JPH06253860A - Shuttle vector - Google Patents

Abstract

PURPOSE:To obtain a shuttle vector replicable with Escherichia coli and Lactococcus.lactis. CONSTITUTION:This shuttle vector has a replicator region derived from a cryptic plasmid of Lactococcus.lactis NCD0763 strain, a replicator region derived from a plasmid pUC19 of Escherichia coli, a medicine-resistant gene region functioning with Gram-positive bacteria and the Escherichia coli and a multiple restriction enzyme cognition sequence (MCS).

Description

Detailed Description of the Invention

[0001]

The present invention relates to a shuttle vector which can function in Lactococcus lactis (hereinafter referred to as "L. lactis") and Escherichia coli (hereinafter simply referred to as "Escherichia coli"). It is about. More specifically, it discloses pLE51 and pLE22 as shuttle vectors.

[0002]

2. Description of the Related Art At present, the most researched and developed DNA cloning system is gram-negative bacterium Escherichia coli and its vector system (so-called EK system). In this system,
Genes derived from Gram-negative bacteria similar to host cells can be expressed.

On the other hand, with respect to the system of Gram-positive bacteria, more problems remain to be solved, and much attention is paid today. Bacillus subtilis, especially among Gram-positive bacteria
(Bacillus subtilis) and lactic acid bacteria (for example, Lactobacillus casei) are useful microorganisms with various practical advantages, but their biological properties are completely different from those of Escherichia coli. In recent years, the development of gene cloning systems has become of great concern.

[0004] Generally, in in vitro gene manipulation, in order to transfer a desired foreign gene into a host cell and express its genetic information, it is necessary to use a vector compatible with the host cell. Has been requested.

By the way, the essential condition as a vector is
It is known that the gene sequence required for self-replication and the presence of a recognition cleavage site for a restriction enzyme for inserting a foreign gene exist, but for further practical use, for example, it is possible to allow genetic manipulation. In order to make it easier, the presence of a marker gene required for detection of transformants, the variety of available restriction enzymes and their recognition cleavage sites, high efficiency of trait expression, compatibility with host cells Sex and host range,
Strict properties that satisfy all of various conditions such as stability in host cells and adaptability to virtual containment of living organisms are required.

[0006] As described above, a vector for gene manipulation having the above characteristics has been most developed in the host-vector system of Escherichia coli, which has been extensively studied as described above. Research and development of host-vector systems are being actively carried out for Bacillus subtilis which is a useful microorganism, actinomycete which is an antibiotic-producing bacterium, and yeast which is widely used in the brewing field.

However, although research and development of a host-vector system for lactic acid bacteria used in the production of dairy products is still delayed, a host using Lactoccus lactis, which is one of the lactic acid bacteria for cheese, as a host. − Recently, the development of vector systems has begun (FEMS Microbiol. Rev. 46: 281-295, 1987).

[0008] The host-vector system using Lactobacillus casei Lactobacillus casei, which is used for the production of lactic acid bacterium beverages for dairy products, was delayed in the development of the transformation method and finally succeeded by electroporation in 1987. (FEMS Microbio
l.Lett.44: 173-177, 1987), and vector construction work has become possible.

We have been conducting gene analysis of Lactococcus lactis for a long time, but the ability to transform into Lactococcus and its ability to extract DNA from Lactococcus in a simple and large amount are not possible. Due to such drawbacks, genetic manipulation is often performed using E. coli as a host.

Therefore, the development of a shuttle vector which can be replicated in both lactococcus and Escherichia coli and is easy to handle in both hosts has been awaited.

[0011] To date, pGKV11 (Table 6-62) has been used as a vector that works in both lactococcus and E. coli.
However, this plasmid retains only the replication initiation region derived from Lactococcus. This replication initiation region also works in E. coli and functions as a shuttle vector.

[0012]

However, inefficiency in transformation into Escherichia coli, time required for colony formation, and stability of plasmid in E. coli are not so good. Taking this into consideration, this plasmid cannot be said to be sufficient as a shuttle vector.

[0013] pGKV11, which is currently used as a vector for expressing or analyzing a lactic acid bacterium gene using L. lactis as a host, is a shuttle vector capable of replicating in Escherichia coli, Bacillus subtilis, and lactic acid bacterium. There are drawbacks such as poor operability due to difficulty in transformation and low copy number with lactic acid bacteria.

Therefore, the present invention aims to overcome these drawbacks and to clone a replication origin region functioning in L. lactis to obtain a new shuttle vector for the purpose of creating a highly original vector. .

[0015]

[Means for Solving the Problems] In the shuttle vector according to the present invention, a replication origin region derived from a cryptic plasmid of L. lactis NCDO763 strain, a replication origin region derived from Escherichia coli plasmid pUC19, and a Gram-positive bacterium. It has a drug resistance gene region that functions in E. coli and a multiple restriction enzyme recognition sequence (MCS).

The shuttle vector pLE51 according to the second aspect of the present invention contains 5 Md of L. lactis NCDO763 strain.
A replication initiation region derived from a cryptic plasmid, a replication initiation region derived from Escherichia coli plasmid pUC19, a drug resistance gene region functioning in Gram-positive bacteria and Escherichia coli, and a multiple restriction enzyme recognition sequence (MCS), which will be described later. 5
It is represented by the restriction enzyme digestion map.

Furthermore, in the shuttle vector pLE22 according to the present invention 3, 2Md of L. lactis NCDO763 strain is used.
A replication initiation region derived from a cryptic plasmid, a replication initiation region derived from Escherichia coli plasmid pUC19, a drug resistance gene region functioning in Gram-positive bacteria and Escherichia coli, and a multiple restriction enzyme recognition sequence (MCS), which will be described later. 8
It is represented by the restriction enzyme digestion map.

[0018]

In the present invention, L. lactis NCDO763
A replication origin region derived from the cryptic plasmid of the strain,
A replication origin region derived from E. coli plasmid pUC19,
Since it has a drug resistance gene region that functions in Gram-positive bacteria and E. coli and a multiple restriction enzyme recognition sequence (MCS), it can be used as a shuttle vector that can be replicated in E. coli and L. lactis.

Specific examples of the shuttle vector are pLE shown in the restriction enzyme cleavage map of FIG. 5 described later.
51 and p shown in the restriction enzyme cleavage map of FIG. 8 described later.
There is LE22.

The plasmid pLE51 contains about 1.4 k of pUC19 containing an MCS and a replication initiation region that functions in E. coli.
1.1 k of pAMβ1 containing the NdeI-DraI fragment of b and the Em resistance gene that functions in Gram-positive bacteria and Escherichia coli
M of pNDE4 prepared by ligating with HinPI fragment of b
L. lactis NC on EcoRI-SacI site in CS
5 of 5Md cryptic plasmid of DO763 strain.
It is a plasmid obtained by inserting a 7 kb EcoRI-SacI fragment and has a replication initiation region functional in Escherichia coli derived from pUC19 and a part of MCS.

The plasmid pLE22 is a 2Md cryptic plasmid of about 2.1 kb NdeI-H.
The incII fragment was replaced with Asp718- in the MCS of pNDE4.
This was inserted into the SmaI site (pMQ022ΔA) and
Approximately 2.4 containing a fragment derived from Md Cryptech plasmid
The 1 kb SacI-BamHI fragment was digested with the E of pNDE4.
It is a plasmid that is inserted into the AvaII site located downstream of the m resistance gene, and the Em resistance gene has a transcription direction opposite to that of the rep gene derived from the 2Md cryptic plasmid.

The plasmid pLE22 is not only replicable in E. coli and L. lactis, but also pU22.
It has an expressible lacZ ′ gene derived from C19, a replication origin region that functions in E. coli, and complete MCS.

Further, as a result of inserting a protease gene derived from L. lactis and a staphylokinase (SAK) gene derived from Staphylococcus aureus into the site in the MCS downstream of the Em resistance gene, both were found to be the same as the Em resistance gene. It has a characteristic that the expression amount when inserted in the direction is higher than that when inserted in the opposite direction.

Furthermore, when about 0.5 kb upstream of the rep gene is deleted, the stability and copy number in L. lactis are reduced or decreased. In addition, the plasmid p
LE51 and pLE22 are L. Since it is considered that it does not show incompatibility in lactis, it seems that it can be introduced into the same cell at the same time.

The above-mentioned plasmid pLE51 is referred to as Microindustrial Research Institute No. 13503 (As of March 04, 2005), and pLE22 is referred to as Microindustrial Research Institute No. 13504 (March 04, 2005). Dated).

[0026]

EXAMPLES Example 1. Has an origin of replication that functions in L. lactis
Vectors were created with a replication origin region that functions in L. lactis. As the material, two types (5Md and 2Md) of cryptic plasmids derived from L. lactis NCD0763, a plasmid pAMβ1 derived from Streptococcus faecalis DS5, and pUC19 derived from Escherichia coli were used. L. lactis MQ953 was used as the host.

First, pNDE4 was prepared as an origin screening vector, a lactic acid bacterium plasmid fragment was cloned using Escherichia coli as a host, and then introduced into lactic acid bacterium by electroporation. The copy number was compared by culturing the lactic acid bacterium transformant overnight, extracting the plasmid, and then separating by agarose gel electrophoresis.

Origin screening vector pND
E4 was created using the erythromycin resistance (Em ^r ) genes from pUC19 and pAMβ1. FIG. 1 is a process drawing showing the process of creating the vector pNDE4. That is, the plasmid pA of Streptococcus faecalis
A cleavage fragment containing the erythromycin resistance (Em ^r ) gene region was obtained using Mβ1 to HindIII, and the fragment was inserted into the HindIII fragment of pHY300PLK to obtain p
EHD1 was obtained.

HindII derived from pAMβ1 of pEHD1
Further cutting the I fragment HinPI, and the cells of the plasmid pUC19 of Escherichia coli NdeI, fragmented and ligation was digested with DraI, Em ^r from pAMβ1
PNDE4 consisting of a 1.1 kb fragment containing the gene region and a 1.4 kb fragment containing the lacZ ′ derived from pUC19, the replication initiation region for E. coli, and the multiple cloning site (MCS) was obtained.

FIG. 2 is an explanatory view schematically showing the structure of the obtained plasmid pNDE4. This pNDE4 is p
A multicloning site of UC19 and a selection system using lacZ can be used. This vector pNDE4 uses E. coli HB101 as a host
Transformants could be selected on LB plates containing m500 μg / ml.

Another plasmid pLE51 was constructed using the obtained pNDE4. Figure 3 shows the plasmid pLE51
FIG. 6 is a process chart showing a process of creating the above. That is, L. lactis N
1 CD5763 cryptic plasmid of 5Md
Cleaves with SacI, an enzyme that cleaves at various sites,
It was cloned into the acI site and named pMQ023.

The obtained pMQ023 was treated with three restriction enzymes S
deleted using acI, EcoRI, HindIII,
It was introduced into L. lactis, and the replication initiation region in L. lactis derived from the 5 Md cryptic plasmid was estimated. FIG. 4 shows the result, and as shown in the figure,
It was found that the replication initiation region of L. lactis exists within the EcoRI-SacI fragment (5.7 Kb).

Then, Ec of 2.4 kb of pMQ023
Create a plasmid excluding the oRI-SacI fragment,
The plasmid pLE51 was obtained. Figure 5 shows the plasmid pLE
It is a restriction enzyme map of 51. As shown in the figure, the plasmid pLE51 contains a replication initiation region derived from the 5Md cryptic plasmid of the L. lactis NCDO763 strain, a replication initiation region derived from the Escherichia coli plasmid pUC19, and Em ^r.
It has a resistance gene region and a multiple restriction enzyme recognition sequence (MCS).

Furthermore, another plasmid pLE22 was constructed using pNDE4. FIG. 6 shows the plasmid pLE2
FIG. 6 is a process diagram showing a process of creating No. 2. That is, the 2Md cryptic plasmid of L. lactis NCD0763 was cleaved with HincII, an enzyme that cleaves at one site, and pNDE4
Was cloned into the SacI site of pMQ022.

The obtained pMQ022 was digested with the restriction enzyme Nde
I, EcoRI, and HincII were deleted and introduced into L. lactis to estimate the replication region in L. lactis derived from the 2Md cryptic plasmid. FIG. 7 shows the result, and as shown in the figure, NdeI-
It was found that a replication initiation region exists within the HincII fragment (2.1 Kb).

Therefore, from pMQ022 to NdeI, As
Unnecessary 1.3 kb fragment was eliminated with p718 (= KpnI) to construct plasmid pMQ022ΔA, and the SacI and BamHI restriction enzyme fragments were added to pNDE.
The plasmid p was inserted into the restriction enzyme AbaII site of 4
LE22 was created (see Figure 6).

FIG. 8 is a restriction map of the obtained plasmid pLE22. As shown in the figure, plasmid pLE2
2 has a replication initiation region derived from the 2Md cryptic plasmid of L. lactis NCDO763 strain, a replication initiation region derived from E. coli plasmid pUC19, an Em ^r resistance gene region, and a multiple restriction enzyme recognition sequence (MCS). There is.

Example 2. Cryptic plasmid derived
Identification of the replication initiation region of Cryptoplasmid derived from the above-mentioned plasmid pLE22 was identified. As the plasmid used for identification, the plasmid pMQ022 before the preparation of the plasmid pLE22 was used. L. lactis MQ954 was used as the host. The enzyme was purchased from Takara Shuzo.

The outline of the identification of the replication initiation region is described in uni-directional deleti.
on) method, various deletions were made, and the region required for replication in L. lactis was identified. The unidirectional delation method is a method in which various deleted DNA fragments can be prepared by selectively enzymatically digesting linear DNA in only one direction and sampling it over time. Specifically, it carried out as follows.

That is, 200 units of exonuclease III was added to 10 μg of linear DNA obtained from the plasmid pMQ022 and reacted at 37 ° C. By sequentially sampling this at 1-minute intervals, a deletion fragment of 300 bases each can be obtained.

The deletion fragment was heated at 65 ° C. for 5 minutes to inactivate exonuclease III. Next, 7
5 units of S1 nuclease was added and reacted at 37 ° C. for 15 minutes to digest the single-stranded portion.

After the phenol treatment, the end portion was blunted with T4 DNA polymerase and circularized with T4 DNA ligase. This circularized DNA was transformed into L. lactis MQ
954 to electroporation
The DNA region of the minimum unit that can be replicated by the method was determined.

A DNA nucleotide sequence determination method was used for determining the DNA region. Specifically, circular double-stranded plasmid D
NA was denatured with alkali to form a single strand, which was used as a template. The reaction is 7-deaza Sequenase Kit (7-deaz
a Sequenase kit) (manufactured by USB Corporation) was used for sequence determination by the chain-termination method using dideoxy NTP. As the primers, M13 primer M4, RV and synthesized DNA were used.

The synthesis of the DNA oligomer was carried out by the phosphite method using a DNA synthesizer 380 (manufactured by ABI). After purification was completed with Tr (trityl) ON for purification, the resin was cleaved and deprotected with ammonia, the side reaction product was separated by a reverse phase C18 column, and the Tr group was removed by TFA. An oligomer of 0.001 _OD was used for the sequence reaction.

As a result of the identification of the region required for replication in L. lactis by the unidirectional delation method, the HincII side of the previously determined replication initiation region was further deleted by about 0.5 Kb. It was found that it could be duplicated (Fig. 7). The area of # 5 shown in FIG. 7 is set to A of pNDE4.
It was inserted into the vaII site and pNDE452 was replicated. The result of the nucleotide sequence of the replication initiation region is shown in SEQ ID NO: 1 described later.

Next, when the open reading frame of this sequence was taken, a frame (ORF I) encoding a polypeptide chain consisting of 383 amino acid residues was found (325-1476). Based on this amino acid sequence, NBR
A search of the F protein database revealed homology with the E protein (repE gene) of a protein (mini-F plasmid) that is thought to be involved in plasmid replication, and with the replication initiation protein of the R6K plasmid. . ORF I seems to be a member of a series of rep genes involved in plasmid replication.

When the nucleotide sequence is analyzed, the start codon (325-32
7) It was revealed that a characteristic sequence exists upstream. As shown in SEQ ID NO: 1, four direct repeat sequences (of which one is incomplete) (132-153,
154-175,176-197,198-218) and a pair of inverted repeat bases (i
The nverted repeat) array (222-234) was found.

A schematic representation of this is shown in FIG. 9, which resembles a common motif found in plasmids that replicate in Gram-negative bacteria. The four direct repeat sequences (132-153,154-175,176-197,198-218) had a common A cluster (A cluster), which was a characteristic that it repeated every 22 residues.

Example 3. Stability of pLE51 and pLE22
Sex and replication capability obtained pLE51 and pLE22 of stability and Streptococcus thermophilus (Streptococcus thermo
philus, hereinafter referred to as S. thermophilus), was examined for replication ability.

The strains used were Escherichia coli HB101, L. lactis MQ954, S. thermophilus YIT2001, YIT2005 (AT
CC14485), YIT2020, YIT2021, YIT2025, YIT2037 (ATCC1925
8), YIT2038 (NCDO1469), YIT2042, YIT2043, YIT2044, YIT20
45, YIT2046, YIT2047. The plasmids used were pNDE4B including the obtained pLE22.
1, pMQ023, pMQ022, and the conventional shuttle vector pGKV11.

It should be noted that pNDE4B1 contains an EcoRI-KpnI fragment of about 3 Kb containing the replication initiation region of pAMβ1.
It was inserted into the AvaII site of NDE4. M17
G medium is 0.5% glucose, M17L medium is 0.5%
It was made by adding lactose.

3-1. Growth curve of L. lactis MQ954 The growth curve of L. lactis MQ954 holding each plasmid was determined. Specifically, MQ95 cultured overnight at 30 ° C
4, MQ954 (pGKV11), MQ954 (pLE
22), MQ954 (pMQ022), MQ954 (p
NDE452) 0.1 ml was planted in 10 ml of M17G medium and cultured at 30 ° C. for Klet unit at a predetermined time.
Was measured. MQ954 without a plasmid was cultured without a drug, and MQ954 with a plasmid was cultured by adding 5 μg / ml of erythromycin.

FIG. 10 is a diagram showing the growth curve of L. lactis MQ954. As shown in the figure, MQ954 (pLE
22) is MQ954 (pGKV11), MQ954
(PMQ022) and MQ954 tended to grow faster than MQ954. Further, it is considered that the growth of MQ954 (pNDE452) is slower than the others and that the copy number is small. However, it is unclear why pLE22 grew faster than pMQ022 and pGKV11, which had almost the same copy number.

3-2. Stability of each plasmid in L. lactis
Sex also investigated stability in L. lactis of each plasmid.
Specifically, M17G containing 5 μg / ml erythromycin
MQ954 (pGKV11), MQ cultured overnight in medium
954 (pLE22), MQ954 (pMQ022),
MQ954 (pNDE452) was diluted to 10 ⁻⁵ in the same medium containing no drug, cultured at 30 ° C. for 18 hours, and then plated on M17G agar medium containing no drug to form colonies at room temperature for 2 nights. 5 each 100 independent colonies
The cells were transferred to M17G agar medium containing μg / ml erythromycin and cultured at room temperature for 2 nights to examine the presence or absence of colony formation.

The results show that L. lactis MQ954 (pGKV
11), MQ954 (pLE22), MQ954 (pM
In Q022), 100 colonies were formed.
That is, it was confirmed that pLE22 and pMQ022 were stably retained in L. lactis as in pGKV11.
However, 0.5 kb upstream of the rep gene from pLE22
Is deleted (pNDE425), L. Lactis stability decreased.

3-3. Stability of each plasmid in E. coli Next, the stability in E. coli was examined. For details, 500μ
HB101 (pGKV11), HB101 (pLE2) cultured overnight in LB medium containing g / ml erythromycin
2), HB101 (pMQ022), HB101 (pN
DE452) was diluted to 10 ⁻⁵ in the same medium containing no drug and cultured at 37 ° C. for 18 hours, and then LB containing no drug was added.
It was spread on an agar medium and cultured overnight at 37 ° C. to form colonies. 100 independent colonies were transferred to LB agar medium containing 500 μg / ml erythromycin and incubated at 37 ° C for 1 hour.
The cells were cultured overnight and examined for the formation of colonies.

Escherichia coli HB101 (pLE22), HB1
01 (pMQ022), HB101 (pNDE452)
100 colonies were formed in HB101
No colony formation was observed in (pGKV11). However, as a result of further culturing for 5 days, as shown in Table 1 below, about 10 colonies finally became HB101 (pG.
It was also formed by KV11).

[0058]

[Table 1] .

For E. coli, pLE22, pMQ022
Were believed to replicate in the ori from pUC19 and were all stably retained. However, pGKV11 took a long time to form colonies, and its stability was low at about 10%.
This is worse than the reported data (52%),
In this experiment, it is possible that the number of erythromycin-resistant colonies decreased because erythromycin induction was not applied. pLE22 was found to be stably retained in L. lactis and Escherichia coli, and its usefulness as a vector was confirmed.

3-4. S. Replication capability in Thermophilus The replication ability in Thermophilus was examined. Specifically, each plasmid was used for S. It was introduced into Thermophilus by electroporation and examined for replication ability. The electroporation method was performed according to L. lactis.

That is, the overnight culture solution was inoculated into M17L medium at a concentration of 1% and cultured at 37 ° C. for about 3 hours. After collecting the bacteria, EP
B (0.5M sucrose, 7mM K-phosphate buffer p
H7.4, washed with 1mM MgCl ₂ ), suspended in 1/100 to 1/125 volume,
1 μl of DNA solution was added to 40 μl of suspension, and 25 μlF,
Apply pulse under the condition of 200Ω, 8.75KV / cm, M17L
1 ml of medium was added and the mixture was allowed to stand at 37 ° C for 1 hour. pGKV
Induction was carried out by adding erythromycin at a concentration of 0.05 μg / ml to 11.

M17 containing 5 μg / ml erythromycin
It was plated on L agar medium and cultured at 37 ° C. The S. PGKV using the Thermophilus 13 strain as a host
11, pLE22, pNDE4B1, pMQ022, p
MQ023 was used as the donor DNA. pGKV11 was extracted from L. lactis, and other plasmids were extracted from E. coli.

Erythromycin resistant colonies were identified as pGK
V11 and pNDE4B1 and YIT2005, YIT2020, YI
Only the combination of T2037 and YIT2045 was obtained. Transformation frequency is YIT2005 ＞ YIT2020 ＞ YIT2037
> It was like YIT2045. M17 containing pNDE4B1 transformants containing 5 μg / ml erythromycin
Upon culturing in L medium and examining the plasmid, a plasmid having the same size as pNDE4B1 was detected in those that could be cultured.

In this experiment, the broad host range plasmid p
Transformants were obtained only with GKV11 and pNDE4B1, and no transformants were obtained with pLE22. Although the DNA base sequence of the replication initiation region of pLE22 has high homology with the plasmid pCI1305 having a narrow host range, It does not seem to be duplicated with Thermophilus.

EXAMPLE 4.763 Protease gene c
In order to confirm the usefulness of the rolling pLE22, the expression with the 763 protease gene incorporated was examined. PLE22 was used as a vector and purified pLP763 was used as a source of protease gene. L. lactis MQ954 was used as the transformation host.

4-1. Cloning of Protease Gene pLE22 was digested with XbaI and the protease production plasmid pL763 was digested with HindIII and PstI to obtain DN.
The ends were blunted with an A branding kit (DNA Bluntig Kit) (Takara Shuzo Co., Ltd.).

Cloning into pLE22 was carried out using pLE2
2-XbaI and an about 6 kb pLP763-HindIII, PstI fragment purified by agarose gel electrophoresis were similarly introduced into MQ954 after ligation and plated on a citrated milk agar medium.

Cloning into pLE22 was carried out by using 2 strains of pLE22 / HP1 which were able to coagulate skim milk at 30 ° C. overnight, out of 100 strains which were considered to be Prt ⁺ on citrated milk agar medium. , PLE22 / HP2 was examined for plasmid DNA to find approximately 6 kb of HindII
It was confirmed that the I-PstI fragment was cloned in the same orientation.

The results of determining the protease activity of the culture supernatant are shown in Table 2 below. As shown in Table 2, pLE22 / HP
PHD2 (HindIII-PstI on pGKV11 at 1)
Cloned fragment) about 1.4 times, pLE2
It was about 33% of pHD2 at 2 / HP2. Moreover, the result of carrying out the transformation again was the same. When cleaved with XbaI, pLE22 / HP1 was cleaved at one site, but pLE22 / HP2 was not cleaved at all, suggesting that the binding site, probably the C-terminal side of ORF1, has a structure different from the expected structure. .

[0070]

[Table 2]

As described above, it was confirmed that pLE22 has sufficient practicality because a clone having higher protease activity than pHD2 was obtained.

Example 5. Staphylokinase (SAK)
Cloning of Gene As described above, pLE22 was prepared, the 763 protease gene was incorporated, and the expression thereof was examined. As a result, it was shown that the pLE22 exhibited higher activity than the conventionally used vector pGKV11. In order to further confirm the usefulness of the prepared vector, we examined the operability and expression of activity during cloning experiments using the staphylokinase (SAK) gene that can be expressed in Gram-positive bacteria and Escherichia coli.

FIG. 11 is an explanatory view schematically showing the structure of the plasmid used. The host is E. coli JM109,
E. coli HB101 and L. lactis MQ954 were used. L.
M17-glucose medium was used for lactis culture, and LB medium was used for E. coli culture. As the SAK gene, a 1.4 kb AccI-AvaII fragment containing a promoter was used. Escherichia coli WA802 (pTS301) was used as a positive control for measuring SAK activity. Fibrinogen was purchased from KABI.

Selection of transformants by X-gal was carried out by selecting 2% X-g on the plate surface of LB agar medium containing the drug.
Al solution (in DMFA) 100 μl and 0.1M IPTG solution (i
It was carried out using an X-gal plate coated with 100 μl of (n H ₂ O).

The SAK activity was detected by the following fibrin plate method. That is, a fibrin plate was prepared by adding an appropriate amount of thrombin to a 0.5% fibrinogen solution (in H ₂ O). An appropriate amount of the culture supernatant from which the bacterial cells had been removed by centrifugation was spotted on this plate and incubated at room temperature or 37 ° C. to observe lysis spots.

5-1. Of SAK gene using pLE22
Cloning of the SAK gene using pLE22
By blunting both ends of the AccI-AvaII fragment containing the AK gene, Sm in the multiple cloning site (MCS)
E. coli JM ligated with pLE22 cleaved at the aI site
109 was transformed.

Transformants forming white colonies on X-gal plates were selected and analyzed for plasmid DNA. L. lactis was transformed with the plasmid DNA extracted from cloned Escherichia coli JM109 (pLE22SAK1) and E. coli JM109 (pLE22SAK2) in which the SAK genes were inserted in different directions.
Q954 (pLE22SAK1) and L. lactis MQ9
54 (pLE22SAK2) was obtained. Note that FIG. 12 is an explanatory view schematically showing the structure of the obtained recombinant plasmid.

That is, on the X-gal plate, 18 white colonies and 6 blue colonies of the E. coli transformant were selected, plasmid DNA was extracted, and the restriction enzyme digestion pattern was examined. It was confirmed that the SAK gene was inserted into the SAK gene and that the selection system using X-gal worked well.

L. lactis was transformed with the DNA extracted from Escherichia coli, and 6 plasmid DNAs were examined from each of the obtained transformants, but no mutation such as deletion was found. The result of having investigated the SAK activity in a culture supernatant by the fibrin plate method is shown in FIG.

The expression of SAK activity in L. lactis was clearly lower than that in E. coli. In addition, the activity of SAK2 was slightly stronger than that of SAK1 in Escherichia coli, whereas the activity of SAK1 was significantly stronger than that of SAK2 in L. lactis. As a result of Western blotting of the culture supernatant, a band was detected at each expected position, but it was confirmed that the band was thin in L. lactis and the expression level was lower than that in E. coli.

5-2. Measurement of SAK Activity Using Synthetic Substrate The SAK activity of the culture supernatant was referred to DTNB with reference to the method of Leprince (Anal. Biochem. 177 ; 341-346).
(5,5'-DITHIO-bis- (2-NITROBENZOICACID)) and CBZ (N
α-CBZ-L-LYSIN THIOBENZYL ESTER). However, for the measurement, 10 μl of the culture supernatant from which bacterial cells were removed by centrifugation was used as a sample. The transformants were cultured overnight, and the SAK activity in the culture supernatant was measured using a synthetic substrate. The results are shown in Table 3. It was confirmed that the activity of SAK1 was higher than that of SAK2 in L. lactis.

[0082]

[Table 3]

As described above, in order to verify the usefulness of the vector, it is necessary to actually clone and examine the gene. In the cloning test of the 763 protease gene of Example 4, it was confirmed that It was not suitable as a reporter gene because it is large and acts lethal in E. coli.

In the cloning of SAK of this example, the SAK gene had a small molecular weight of about 1.4 kb, and since it was expressed in Gram-positive bacteria and Escherichia coli, it was considered to be suitable as a reporter gene. As pLE2 which can be selected by X-gal in E. coli
For 2, the cloning and activity expression of the SAK gene was examined.

First, the operability of pLE22 into which lacZ 'of pUC19 was introduced in E. coli is the same as that of conventional pGKV.
It was confirmed that it was extremely superior to 11. By using this vector, cloning of a gene that does not work lethal in Escherichia coli has been facilitated.

Next, the cloned SAK gene
Since it was expressed in L. lactis and the SAK protein was detected in the culture supernatant, it was revealed that the promoter and signal sequence of the SAK gene also function in L. lactis. It may be useful for studying secretory expression of other genes in the future.

As for the expression level of the SAK gene in L. lactis, higher activity was observed when the SAK gene was inserted in the same direction as the transcription direction of the Em resistance gene, like the protease gene. This is probably because the read-through of the Em resistance gene promotes the transcription of the downstream gene.

From the above results, among the vectors prepared this time, pLE22 can be used for gene manipulation as a vector which facilitates cloning operation via E. coli.

[0089]

INDUSTRIAL APPLICABILITY As described above, the present invention has a replication initiation region derived from the cryptic plasmid of L. lactis NCDO763 strain, a replication initiation region derived from Escherichia coli plasmid pUC19, and a drug which functions in Gram-positive bacteria and Escherichia coli. Resistance gene region and multiple restriction enzyme recognition sequence (MCS)
Since it is equipped with and, it can be used as a shuttle vector capable of replicating in E. coli and L. lactis.

A specific plasmid pLE51 is 1.1.4 kb of pAMβ1 containing an NdeI-DraI fragment of pUC19 containing a replication initiation region that functions in E. coli and MCS, and an Em resistance gene that functions in Gram-positive bacteria and Escherichia coli. The 1 kb HinPI fragment was ligated to create pNDE4. EcoRI-Sac in MCS of pNDE4
At the I site, a 5.7 kb EcoRI-Sac of a 5Md cryptic plasmid of L. lactis NCDO763 strain was prepared.
A plasmid obtained by inserting the I fragment, pUC1
It has a replication origin region that functions in E. coli derived from 9 and a part of MCS.

The plasmid pLE22 is a 2Md cryptic plasmid containing approximately 2.1 kb of NdeI-H.
The incII fragment was replaced with Asp718- in the MCS of pNDE4.
This was inserted into the SmaI site (pMQ022ΔA) and
Approximately 2.4 containing a fragment derived from Ms Cryptech plasmid
The 1 kb SacI-BamHI fragment was digested with the E of pNDE4.
It is a plasmid which is inserted into the AvaII site located downstream of the m-resistant gene, and the Em-resistant gene has a transcription direction opposite to that of the rep gene derived from the 2Md cryptic plasmid.

The plasmid pLE22 is, of course, replicable in E. coli and L. lactis.
It has an expressible lacZ ′ gene derived from C19, a replication origin region that functions in E. coli, and complete MCS.

Further, as a result of inserting a protease gene derived from L. lactis and a staphylokinase (SAK) gene derived from Staphylococcus aureus into the site in the MCS downstream of the Em resistance gene, both were found to be the same as the Em resistance gene. It has a characteristic that the expression amount when inserted in the direction is higher than that when inserted in the opposite direction.

Furthermore, when about 0.5 kb upstream of the rep gene is deleted, the stability and copy number in L. lactis are reduced or decreased.

The plasmids pLE51 and pLE
22 and L. lactis incompatibility (incomp
Since it is considered that it does not exhibit the abbilities), there is an effect that it can be introduced into the same cell at the same time.

[Sequence list]

SEQ ID NO: 1 Sequence length: 1644 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin organism name: Lactococcus lact
is) Strain name: NCDO763 (2Md cryptic plasmid) Sequence features Characteristic symbol: -35 signal Location: unknown Method of determining feature: unknown Characteristic symbol: -10 signal Location: 240..245 Features Method for determining: E Characteristic symbol: ORF1 Location: 325..1473 Method for determining characteristic: E sequence TTTTGACCTT GATTTTTAGA TTTTGAAACG AAGTGAAAAA AAGCGAAGCC TATAAAACACACACACATATATATCAATAGT AGTAAGTAACAAAGTACAAGTACAAGTACAAGTAGAAGT ATCAACACAA AAACACTTTC GTTTGTGTTG ATATCGTGGT 240 ATAATAAAAG CATAGAGAAA TCATGACGGC AAAATCAGTT TCTCTATACC TAATTCAAAA 300 ACACTCACAA AGGAGCGTAT TTAC 324 1 5 10 15 ATG CCT ATT ATA TCA GAn Asalu Iln CAIN Ale CAln ALA CAI Aln CAln ACA CAA AAG CAAG AAG CAAG Val Leu Thr 20 25 30 TTG AAT GAA CTT GAA AAA CGT AAA GTG GTG GAG CAT AAC AGC CTC ATT 420 Leu Asn Glu Leu G lu Lys Arg Lys Val Val Glu His Asn Ser Leu Ile 35 40 45 ACC TCA ATA GCC AAA ATG GAT AAA ACG CCC TTG AAA ATG TTT GAA TTG 468 Thr Ser Ile Ala Lys Met Asp Lys Thr Pro Leu Lys Met Phe Glu Leu 50 55 60 GCG GTG TCT TGC ATT GAT ACG GAA AAG CCA CTT GAA GAT AAT ACC GTG 516 Ala Val Ser Cys Ile Asp Thr Glu Lys Pro Leu Glu Asp Asn Thr Val 65 70 75 80 TAT CTT TCA AAA AAA GAC CTT TTC GCT TTC TTT AAG GTG TCT GAT AAT 564 Tyr Leu Ser Lys Lys Asp Leu Phe Ala Phe Phe Lys Val Ser Asp Asn 85 90 95 GAC AAA CAC AGT CGT TTT AAA GAA GCG GTT GAG AAA ATG CAG AAA CAA 612 Asp Lys His Ser Arg Phe Lys Glu Ala Val Glu Lys Met Gln Lys Gln 100 105 110 GCC TTT TTC AAA ATC AAA GAA AAA AAA GAT AAA GGT TTT GAG TTT GAA 660 Ala Phe Phe Lys Ile Lys Glu Lys Lys Asp Lys Gly Phe Glu Phe Glu 115 120 125 AAT ATT GTG CCG ATT CCT TAC GTC AAG TGG ACA GAT TAT AAC GAT GAA 708 Asn Ile Val Pro Ile Pro Tyr Val Lys Trp Thr Asp Tyr Asn Asp Glu 130 135 140 GTG TTA ATT CGT TTC AGT CCT GAA ATT ATC CCC TAC TTA GTC AAT CTC 756 Val Leu Ile Arg Ph e Ser Pro Glu Ile Ile Pro Tyr Leu Val Asn Leu 145 150 155 160 AAA AAA AAT TTC ACG CAA CAT GCC TTA TCT GAC CTT GCA GAA CTC AAT 804 Lys Lys Asn Phe Thr Gln His Ala Leu Ser Asp Leu Ala Glu Leu Asn 165 170 175 AGC AAG TAT TCT ATT ATT CTT TAC CGT TGG TTG TCT ATG AAC TAC AAC 852 Ser Lys Tyr Ser Ile Ile Leu Tyr Arg Trp Leu Ser Met Asn Tyr Asn 180 185 190 CAA TAC GAG CAT TAT AGT GTT AAA GGG GGA CGG AGA GCG GAG CAG GTA 900 Gln Tyr Glu His Tyr Ser Val Lys Gly Gly Arg Arg Ala Glu Gln Val 195 200 205 GAA GCC TAC CGT AAT CCC TCA ATT AGT ATT AAA GAG TTG CGA GAG ATG 948 Glu Ala Tyr Arg Asn Pro Ser Ile Ser Ile Lys Glu Leu Arg Glu Met 210 215 220 ACA GAT ACG ATT AAT GAG TAT AAG CTA ATG CAC CAA TTT ACA GAA CGA 996 Thr Asp Thr Ile Asn Glu Tyr Lys Leu Met His Gln Phe Thr Glu Arg 225 230 235 240 ATA TTA AAA GAA CCT TTA GAA GAA ATC AAC GCT CAC ACC TCT TTT AAT 1044 Ile Leu Lys Glu Pro Leu Glu Glu Ile Asn Ala His Thr Ser Phe Asn 245 250 255 GTG TCC TAT GAG AAA GTC AAA AAA GGG CGT TCG ATT GAT AGC ATT GTC 1092 Val Ser Tyr Glu Lys Val Lys Lys Gly Arg Ser Ile Asp Ser Ile Val 260 265 270 TTT CAT ATT GAG AAG AAA CGC ATG GCA GAC GAT AAC AGT TAC AAG TTG 1140 Phe His Ile Glu Lys Lys Arg Met Ala Asp Asp Asn Ser Tyr Lys Leu 275 280 285 GAC GAT AGG GCT TAT CAA GAA GAT AAA GCA CGT AAA GCT GAA ACA GAA 1188 Asp Asp Arg Ala Tyr Gln Glu Asp Lys Ala Arg Lys Ala Glu Thr Glu 290 295 300 GAC GAA TTA GTC TTG CAG GCA ATC AAT AGC CCT TAT ACT AAG TTA CTT 1236 Asp Glu Leu Val Leu Gln Ala Ile Asn Ser Pro Tyr Thr Lys Leu Leu 305 310 315 320 ATG GAA CAT TTC TTA TTG TCT TAT CTT GAC CTT ATG GAC ATA AAG ATA 1284 Met Glu His Phe Leu Leu Ser Tyr Leu Asp Leu Met Asp Ile Lys Ile 325 330 335 TTG GCA GGC TTA CAG AAA AAC GTT TAT ACG CTT TAT GAC GAA CTG AAA 1332 Leu Ala Gly Leu Gln Lys Asn Val Tyr Thr Leu Tyr Asp Glu Leu Lys 340 345 350 GAC TTA CGA GGG CTT AAT GGC GTG AAA GAC CAC TTG TCT TAT GTG GGA 1380 Asp Leu Arg Gly Leu Asn Gly Val Lys Asp His Leu Ser Tyr Val Gly 355 360 365 GCT AAA CAA GAG GAC TAC TCA AAG AAA AAT ATC TGT AA G TAC CTT AAA 1428 Ala Lys Gln Glu Asp Tyr Ser Lys Lys Asn Ile Cys Lys Tyr Leu Lys 370 375 380 AAA GCC ATT GAA CAA TAT CTA CCA ACG GTT AAA AGA CAG GAC TTA TGA 1476 Lys Ala Ile Glu Gln Tyr Leu Pro Thr Val Lys Arg Gln Asp Leu *** TGAG TGAAAAGTTA AAGACAATCA 1500 AAGAGTTGGC GGACGAGTTA GGGGTAAGTA AATCATATGT TGATAAGATA ATACGCATAC 1560 TCAAATTGCA TACTAAATTA GATAAAGTAG GTAATAAGTA TGTAATTTCT AAAACAGATAT 16AAAAGCAAT 16A

[Brief description of drawings]

FIG. 1 is a process drawing showing a process of creating a vector pNDE4.

FIG. 2 is an explanatory view schematically showing the structure of plasmid pNDE4.

FIG. 3 is a process diagram showing a process for creating a plasmid pLE51.

FIG. 4 is an explanatory drawing showing the results of estimation of the replication initiation region in L. lactis derived from a 5 Md cryptic plasmid.

FIG. 5 is a restriction map of plasmid pLE51.

FIG. 6 is a process diagram showing a process for creating plasmid pLE22.

FIG. 7 is an explanatory drawing showing the results of estimation of the replication initiation region in L. lactis derived from a 2Md cryptic plasmid.

FIG. 8 is a restriction map of plasmid pLE22.

FIG. 9 is a schematic diagram of a replication initiation region of a cryptic plasmid.

10 is a diagram showing the growth curve of L. lactis MQ954.

FIG. 11: Plasmids pUC19, pND1, pNDe
It is explanatory drawing which showed the structure of 4, pLE22, pGKV11 typically.

FIG. 12: Recombinant plasmid pLE22SAK1, p
It is explanatory drawing which showed the structure of LE22SAK2 typically.

FIG. 13: S in culture supernatant by fibrin plate method
It is a schematic diagram which shows the result of detection of AK activity.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification number Office reference number FI technical display location (C12N 15/70 C12R 1:19) (72) Inventor Tomoyuki Saiko 1 Higashishinbashi, Minato-ku, Tokyo 1-19 No. 19 Yakult Honsha Co., Ltd. (72) Inventor Hirashima 1-11-19 Higashishimbashi, Minato-ku, Tokyo Showa Yakult Honsha Co., Ltd.

Claims (3)

[Claims] 1. Lactococcus
lactis) NCDO763 cryptic plasmid-derived replication initiation region, Escherichia coli plasmid pUC19-derived replication initiation region, drug-resistant gene region that functions in Gram-positive bacteria and E. coli, and multiple restriction enzyme recognition sequence (MCS) and a shuttle vector. 2. Lactococcus
lactis) NCDO763 5Md cryptic plasmid-derived replication initiation region, Escherichia coli plasmid pUC19-derived replication initiation region, drug-resistant gene region that functions in Gram-positive bacteria and E. coli, and multiple restriction enzyme recognition sequence (MCS) and a shuttle vector pLE51 represented by the following restriction enzyme cleavage map of Chemical formula 1. [Chemical 1] 3. Lactococcus
lactis) NCDO763 2Md cryptic plasmid-derived replication initiation region, Escherichia coli plasmid pUC19-derived replication initiation region, drug-resistant gene region that functions in Gram-positive bacteria and E. coli, and multiple restriction enzyme recognition sequence (MCS) and a shuttle vector pLE22 represented by the following restriction enzyme cleavage map of Chemical formula 2. [Chemical 2]