JPH06277065A - Adipocyte-formation suppressing factor derivative - Google Patents

Abstract

PURPOSE:To obtain a new single polypeptide having activities to suppress the conversion of a cell into adipocyte, to suppress the lipoprotein lipase(LPL) of adipocyte, to induce the generation of colony stimulating factor(CSF) from a preadipocyte, to promote the antibody formation of B cell, to promote the formation of blood megakaryocyte colony, to promote the generation of platelet and/or to shorten the G0 phase of hemopoietic precursor cell, a DNA coding the above polypeptide, etc. CONSTITUTION:A polypeptide produced by gene manipulation technique, having AGIF activity, essentially free from other proteins originated from human and constituted of an amino acid sequence of amino acid numbers 2-178 to 10-178 in the amino acid sequence expressed by the sequence number 2 of the sequence table. A DNA coding for this peptide. The new polypeptide is expected to be useful as an agent for the treatment of hypocytosis such as thrombopenia, an immune enhancement agent and an agent for the prevention or treatment of morbid obesity.

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to lipoprotein lipase (LP) for adipocytes, which has an activity of suppressing adipogenesis of cells.
L) suppressing activity, activity of inducing production of colony stimulating factor (CSF) from preadipocytes, activity of promoting B cell antibody production, activity of promoting formation of megakaryocyte colonies, platelets , A novel single polypeptide having an activity of promoting the production of hepatocytes and / or an activity of shortening the G 2 _O phase of hematopoietic stem cells, and a DNA encoding the polypeptide, and a recombinant D comprising the DNA
It relates to a NA expression vector, a host transformed with the recombinant DNA expression vector, and a polypeptide composition containing an effective amount of the polypeptide. The novel polypeptide of the present invention is expected to be used as a therapeutic drug for cytopenias such as thrombocytopenia, as an immune function-enhancing drug, and as a preventive or therapeutic drug for morbid obesity.

[0002]

BACKGROUND OF THE INVENTION All blood cells such as erythrocytes, neutrophils, monocytes, eosinophils, basophils, platelets and lymphocytes present in blood are common mother cells mainly present in bone marrow, That is, it is known that it is derived from pluripotent stem cells and is generated by differentiation and proliferation of the pluripotent stem cells. Differentiation and proliferation of hematopoietic progenitor cells are regulated by the action of various hematopoietic factors, and contact (cell-to-cell) with bone marrow stromal cells etc.
-cell interaction). The hematopoietic field formed by such bone marrow stromal cells is called the hematopoietic microenvironment (Dexter, TM and Spooncer, E. (1987) An
n. Rev. Cell Biol. 3 , 423-441).

It is known that cells having a function of supporting hematopoiesis in the hematopoietic microenvironment are mainly preadipocytes, and lose their ability when they differentiate into adipocytes (Hiroaki Kodama).
(1986) Tissue culture 12 , 191-195). Therefore, a novel cytokine having an activity of inhibiting the differentiation of preadipocytes into adipocytes was searched for, and as a result, the adipogenesis inhibitory factor (adipo
genesis inhibitory factor, hereafter abbreviated as "AGIF". : SEQ ID NO: 4) was isolated (Kawashima, I. et al. (1991), FE
BS Lett. 283 , 199-202; Ohsumi, J. et al. (1991), FEBS Le
tt. 288 , 13-16). AGIF is a human bone marrow stromal cell line KM-1
Mouse bone marrow-derived preadipocyte cell line H-
It has the effect of inhibiting 1 / A differentiation into adipocytes.

For example, mouse bone marrow preadipocyte cell line PA6
Has the activity of supporting the proliferation of hematopoietic stem cells, but its capacity is reduced when these cells differentiate into adipocytes (Kodam.
a, H.-A. et al. (1984) J. Cell. Physiol. 118, 233-240).
It is known that co-culture of PA6 cells and mouse bone marrow cells can induce blast colonies, megakaryocyte colonies, and macrophage colonies (Kodama Hiroaki (198
7), Experimental Medicine 5 , 826-830), AGIF acts on bone marrow preadipocytes to maintain their ability to support hematopoiesis, that is, the ability to induce white blood cells, macrophages, platelets (derived from megakaryocytes) in a high state. Is believed to be.

Further, mouse bone marrow-derived preadipocyte cell line H-1
/ A produces CSF, but it has been reported that CSF production decreases when these cells are differentiated into adipocytes (Nakamura, M. et al. (1985), Proc. Soc. Exp). .Biol.M
ed., 179, 283-287). Therefore, it is considered that AGIF can promote hematopoiesis also by increasing the amount of CSF produced by hematopoietic feeder cells of bone marrow. As described above, AGIF can be effectively applied to the treatment and diagnosis of various anemias and other blood diseases.

The present inventors have found that a polypeptide lacking 1 to 9 amino acid residues in the N-terminal portion of AGIF still has AGIF activity, and completed the present invention.

[0007] PCT WO 92/13955 is an international application published after the first priority date (April 17, 1992) of the present application, in which thioredoxin and N-type of AGIF mature form are used.
A fusion protein with an AGIF mutant in which the terminal proline residue is deleted is described. However, in such description, the mutants of AGIF itself and the biological activity of these compounds are not discussed.

[0008]

INDUSTRIAL APPLICABILITY According to the present invention, a polypeptide having AGIF activity can be efficiently obtained in a large amount, and can be effectively applied to the treatment and diagnosis of various anemias and other blood diseases. become able to. For example, it can be applied to aplastic anemia, leukopenia due to poisons and radiation, infections due to viruses, bacteria, parasites, cytopenias after bone marrow transplantation, and cytopenias after chemotherapy with anticancer agents. It may also result in savings of the currently widely practiced component transfusion. Furthermore, not only these immune function enhancing effects but also use as a preventive or therapeutic agent for morbid obesity are possible.

In the present invention, "cytopenia" refers to all of the above-mentioned diseases and various immune diseases that accompany it, and "cytopenia-improving agent" is effective for the prevention / treatment of cytopenia. Drugs that have various effects are collectively referred to.

In addition, the activity of suppressing LPL of adipocytes,
Activity of suppressing the morphological change of preadipocytes into adipocytes, activity of maintaining / promoting CSF-producing ability of preadipocytes, activity of promoting B cell antibody production, activity of promoting formation of megakaryocyte colonies, platelets One or more of the activities that promote the production of Escherichia coli are referred to as "AGIF activity".

[0011]

The present invention provides (1) an amino acid sequence from 3 to 9 of SEQ ID NO: 2 in the sequence listing, which is obtained by genetic engineering and does not substantially contain other proteins of human origin. Or an amino acid sequence lacking one or more amino acids from the N-terminus of the sequence, and
A polypeptide having AGIF activity, comprising a C-terminal 10 to 178 amino acid sequence, or
One or more amino acid residues in one or more sites of the polypeptide are deleted, inserted or substituted, the same effect product of the polypeptide, (2) obtained by genetic engineering , An amino acid which does not substantially contain other proteins of human origin and has one or more amino acids deleted from the N-terminal of all of the amino acid sequences 3 to 9 of SEQ ID NO: 2 in the sequence listing Array and
A polypeptide having an AGIF activity, which comprises an amino acid sequence of C-terminal side 10 to 178, (3) a polypeptide according to (1) or (2), which has Met at the N-terminus, (4) D encoding the polypeptide according to (1), (2) or (3)
NA, a recombinant DNA expression vector consisting of the DNA described in (5) (4), wherein the DNA is expressible and replicable, (6) a host transformed with the recombinant expression vector described in (5), (7) A host comprising a DNA encoding the polypeptide according to (1), (2) or (3), which is expressible and replicable, and which has been transformed with a recombinant DNA expression vector. A method for producing the polypeptide, which comprises culturing and recovering the polypeptide from the cell extract or the culture, (8) obtained by genetic engineering, and substantially free of other human-derived proteins , All of the amino acid sequences 2 to 9 of SEQ ID NO: 2 in the sequence listing, or an amino acid sequence in which one or more amino acids have been deleted from the N terminus of the sequence, and
A polypeptide having AGIF activity, comprising a C-terminal 10 to 178 amino acid sequence, or
Improvement of cytopenia using the same substance of the polypeptide in which one or more amino acid residues are deleted, inserted or substituted at one or more sites of the polypeptide (9) All of the amino acid sequences from 2 to 9 of SEQ ID NO: 2 in the sequence listing, or one from the N terminus of the sequence, which is obtained by genetic engineering and does not substantially contain other proteins of human origin Or an amino acid sequence lacking two or more amino acids, and
A cytopenia-improving agent comprising a polypeptide having AGIF activity as an active ingredient, which comprises an amino acid sequence of C-terminal side 10 to 178, (10) Another human-derived protein obtained by genetic engineering Substantially containing no amino acid sequence from 2 to 9 of SEQ ID NO: 2 in the sequence listing, or an amino acid sequence in which one or more amino acids are deleted from the N-terminal of the sequence, and
A polypeptide having AGIF activity, comprising a C-terminal 10 to 178 amino acid sequence, or
An antiobesity agent comprising, as an active ingredient, the same substance of the polypeptide in which one or more amino acid residues are deleted, inserted or substituted at one or more sites of the polypeptide, (11) All of the amino acid sequences from 2 to 9 of SEQ ID NO: 2 in the sequence listing, or 1 or 2 from the N terminus of the sequence, which is obtained by genetic engineering and does not substantially contain other proteins of human origin. An amino acid sequence lacking one or more amino acids, and
The present invention relates to an antiobesity agent comprising a polypeptide having AGIF activity, which comprises an amino acid sequence of 10 to 178 on the C-terminal side as an active ingredient.

The polypeptide of the present invention is preferably the polypeptide described in (2).

One of the polypeptides of the present invention can be obtained, for example, by expressing AGIF in a suitable host-vector system using recombinant DNA technology and then digesting it with trypsin.

DNA encoding the polypeptide of the present invention
For example, the phosphite triester method (Hunkapille
r, M. et al. (1984) Nature 310 , 105-111) and the like, and can be prepared by chemical synthesis of nucleic acid. The codon corresponding to the desired amino acid is known per se, and its selection may be arbitrary. Alternatively, RNA is prepared from cells expressing AGIF, cDNA is synthesized by reverse transcription using it as a template, and then the cDNA sequence described in the literature (Kawashima, I. et al. (1991) FEBS Lett. 283 ). , 199-20
2: Oligonucleotide primers of sense strand and antisense strand corresponding to a part of SEQ ID NO: 1) were prepared and used in combination to carry out polymerase chain reaction (Saiki, RK et al. (1988) Science 239,487 ). -491)
It can also be obtained by performing. In this case, R
Depending on the type of cell used as the NA source, etc., there may be one or more nucleotide sequence substitutions associated with the polymorphism.

The polypeptide of the present invention can be obtained by introducing the DNA thus prepared into a suitable host and expressing it according to the method described below.

Further, in order to obtain a polypeptide (SEQ ID NO: 8) consisting of the amino acid sequence of amino acid numbers 10 to 178 of SEQ ID NO: 2 in the sequence listing, the following method can be used. First, a method for coding a DNA encoding a protein containing the polypeptide (a precursor of AGIF, a mature form, etc.) (Kawashima, I. et al. (1991) FEBS Lett. 283 , 1)
99-202), followed by introduction into a suitable host for expression according to the method described below, and partial digestion of the expression product with trypsin.

The following method can also be used to obtain a polypeptide (SEQ ID NO: 6) consisting of the amino acid sequence of amino acid numbers 2 to 178 of SEQ ID NO: 2 in the sequence listing. First, a DNA encoding the precursor or mature form of AGIF (SEQ ID NO: 1 or 3) was described in the literature (Kawashima, I. et al. (1991) FEBS Lett. 283 , 199-20).
2) and then using a technique such as in vitro mutagenesis, DNA encoding a polypeptide consisting of the amino acid sequence of amino acid numbers 2 to 178 of SEQ ID NO: 2 in the sequence listing (SEQ ID NO: 2) : 5) is produced. Next, this is blood coagulation factor Xa
Is ligated to the 3'side of a DNA encoding an appropriate protein having the amino acid sequence recognized by the C-terminal side. This is introduced into an appropriate host and expressed, and the expression product (fusion protein) is
It can be obtained by cutting with Xa.

The DNA encoding the protein containing the polypeptide of the present invention thus obtained is used as a suitable vector D.
Incorporation into NA can transform prokaryotic or eukaryotic host cells. Furthermore, by introducing an appropriate promoter and a sequence involved in expression into these vectors, it is possible to express the gene in each host cell.

As a host for prokaryotic cells, for example, Escherichia coli (E
scherichia coli) and Bacillus subtilis. To express the gene of interest in these host cells, a replicon from a species compatible with the host,
That is, a host cell may be transformed with a plasmid vector containing an origin of replication and regulatory sequences. Further, the vector preferably has a sequence capable of imparting phenotypic (phenotypic) selectivity to the transformed cell.

For example, E. coli K12 strain and the like are often used as Escherichia coli, and pBR322 and pUC type plasmids are often used as vectors, but the present invention is not limited thereto, and various known strains and vectors can be used. Available.
As the promoter, in E. coli, tryptophan (trp) promoter, lactose (lac) promoter, tryptophan lactose (tac) promoter,
Lipoprotein (lpp) promoter, the lambda-derived bacteriophage (lambda) P _L promoter, polypeptide chain elongation factor Tu (tufB) promoter and the like, any promoters used in the production of adipogenesis inhibitory factor derivative of the present invention can do. As Bacillus subtilis, for example, 20
7-25 strain is preferable, and the vector is pTUB228 (Ohmu
ra, K. et al . (1984) J. Biochem. 95 , 87-93) and the like are used, but not limited thereto. As the promoter, a regulatory sequence of the α-amylase gene of Bacillus subtilis is often used, and if necessary, by ligating a DNA sequence encoding the signal peptide sequence of α-amylase, secretory expression outside the cells is also possible. Become.

Eukaryotic host cells include cells of vertebrates, insects, yeasts and the like. Examples of vertebrate cells are COS cells (Gluzman, Y. (1981) Ce, which are monkey cells).
ll 23, 175-182) and Chinese hamster ovary cells (C
HO) dihydrofolate reductase-deficient strain (Urlaub, G. and
Chasin, LA (1980) Proc.Natl.Acad.Sci.USA 77 , 4216-4
220) and the like are often used, but not limited to these.

As an expression vector for vertebrate cells, one having a promoter located upstream of the gene to be normally expressed, an RNA splice site, a polyadenylation site, a transcription termination sequence, etc. can be used. It may have an origin of replication. An example of the expression vector is pS having an SV40 early promoter.
V2dhfr (Subramani, S. et al . (1981) Mol.Cell.Biol. 1 , 854
-864) can be exemplified, but the invention is not limited thereto.

Yeast is commonly used as a eukaryotic microorganism, and among them, Saccharomyces yeast, for example, Saccharomyces cerevisiae is preferable. Examples of the expression vector for eukaryotic microorganisms such as the yeast include, for example, the promoter of the alcohol dehydrogenase gene (Bennetzen, JLand H
all, BD (1982) J. Biol. Chem. 257 , 3018-3025) and the promoter of the acid phosphatase gene (Miyanohara, A. et a .
l . (1983) Proc.Natl.Acad.Sci.USA 80 , 1-5) and the like can be preferably used.

Taking the case of using COS cells as a host cell, the expression vector has an SV40 origin of replication and is capable of autonomous growth in COS cells. Furthermore, a transcription promoter, transcription termination signal and RNA splice are used. It is possible to use a device having a part. The expression vector is a DEAE-textrun method (Luthman,
H. and Magnusson, G. (1983) Nucleic Acids Res. 11 , 1295-
1308), calcium phosphate-DNA co-precipitation method (Graham, F.
L. and van der Ed, AJ (1973) Virology 52 , 456-457) and electric pulse drilling (Neumann, E. et al . (1982) EMBO
J. 1 , 841-845) and the like, and can be incorporated into COS cells, and thus desired transformed cells can be obtained. When CHO cells are used as host cells,
A vector capable of expressing the neo gene that functions as a G418 resistance marker together with the expression vector, such as pRSVneo
(Sambrook, J. et al . (1989): “Molecular Cloning-A Lab
oratory Manual ”Cold Spring Harbor Laboratory, NY)
And pSV2-neo (Southern, PJand Berg, P. (1982) J.Mol.A
ppl.Genet. 1 , 327-341) etc.
By selecting a G418-resistant colony, a transformed cell that stably produces an adipogenesis inhibitory factor derivative can be obtained.

The desired transformant obtained above can be cultured by a conventional method, and the adipogenesis inhibitor factor derivative is produced intracellularly or extracellularly by the culture. As the medium used for the culturing, various kinds of medium commonly used can be appropriately selected depending on the adopted host cell. For example, in the case of the above COS cells, RPMI-1640 medium or Dulbecco's modified Eagle minimum essential medium (DMEM), etc. If necessary, a serum component such as fetal bovine serum (FBS) may be added to the medium.

[0026] As described above, a protein containing the polypeptide of the present invention produced intracellularly or extracellularly of a transformant,
It can be separated and purified by various known separation procedures utilizing the physical properties and chemical properties of the protein.
Specific examples of such a method include treatment with an ordinary protein precipitant, ultrafiltration, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography ( Examples thereof include various chromatography methods such as HPLC), dialysis methods, and combinations thereof.

In this way, a polypeptide having a desired AGIF activity can be easily produced in high yield and high purity on an industrial scale.

The properties of the polypeptide of the present invention obtained as described above are as described in detail in the Examples below, and the polypeptide is useful in the various fields mentioned above because of its biological activity. .

[0029]

The polypeptide having AGIF activity of the present invention is, as amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, Val at amino acid number 10 or Gly at amino acid number 2.
A polypeptide consisting of 169 or 177 amino acids having N as the N-terminus can be particularly exemplified (SEQ ID NO: 6 or 8). In addition, this polypeptide is SD under reducing conditions.
In S-polyacrylamide gel electrophoresis, they each have an apparent molecular weight of about 22,000 or 23,000.

All of the amino acid sequences 2 to 9 of SEQ ID NO: 2 in the sequence listing, or an amino acid sequence in which one or more amino acids have been deleted from the N terminus of the sequence, and its C
These polypeptides are also included in the present invention because the polypeptides consisting of the terminal amino acid sequence from 10 to 178 also have AGIF activity.

The DNA encoding the polypeptide having AGIF activity of the present invention can also be exemplified as the DNA of the present invention. Suitably, such DNA is nucleotide number 84 or 108 of SEQ ID NO: 1 of the sequence listing.
It is the DNA represented by the nucleotide sequence starting from and ending at 614 (SEQ ID NO: 5 or 7).

Generally, eukaryotic genes have polymorphism (polymorphism), as is known for interferon genes.
ism) (for example, Nishi, T. et al. (1985)
J. Biochem. 97 , 153-159), this polymorphism may result in the substitution of one or more amino acids, or in the presence of nucleotide changes but no amino acid changes at all.

One or more sites in the amino acid sequence of the polypeptide comprising the above-mentioned amino acid sequence starting with amino acid numbers 2 to 10 and ending with 178 of SEQ ID NO: 2 in the sequence listing. In, even a polypeptide in which one or more amino acid residues are deleted, inserted or substituted may have AGIF activity. These polypeptides are called synonymous with the polypeptides of the present invention.

For example, a protein obtained by converting a nucleotide sequence corresponding to cysteine of interleukin 2 (IL-2) gene into a nucleotide sequence corresponding to serine is IL
-2 activity is already known (Wang,
A. et al. (1984) Science 224 , 1431-1433). therefore,
Included in the present invention are the same effects of the polypeptides of the present invention that are naturally occurring or artificially synthesized.

The present invention also includes all DNAs having the same nucleotide sequence that code for these polypeptides. Preferably, such DNA is at the 5'end of the DNA represented by the nucleotide sequence of SEQ ID NO: 1 in the sequence listing from nucleotide number 108 to 614, and at the 5'end of the sequence listing, nucleotide number 84 to 107, 8
7-107, 90-107, 93-107, 96-10
7,99-107, 102-107, or 105-10
DNA having the nucleotide sequence of 7 or a nucleotide sequence having the same effect as the nucleotide sequence.

Such various DNAs of the present invention can be synthesized, for example, based on the information on the above-mentioned polypeptide.
Triester method (Hunkapiller, M. et al. (1984) Nature 3
It can also be produced by chemical synthesis of nucleic acid according to a conventional method such as 10 , 105-111).

The codon for the desired amino acid is known per se, and its selection may be arbitrary. For example, it can be determined according to a conventional method in consideration of the frequency of codon usage of the host to be used (Grantham, R. et al . (1981). ) Nucleic Acids Res. 9 r43
-r74). Further, partial modification of the codons of these nucleotide sequences, according to a conventional method, site-specific mutagenesis (site specific m) using a primer consisting of a synthetic oligonucleotide encoding the desired modification.
utagenesis) (Mark, DF et al . (1984) Proc.Natl.Acad.Sc
i.USA 81 , 5662-5666) etc.

The above-mentioned polypeptide of the present invention is preferably produced by genetic engineering by a fusion protein expression method using a microorganism as a host, but can also be produced by a direct expression method.
It can also be produced by using a eukaryotic cell as a host.

The polypeptide of the present invention contains aplastic anemia, leukopenia caused by poisons and radiation, infections caused by viruses, bacteria, parasites, cytopenias after bone marrow transplantation,
In addition, it is used alone or in combination with other therapeutic agents in the treatment of diseases such as refractory pancytopenia and various immune diseases that accompany it. Furthermore, the polypeptide is used alone or in combination with other therapeutic agents in the prevention or treatment of morbid obesity.

The cytopenia improving agent composition or antiobesity agent composition of the present invention used for treating the above-mentioned conditions comprises a medically acceptable carrier and a therapeutically effective amount of the polypeptide of the present invention. It consists of a mixture of. The composition can be administered in various forms, such as oral administration by tablets, capsules, granules, powders, syrups, etc., or injections, infusions, suppositories, etc. Parenteral administration may be mentioned.

When administered as an injection or drip,
The therapeutic compositions of the present invention are in the form of a pyrogen-free, parenterally acceptable aqueous solution. The formulation of the above-mentioned parenterally acceptable protein solution prepared in consideration of pH, isotonicity, and stability is within the skill of those in the art.

The dosage and administration method for the treatment of the above-mentioned symptoms depend on factors that may influence the action of the present drug, such as patient's symptoms, weight, sex, age, diet, severity of any infection, time of administration and It may be decided by a doctor who consults in consideration of other clinically affecting factors. Oral administration is usually about 0.01 mg to 1000 mg per day for an adult, and these can be administered once or in several divided doses. For parenteral administration, about 0.01 mg to 100 mg at a time
Can be administered by subcutaneous, intramuscular, or intravenous injection.

The cytopenia-improving composition of the present invention comprises other suitable hemostatic factors such as IL-1 to 10, LIF, stem cell factor, GM-CSF, and the like.
It can be used in combination with G-CSF, M-CSF, Meg-CSF, TNF, IFN, erythropoietin. In this case, other hematopoietic factors can be used in addition to one component in the cytopenia improving agent composition of the present invention, but they can also be administered to the same patient as separate compositions. The above combination may enhance the activity or efficacy of treatment with other hematopoietic factors alone.

The antiobesity composition of the present invention also comprises other suitable antiobesity agents such as an appetite suppressant, intestinal absorption suppressant,
It can be used in combination with a digestive enzyme inhibitor, a metabolic stimulating hormone agent, a fat synthesis inhibitor, an insulin secretion inhibitor, and can also be used in combination with diet therapy and exercise therapy. This may enhance the activity or effect of treatment with the other antiobesity agent alone, as well as the effect of treatment with the other antiobesity therapy alone.

The cytopenia-improving agents and anti-obesity agents used in the present invention are all derived from living organisms or gene recombinants, and therefore have low toxicity. As a result of oral administration to male DDY mice (body weight: about 20 g) and observation for 5 days, all of the polypeptides of the present invention were 500 m.
It showed no toxicity below g / kg.

[0046]

The present invention will be described in detail below with reference to examples, but these do not limit the scope of the present invention.
Before that, a method for measuring AGIF activity will be explained with reference examples.

(Reference Example) AGIF used in the present invention
The method for measuring the activity is as follows. The cells used for measurement were the mouse embryonic fibroblast cell line 3T3-L1 (Green, H. and Kehinde,
O. (1974) Cell 1 , 113-116) and American Type Cultu
We purchased from re Collection (ATCC). All cell cultures were performed at 37 ° C. in a humidified mixture of 10% CO ₂ -90% atmosphere. Subculture of the cells was performed using medium A (10% inactivated FBS
(Manufactured by Hyklon) and 10 mM Hepes (pH7.2, HEPES,
DMEM containing Sigma) (containing 4.5 g / l glucose, manufactured by Gibco) was used. Induction of differentiation of 3T3-L1 cells into adipocytes was performed by the method of Rubin et al. (Rubin, CS et a
l . (1978) J. Biol. Chem. 253 , 7570-7578).

Method for Measuring Inhibitory Effect of 3T3-L1 Cells on Morphological Changes to Adipocytes 3T3-L1 cells were suspended in medium A at a density of 1.0 × 10 ⁴ cells / ml, and this was suspended in a 48-well multi-cluster dish. 0.5 ml was added to each well (manufactured by Coaster) and cultured. After 3 days in culture, the cells reach confluence. After that, the medium was replaced with a fresh medium A, and after culturing for another 2 days, the medium was a medium for inducing adipogenesis, that is, medium B (10 mM HEPES (pH7.2), 3%
Inactivated FBS, 5 μg / ml bovine insulin (manufactured by Sigma), 8 μg / ml d-biotin (manufactured by Sigma), 4 μg /
DMEM (containing 4.5 g / l glucose) containing ml pantothenic acid (manufactured by Sigma), 1.0 μM texamethasone (manufactured by Sigma) and 0.5 mM isobutylmethylxanthine (manufactured by Aldrich) was exchanged. At this time, samples were added at the same time. Then, the medium was replaced with fresh medium B every two days, and the sample was added again. Four to seven days after the start of addition of the medium B and the sample, the medium was an adipocyte maintenance medium C (5% inactivated FBS, 10 mM HEPES (pH 7.2)).
And DMEM containing 100 ng / ml bovine insulin
(Containing 4.5 g / l glucose)).

After culturing in the medium C for 2 days, the cells were fixed with 5% formaldehyde, and oil red 0 and hematoxylin were used to stain the lipid granules accumulated inside the cells and the cell nuclei, respectively. After taking a micrograph, the number of cells accumulating fat particles stained red from the photograph and the number of nucleated cells stained with hematoxylin were counted, and the adipocyte conversion rate was calculated from the following formula. .

Adipocyte conversion rate (%) = 100 × number of fat particle accumulating cells / number of nucleated cells The method of fixing cells, oil red 0 staining and hematoxylin staining were written in an experimental manual (Yoshio Mitomo, Shojiro Takayama “Clinical examination. The course was conducted in accordance with the course "Vol. 12" Pathology "(1982), Ito Denshaku Shuppan.

Method for Measuring LPL Inhibitory Effect Beutler et al . (Beutler, BA et al . (1985) J. Immuno
l. 135 , 3972-3977) as a reference.
Adipocyte-ized 3T3-L1 cells were prepared using the method described in the section "Method for measuring inhibitory effect of 3T3-L1 cells on adipocyte morphological change". However, no sample was added during the induction of differentiation into adipocytes. The medium was then replaced with fresh medium C and the sample added. After culturing for 18 hours, the medium was removed, and the cells were washed twice with PBS (-) (phosphate buffered saline, manufactured by Nissui Pharmaceutical Co., Ltd.). Next, medium D (5% inactivated F
DMEM (containing 4.5 g / l glucose) containing BS, 10 mM HEPES (pH7.2), 100 ng / ml bovine insulin and 10 U / ml heparin sodium (manufactured by Novo Industry) was added to each well in an amount of 300 μl. After culturing for 1 hour, 100 μl of this culture supernatant was taken and used for measuring LPL activity. The LPL inhibitory action was measured in triplicate for each sample, and the average value was obtained.

LPL activity was assayed by Nilsson-Ehle and Sc
hotz's method (Nilsson-Ehle, P. and Schotz, MC (1976) J.
Lipid Res. 17 , 536-541). 100 μl of culture supernatant prepared as described above was added to an equal volume of substrate solution (13 m
M Glycerol tri [9,10 (n) ^-3 H] oleic acid (51.8KB
eq / μmol, Amersham), 1.3 mg / ml L-α-phosphatidylcholine distearoyl (Sigma),
20 mg / ml bovine serum albumin (Sigma), 135
mM Tris-hydrochloride (Tris-HCl, pH8.1, manufactured by Sigma), 16.5% (v / v) glycerol, 16.5% (v / v) inactivated FBS) were mixed and reacted at 37 ° C for 120 minutes. . 1.05 ml of 0.1 M potassium carbonate-borate buffer (pH 10.
5) and 3.25 ml of methanol: chloroform: heptane = 1
41: 125: 100 (v / v) was added to stop the reaction,
After stirring vigorously, the mixture was centrifuged at 3,000 xg for 15 minutes. The ³ H count of the water-methanol layer was measured with a liquid scintillation counter. One unit of LPL activity is 1 μmol
Of fatty acid was defined as the activity of producing one minute. In addition, 13 mM glycerol tri [9,10 (n)] in the substrate solution
^-3 H] oleic acid was prepared by diluting Amersham's glycerol tri [9,10 (n) ^-3 H] oleic acid (370 GBeq / mmol) with triolein (Sigma), followed by silica gel column chromatography. It was prepared by purification by chromatography.

Example 1 Construction of AGIF expression vector and AG
Expression of IF in COS-1 cells AGIF cDNA was prepared by the method described in the literature (Kawashima, I. et al.
(1991), FEBS Lett. 283 , 199-202) and cloned from the cDNA library of human bone marrow stromal cell line KM-102. From the obtained clone pcD-20-2
Cut out the cDNA insert and insert it into the high expression vector pcDL-S
R α296 (Takebe, Y. et al. (1988) Mol.Cell.Biol. 8 , 46
6-472) and constructed AGIF high expression plasmid pSR α-20-2 (Ohsumi, J. et al. (1991), FEBS Lett. 288 , 13-1.
6).

The introduction of pSR α-20-2 into COS-1 cells was carried out by electroporation using a gene transfer system GTE-1 manufactured by Shimadzu Corporation. That is, first CO
From the flask in which S-1 cells were grown to be semi-confluent, the cells were collected by trypsin-EDTA treatment and washed twice with PBS (-) buffer (manufactured by Nissui Pharmaceutical Co., Ltd.). Then, the cells were diluted with PBS (-) buffer at 1 x 10
Suspended at ⁸ cells / ml. On the other hand, plasmid DNA prepared by the cesium chloride method was added to PBS (-) buffer at 200 μg /
Adjusted to ml. 20 μl of the above cell suspension and DNA solution
Mixed with each other, and this was placed in a chamber with an electrode interval of 2 mm (FCT
-13, (manufactured by Shimadzu Corporation), 600V-50
A pulse of μsec was applied twice at 1 second intervals. Next, the cell-DNA mixture in the chamber was added to DMEM2 containing 10% FBS.
In addition to 0 ml, this was transferred to a petri dish (diameter 150 mm) and incubated at 37 ° C. under 5% CO ₂ overnight. Thereafter, the culture supernatant was removed, the cells and the dish were washed with serum-free DMEM, 20 ml of DMEM was added, and the cells were further cultured for 3 days. The culture supernatant was recovered from the cell culture thus obtained. The fact that AGIF is contained in the culture supernatant means that
AGIFp15 antibody prepared by the method described in the literature (Ohsumi, J. e.
(1991) FEBS Lett. 288 , 13-16) and confirmed by Western blot analysis.

Example 2 Preparation of Novel Polypeptide Having AGIF Activity 0.5 μg of trypsin (manufactured by Sigma) was added to 500 μl of the AGIF-containing COS-1 cell culture supernatant prepared in Example 1, and 37 It was kept at 20 ° C. for 20 minutes. next,
Lima bean trypsin inhibitor (manufactured by Sigma)
0.5 μg was added to inactivate trypsin. The results of Western blot analysis of these solutions are shown in FIG.
Shown in. As shown in FIG. 1, the mature AGIF was subjected to SDS-polyacrylamide gel electrophoresis (SDS-P) under reducing conditions.
AGE) has an apparent molecular weight of about 23,000, and treatment with trypsin produces a polypeptide having a molecular weight of about 22,000. Under the above trypsin treatment conditions, about 60% of the mature AGIF was decomposed into a polypeptide having a molecular weight of about 22,000.
930, manufactured by Shimadzu Corp.).

In general, trypsin is known to exhibit substrate specificity for cleaving the peptide bond on the carboxy side of the arginine residue or lysine residue of the protein. Therefore,
An AGIF mutant was prepared in which the arginine residue at the 9th position from the N-terminal of the AGIF mature body was replaced with another amino acid. AG
The IF mutant was prepared using an in vitro Mutagenesis System (manufactured by Amersham). The AGIF mutant did not undergo degradation under the trypsinized conditions described above. Therefore, it was shown that the above-mentioned polypeptide having a molecular weight of about 22,000 obtained by treating the mature AGIF form with trypsin consists of the amino acid sequence from the 10th valine from the N-terminus of the AGIF mature form.

The culture supernatant obtained by transfecting COS-1 cells with pSRα-20-2 was treated with trypsin under the above conditions, and then trypsin inhibitor was added under the above conditions to inactivate trypsin. As shown in FIG. 1, this solution contains about 60% of a polypeptide having a molecular weight of about 22,000.
Including. Next, the LPL inhibitory activity of this solution was measured (see FIG. 2). The LPL inhibitory activity of this solution is equivalent to that of the culture supernatant untreated with trypsin and has a molecular weight of about 2
2,000 polypeptides had comparable specific activity to mature AGIF. Further, the polypeptide had an action of suppressing the morphological change of 3T3-L1 cells into adipocytes. Further, the polypeptide is a mouse bone marrow preadipocyte cell line H-1 /
A (Nakamura, M. et al. (1985) Proc. Soc. Exp. Biol. Med. 1
79 , 283-287) also had an activity of suppressing the morphological change of adipocytes.

The COS-1 cell culture supernatant containing the mature AGIF was treated with trypsin, and then subjected to a membrane passage fraction using an ultrafiltration membrane (Centricon C-10, manufactured by Amicon) having a cut-off molecular weight of about 10,000. The non-passage fraction was prepared. As a result of examining the LPL inhibitory action of adipocyte-ized 3T3-L1 cells in each solution, the inhibitory activity was detected only in the membrane non-passage fraction. Therefore, it was shown that the AGIF activity is present in the polypeptide having a molecular weight of about 22,000 produced by cleavage with trypsin from the mature form of AGIF, and not in the N-terminal 9-amino acid peptide.

Example 3 Expression of a novel polypeptide having AGIF activity in E. coli M13 mp19 RF1 DNA (manufactured by Toyobo Co., Ltd.) was digested with Bam H1 and dephosphorylated at the ends of the DNA using alkaline phosphatase. It was Meanwhile, pSR α-20-2 was replaced with Bam H1 and Bgl 2
Approximately 7 out of 3 fragments produced by digestion containing AGIF cDNA
A 50 bp fragment was isolated and purified. Next, these both DNA fragments were ligated by a reaction using T4 DNA ligase. This DN
E. coli DH5αF ′ strain was transformed with A to prepare recombinant phage plaques. Twelve clones were arbitrarily selected from the obtained plaques, and single-stranded DNA and double-stranded RF DNA were isolated and purified from each by a conventional method.
Each RF DNA was digested with Sma1, and a clone M13mp19 (20-2) in which a fragment of about 750 bp generated by ligation of AGIF cDNA appeared was selected (see FIG. 3).

Next, single-stranded DN of clone M13 mp19 (20-2)
In A, synthetic oligonucleotide 5'-CCAGATACAGCTGTCAGG
After annealing CCTGGGCCACCACCT-3 ′ (nucleotide sequence of SEQ ID NO: 13), a mutant phage clone M13 mp19 (20-2) μ was obtained using the in vitro mutagenesis system (manufactured by Amersham) (see FIG. 3 :). SEQ ID NOs: 9 and 10). By this operation, a DNA fragment encoding mature AGIF can be prepared with Stu 1 (recognition nucleotide sequence: AGGCCT) from the RFDNA of this mutant clone (see FIG. 4: SEQ ID NOS: 12 and 13)).
The operation of in vitro mutagenesis was performed according to the protocol of Amersham.

Expression vector pMAL-C (manufactured by New England Biolabs) for Escherichia coli was linearized by digesting with Stu1 and Hind3 and double-stranded RF DNA of M13 mp19 (20-2) μ.
AGIF cDNA-containing fragment prepared by digesting Stu1 with Hind3 was ligated with T4 DNA ligase. The pMAL-C used here contains a structural gene (malE) encoding a maltose binding protein (MBP) downstream of the promoter. Escherichia coli TB1 strain was transformed with this DNA to obtain ampicillin-resistant colonies capable of growing on L agar medium containing ampicillin (100 μg / ml). Select 12 clones arbitrarily from the obtained colonies, extract each plasmid,
It was purified and a clone pMAL-c-20-2μ containing AGIF cDNA was obtained by restriction enzyme mapping (see FIG. 5).

Next, two complementary types having a nucleotide sequence encoding the N-terminal proline residue of mature AGIF and having a nucleotide sequence encoding an amino acid sequence recognized by blood coagulation factor Xa. Was synthesized. These were annealed to prepare linker DNA having BamH1 site and Xho1 site at both ends (Fig. 5).
Reference: SEQ ID NOS: 14 and 15). The plasmid pMAL-c-20-2μ obtained by the above method was digested with BamH1 and Xho1, and the DNA on the vector side was ligated to a synthetic DNA linker, and E. coli TB1 strain was transformed with this ligated vector. . A clone containing the desired linker was selected from the obtained ampicillin-resistant colonies, and the plasmid carried by the clone was named pMAL-c-20-2ΔPro (see FIG. 5).

5 TB1 strains harboring pMAL-c-20-2 ΔPro
0 ml of medium E (1% bactotryptone, 0.5% yeast extract, 0.5% NaCl, 0.2% glucose) was inoculated and cultured at 30 ° C. with shaking overnight. Then 10 ml of this culture was inoculated into 1 liter of fresh medium E,
The cells were cultured with shaking at ℃. The absorbance of the culture solution at 600 nm is 0.
When it reached 5, isopropyl β-D-thiogalactopyranoside was added to a final concentration of 0.3 mM, and the culture was further continued overnight at 30 ° C.

After completion of the culture, the cells were collected by centrifugation, and 50 ml of buffer A (10 mM Tris-HCl, 0.2) was collected.
M NaCl, 1 mM sodium azide, 10 mM 2-mercaptoethanol, 1 mM ethylenediaminetetraacetic acid (EDTA), pH
7.4). The suspension was sonicated for 2 minutes to disrupt the cells, and then 9000 × g for 30 minutes.
After centrifugation at 4 ° C, the supernatant was collected. 4 times the obtained supernatant
It was diluted with a double volume of buffer solution A, and this was filtered through a Millex GV filter (manufactured by Millipore) having a pore size of 0.22 μm.
Next, this solution was applied to an amylose resin column having a bed volume of 10 ml, and then the column was washed with about 80 ml of buffer solution A. Subsequently, a buffer A containing 10 mM maltose was run to elute the fusion protein of maltose-binding protein (MBP) and AGIF (AGIF ΔPro) lacking the N-terminal proline from the column, and about 2 ml of the peak fraction was collected. It was

MBP-AGIFΔPro prepared as described above
One unit (1 μg) of blood coagulation factor Xa was added to 20 μl (containing about 90 μg of protein) of the crude purified fraction of the fusion protein, and the cleavage reaction was carried out at room temperature for 2 to 24 hours. 12.
When the reaction product was analyzed by SDS-PAGE under reducing conditions using a 5% gel, the band with a molecular weight of about 62,000, which was presumed to be an MBP-AGIFΔPro fusion protein, decreased with time, while AGIFΔPro. It was observed that a band having an estimated molecular weight of about 23,000 increased with time. Also,
Western blot analysis revealed that this band with a molecular weight of approximately 23,000 reacted with the AGIFp15 antibody.

Next, 800 μl of the above crudely purified fraction (about
40 units (40 μg) of blood coagulation factor Xa was added to 3.6 mg of protein), and the cleavage reaction was carried out at room temperature overnight. The solution after the reaction was concentrated by a trichloroacetic acid (TCA) precipitation treatment and subjected to SDS-PAGE using a 12.5% gel under reducing conditions. After electrophoresis, transfer protein bands from polyacrylamide gel to transfer buffer (0.02% SDS, 20% methanol, 25 mM
Tris-boric acid (pH 9.5)) using a gel membrane transfer device (KS-8441, manufactured by Marisol Co.) at 4 ° C. for 15 hours.
Polyvinylidene difluoride at 0.8 mA / cm ²
It was transferred to a (PVDF) membrane (Millipore, Immobilon). The membrane after transfer was washed by shaking it in a 10 mM sodium borate buffer (pH 8.0) containing 25 mM NaCl for 5 minutes and then in pure water for 5 minutes, and then air-drying. Next, the portion to which the band having a molecular weight of about 23,000 was transferred was cut out from this membrane, and the sequence from the N-terminal to 9 amino acid residues was determined by a gas phase protein sequencer (Applied Biosystems, 475A type). The phenylthiohydantoin (PTH) -amino acid obtained in each reaction cycle was separated and identified by reverse phase HPLC (Applied Biosystems, 120A type). The amino acid sequence thus determined was as follows (Xaa is an unidentified amino acid residue).

Gly-Pro-Pro-Pro-Gly-Pro-Pro-Xaa-Val-
(SEQ ID NO: 11) From these results, it was confirmed that the isolated protein was AGIFΔPro lacking the N-terminal proline of mature AGIF. Next, the biological activity of AGIFΔPro thus prepared was examined. First, MBP-AGIFΔPr produced according to the above method
o The crude purified fraction of fusion protein was cleaved by blood coagulation factor Xa. Next, gel filtration column chromatography from this sample, CM Toyopearl Pack 650M
(Tosoh Corp.) column chromatography etc. were combined and refine | purified and AGIF (DELTA) Pro was isolated. This protein was electrophoresed at a molecular weight of about 23,000 on SDS-PAGE under reducing conditions using a 12.5% gel, and was confirmed to react with AGIF p15 antibody by Western blot analysis. AGIFΔPro purified in this manner exhibited the effect of suppressing the morphological change of 3T3-L1 cells into adipocytes. Moreover, the LPL activity was markedly suppressed in 3T3-L1 cells that had been induced to differentiate into adipocytes. The specific activity of suppressing LPL was almost the same as that of the known mature AGIF (WO 92/08735).

Example 4 Expression of a novel polypeptide having AGIF activity in COS-1 cells The synthetic oligonucleotide PRO-DEL 1,5'-GATACAGCTGTCGCCGGGCCCCCACCTGGC was added to the single-stranded DNA of M13mp19 (20-2).
After annealing 3 '(nucleotide sequence of SEQ ID NO: 16), a mutant phage clone M13mp19 (20-2) ΔPro was prepared using an in vitro mutagenesis system (manufactured by Amersham). Mutant clones were selected by restriction oxygen mapping using the Apa 1 site present in the PRO-DEL1 sequence. Obtained M1
3mp19 (20-2) ΔPro lacks mature N-terminal proline
The inclusion of DNA encoding AGIFΔPro was confirmed by nucleotide sequencing (see FIG. 6: SEQ ID NOS: 18 and 19).

A linear vector in which the mature AGIF expression plasmid pSR α-20-2 for COS-1 cells was digested with Bal 1 and a 190 bp fragment containing the vicinity of the N-terminus of mature AGIF was deleted.
DNA (about 4.5 kb) was prepared. On the other hand, M13mp19 (20-2) ΔP
The double-stranded RF DNA of ro was digested with Bal 1 to prepare a 187 bp fragment containing the vicinity of the N-terminal of AGIFΔPro, and this was ligated with the above vector DNA using T4 DNA ligase. next,
E. coli DH5α strain was transformed with this DNA and ampicillin
Ampicillin resistant colonies capable of growing on L agar medium containing (100 μg / ml) were obtained. Arbitrarily 2 from the obtained colonies
0 clones were selected, and each plasmid was extracted and purified. By digesting each plasmid DNA with Apa 1, the orientation of the integrated 187 bp Bal 1 fragment was changed to pSR α-20-.
A clone was selected that matches the orientation of the AGIF cDNA encoded by 2. As a result, one clone of interest was obtained, and this plasmid was named pSR α- (20-2) ΔPro.

The expression plasmid pSR α- (20-2) ΔPro of AGIFΔPro thus produced was introduced into COS-1 cells to produce AGIFΔPro in the culture medium. The plasmid DNA was introduced into COS-1 cells by the same method as described in Example 1. In this way, pSR α-
(20-2) 1 liter of serum-free culture supernatant of transfected COS-1 cells was prepared with ΔPro. The culture supernatant was mixed with 20 volumes of dialysis buffer (10 mM boric acid-NaOH (pH 9.0), 13 mM KCl).
After dialysis at 4 ° C. for 15 hours, it was applied to a CM Toyopearl Pack 650M column (manufactured by Tosoh Corp.) using FPLC manufactured by Pharmacia and subjected to weak cation conversion chromatography.

Chromatography was performed under the following conditions.

Column: CM Toyopearl Pack 650M (2.2
Eluent: A = 10 mM boric acid-NaOH (pH 9.0), 13 mM KCl B = 10 mM boric acid-NaOH (pH 9.0), 13 mM KCl 300 mM NaCl Flow rate: 3 ml / fraction Volume: 3 ml / tube Concentration gradient: eluent A → eluent B (linear concentration gradient), 50 minutes The fraction containing AGIFΔPro was identified by Western blot analysis using AGIF p15 antibody. That is, AGIF
The peak fraction containing the largest amount of ΔPro and a total of three fractions before and after it were pooled, concentrated by TCA precipitation treatment, and subjected to SDS-PAGE using a 12.5% gel under reducing conditions. After electrophoresis, transfer protein bands from polyacrylamide gel to transfer buffer (0.02%, SDS, 20% methanol, 2%).
PVDF membrane (Applied Biosystems) under the conditions of 4 V, 2.5 hours and 18 V / cm using a gel membrane transfer device (KS-8441 manufactured by Marisol Co., Ltd.) in 5 mM Tris-boric acid (pH 9.5)). Transferred to Pro Blott). After transfer, the membrane was transferred to 10 mM sodium borate buffer containing 25 mM NaCl (pH
It was washed by shaking for 5 minutes at 8.0) followed by 5 minutes in pure water, and then air-dried. Then from this film AGIFΔ
The portion where Pro was transcribed (position of molecular weight about 23,000) was cut out, and the sequence from the N-terminal to 6 amino acid residues was determined by a gas phase protein sequencer (Applied Biosystems, 475A type).

PTH-amino acid obtained in each reaction cycle was analyzed by reversed-phase HPLC (120A manufactured by Applied Biosystems).
Type). The amino acid sequence thus determined was as follows.

Gly-Pro-Pro-Pro-Gly-Pro- (SEQ ID NO: 17) From these results, it was confirmed that the isolated protein was AGIFΔPro lacking the N-terminal proline of mature AGIF.

Further, from the serum-free culture supernatant of COS-1 cells transfected with pSR α- (20-2) ΔPro, reference (O
AGIFΔPro was purified according to the purification method of mature AGIF described in hsumi, J. et al, (1991) FEBS Lett, 288 , 13-16). AGIFΔPro purified in this manner exhibited the effect of suppressing the morphological change of 3T3-L1 cells into adipocytes. Furthermore, the LPL activity was markedly suppressed in 3T3-L1 cells that were induced to differentiate into adipocytes. The specific activity of suppressing LPL was almost the same as that of the known mature AGIF (WO 92/08735).

Example 5 Thrombocytosis of Adipocyte Depression Factor Derivatives AGIFΔPro prepared as described above was added to a medium (PBS (-) buffer containing 0.1% bovine serum albumin (manufactured by Sigma)). After lysing, this was used to examine the thrombocytosis effect of AGIFΔPro. Seven-week-old male SD rats (Japan SLC, Inc.) were purchased and preliminarily reared for 1 week, and then two groups of 5 animals were randomly created. Each group was defined as an AGIFΔPro administration group and a control administration group. The administration was performed once a day for 5 consecutive days. During the administration period, body weight was measured daily before administration. The AGIFΔPro-administered group was subcutaneously injected with 100 μg of AGIFΔPro / kg body weight each time. The AGIFΔPro solution was used by adjusting the concentration of the AGIFΔPro solution according to the body weight of each rat so that the administration volume was 1 ml for any rat. The control group was injected subcutaneously with 1 ml of vehicle.

The blood sampling and the platelet count were measured as follows. Twenty-four hours after the final administration, 4.5 ml of blood was collected from the heart under ether anesthesia with a syringe containing 0.5 ml of 3.8% trisodium citrate dihydrate solution. Coulter counter (Model T5 / 40, manufactured by Coulter) for platelet count, white blood cell count, and red blood cell count immediately after blood collection
Was measured using.

As a result, the number of platelets in the control group was 89.
3,000 ± 23,700 / mm ³ (mean ± standard error), whereas the platelet count in the AGIFΔPro-treated group was 1,123,000 ± 66,500.
/ mm ³ (mean ± standard error) and a high value were shown. Dunnet this
Multiple test of t (Dunnett, CW et al. (1964) Biometric
s, September, 482-489), the number of platelets in the AGIFΔPro-administered group and the control group was assayed, and it was determined that the AGIFΔPro-administered group was significantly higher at a 5% risk rate.
No significant difference was observed between the two groups in white blood cell count and red blood cell count. Both groups showed similar weight gain during the administration period.

AGIFΔPro showed thrombocytosis even in normal mice. In addition, AGIFΔPro was 200 times higher in thrombocytopenic rats treated with the anticancer drug carboplatin.
Administration of μg / kg for 10 consecutive days promoted recovery of platelet count. In addition, the AGIF derivative lacking the N-terminal 9 amino acids of mature AGIF prepared as in Example 1 also showed a platelet increasing action in the same experimental system.

[0080]

INDUSTRIAL APPLICABILITY The novel polypeptide of the present invention has aplastic anemia, leukocytes and thrombocytopenia caused by toxic substances and radiation, infections caused by viruses, bacteria, parasites, cytopenias after bone marrow transplantation, and refractory disease. It is used alone or in combination with other therapeutic agents in the treatment of diseases such as pancytopenia and various immune diseases that accompany it.
Further, the polypeptide is used alone or in combination with other therapeutic agents in the prevention or treatment of morbid obesity.

[0081]

[Sequence list]

[0082]

[SEQ ID NO: 1] Sequence length: 1065 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Hypothetical sequence: NO Antisense: NO Sequence characteristics Features Symbol: CDS Location: 18..614 Method for determining features: E Feature symbol: mat_peptide Location: 81..614 Feature symbol: sig_peptide Location: 18..80 Sequence CCTGGCCCTG TGGGGAC ATG AAC TGT GTT TGC CGC CTG GTC CTG GTC GTG 50 Met Asn Cys Val Cys Arg Leu Val Leu Val Val -21 -20 -15 CTG AGC CTG TGG CCA GAT ACA GCT GTC GCC CCT GGG CCA CCA CCT GGC 98 Leu Ser Leu Trp Pro Asp Thr Ala Val Ala Pro Gly Pro Pro Pro Gly -10 -5 1 5 CCC CCT CGA GTT TCC CCA GAC CCT CGG GCC GAG CTG GAC AGC ACC GTG 146 Pro Pro Arg Val Ser Pro Asp Pro Arg Ala Glu Leu Asp Ser Thr Val 10 15 20 CTC CTG ACC CGC TCT CTC CTG GCG GAC ACG CGG CAG CTG GCT GCA CAG 194 Leu Leu Thr Arg Ser Leu Leu Ala Asp Thr Arg Gln Leu Ala Ala Gln 25 30 35 CTG A GG GAC AAA TTC CCA GCT GAC GGG GAC CAC AAC CTG GAT TCC CTG 242 Leu Arg Asp Lys Phe Pro Ala Asp Gly Asp His Asn Leu Asp Ser Leu 40 45 50 CCC ACC CTG GCC ATG AGT GCG GGG GCA CTG GGA GCT CTA CAG CTC CCA 290 Pro Thr Leu Ala Met Ser Ala Gly Ala Leu Gly Ala Leu Gln Leu Pro 55 60 65 70 GGT GTG CTG ACA AGG CTG CGA GCG GAC CTA CTG TCC TAC CTG CGG CAC 338 Gly Val Leu Thr Arg Leu Arg Ala Asp Leu Leu Ser Tyr Leu Arg His 75 80 85 GTG CAG TGG CTG CGC CGG GCA GGT GGC TCT TCC CTG AAG ACC CTG GAG 386 Val Gln Trp Leu Arg Arg Ala Gly Gly Ser Ser Leu Lys Thr Leu Glu 90 95 100 CCC GAG CTG GGC ACC CTG CAG GCC CGA CTG GAC CGG CTG CTG CGC CGG 434 Pro Glu Leu Gly Thr Leu Gln Ala Arg Leu Asp Arg Leu Leu Arg Arg 105 110 115 CTG CAG CTC CTG ATG TCC CGC CTG GCC CTG CCC CAG CCA CCC CCG GAC 482 Leu Gln Leu Leu Met Ser Arg Leu Ala Leu Pro Gln Pro Pro Pro Asp 120 125 130 CCG CCG GCG CCC CCG CTG GCG CCC CCC TCC TCA GCC TGG GGG GGC ATC 530 Pro Pro Ala Pro Leu Ala Pro Pro Ser Ser Ala Trp Gly Gly Ile 135 140 145 150 A GG GCC GCC CAC GCC ATC CTG GGG GGG CTG CAC CTG ACA CTT GAC TGG 578 Arg Ala Ala His Ala Ile Leu Gly Gly Leu His Leu Thr Leu Asp Trp 155 160 165 GCC GTG AGG GGA CTG CTG CTG CTG AAG ACT CGG CTG TGACCCGG ala Val Arg Gly Leu Leu Leu Leu Lys Thr Arg Leu 170 175 CCCAAAGCCA CCACCGTCCT TCCAAAGCCA GATCTTATTT ATTTATTTAT TTCAGTACTG 684 GGGGCGAAAC AGCCAGGTGA TCCCCCCGCC ATTATCTCCC CCTAGTTAGA GACAGTCCTT 744 CCGTGAGGCC TGGGGGACAT CTGTGCCTTA TTTATACTTA TTTATTTCAG GAGCAGGGGT 804 GGGAGGCAGG TGGACTCCTG GGTCCCCGAG GAGGAGGGGA CTGGGGTCCC GGATTCTTGG 864 GTCTCCAAGA AGTCTGTCCA CAGACTTCTG CCCTGGCTCT TCCCCATCTA GGCCTGGGCA 924 GGAACATATA TTATTTATTT AAGCAATTAC TTTTCATGTT GGGGTGGGGA CGGAGGGGAA 984 AGGGAAGCCT GGGTTTTTGT ACAAAAATGT GAGAAACCTT TGTGAGACAG AGAACAGGGA 1044 ATTAAATGTG TCATACATAT C 1065

[0083]

[SEQ ID NO: 2] Sequence length: 199 Sequence type: Amino acid Topology: Linear Sequence type: Protein sequence Met Asn Cys Val Cys Arg Leu Val Leu Val Val Leu Ser Leu Trp Pro -21 -20 -15 -10 Asp Thr Ala Val Ala Pro Gly Pro Pro Pro Gly Pro Pro Arg Val Ser -5 1 5 10 Pro Asp Pro Arg Ala Glu Leu Asp Ser Thr Val Leu Leu Thr Arg Ser 15 20 25 Leu Leu Ala Asp Thr Arg Gln Leu Ala Ala Gln Leu Arg Asp Lys Phe 30 35 40 Pro Ala Asp Gly Asp His Asn Leu Asp Ser Leu Pro Thr Leu Ala Met 45 50 55 Ser Ala Gly Ala Leu Gly Ala Leu Gln Leu Pro Gly Val Leu Thr Arg 60 65 70 75 Leu Arg Ala Asp Leu Leu Ser Tyr Leu Arg His Val Gln Trp Leu Arg 80 85 90 Arg Ala Gly Gly Ser Ser Leu Lys Thr Leu Glu Pro Glu Leu Gly Thr 95 100 105 Leu Gln Ala Arg Leu Asp Arg Leu Leu Arg Arg Leu Gln Leu Leu Met 110 115 120 Ser Arg Leu Ala Leu Pro Gln Pro Pro Pro Asp Pro Pro Ala Pro Pro 125 130 135 Leu Ala Pro Pro Ser Ser Ala Trp Gly Gly Ile Arg Ala Ala His Ala 140 145 150 155 Ile Leu Gly Gly Leu His Le u Thr Leu Asp Trp Ala Val Arg Gly Leu 160 165 170 Leu Leu Leu Lys Thr Arg Leu 175

[0084]

[SEQ ID NO: 3] Sequence length: 534 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Hypothetical sequence: N Antisense: N Sequence features: Characteristic symbol: CDS Location: 1..534 Sequence CCT GGG CCA CCA CCT GGC CCC CCT CGA GTT TCC CCA GAC CCT CGG GCC 48 Pro Gly Pro Pro Pro Gly Pro Pro Arg Val Ser Pro Asp Pro Arg Ala 1 5 10 15 GAG CTG GAC AGC ACC GTG CTC CTG ACC CGC TCT CTC CTG GCG GAC ACG 96 Glu Leu Asp Ser Thr Val Leu Leu Thr Arg Ser Leu Leu Ala Asp Thr 20 25 30 CGG CAG CTG GCT GCA CAG CTG AGG GAC AAA TTC CCA GCT GAC GGG GAC 144 Arg Gln Leu Ala Ala Gln Leu Arg Asp Lys Phe Pro Ala Asp Gly Asp 35 40 45 CAC AAC CTG GAT TCC CTG CCC ACC CTG GCC ATG AGT GCG GGG GCA CTG 192 His Asn Leu Asp Ser Leu Pro Thr Leu Ala Met Ser Ala Gly Ala Leu 50 55 60 GGA GCT CTA CAG CTC CCA GGT GTG CTG ACA AGG CTG CGA GCG GAC CTA 240 Gly Ala Leu Gln Leu Pro Gly Val Leu Thr Arg Leu Arg Ala Asp Leu 65 70 75 80 C TG TCC TAC CTG CGG CAC GTG CAG TGG CTG CGC CGG GCA GGT GGC TCT 288 Leu Ser Tyr Leu Arg His Val Gln Trp Leu Arg Arg Ala Gly Gly Ser 85 90 95 TCC CTG AAG ACC CTG GAG CCC GAG CTG GGC ACC CTG CAG GCC CGA CTG 336 Ser Leu Lys Thr Leu Glu Pro Glu Leu Gly Thr Leu Gln Ala Arg Leu 100 105 110 GAC CGG CTG CTG CGC CGG CTG CAG CTC CTG ATG TCC CGC CTG GCC CTG 384 Asp Arg Leu Leu Arg Arg Leu Gln Leu Leu Met Ser Arg Leu Ala Leu 115 120 125 CCC CAG CCA CCC CCG GAC CCG CCG GCG CCC CCG CTG GCG CCC CCC TCC 432 Pro Gln Pro Pro Pro Asp Pro Pro Ala Pro Pro Leu Ala Pro Pro Ser 130 135 140 TCA GCC TGG GGG GGC ATC AGG GCC GCC CAC GCC ATC CTG GGG GGG CTG 480 Ser Ala Trp Gly Gly Ile Arg Ala Ala His Ala Ile Leu Gly Gly Leu 145 150 155 160 CAC CTG ACA CTT GAC TGG GCC GTG AGG GGA CTG CTG CTG CTG AAG ACT 528 His Leu Thr Leu Asp Trp Ala Val Arg Gly Leu Leu Leu Leu Lys Thr 165 170 175 CGG CTG 534 Arg Leu

[0085]

[SEQ ID NO: 4] Sequence length: 178 Sequence type: Amino acid Topology: Linear Sequence type: Protein sequence Pro Gly Pro Pro Pro Gly Pro Pro Arg Val Ser Pro Asp Pro Arg Ala 1 5 10 15 Glu Leu Asp Ser Thr Val Leu Leu Thr Arg Ser Leu Leu Ala Asp Thr 20 25 30 Arg Gln Leu Ala Ala Gln Leu Arg Asp Lys Phe Pro Ala Asp Gly Asp 35 40 45 His Asn Leu Asp Ser Leu Pro Thr Leu Ala Met Ser Ala Gly Ala Leu 50 55 60 Gly Ala Leu Gln Leu Pro Gly Val Leu Thr Arg Leu Arg Ala Asp Leu 65 70 75 80 Leu Ser Tyr Leu Arg His Val Gln Trp Leu Arg Arg Ala Gly Gly Ser 85 90 95 Ser Leu Lys Thr Leu Glu Pro Glu Leu Gly Thr Leu Gln Ala Arg Leu 100 105 110 Asp Arg Leu Leu Arg Arg Leu Gln Leu Leu Met Ser Arg Leu Ala Leu 115 120 125 Pro Gln Pro Pro Pro Asp Pro Pro Ala Pro Pro Leu Ala Pro Pro Ser 130 135 140 Ser Ala Trp Gly Gly Ile Arg Ala Ala His Ala Ile Leu Gly Gly Leu 145 150 155 160 His Leu Thr Leu Asp Trp Ala Val Arg Gly Leu Leu Leu Leu Lys Thr 165 170 175 Arg Leu

[0086]

[SEQ ID NO: 5] Sequence length: 531 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Hypothetical sequence: N Antisense: N Sequence features: Characteristic symbol: CDS Location: 1..531 Sequence GGG CCA CCA CCT GGC CCC CCT CGA GTT TCC CCA GAC CCT CGG GCC GAG 48 Gly Pro Pro Pro Gly Pro Pro Arg Val Ser Pro Asp Pro Arg Ala Glu 1 5 10 15 CTG GAC AGC ACC GTG CTC CTG ACC CGC TCT CTC CTG GCG GAC ACG CGG 96 Leu Asp Ser Thr Val Leu Leu Thr Arg Ser Leu Leu Ala Asp Thr Arg 20 25 30 CAG CTG GCT GCA CAG CTG AGG GAC AAA TTC CCA GCT GAC GGG GAC CAC 144 Gln Leu Ala Ala Gln Leu Arg Asp Lys Phe Pro Ala Asp Gly Asp His 35 40 45 AAC CTG GAT TCC CTG CCC ACC CTG GCC ATG AGT GCG GGG GCA CTG GGA 192 Asn Leu Asp Ser Leu Pro Thr Leu Ala Met Ser Ala Gly Ala Leu Gly 50 55 60 GCT CTA CAG CTC CCA GGT GTG CTG ACA AGG CTG CGA GCG GAC CTA CTG 240 Ala Leu Gln Leu Pro Gly Val Leu Thr Arg Leu Arg Ala Asp Leu Leu 65 70 75 8 0 TCC TAC CTG CGG CAC GTG CAG TGG CTG CGC CGG GCA GGT GGC TCT TCC 288 Ser Tyr Leu Arg His Val Gln Trp Leu Arg Arg Ala Gly Gly Ser Ser 85 90 95 CTG AAG ACC CTG GAG CCC GAG CTG GGC ACC CTG CAG GCC CGA CTG GAC 336 Leu Lys Thr Leu Glu Pro Glu Leu Gly Thr Leu Gln Ala Arg Leu Asp 100 105 110 CGG CTG CTG CGC CGG CTG CAG CTC CTG ATG TCC CGC CTG GCC CTG CCC 384 Arg Leu Leu Arg Arg Leu Gln Leu Leu Met Ser Arg Leu Ala Leu Pro 115 120 125 CAG CCA CCC CCG GAC CCG CCG GCG CCC CCG CTG GCG CCC CCC TCC TCA 432 Gln Pro Pro Pro Asp Pro Pro Ala Pro Pro Leu Ala Pro Pro Ser Ser 130 135 140 GCC TGG GGG GGC ATC AGG GCC GCC CAC GCC ATC CTG GGG GGG CTG CAC 480 Ala Trp Gly Gly Ile Arg Ala Ala His Ala Ile Leu Gly Gly Leu His 145 150 155 160 CTG ACA CTT GAC TGG GCC GTG AGG GGA CTG CTG CTG CTG AAG ACT CGG 528 Leu Thr Leu Asp Trp Ala Val Arg Gly Leu Leu Leu Leu Lys Thr Arg 165 170 175 CTG 531 Leu

[0087]

[SEQ ID NO: 6] Sequence length: 177 Sequence type: Amino acid Topology: Linear Sequence type: Protein sequence Gly Pro Pro Pro Gly Pro Pro Arg Val Ser Pro Asp Pro Arg Ala Glu 1 5 10 15 Leu Asp Ser Thr Val Leu Leu Thr Arg Ser Leu Leu Ala Asp Thr Arg 20 25 30 Gln Leu Ala Ala Gln Leu Arg Asp Lys Phe Pro Ala Asp Gly Asp His 35 40 45 Asn Leu Asp Ser Leu Pro Thr Leu Ala Met Ser Ala Gly Ala Leu Gly 50 55 60 Ala Leu Gln Leu Pro Gly Val Leu Thr Arg Leu Arg Ala Asp Leu Leu 65 70 75 80 Ser Tyr Leu Arg His Val Gln Trp Leu Arg Arg Ala Gly Gly Ser Ser 85 90 95 Leu Lys Thr Leu Glu Pro Glu Leu Gly Thr Leu Gln Ala Arg Leu Asp 100 105 110 Arg Leu Leu Arg Arg Leu Gln Leu Leu Met Ser Arg Leu Ala Leu Pro 115 120 125 Gln Pro Pro Pro Asp Pro Pro Ala Pro Pro Leu Ala Pro Pro Ser Ser 130 135 140 Ala Trp Gly Gly Ile Arg Ala Ala His Ala Ile Leu Gly Gly Leu His 145 150 155 160 Leu Thr Leu Asp Trp Ala Val Arg Gly Leu Leu Leu Leu Lys Thr Arg 165 170 175 Leu

[0088]

[SEQ ID NO: 7] Sequence length: 507 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA to mRNA Hypothetical sequence: N Antisense: N Sequence features: Characteristic symbol: CDS Location: 1..507 Sequence GTT TCC CCA GAC CCT CGG GCC GAG CTG GAC AGC ACC GTG CTC CTG ACC 48 Val Ser Pro Asp Pro Arg Ala Glu Leu Asp Ser Thr Val Leu Leu Thr 1 5 10 15 CGC TCT CTC CTG GCG GAC ACG CGG CAG CTG GCT GCA CAG CTG AGG GAC 96 Arg Ser Leu Leu Ala Asp Thr Arg Gln Leu Ala Ala Gln Leu Arg Asp 20 25 30 AAA TTC CCA GCT GAC GGG GAC CAC AAC CTG GAT TCC CTG CCC ACC CTG 144 Lys Phe Pro Ala Asp Gly Asp His Asn Leu Asp Ser Leu Pro Thr Leu 35 40 45 GCC ATG AGT GCG GGG GCA CTG GGA GCT CTA CAG CTC CCA GGT GTG CTG 192 Ala Met Ser Ala Gly Ala Leu Gly Ala Leu Gln Leu Pro Gly Val Leu 50 55 60 ACA AGG CTG CGA GCG GAC CTA CTG TCC TAC CTG CGG CAC GTG CAG TGG 240 Thr Arg Leu Arg Ala Asp Leu Leu Ser Tyr Leu Arg His Val Gln Trp 65 70 75 80 CTG CGC CGG GCA GGT GGC TCT TCC CTG AAG ACC CTG GAG CCC GAG CTG 288 Leu Arg Arg Ala Gly Gly Ser Ser Leu Lys Thr Leu Glu Pro Glu Leu 85 90 95 GGC ACC CTG CAG GCC CGA CTG GAC CGG CTG CTG CGC CGG CTG CAG CTC 336 Gly Thr Leu Gln Ala Arg Leu Asp Arg Leu Leu Arg Arg Leu Gln Leu 100 105 110 CTG ATG TCC CGC CTG GCC CTG CCC CAG CCA CCC CCG GAC CCG CCG GCG 384 Leu Met Ser Arg Leu Ala Leu Pro Gln Pro Pro Pro Asp Pro Pro Ala 115 120 125 CCC CCG CTG GCG CCC CCC TCC TCA GCC TGG GGG GGC ATC AGG GCC GCC 432 Pro Pro Leu Ala Pro Pro Ser Ser Ala Trp Gly Gly Ile Arg Ala Ala 130 135 140 CAC GCC ATC CTG GGG GGG CTG CAC CTG ACA CTT GAC TGG GCC GTG AGG 480 His Ala Ile Leu Gly Gly Leu His Leu Thr Leu Asp Trp Ala Val Arg 145 150 155 160 GGA CTG CTG CTG CTG AAG ACT CGG CTG 507 Gly Leu Leu Leu Leu Lys Thr Arg Leu 165

[0089]

[SEQ ID NO: 8] Sequence length: 169 Sequence type: Amino acid Topology: Linear Sequence type: Protein sequence Val Ser Pro Asp Pro Arg Ala Glu Leu Asp Ser Thr Val Leu Leu Thr 1 5 10 15 Arg Ser Leu Leu Ala Asp Thr Arg Gln Leu Ala Ala Gln Leu Arg Asp 20 25 30 Lys Phe Pro Ala Asp Gly Asp His Asn Leu Asp Ser Leu Pro Thr Leu 35 40 45 Ala Met Ser Ala Gly Ala Leu Gly Ala Leu Gln Leu Pro Gly Val Leu 50 55 60 Thr Arg Leu Arg Ala Asp Leu Leu Ser Tyr Leu Arg His Val Gln Trp 65 70 75 80 Leu Arg Arg Ala Gly Gly Ser Ser Leu Lys Thr Leu Glu Pro Glu Leu 85 90 95 Gly Thr Leu Gln Ala Arg Leu Asp Arg Leu Leu Arg Arg Leu Gln Leu 100 105 110 Leu Met Ser Arg Leu Ala Leu Pro Gln Pro Pro Pro Asp Pro Pro Ala 115 120 125 Pro Pro Leu Ala Pro Pro Ser Ser Ala Trp Gly Gly Ile Arg Ala Ala 130 135 140 His Ala Ile Leu Gly Gly Leu His Leu Thr Leu Asp Trp Ala Val Arg 145 150 155 160 Gly Leu Leu Leu Leu Lys Thr Arg Leu 165

[0090]

[SEQ ID NO: 9] Sequence length: 33 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA Hypothetical sequence: N Antisense: N Sequence features: Features Symbol: CDS Location: 1..33 Sequence CCA GAT ACA GCT GTC AGG CCT GGG CCA CCA CCT 33 Pro Asp Thr Ala Val Arg Pro Gly Pro Pro Pro 1 5 10

[0091]

[SEQ ID NO: 10] Sequence length: 11 Sequence type: Amino acid Topology: Linear Sequence type: Protein

[0092]

[SEQ ID NO: 11] Sequence length: 9 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Hypothetical sequence: N Antisense: N Fragment type: N-terminal fragment sequence Gly Pro Pro Pro Gly Pro Pro Xaa Val 1 5

[0093]

[SEQ ID NO: 12] Sequence length: 33 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA Hypothetical sequence: N Antisense: N sequence CCAGATACAG CTGTCGCCCC TGGGCCACCA CCT 33

[0094]

[SEQ ID NO: 13] Sequence length: 33 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA Hypothetical sequence: N Antisense: N sequence CCAGATACAG CTGTCAGGCC TGGGCCACCA CCT 33

[0095]

[SEQ ID NO: 14] Sequence length: 37 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA Hypothetical sequence: N Antisense: N sequence GATCCATCGA GGGTAGGGGG CCCCCACCTG GCCCCCC 37

[0096]

[SEQ ID NO: 15] Sequence length: 37 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA Hypothetical sequence: N Antisense: Y sequence TCGAGGGGGG CCAGGTGGGG GCCCCCTACC CTCGATG 37

[0097]

[SEQ ID NO: 16] Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA Hypothetical sequence: N Antisense: Y sequence GATACAGCTG TCGACCGGCGCCCCCCCTGGC
Thirty

[0098]

[SEQ ID NO: 17] Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA Hypothetical sequence: N Antisense: Y sequence Gly Pro Pro Pro Gly Pro 1 5

[0099]

[SEQ ID NO: 18] Sequence length: 33 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA Hypothetical sequence: N Antisense: Y sequence GATACAGCTG TCGCCCCTGG GCCACCACCT GGC 33

[0100]

[SEQ ID NO: 19] Sequence length: 30 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA Hypothetical sequence: N Antisense: N sequence GATACAGCTG TCGCCGGGCC CCCACCTGGC 30

[Brief description of drawings]

FIG. 1 is an image of limited digestion (western blot) of mature AGIF with trypsin.

[Explanation of symbols]

Lane 1 represents untreated COS-1 cell culture supernatant. Lane 2 represents trypsinized COS-1 cell culture supernatant. Lane 3 represents COS-1 cell culture supernatant, which had been quenched with trypsin inhibitor after trypsin treatment. The size of the molecular weight marker is shown at the right end.

FIG. 2. Biological activity of trypsinized COS-1 cell culture supernatant.

[Explanation of sign]

[Outer 1]

FIG. 3 is a production diagram of M13mp19 (20-2) μDNA containing AGIF cDNA.

FIG. 4 shows the nucleotide sequence near the Stu1 site of M13mp19 (20-2) μ.

FIG. 5: AGIFΔPro expression plasmid pMAL-c-20-2ΔPr
o Figure.

FIG. 6 is a comparison diagram of DNA sequences contained in M13mp19 (20-2) and M13mp19 (20-2) ΔPro.

Continuation of front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display location C12N 1/19 7236-4B 1/21 7236-4B 5/10 C12P 21/02 C 8214-4B // (C12N 1/19 C12R 1: 865) (C12N 1/21 C12R 1:19) (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1:19) (C12P 21/02 C12R 1: 865) (C12P 21/02 C12R 1:91) (72) Inventor Hiro Takiguchi 1-25-2 Hiromachi, Shinagawa-ku, Tokyo Sankyo stock company (72) Inventor Yasuhiro Ito 1-2-2 Hiromachi, Shinagawa-ku, Tokyo Sankyo Stock Company

Claims (11)

[Claims] 1. A method comprising the steps of 3 to 3 in SEQ ID NO: 2 in the sequence listing, which is obtained by genetic engineering and does not substantially contain other proteins of human origin.
All amino acid sequences up to 9 or 1 from the N-terminus of the sequence
Polypeptide having AGIF activity, comprising one or two or more amino acids deleted, and an amino acid sequence of C-terminal side from 10 to 178, or one or two of the polypeptides A synonymous compound of the polypeptide, wherein one or more amino acid residues are deleted, inserted or substituted at one or more sites. 2. The method of SEQ ID NO: 3 to 3 of the Sequence Listing, which is obtained by genetic engineering and does not substantially contain other proteins of human origin.
All amino acid sequences up to 9 or 1 from the N-terminus of the sequence
A polypeptide having AGIF activity, comprising an amino acid sequence in which one or two or more amino acids are deleted, and an amino acid sequence of C-terminal side from 10 to 178. 3. The polypeptide according to claim 1 or 2, which has Met at the N-terminus. 4. A DNA encoding the polypeptide according to claim 1, claim 2 or claim 3. 5. A DNA comprising the DNA according to claim 4, wherein said DNA
A recombinant DNA expression vector that is expressible and replicable. 6. A host transformed with the recombinant expression vector according to claim 5. 7. A DNA encoding the polypeptide according to claim 1, claim 2 or claim 3, which comprises:
A method for producing a polypeptide comprising culturing a host which is expressible and replicable and which has been transformed with a recombinant DNA expression vector, and recovering the polypeptide from the cell extract or the culture. [8] A protein obtained by genetic engineering, containing substantially no other human-derived protein, and having 2 to 2 of SEQ ID NO: 2 in the sequence listing.
All amino acid sequences up to 9 or 1 from the N-terminus of the sequence
Polypeptide having AGIF activity, comprising one or two or more amino acids deleted, and an amino acid sequence of C-terminal side from 10 to 178, or one or two of the polypeptides A cytopenia-improving agent comprising, as an active ingredient, the same compound having one or more amino acid residues deleted, inserted or substituted at one or more sites. [9] A protein obtained by genetic engineering, containing substantially no other human-derived protein, and having 2 to 2 of SEQ ID NO: 2 in the sequence listing.
All amino acid sequences up to 9 or 1 from the N-terminus of the sequence
A cytopenia-improving agent comprising a polypeptide having AGIF activity as an active ingredient, which comprises an amino acid sequence in which one or two or more amino acids are deleted, and an amino acid sequence from the C-terminal side to 10 to 178. [10] SEQ ID NO: 2 of Sequence Listing, which is obtained by genetic engineering and does not substantially contain other proteins of human origin.
AGIF comprising all of the amino acid sequences up to 9 or an amino acid sequence lacking one or more amino acids from the N-terminal of the sequence, and the amino acid sequence up to C-terminal 10 to 178 A polypeptide having an activity, or an equivalent drug of the polypeptide in which one or more amino acid residues are deleted, inserted or substituted in one or more sites of the polypeptide, An antiobesity agent as an active ingredient. [11] A SEQ ID NO: 2 of SEQ ID NO: 2 obtained by genetic engineering and containing substantially no other human-derived protein
AGIF comprising all of the amino acid sequences up to 9 or an amino acid sequence lacking one or more amino acids from the N-terminal of the sequence, and the amino acid sequence up to C-terminal 10 to 178 An antiobesity agent comprising a polypeptide having activity as an active ingredient.