNA was stained with ethidium bromide to confirm the amplified DNA. As a result, a single band of 687 bp was confirmed only when Candida albicans TIMM0169 and Aspergillus fumigatus JCM1738 were used as templates. No amplification was observed when other DNA was used as a template. (5) Detection of Candida albicans and Aspergillus fumigatus ribosomal RNA genes amplified by the PCR method by Southern hybridization 1.2% agarose obtained by electrophoresis of the PCR reaction solution described in Example 1- (4) After denaturing the gel with alkali, it was Southern blotted on a nylon membrane (Amersham Hybond-N) overnight. UV transilluminator (2
The DNA was immobilized on the membrane by irradiating with a membrane (54 nm) for 10 minutes. DNA detection from this membrane is based on ECL 3
It was carried out as follows by fluorescence emission using an'-oligo labeling / detection system (Amersham Japan). 3 in 5 ml of hybridization buffer (0.5% blocking solution, 5 × SSC, 0.1% SDS, 5% dextran sulfate and 100 μg / ml salmon sperm DNA)
Prehybridization was performed for 30 minutes at 7 ° C.
Next, using a terminal transferase, the probe 1 tailed with fluorescein-modified dUTP was added, and hybridization was carried out at 37 ° C. overnight. After hybridization, the membrane is washed in Wash Buffer 1 (1 × SSC / 0.1% SDS) for 15 minutes for 60 minutes.
Wash with shaking at ℃, then wash buffer 2
15 minutes in (0.5 x SSC / 0.1% SDS), 6
It was washed with shaking at 0 ° C. Further, wash the membrane in Buffer 1 for 1 minute, then at room temperature for 60 minutes,
Shaking was performed in 0.5% blocking solution. Then, incubation was carried out at room temperature for 60 minutes in an HRP-labeled anti-fluorescein antibody solution diluted 1000-fold with buffer 2. The membrane was dried and then exposed for 40 minutes in a cassette containing Hyperfilm-ECL (Amersham Japan Co.). As a result, P. of Candida albicans and Aspergillus fumigatus
CR-amplified DNA hybridizes with probe 1,
A band appeared, but no band was observed in the other samples. This means that only the Candida albicans and Aspergillus fumigatus genomic DNAs are specifically amplified by the primer 1 and the primer 2, and the amplified DNA hybridizes with the probe 1, whereby the Candida albicans and Aspergillus fumigatus are hybridized. It shows that a sequence specific to the ribosomal RNA gene of can be detected.

Example 2 Detection of ribosomal RNA gene of each pathogenic fungal species by PCR (1) Preparation of genomic DNA Regarding various pathogenic fungi shown in Table 2, each species of Aspergillus spp. And Penicillium spp. 3), other bacterial strains were cultured and genome D was prepared by the method of Example 1- (2).
NA was prepared.

Table 2 Aspergillus fumigatus JCM1738 Aspergillus fumigatus TIMM1335 Aspergillus fumigatus No. 2005 Aspergillus fumigatus No. 2014 Aspergillus Fumigatus No. 2021 Aspergillus fumigatus No. 2022 Aspergillus terreus No. 2036 Aspergillus Furabusu TIMM0057 Aspergillus versicolor TIMM1290 Aspergillus nidulans TIMM0111 Aspergillus niger TIMM0113 Penicillium Ekusupansumu TIMM1293 Candida albicans TIMM1623 Candida albicans TIMM2726 Candida albicans (Suteratoidea) TIMM0310 Candida Gili El Mondi Lee TIMM0260 Candida Kefiru TIMM0302 Candida Kuruzei TIMMM0269 Candida tropicalis TIMMM0313 Candida parapsilosis TIMMM0292 Candida glabrata TIMMM1064 Hansenula Anomala JCM3585 Saccharomyces cerevisiae IMM0925 Cryptococcus neoformans TIMM0354 Cryptococcus neoformans No. 0061 Trichosporon beigelie No. 0065

(2) Detection of ribosomal RNA gene by PCR method using Primer 1 and Primer 2 10 ng of each of the above DNAs was placed in a 0.5 ml tube, and 10 μl of 10 × amplification buffer prepared in the same composition as in Example 1 Solution, 8 μl dNTP mixture (dATP, dG
TP, dTTP, dCTP; 100 mM each), 1 μl of 3
0 pmol / μl primer 1, 1 μl of 30 pmol / μl primer 2 and 0.5 μl of 5 units / μl tack polymerase were added, and sterile water was further added to make 100 μl of solution. After adding 100 μl of mineral oil to the upper layer of this reaction solution, an amplification reaction was carried out by an automatic gene amplifier thermal cycler. The reaction conditions are 94 ° C and 5
After denaturing for 1 minute, 25 cycles of denaturing at 94 ° C. for 1 minute → annealing of primer at 55 ° C. for 2 minutes → synthesis reaction at 72 ° C. for 1 minute were performed, and extension reaction was performed at 72 ° C. for 10 minutes. After the reaction, 5 μl of the reaction solution in the lower layer was taken, subjected to 1.2% agarose gel electrophoresis, and the DNA was stained with ethidium bromide to confirm the amplified DNA. As a result, a single band of 687 bp was confirmed in all of the pathogenic fungi of 18 strains and 26 strains shown in Table 2.

Example 3 Preparation of Amplification / Detection Kit for Pathogenic Fungal DNA A kit for amplifying / detecting a pathogenic fungal gene in a sample was prepared. As a primer for DNA amplification, TE buffer (10 mM Tris, 1 mM EDTA pH) was prepared so that each of primer 1 and primer 2 was a 30 pmol / μl solution.
8.2) Dissolved in 40 μl to prepare a pathogenic fungal gene amplification primer solution (agent A). As a probe for DNA detection,
1 μg of the probe 1 was dissolved in 20 μl of TE buffer to prepare a pathogenic fungal gene detection probe solution (agent B). Agent A, B
A set of agents was used as an amplification / detection kit for pathogenic fungal genes (Table 3).

Table 3 Agent A Pathogenic fungal gene amplification primer A solution 40 μl
(2 μl x 20 times) Agent B Pathogenic fungal gene detection probe B solution 20 μl
(1 μl x 20 times)

[0018]

INDUSTRIAL APPLICABILITY As described in detail above, the present invention provides a highly sensitive detection method and detection kit for pathogenic fungi in a sample by detecting the ribosomal RNA gene of the pathogenic fungus.

[Sequence list]

 SEQ ID NO: 1 Sequence length: 19 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Hypothetical sequence: NO Antisense: NO Sequence characteristics : 1-19 E primer Sequence: ACTTTCGATGGTAGGATAG 19 SEQ ID NO: 2 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) hypothetical Sequence: NO Antisense: YES Sequence characteristics: 1-20 E primer Sequence: TGATCGTCTTCGATCCCCTA 20 SEQ ID NO: 3 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acids (synthetic DNA) Hypothetical sequence: NO Antisense: NO Sequence features: 1-20 E probe sequence: CTGAGAAACGGCTACCACAT 20

Claims (2)

[Claims] 1. Synthetic DNs represented by SEQ ID NOS: 1 and 2
A method for detecting a pathogenic fungus, which comprises amplifying a ribosomal RNA gene of a wide range of pathogenic fungi by PCR using an A primer pair and detecting the gene. 2. A kit for detecting pathogenic fungi, which comprises the synthetic DNA primer pair according to claim 1 and a probe for detecting amplified DNA.