JPH0625292A - Protein and its gene - Google Patents

Abstract

PURPOSE:To obtain a new protein, derived from a biological tissue and cell, capable of enhancing the production of an anti-DNA antibody and binding to the DNA and useful for understanding the morbid state, diagnosing and treating autoimmune diseases caused by abnormal production, transudation, etc., of nucleic acids such as the DNA. CONSTITUTION:A KML1-7 cell derived from a lymphoid established cell established as a cell strain capable of producing and releasing a factor enhancing the production of an anti-DNA antibody from the whole cell population of a tumescent lymph node in an MRL/l mouse is cultured in the presence of blood serum until a confluent state is attained. The cultured KML1-7 cell is then collected by centrifugation, transferred to a serum-free culture medium, suspended and subsequently cultured in a CO2 incubator for 3 days. The resultant culture solution is centrifuged to collect the culture supernatant and a serine protease inhibitor is directly added thereto. The prepared mixture is then concentrated with an ultrafiltration membrane and the resultant concentrate is adsorbed on an anion exchange resin. Common salt at >=0.2M concentration is added to purify the eluted fraction by high-performance liquid chromatography to afford the objective protein capable of enhancing the production of the anti-DNA antibody and binding to the DNA.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a protein derived from a living organism such as a human being or an animal, which has an activity of binding to nucleic acids such as DNA, a gene thereof, and a method for preparing and producing them.

Further, the present invention relates to various human and animal diseases accompanied by abnormal production of nucleic acids such as DNA in cells, abnormal production of antibodies against nucleic acids such as DNA, leakage of nucleic acids such as DNA accompanying cell death, and the like. The present invention relates to an antibody against the protein useful for diagnosis and treatment of rheumatism, autoimmune disease, immunodeficiency disease, various infectious diseases, genetic disease, metabolic disease, cancer and the like, and a method for producing the same.

[0003]

2. Description of the Related Art Disease model animals such as autoimmune disease mice have been heavily used in order to clarify the pathophysiology and etiology of autoimmune diseases and to carry out research on their diagnostic and therapeutic methods.

For example, NZB mouse, NZB / WF ₁ mouse, MRL / l mouse, MRL / n mouse and BXSB mouse are systemic lupus erythematosus.
lupus erythematoto sus, SLE)
It has been widely studied as a model animal of.

MRL / l mice showed marked lymphadenopathy from about 10 weeks of age, and the anti-double chain (d) characteristic of SLE (d).
s) Abnormal production of autoantibodies centering on anti-DNA antibodies such as DNA antibodies is observed, and nephritis frequently occurs.

[0006] Prud'homme et al. Reported that these autoantibodies produced by MRL / l mice were due to antigen-specific helper factor (L-BCDF) produced by T cells present in swollen lymph nodes. I went (Prud '
home, G.H. T. et al: J. Exp. Me
d. , 157 , 730, 1983).

On this occasion, many research groups tried to establish an L-BCDF-producing T cell line for the molecular elucidation of L-BCDF. All L-BCDF-like differentiation factor producing strains have not been successfully established.

[0008] The present inventors have previously independently developed a lymphoid cell line KML that produces and releases a factor that enhances anti-DNA antibody production from the swollen lymph node whole cell population of MRL / l mice.
_One cell was established and a patent application was filed (Japanese Patent Laid-Open No. 62-8709).
0).

[0009] The KML ₁ by cells derived _KML 1 -7 cells transplanted into late onset model MRL / n mice SLE pathology, perform the enhanced production of early onset model MRL / l mouse and anti-dsDNA antibodies comparable It was clarified that the SLE pathological condition is developed early in any model (Kanai, Y. et a.
l, Immunol. Lett. , 24 , 49, 199
0).

On the other hand, a DNA-binding protein that binds to gene DNA and regulates and controls the expression of genetic information has been known (Mitchell, PJ & Tjian,
R. , Science, 245 , 137, 1989 and Johnson, P .; F. & McKnigith, S.M.
L. , Annu. Rev. Biochem. , 58 , 7
99, 1989).

Further, the phenomenon of cell death and leakage of nucleic acids such as DNA upon cell death has been known (apoptosis).
s). In this case, the DNA released from the cells has a size that is a multiple of about 120 base pairs in units of nucleosome, which is in agreement with the property of DNA found in the blood of SLE patients (Wyllie, A. H. et a
l, J. Pathol. , 142 , 67, 1984 and Bell, D .; A. et al. Clin. Inve
st. , 85 , 1487, 1990).

It has also been reported that in fibroblasts, the DNA is shortened by 1000 nucleotides when the cell divides once (Harle).
y, C.I. B. et al, Nature, 345 , 45.
8, 1990).

[0013]

Given the variety of knowledge related to the DNA as described above [0005], the present inventors have, KML 1 _-7 cells produced from autoimmune diseases MRL / l mouse
The released factor that enhances the production of anti-DNA antibody (hereinafter referred to as “enhancing factor”) reacts with excess or non-temporary DNA produced in the living body, and has a function of performing some treatment with an immune mechanism, I thought that it might be a substance with a role, and in the same way that interferons are produced not only by fibroblasts but also by lymphoid cells, the enhancer is not limited to just lymphoid cells, but is universally found in other organs. It was presumed that the substance is also produced from cells.

Therefore, first, the isolation / purification and identification of the enhancer protein and the cloning of the gene thereof,
It was considered to be the subject of the present invention to clarify the structure and to express the enhancer protein in Escherichia coli or the like having the gene recombined.

As a result of intensive studies to highly purify the enhancing factor, a method for obtaining a highly purified enhancing factor and a method for determining a partial structure of its amino acid sequence were established and obtained. PCR with a synthetic oligonucleotide primer corresponding to the specified amino acid sequence
DN by the cDNA of the _KML 1 -7 cells as a template by
A probe was prepared.

[0016] and, c prepared from _KML 1 -7 cells
A positive clone is selected from the DNA library by plaque hybridization using the present DNA probe to obtain a full-length 2.2K-base cDNA containing a DNA fragment encoding the enhancement factor.
re-cloning into escript SKM13 ⁺ ,
DNA sequencing was performed. Then, the obtained full-length 2.2K-base cDNA was recombined into Escherichia coli or the like using an appropriate expression vector, and an enhancer protein having an activity equal to or higher than that of the natural enhancer was successfully expressed. Also, immunize animals with this enhancer protein,
We have also reached the production of antibodies.

Further, the present inventors have found that the enhancer is also expressed in other organs of the normal mouse other than the lymphoid cells of the MRL / l mouse. Was also successfully cloned.

Furthermore, human pheochromocytoma (Pheochro
mocytoma) cDNA library from MRL
/ L mouse was used as a probe to clone a human-type enhancer gene using a DNA fragment containing the enhancer-protein gene as a probe, and it was revealed that these enhancer proteins are DNA-binding proteins, and the present invention was completed. .

The first object of the present invention, necessary for the cloning of genes encoding technique and enhancement factor for separating and purifying the enhancement factor of MRL / l mouse KML 1 _-7 cells enhances the anti-DNA antibody production produced To provide various technologies.

The second object of the present invention, MRL / l mice _KML 1 -7 revealed DNA nucleotide sequence of the amino acid sequence and enhancing factor genes potentiators of cells, DNA or a part thereof constitute an enhancement factor gene Using fragment DNA as a probe, various organs of MRL / l mouse, and other autoimmune disease mouse, autoimmune disease animal, normal animal, healthy person, SLE, mixed connective fiber disease (MCTD), scleroderma (SD) Tissues having immunocompetent cells of patients with autoimmune diseases such as collagen disease, lymphoid cells, and various organs, blood,
It is an object of the present invention to provide a method capable of detecting and obtaining a gene encoding an enhancer or an enhancer-like substance in body fluid.

The third object of the present invention is to provide this enhancer or this enhancer-like factor of various animals such as mouse enhancer, mouse enhancer-like factor, rat enhancer, human enhancer, human enhancer-like factor. It is intended to provide a method for quantitatively producing an enhancer or an enhancer-like factor by expressing the encoded gene in various cells, microorganisms and the like.

A fourth object of the present invention is to provide a method for preparing a polyclonal antibody or a monoclonal antibody against an enhancer or an enhancer-like factor.

A fifth object of the present invention is to provide a method for measuring an enhancer in a living body, an antibody against the enhancer-like factor, or an animal such as a mouse, using the enhancer or enhancer-like factor in animals such as mice and humans. Human enhancer, enhancer using antibody against enhancer-like factor, method for detecting enhancer-like factor,
Measurement method, and animal such as mouse, human enhancement factor gene,
It is intended to provide a technique necessary for diagnosing and treating various diseases using an enhancer-like factor gene.

[0024]

Means for Solving the Problems The present inventors
For the accomplishment of, first, the separation of anti-DNA IgG antibody production enhancing factor (enhancement factor), were cultured mass of KML 1 _-7 cells to attempt the purification.

[0025] KML 1 _-7 cells complete medium under, and cultured to confluence in the flask, thereafter, continued a more cultured in a large flask of capacity, then KML
Collected ₁ -7 cells centrifugation or the like, high medium 606
Etc. were suspended in serum-free medium. Cell concentration is 0.5-5x
10 ⁷ / ml is preferable, and 1 to 3 × 10 ⁷ / ml is preferable.

Next, the present cells were placed in a large flask and cultured at the above cell concentration in a carbon dioxide incubator for 2 to 5 days, preferably 3 days. Then, the culture supernatant was collected by centrifugation at 3000 rpm for 15 minutes, for example, and the serine protease inhibitor PMSF was immediately added to 0.5 mM.

After that, it is filtered with a Sterivex filter or the like, and then 200 to 2 with an ultrafiltration membrane such as PM-10.
It was concentrated 50 times. Centrifugation and aseptic filtration were performed in the same manner as when the culture supernatant was collected, and the culture supernatant of each flask was collected at this stage, and 10 to 20 l was made into one batch, and the subsequent purification process was performed.

That is, as described later in detail in Example 1, the culture supernatant containing the enhancer is adsorbed on an anion exchange resin such as DEAE-Sephadex A-50, and then a salt such as NaCl is added. With the above buffer, the enhancement factor adsorbed on the carrier was eluted in a batch manner or by column operation. or,
Gel filtration was also performed using a molecular sieve such as an AcA54 column.

Purification is further carried out using an affinity column carrying heparin and the like, and finally Phenyl 5P
The enhancing factor could be purified and isolated by HPLC using a reverse phase column such as WRP. The degree of purification is 1200-1
It was 500 times.

Using this method and similar methods available to those skilled in the art, the purified and separated present enhancer is subjected to SDS.
Polyacrylamide gel electrophoresis (SDS-PAG
E) and analyzed the purity by silver staining or the like.

Further, the enhancer was subjected to SDS-PAGE,
The obtained single peak was applied to PhastGel or the like to examine the isoelectric point.

At each purification step of the enhancing factor, the purified preparation was added to the splenocyte suspension of MRL / l mouse and cultured for 4 days,
By measuring the amount of anti-DNA antibody produced in the supernatant, and by purifying the purified sample with ss DNA, normal Bal
b / c mouse spleen cell suspension, cultured for 5 to 7 days,
The increase in specific activity per protein weight was examined by calculating plaque forming cells (PFC) targeting SRBC coated with ss DNA.

As shown in FIG. 1, the anti-DNA antibody titer increased depending on the volume of the added serum-free medium culture supernatant. 5% fetal bovine serum-Dulbecc to obtain enhancement factor
o's modified Eagle medium
When cultured with _KML 1 -7 cells [DMEM], whereas enhancement factor tends to suppress the anti-DNA antibody in 40% (vol / vol), enhancement factor obtained in a serum-free medium is still because of the activity allowed to raise anti-DNA IgG antibody titer, serum-free media is found to be suitable for the isolation and purification of the enhancement factor by mass culture of the KML 1 _-7 cells.

When adsorbing the enhancer on DEAE-Sephadex A-50, it is preferable to first perform batchwise elution with a buffer containing 0.3 M Nacl.

Thereafter, the AcA54 column or the like was charged with a potentiating factor, and gel filtration was performed to enhance the potentiating activity of each fraction with PFC.
As shown in Fig. 2, the enhancement factor was about 30 KD.
The molecular weight of a is shown.

Then, DEAE-Sephadex A-50
It can be seen that upon further purification of the enhancing factor by applying it to the column, the enhancing factor is eluted at a salt concentration of 0.2 to 0.3 M NaCl as shown in FIG.

The elution fractions containing the enhancing factor fraction thereafter absorb a large amount of A ₂₆₀ , suggesting that the enhancing factor may form a complex with a certain nucleic acid (DNA). It

After the fraction containing the enhancing factor was further concentrated and filtered, it was charged on a heparin sepharose column, but all the A ₂₈₀ units passed through without adsorbing to the column.

This suggests that the enhancer is not a glycoprotein. Next, this active fraction was injected into Phenyl 5PWRP, and HP
LC was able to obtain a single sharp peak eluting at about 50% acetonitrile as shown in FIG. As shown in FIG. 4, by SDS-PAGE, this enhancer was shown to be a single molecule of about 55 KDa (p55 protein). The isoelectric point (PI) is Phast
It was found to be 5.8 by Gel. A as above
From the elution position of this enhancer on the cA54 column, the apparent enhancer had a molecular weight of about 30 KDa as shown in FIG. 2.
Original molecular weight of about 55 KD by combining with NA
It is considered that it was eluted at a position different from the position of a. The above purification process is summarized in the table below.

[0040]

【table】

This enhancer which selectively increases anti-DNA antibody in vitro was a simple protein (p55), and its entire amino acid sequence was determined. Since this protein was found to be blocked at the N-terminus,
From the peptide obtained by lysyl endopeptidase, steps were taken to determine its partial primary structure.
Chemically synthesizing DNA considered from this partial primary structure,
KM that hybridizes with this as a probe
The isolation of L ₁ -7 cell-derived cDNA clones were carried out.

That is, the protein sample purified by HPLC and further dried was dissolved in 8M urea, and then Tris-HCl (pH 9.0) buffer was added thereto, followed by Ac.
homobacterium protease I, that is,
After digestion with lysyl endopeptidase overnight, the digestion product was subjected to HP using Synchropack RP-8 column.
Separated by LC.

Regarding the two obtained peptide fragments, A
Applied Biosystem 470A on-l
The amino acid sequence was determined with an ine 120A PTH amino acid analyzer.

Peptide fragment 1 is QFEHLDPQNQE
TFEAIDLEL, peptide fragment 2 is LSQELDF
It was VSHNVRTK.

Regarding the peptide fragment 1 consisting of this 20 amino acid residues, the 7 amino acids (QFE
Two types of primers (N and C) consisting of 20 bases capable of coating HLDP and EAIDLEL were synthesized.

These are Is. In the above two types of base sequences, () indicates either one of the two bases, for example, (AG), (T
C) and the like indicate A or G, T or C, respectively.

[0047] _KML 1 -7 to produce cDNA by reverse transcriptase from mRNA prepared from cells, was amplified by PCR using primers N and C the cDNA as a template. After separation by acrylamide gel, about 60 bases were collected and amplified again by the PCR method. The ends were labeled with polynucleotide kinase and [γ- ³² p] ATP, separated by acrylamide gel, and the 59 base pair portion was isolated. The portion of 59 base pairs was amplified again by the PCR method.

The primer is composed of a base sequence obtained by converting a part of the base sequence of these primers, a base sequence with some bases increased or decreased, or a combination thereof, as long as the function of the primer is not impaired. An oligonucleotide having a base sequence is also included in the present invention.

It is also possible to amplify a gene by carrying out PCR using a primer derived from peptide fragment 1 and a primer derived from peptide fragment 2.

Next, the amplified PCR product was bluesc
It was cloned into the ript SKM13 ⁺ vector. D
When the NA base sequence was determined, a DNA capable of encoding the amino acid corresponding to fragment 1 was confirmed (at 2 places, the 146th amino acid in FIG. 5 is H, and E and H
There was a discrepancy. And in the subsequent nucleotide sequence determination, the 151st amino acid is R, and I
And R discrepancy were shown to be present. ). This oligonucleotide consisting of 59 bases was synthesized, labeled with ³² P at the end and used as a probe for K
Doing Northern hybridization against ML ₁ -7mRNA, a band was identified at the 2.2K bases.

[0051]

[0052] On the other hand, from the mRNA prepared by a conventional method from _KML 1 -7 cells, cDNA synthesis kit (eg Am
ersham, Pharmacia, Beth
Boehringe, manufactured by esda Research
(manufactured by r-Mannheim, etc.) was used to prepare a cDNA library, and clones were selected and isolated by plaque hybridization using the above-mentioned 59-base DNA fragment as a probe. Blues as above
Recloning was performed using the script SKM13 ⁺ (S
K-cDNA), and the base sequence of DNA was determined. FIG. 5 shows a part of the nucleotide sequence and the corresponding amino acid sequence.

The structures corresponding to peptide fragments 1 and 2 can be seen in the amino acid sequence of FIG. The base sequence shown in FIG. 5 has a total length of 2156 including a poly A portion at the 3 ′ end on the downstream side.
It is a base sequence consisting of bases. An open reading frame (open reading frame) capable of encoding 455 amino acids that begins with ATG and ends with TAA is included therein.
frame) was present. This simple protein consisting of 455 amino acids and having a molecular weight of 50,410 daltons and an isoelectric point of 4.80 had a region considered to be a leader peptide rich in hydrophobic amino acids at the N-terminus. The basis for this is that the commonality found in leader peptides is the paper by Perlman et al. (D. Perlmand et al: J. Mol. B.
iol. , 167 , 391-409, 1983), Bl.
Obel et al. (G. Blobel et al:
J. Cell. Biol. , 67 , 835-851, 1
975), Walter et al. (P. Walter).
et al: J. Cell. Biol. , 91 , 545
-550 and 551-565, 1981) and the like can be enumerated as follows, and these conditions can be considered to be extremely well applicable to the present enhancement factor p55. That is, as commonality 1. 1. There is a hydrophobic core consisting of around 12 amino acids in the center of the leader peptide. Immediately before the hydrophobic core, a positively charged amino acid (Lys
Or Arg) is present, 3. Following the core part is a sequence that determines β-turn, There are amino acids with short side chains (Ala, Gly, Ser, Cys, Thr) at the C-terminal of the leader peptide, and so on. Looking at p55, MPTSVPR GAPFLLLLPPLMLML SAVLA
It is VPVDR, and it can be judged that these four conditions are satisfied. This enhancer p55 has valine (V) at position 26 as the N-terminus 430
It is considered that the amino acids of the residues are secreted.
When this valine (methionine) was designated as No. 1 (No. 26),
A leucine zipper structure in which 7 leucines (L) are repeated every 7 amino acids from the 321st (346th) to the 363rd (388th) is observed. or,
The region rich in basic amino acids exists from the 146th (171st) to the 192nd (217th).

Next, in order to clarify the properties of this enhancer protein, the protein was produced by gene expression in Escherichia coli or the like. A primer corresponding to the vicinity of the N-terminus And T7 RNA in Bluescript SKM13 ⁺
Polymerase primer (5'AATACGACTCA
PCR is carried out using the above SK-cDNA as a template, and the amplified DNA is Nco
After digestion with I, the above-mentioned 2.2K base DNA fragment was obtained by agarose gel electrophoresis. This is a vector λ Lcl (Lerner vect developed by Lerner
or λLcl; Science, 246 , 1275-.
1280, 1989) and transformed into E. coli.

Lerner vector λ Lcl
Has a Pel B leader peptide with an NcoI cleavage site at its C-terminus. Since the C-terminal of the leader peptide of p55 is different from that of Pel B, the 23rd residue Val and the 24th Leu are Ala,
A synthetic primer (N-term 27me
r) was prepared. Using N-term 27mer and T7 primer (used for sequencing), Bluesc
PCR using DNA (10 ng) in which p55cDNA was cloned in ript SKM13 ⁺ as a template
After amplification by 20 cycles of 94 ° C. for 1 minute, 55 ° C. for 2 minutes, 72 ° C. for 3 minutes, it was digested with Nco I, and the fragment of about 1.9 kb was cloned into the Nco I digestion site of λ Lcl. Fig. 5 shows Lern of p55 cDNA using PCR.
The method of recloning to er vector is shown.
The transformed E. coli was transformed into LB +
The mouse p55 protein was produced by culturing in ampicillin medium or the like and adding IPTG in the logarithmic growth phase. The cultured Escherichia coli was centrifuged at a low temperature, and the cell pellet obtained by collecting the cells was resuspended in Tris-Hcl buffer containing EDTA and sucrose. Then, a buffer diluted with water was added, and p55 protein in periplasma between the cell wall of the bacterial cell and the outer membrane of the cell membrane was recovered by osmotic shock. This protein was separated by SDS-PAGE and pual M
When the N-terminal amino acid sequence was examined by the atusdaira method (J. Biol. Chem., 262 1003).
5-10038), followed by Val, Pro, and Val in that order.

When the present enhancer protein is expressed in yeasts other than E. coli, microorganisms such as Bacillus subtilis, or animal cells, it is necessary to use a vector corresponding thereto.
The present inventors succeeded in producing the present enhancer protein in Escherichia coli and completed the present invention.

According to the present invention, it was revealed that the present enhancer protein isolated and purified from mouse and further gene-expressed in Escherichia coli has the following properties. DNA that appear in the culture solution to the KML ₁ -7 in cell culture
It has a property of binding to (K-DNA) and causing gel shift. It directly acts on the B cell fraction of MRL / l mouse and spleen to increase cell proliferation activity. Directly acts on the B cell fraction of MRL / l mouse spleen,
Promotes the production of G-type anti-DNA antibody. Competitate the binding of anti-DNA antibody and K-DNA
inhibits ive.

Therefore, the enhancement factor p55 protein is D
It has the ability to bind to nucleic acids such as NA, promotes the induction of anti-DNA antibodies in MRL / l mice, and is a lupus-accelerator.
It has an aching property, but is widely nucleic
It is a protein that binds with cids,
The general name of Nucleobindin (hereinafter abbreviated as Nuc) was named.

The enhancement factor p55 produced in E. coli
The amino acid sequence of Nuc is represented by cyanogen bromide (B
It was confirmed that the amino acid predicted from the DNA base sequence was in agreement with the result as determined at 4 sites such as the cleavage site by rCN).

That is, p55 by cyanogen bromide
Hydrolysis of protein is 20% per ml in 70% formic acid.
In a solution containing mg of cyanogen bromide, p55
Are dissolved and allowed to react overnight at 37 ° C. The reaction was then evaporated to dryness and the pellet was dissolved in water, then SDS-
PAGE was performed. At this time, TEFCO WIDEPA
A device such as GE mini can be used. Further, each cleaved fragment in the reaction product was treated with the above-mentioned Paul Matsu.
Western blotting was carried out according to the method of Daira, and then the above Applied Biosystem.
The amino acid sequence was determined with an em470A on-line 120A PTH amino acid analyzer (Fig. 5).

On the other hand, the amino acid sequence near the C-terminus of p55 was also determined. That is, p55 was dissolved in 8M urea, TPCK-treated trypsin was added, and hydrolysis was carried out at 37 ° C. overnight. Thereafter, 100 mM diisopropylfluorophosphate was added to the reaction solution, and 10% acetic acid was further added. Then, this reaction liquid was applied to an anhydrotrypsin agarose column (Takara) to separate hydrolyzed peptide fragments. Blotting device for non-adsorbed fraction (Marysol
KS-8451), 20V, 4 hours, 4 ° C, PVDF
It was blotted on a membrane (Millipore ^R ). It was found that not only the first peptide fragment at the C-terminus but also two other peptide fragments were mixed in the non-adsorbed fraction. When sequencing was performed, the presence of three peptide fragments on the C-terminal side of the leucine zipper was confirmed, and it was revealed that the peptide fragments match the amino acid sequence deduced from the nucleotide sequence (Fig. 5).

[0062] Nuc mRNA is expressed in _KML 1 -7 in cells, Nuc protein is secreted, expression of this Nuc gene, we what is happening in the kidneys of Balb / c normal mice I found it as expected. A small amount of this Nuc gene was expressed in the spleen.

From these findings, the present Nuc which is considered to be directly related to SLE in MRL / l mouse.
In normal mice, the protein has some apopto
It is presumed that it is involved in the processing by the immune system of DNA generated by cell death such as sis.

Further, using the p55 protein cDNA clone isolated from mouse as a probe, a cDNA library of human pheochromocytoma was screened by the plaque hybridization method to obtain a cDNA clone of human Nuc gene. The longest cDNA fragment of about 1.5 Kb (Ec
oRI-EcoRI fragment) to Bluescript S
It was recloned at the EcoRI site of KM13 ⁺ , and its nucleotide sequence and amino acid sequence were determined by the dideoxy method. It was revealed by the present invention that its structure is highly homologous to mouse (FIGS. 7 and 8).

That is, the nucleotide sequence of the DNA fragment from the 24th base to the 1596th base containing the human p55Nuc protein gene and the 3rd to 1553rd base containing the mouse p55Nuc protein gene. It was revealed that there is a high homology of about 90% with the nucleotide sequence of the DNA fragment. Human p55Nu
The amino acid sequences corresponding to the above base sequences of the c protein and the mouse p55Nuc protein consist of 460 amino acid residues in human and 455 amino acid residues in mouse, and the amino acid residue homology between human and mouse (p
erdentity) is about 87%, and its amino acid residue similarity (percentsimilari)
It was confirmed that ty) was about 93%. Regarding the leader peptide, although there are changes between humans and mice, there is a hydrophobic core in the central part, immediately before that there is arginine, which is a positively charged amino acid, and at the C-terminal, an amino acid with a short side chain. It is considered that the function of the leader peptide is completely possessed due to the presence of a certain alanine.

Next, this human p55 protein Nuc
Therefore, a mature protein after cleavage of the leader peptide was produced in Escherichia coli. That is, a synthetic DNA 27mer for the vicinity of the N terminus was prepared, and P27 was formed between it and the T7 primer.
After amplification using the CR method, it was cleaved with the restriction enzyme NcoI and
It was cloned into the NcoI site of the Lcl vector. Lerner using PCR of this human Nuc cDNA
The method of recloning into a vector is shown in FIGS. 9 and 10. Then, as in the case of producing mouse Nuc in E. coli, the E. coli is cultured in LB + ampicillin medium,
It was possible to produce and recover human Nuc. SDS-P
After separating and purifying the protein by AGE, P. Matsuda
When the N-terminal amino acid sequence was examined by the ira method, VPL
It was considered that 5 residues of ER could be detected and a mature protein could be produced in E. coli.

Using the human Nuc protein and the mouse Nuc protein thus recombinantly expressed, various cell biological studies are carried out. Nuc was originally identified as an autoimmune response enhancer, but its chemical structure has various actions, and Nuc may form a heterodimer with an unspecified large number of opponents.

Nu which is actually present in serum or cell extract
c is slightly larger than the original molecular weight of 50,410, and is considered to be bound to the biomaterial of the other party by using the leucine zipper portion.

Further, the DNA binding ability and the presence of the signal peptide may act as a scavenger of nucleosomes or DNAs accumulated in the cell, which may lead to abnormal metabolism in the living body, aging of the cell, or apoptosis (proliferation).
It is pointed out that the relationship with the grammed cell death).

Nuc acts directly on B cells, promotes their proliferation and differentiation, and also acts on T cells, macrophages, dendritic cells and the like to produce various factors that direct B cells to proliferation and differentiation.・ We are guiding.

Mouse and human p obtained according to the invention
A specific study of active center partial peptides responsible for the biological activity of the 55Nuc protein was also conducted. That is, several kinds of gene fragment-deficient mutant clones were prepared based on the mouse Nuc production plasmid mNUC-λLcl. That is, mNUC-λ
The Lcl plasmid was cleaved with the eye-controlling enzyme Xbal, treated with Sl nuclease, the ends were aligned, and the restriction enzyme PmaC was used.
It was cut with I or Eco47III. They were individually self-ligated using T4 DNA ligase, and Escherichia coli XL1-blue was transformed into a clone (this transformed Escherichia coli was named mNUC-delB, Institute of Biotechnology, Ministry of International Trade and Industry, Industrial Technology Institute). Depositary No .: FERM P-1256
6. Deposit date: October 11, 1991 >>). Then, Escherichia coli was cultured and cut with PmaCI in the same manner as that for expressing the mouse Nuc protein. The deletion of 157 amino acid residues from the C terminus including the leucine zipper (deleted from the 199th position to the 455th position) ) Occurred, a protein having a molecular weight of 32,674 and an isoelectric point of 5.08 was produced, and was separated and purified in the same manner as in the case of Nuc. This peptide fragment-deficient mutant protein was named DelZ.
In addition, the one cleaved with Eco47 III had a deletion of 33 amino acid residues from the C-terminus, resulting in a molecular weight of 44,86.
1. A protein with an isoelectric point of 4.89 was produced, and this peptide fragment-deficient mutant protein was named DelC. Incidentally D
For both elZ and DelC, the stop codon used was in the λLcl plasmid, and therefore serine before the stop codon was added. The leucine zipper structure is believed to be a motif for duplex formation (Fig. 11,
(Fig. 13). Then, for convenience of plasmid construction for preparing another gene fragment-deficient mutant clone, the mNUC-λLcl plasmid cleaved with XbaI was further digested with restriction enzyme A.
Cleavage with ccI followed by Klenow digestion to align the ends, self-ligation with T4 DNA ligase, transformation of E. coli XLl-blue to mNUC
-ΛLcl plasmid was constructed. And D of Nuc
The following operations were performed to prepare a protein lacking a basic amino acid region that is considered to be an NA-binding active portion. First, a PCR primer was prepared immediately after the basic amino acid region. 1 for the mouse Nuc cDNA
It has complementarity of 8 bases and has restriction enzymes BamHI and S
5'-GCGAGCTCG with an acI site
GATCCCTGGCAGCCAAGCCCAG-3 '
Is the 31 mer.

The 31mer and 17 primers (5'-
AATACGACTCACTATAG-3 '),
PCR was performed using the mNUC-λLcl plasmid as a template. The condition is 94 ° C lmin. , 55 ℃ 2mi
n. , 72 ° C., 3 min, 25 times. The PCR product, a DNA fragment of about 0.9 Kb, was digested with restriction enzymes SacI and Xb.
cleaved with aI and the λLcl plasmid was digested with the restriction enzyme SacI
And cloned with XbaI. The plasmid was cleaved with restriction enzymes EcoRl and BamHI, and an EcoRl-Sau3Al fragment (about 0.5 Kb) cut out from the mNUC-λLcl plasmid was cloned therein.

Thus, a gene fragment-deficient mutant clone corresponding to the basic amino acid region was obtained. Escherichia coli transformed with this clone was cultivated to produce a protein having a molecular weight of 42,528 and an isoelectric point of 4.53 in which the basic amino acid region has 64 amino acid residues deleted (deletion from the 158th position to the 220th position). This peptide fragment-deficient mutant protein was named DelB (FIGS. 12 and 13).

The biological activity of these mutant proteins and the recombinantly expressed Nuc protein was determined by comparing the Ig of MRL / l mouse B cells with Ig.
FIG. 14 shows the results of comparison of G-type anti-DNA antibody production, IgM and IgG antibodies, and B cell proliferation.
Nuc has various biological activities, but lack of leucine zipper impaired cell proliferation, IgM production, and induction of IgG production. In addition, the effect of Nuc on cell proliferation and IgM production was diminished by the lack of the basic peptide portion.
The role of the basic peptide moiety and especially the leucine zipper substructure appeared to be essential for the various biological activities of Nuc. Like the recombinantly expressed Nuc protein bulk powder, these peptide fragment-deficient mutant protein bulk powders are considered to be useful for determining the higher-order structure of the protein by NMR analysis or crystallization and X-ray analysis.

According to the present invention, detection and isolation from mouse, human, etc., purification or cloning of the gene thereof,
Furthermore, this enhancer protein (N, N, etc.) of mouse, human, etc., which was expressed and produced in Escherichia coli etc.
uc) is for measuring an antibody against this enhancement factor produced / present in the living body using this protein as an antigen,
It can be used as an antigen protein for antibody measurement. It can also be used as an antigen for producing a polyclonal antibody or a monoclonal antibody. In particular, rabbit, horse and other polyclonal antibodies against human Nuc, mouse monoclonal antibodies,
Furthermore, a human type monoclonal antibody is prepared by a conventional method,
Using them, a measurement system such as RIA, EIA, or FIA can be prepared, and for example, the present enhancer protein Nuc in the blood, tissue cells and outside of tissue cells of autoimmune disease patients and animals can be quantified. , For example, human autoimmune disease, immunodeficiency disease, metabolic disease, genetic disease,
It becomes possible to grasp and diagnose the pathological condition of cancer and the like. Further, the present polyclonal antibody and monoclonal antibody can be applied to the treatment of patients with autoimmune diseases and animals.

On the other hand, p55Nuc protein gene DNA isolated from mouse and human according to the present invention
Fragment or DNA fragment thereof, or p55Nu
Using a larger DNA fragment containing the c protein gene as a probe, tissues and cells of human and animal organs, H
Humans such as L-60, HeLa cells and NIH3T3 cells,
A gene DNA fragment encoding a protein having or not having the same function as p55Nuc protein of human and various animals and plants such as animal-derived cells, blood and body fluid, and microorganisms, or a larger DNA fragment containing the gene,
It became possible to isolate by the hybridization method.

Furthermore, an arbitrary part of the nucleotide sequence of the human and mouse p55Nuc protein genes revealed by the present invention is selected, a DNA primer for PCR is synthesized, and the unknown primer is synthesized using the primer. It has also become possible to amplify, synthesize and isolate genes of various animals and plants and microorganisms. These techniques are also included in the scope of the present invention.

The present invention is described in detail below with reference to examples, but the present invention is not limited to these.

[0079]

Example 1 (a). A large amount taken first 25cm ² flask of KML ₁ -7 cell culture supernatant (Corning, 25100) complete medium 5% fetal bovine serum at (fetal bovine
serum, hereinafter FBS), 2 mM glutamine, 10
Dulbecco's mod containing mM Hepes, 100 U / ml penicillin, 100 μg / ml streptomycin, 50 μM 2-ME (mercaptoethanol).
if the Eagle Eagle medium [DMEM])
(FBS-DMEM) under, culturing the _KML 1 -7 cells were confluent ^(~10 6 / ml). next,
Expansion culture was carried out in a 75 cm ² flask (Corning, 25110). Then collected ^KML 1 -7 cells by centrifugation, serum-free medium (Haimedimu 606, Kohjin) was suspended in ^{(4 × 10 6 cells / 32ml} ). Then 60 ml
Large flask containing high medium (156502,
1 ml (1.25 × 10 ⁷ cells) for each Nunc)
And suspend it in a CO ₂ incubator (5% CO ₂ , 3
The cells were cultured at 7 ° C for 3 days. Then 3,000 rotations, 15
After collecting the culture supernatant by centrifugation for 5 minutes and immediately adding 0.5 mM of serine protease inhibitor PMSF,
It is filtered with a Sterivex filter (0.22 micron) and then about 20 using an ultrafiltration membrane, PM-10.
It was concentrated 0 to 250 times. Centrifugation and aseptic filtration were performed in the same manner as when the culture supernatant was collected, several batches were collected at this stage, and the next purification step was performed. This was done and at this stage several batches were collected and proceeded to the next purification step.

(B). Separation of DNA antibody production enhancer by gel filtration method 2 ml of culture supernatant concentrated 100 to 150 times
55 cm AcA ₅₄ column [(50 mM Tris /
100 mM NaCl buffer) (pH 8.0) ... A below
2 ml each was collected and the elution site of the enhancing activity fraction was determined.

(C). Separation of enhancing factor by anion exchange column chromatography First, DEAE-sephadex A-50 was equilibrated with solution A, and then a column of 1 × 14 cm was prepared, and the active fraction obtained in (b) was added to this column. When the column was charged and the column was washed with the solution A, and the A ₂₈₀ became 0.1 or less, the enhancing activity fraction was adjusted from 100 mM to 600 mM of NaCl in the solution A.
It was separated and eluted by applying a concentration gradient to reach mM.

(D). The heparin column fraction (1 × 10 cm) activated with the solution A was charged with the fraction containing the enhancing substance obtained by the treatment with the heparin column of the enhancing factor (c),
The presence or absence of adsorbability of the enhancer on heparin was examined by A ₂₈₀ .

(E). Separation and purification of enhancer by HPLC After equilibrating the reverse phase column Phenyl 5PWRP with a solution containing 0.05% trifluoroacetic acid and 7% acetonitrile, the heparin column treatment enhancer carried out in (d) was injected. Then, after elution with 7% acetonitrile, the enhancing substance was isolated with an acetonitrile concentration gradient of up to 70%.

(F). A single peak obtained by SDS-PAGE (e) was analyzed by SDS-added 12% polyacrylamide gel electrophoresis (SDS-PAGE), and its purity was examined by silver staining.

(G). The single peak obtained by the isoelectric point fractionation (e) was analyzed by Phast Gel (IEF 3-9 Gel).
and the isoelectric point was examined.

(H). Reaction system for measuring enhancer activity (1) Reaction system using suspension of MRL / l mouse splenocytes Suspension cells of 4 to 6 months old MRL / l mice were treated with Hank's
After forming a single floating cell in Balanced Salt Solution (hereinafter abbreviated as HBSS), 5
Prepared to 2 × 10 ⁶ cells / ml with% FBS-DMEM, added a sample containing an enhancer, and cultured in a 48-well cluster dish for 4 days. The anti-DNA antibody in the supernatant was prepared by the method described below. It was measured.

(2) Reaction system using spleen cell suspension of normal mouse Female 10-week-old BALB / c was preliminarily primed with ssDNA, and 5 to 7 days later, spleen cells were made into single suspension cells with HBSS, and (h ) -After culturing as in (1), ssDN
The plaque forming cells (hereinafter abbreviated as PFC) as SRBC targets coated with A (described later) were calculated.

(I). Enhancing activity measuring method ELISA method Imron No. After exposing a 96-well plate made of 1 polystyrene to a germicidal lamp for 16 hours, immediately add 50 μl of 1 μg / ml single-stranded (ss) DNA (derived from calf thorax),
Incubated for 2 hours at room temperature. Next, Tris buffer containing 5% FBS and 0.05% Tween 20 (25 mM Tr
DNA in is, 140 mM NaCl, pH 7.4)
The non-adsorbed site was blocked to prepare an antigen-adhered plate.
After inactivating the culture supernatant obtained in (h)-(1), 50 μl of the culture supernatant was added to the antigen-attached plate, and the antibody bound to the antigen like the type was measured by the alkaline phosphatase standard secondary antibody for each class.

(2) PFC SRBC was coated with ssDNA by the chromium chloride method, and anti-ssDNA PFC was calculated by the method of Cunningham. In this system, the enhancing activity that gives 50% of the maximum PFC is 1
As a unit, the activity of the sample was displayed in the total unit.

[0090]

Example 2 (a). Amino Acid Sequence Sequencing of Enhancer Mouse Nuc Protein 7 μg of p55 protein preparation, which was purified using HPLC and dried, was dissolved in 50 μl of 8M urea, 37
Incubate at 15 ° C for 15 minutes, then add 150 µl of 50 mM Tris-HCl buffer (pH 9.0), and then add Ach.
romobacter protease I, that is, lysyl endopeptidase (Masaki, T. et a.
l; Agric. Biol. Chem. , 42 , 144
3, 1978) was added thereto, and the mixture was decomposed at 37 ° C. overnight.
The decomposed product was subjected to HPLC (Waters 490) using a Synchropack RP-8 column, and separated with a trifluoroacetic acid-acetonitrile (0-60% concentration gradient) system. For the obtained two peptide fragments, Applied Biosystem 470A was used.
The amino acid sequence was determined with an on-line 120A PTH amino acid analyzer. Peptide fragment 1 is QFE
HLDPQNQETFEAIDLEL, peptide fragment 2
Was LSQELDFVSHNVRTK.

(B). Synthesis of PCR Amplification Primer For peptide 1, two types of primers N and C consisting of 20 bases capable of encoding 7 amino acids (QFEHLDP and EAIDLEL) located at both ends thereof were synthesized by a known conventional method.

(C). KML ₁ -7 cDNA library construction KML ₁ -7 Chirguin's method from cells of the cell (Ch
irguin, J .; J. et al; Biochemi
Str., 18 , 5294, 1979).
A was prepared by a method using guanidine isothiocyanate-cesium chloride. poly (A) ⁺ RNA is A
Viv &Leder's method (Aviv, H. et.
al; J. Mol. Biol. , 134 , 743, 19
72) and purified through an oligo (dT) cellulose column several times. poly (A) ⁺ RNA 0.5μ
g, 5 × MMLV buffer (0.25M Tris-HCl, p
H8.3, 0.375M potassium chloride, 15 mM magnesium chloride, 50 mM dithiothreitol), 10 mM
dNTPs (dATP, dGTP, dCTP, dTT
P) and oligo (dT) primers are added to water and S
cD using the trata Gene cDNA synthesis kit
NA was synthesized. This cDNA was separated and ligated to a λgtll arm. A library of recombinant phages was prepared from the cDNA and λgtll arm using a lambda phage packaging extract (Gigapack Gold II-Stratagene).

(D). PCR Amplification Perkin Elmer Cetus DNATh
PCR was performed using the armal Cycler. Amplification conditions are denaturation at 94 ° C for 1 minute → ann
2 minutes at 37 ° C for ealing → 7 for extension
40 cycles were carried out at 2 ° C. for 30 seconds, and ethanol was added to the reaction solution to precipitate the amplified DNA.

(E). Purification of DNA The DNA obtained in (d) was dissolved in a buffer and subjected to electrophoresis using 10% polyacrylamide gel (PAG).
E), a gel around 60 bases was cut out, and 200 μl of T
E-buffer was added and the DNA was eluted by occasional shaking.

(F). Re-PCR PCR of the DNA obtained in (e) again in the same manner as in (d)
Amplified.

(G). Purification of DNA Perform PAGE in the same manner as in (e), cut out a gel in the vicinity of 60 bases as in (e), add 200 μl of TE buffer,
The DNA was eluted. It was then treated with phenol and ether, after which the DNA was precipitated with ethanol. This ethanol pellet was dissolved in 10 μl of TE buffer, and DN was treated with polynucleotide kinase and [γ- ³² p] ATP.
The A terminus was labeled.

Then, PAGE was performed on a sequence gel to isolate the 59 base pair gel portion, and 200 μl of TE was isolated.
Elute in buffer.

(H). Re-PCR again Using the DNA solution obtained in (g), PCR was performed again.

(I). Purification of DNA probe The PCR product obtained in (h) was separated by PAGE, and the main band was eluted in 400 µl of TE buffer. It was treated with phenol and ether as in (g), and then the DNA was precipitated with ethanol. Add DNA pellet to 10 μl TE
Dissolved in buffer.

(J). Determination of nucleotide sequence of DNA probe The DNA obtained in (i) was bluescript by a conventional method.
Single-stranded DNA was prepared by ligating to SKM13 ⁺ , and sequenced by the dideoxy method.

(K). Preparation of cDNA library by Amersham cDNA synthesis kit 5 μg of Poly (A) ⁺ RNA obtained in (c) was synthesized with reverse transcriptase to synthesize the first cDNA. Then, the second cDNA was synthesized using DNA polymerase I and RNaseH. Then, it was treated with T ₄ DNA polymerase and further treated with EcoRI methylase. The EcoRI linker was ligated to the cDNA and then hydrolyzed with EcoRI. This cDNA was separated by gel filtration with Sephadex G-150 and ligated to a λgt10 arm. Then, a recombinant phage library was prepared using the lambda phage packaging extract.

(L). Based on the results of plaque hybridization (j) with a 59-base probe, 5'AG (CT) TC (CG)
AG (GA) TC (GA) AT (GA) GC (CT) T
CAAACGTGTGCTGGTTCTGAGG (G
A) TC (CG) AG (GA) TG (CT) TC (G
A) A DNA probe having the sequence of AA (CT) TG3 'was synthesized. (K). Plaque hybridization was carried out using this probe from the cDNA library obtained in step 1 above, and positive clones were selected, propagated, and Blu
Recloned into escript SKM13 ⁺ (S
K-cDNA) and DNA were sequenced.
Then, a sequence of 2159 bases containing a poly A portion at the 3'end was determined. The nucleotide sequence is shown in Fig. 5. The ope that can encode 455 amino acids beginning with ATG and ending with TAA
It became clear that n reading frame was present. The corresponding amino acid sequence is also shown.

[0103]

Example 3 Production of the present enhancer p55 mouse Nuc protein in Escherichia coli (a) Using the SK-cDNA obtained in (l) of Example 2 as a template, a 27mer fragment corresponding to the N-terminal region of p55 mouse Nuc protein was prepared. Oligonucleotide (Fig. 6) was synthesized as a primer, and this was combined with Bluescript.
PCR was performed in combination with T7 RNA polymerase primer (5′AATACGACTCACTATAG3 ′) in SKM 13 ⁺ . 94 ℃ 1 minute → 55 ℃ 2
The reaction was performed for 20 minutes → 72 ° C for 3 minutes to obtain a PCR product. It was treated with phenol and ether and then DNA was precipitated with ethanol. 20 DNA pellets
After dissolving in μl of TE buffer and digesting with NcoI, agarose gel electrophoresis was performed, and a band of 2.2K bases was cut out and eluted with 10 μl of TE buffer. This 2.2K
Ligation of DNA fragment of Lerner into Lerner vector λLcl
and transformed into E. coli XLl-blue. This E. coli Mp55 mouse Nuc cDNA (X
Ll-blue / λLcl-cDNA) [Deposited under the Budapest Treaty with the Institute of Microbial Technology, Ministry of International Trade and Industry, Industrial Technology Institute (Deposit number: FERMBP-317).
0 Deposit date: November 22, 1990). ] To LB-Am
p medium (containing 50 mg / l of ampicillin) at 30 ° C
The cells were cultured and proliferated in.

The OD of the culture medium at 650 nm was measured. D. Was 0.5, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to the culture solution to a final concentration of 1 mM, and the culture was continued for another 4 hours. Then, the cells were collected by centrifugation at 4 ° C. for 5000 G for 10 minutes, and the bacterial cell pellet obtained was 0.2 M Tris-HCl, pH 8.0, 0.5.
The cells were resuspended in TES buffer containing 20 mM EDTA and 0.5 M sucrose (20 ml volume per liter of the original culture solution). Then, TES buffer diluted 1: 4 with water was added to the cell suspension to disrupt the osmotic pressure, and the mixture was allowed to stand on ice for 30 minutes. Then, this suspension was centrifuged at 10,000 G for 10 minutes, and the supernatant was separated. This supernatant contains 1
This enhancer p55 mouse Nuc protein 1 per 1
It contained 0 mg.

(B) Partial sequencing for confirmation of the amino acid sequence of this enhancement factor p55 mouse Nuc .....
Cleavage with cyanogen bromide 70 μg of dry p55 mouse Nuc protein 10 μg
The solution was dissolved in 50 ml of a solution containing 20 mg of cyanogen bromide in 1 ml of 1% formic acid, and reacted overnight at 37 ° C. Then dry the reaction to 10 μl of the pellet
Dissolved in water, and then SDS-PAGE TEFCO
It was performed using WIDE PAGE mini. Western blotting was performed according to the method of Paul Matsudaira described above, and then Applied
Biosystem 470Aon-line 12
The amino acid sequence was determined with a 0A PTH amino acid analyzer (Fig. 5).

(C) Confirmation of Amino Acid Sequence by Trypsin Decomposition of p55 Mouse Nuc 100 μg of dry p55 powder was dissolved in 25 μl of 8 M urea solution, and dissolved at 37 ° C. for 15 minutes. 0.1M N
75 μl of H ₄ HCO ₃ solution was added, 1 μg of trypsin treated with TPCK was further added, and hydrolysis was carried out at 37 ° C. overnight. Thereafter, 1 µl of 100 mM diisopropyl fluorophosphate was added to this reaction solution, and further 5 µl of 10% acetic acid was added. Then, this reaction solution was applied to an anhydrotrypsin agarose column (Takara) in an amount of 1 ml to separate hydrolyzed peptide fragments. The non-adsorbed fraction was analyzed with a blotting device (Marysol KS-8451) for 4
℃, 20V, 4 hours, PVDF membrane (Mill
blotted to Ipore ^R ). It was found that the non-adsorbed fraction contained not only the first peptide fragment at the C-terminus but also two other peptide fragments. When sequencing was performed, the presence of three peptide fragments on the C-terminal side of the leucine zipper was confirmed, and it was revealed that the peptide fragments match the amino acid sequence deduced from the nucleotide sequence (Fig. 5).

[0107]

Example 4 p55 mouse Nu obtained in Examples 2 and 3
300 μg of c protein was added to 50 mM Tris-HCl, 1
Dissolve in 0.5 ml of pH 8.0 buffer containing 00 mM NaCl and 0.5 mM PMSF, mix with an equal volume of Freund's complete adjuvant, and weight
Mix well until a state of "r in oil" is reached. This emulsion was injected into a total of 8 foot pads of the four fingers of a New Zealand white female rabbit hind limb so that a total of 1 ml of wheal was formed and immunized. Three weeks later, the same amount of the antigen emulsion containing Freund's incomplete adjuvant was injected into four sites on the back. Blood was collected 10 days later and the antibody titer was measured. After that, whole blood was collected to obtain antiserum. This antiserum containing a polyclonal antibody against p55 mouse Nuc protein is
Anti-DNA antibody production enhancing action of KML ₁ -7 cell culture supernatants were completely blocked. The cells were also stained well.

[0108]

Example 5 p55 mouse Nu obtained in Examples 2 and 3
In the same manner as in Example 4, c protein and Freund's complete adjuvant were mixed in equal amounts, and Lewis rats were immunized, spleen cells were collected, cell fusion was performed with mouse myeloma cells, and hybridomas were prepared. p
A monoclonal antibody against 55 mouse Nuc was obtained.

[0109]

Example 6 c of 2.2K base obtained in (l) of Example 2
Based on the nucleotide sequence of the DNA, the 2.2K DNA fragment prepared in (a) of Example 3 was used as a probe to screen genomic DNA of the normal Balb / c mouse kidney. From this normal Balb / c mouse, a gene that hybridizes with this probe could be cloned.

[0110]

Example 7 c of 2.2K base obtained in (l) of Example 2
Based on the nucleotide sequence of DNA, the 2.2K DNA fragment prepared in (a) of Example 3 was used as a probe for cDNA of human pheochromocytoma.
The library was screened. p55 mouse Nu
human c encoding human Nuc corresponding to c protein
A DNA clone was obtained. When its nucleotide sequence was determined, it was found to have extremely high homology to the mouse cDNA and also extremely high homology to the corresponding amino acid sequence (Figs. 7 and 8).

Cloning of human p55Nuc cDNA Using the mouse p55Nuc cDNA as a probe, a human pheochromocytoma cDNA library was screened by the plaque hybridization method. The library used was to prepare mRNA from tissues extracted from human and pheochromocytoma patients by a conventional method, synthesize cDNA using a cDNA synthesis kit (Amersham), and connect to λgtll to prepare about 500,000 cells. It consisted of individual cranes. This cDNA
A random hexamer was used as a primer for synthesizing. It was possible to obtain 10 clones showing a positive signal by plaque hybridization. Among them, after cloning the DNA from the phage having the longest cDNA insert of about 1.5 Kb, the cDNA fragment (E
(coRI-EcoRI fragment) of SK M13 + Eco
It was recloned at the RI site and the band sequence was determined by the dideoxy method. Since a random hexamer was used as a primer as described above, the polyA portion was not included, but the coding region translated into the protein was completely retained.

When comparing human and mouse, C-terminal 2
There are insertions of 4 amino acid residues and 3 amino acid residues at one site, and deletion of 2 amino acid residues at one site.
There were 460 amino acid residues for 5 amino acid residues.
At the protein level, about 90 in the coding region
% Homology, and especially in the central part (No 40 to N
In o349), it was found to have a high homology of 95% or more. The leader peptide varies between humans and mice, but there is a hydrophobic core in the central part, and a positively charged amino acid (A
rg) and a short sequence band amino acid (Al
Since a) exists, it was considered that the leader peptide has a complete function. Therefore, in order to generate the mature protein of the leader peptide cleaving machine in E. coli, N
Create a synthetic DNA 27mer near the end and
After amplification with the primer using the PCR method, it was cleaved with a restriction enzyme and cloned into the Ncol site of the λLcl vector.

[0113]

Example 8 Production of the present growth factor p55 human Nuc protein in E. coli Mature p55 human Nuc after cleavage of the leader peptide
In order to produce the protein, a synthetic DNA27mer for the vicinity of the N-terminus of p55 human Nuc protein was synthesized as a primer, and T7RNA was synthesized in the same manner as in Example 3.
SK obtained in Example 7 with the polymerase primer
-A clone was amplified by PCR using cDNA as a template, then cleaved with the restriction enzyme NcoI, and cloned into the NcoI site of the λLcI vector (Fig. 9). This E. coli Hp55 cDNA (XL1-blue / λLcl
-CDNA) [Deposited to the Institute of Microbial Technology, Ministry of International Trade and Industry, based on the Budapest Treaty (Deposit Number: FERMBP-3209, Deposit Date December 1, 1990.
9th). ] Are cultured and grown in the same manner as in Example 3,
As a post-treatment, p55 human N was added per liter of the original culture solution.
10 mg of uc protein was obtained. This protein is p
It was confirmed that the mouse 55 Nuc protein shows cross-reactivity with the rabbit polyclonal antibody prepared in Example 4.

[0114]

Example 9 300 μg of the p55 human Nuc protein obtained in Example 8 was injected in the same manner as in Example 4 into eight foot pads of the New Zealand white female rabbit hindlimbs in a total of eight foot pads in the form of an emulsion with an adjuvant. And immunized.
Blood was collected and the antibody titer was measured every few weeks thereafter, and when the antibody titer had risen, whole blood was collected to obtain antiserum. p5
This serum containing a polyclonal antibody against 5 human Nuc protein was used for various tests.

[0115]

Example 10 Using the anti-mouse Nuc antibody or the anti-human Nuc antibody obtained in the present invention for serum or the like body fluids or tissues of animals such as mice, human serum or the like body fluids or tissues and various animals and human cells, When Western blot of each body fluid such as blood or tissue / cell extract was performed, a band was observed in the part corresponding to mouse Nuc and human Nuc of p55, and further, a high molecular weight side, for example, a 10,000 high molecular weight side in terms of molecular weight A band located at was detected.

[0116]

Example 11 Mouse Nuc Production Plasmid m
The NUC-λLcl plasmid was digested with the restriction enzyme Xbal, treated with Sl nuclease to align the ends, and digested with the restriction enzyme PmaCI. They were individually self-ligated with T4 DNA ligase and transformed into E. coli XL
l-blue was transformed into a clone (this transformed Escherichia coli was named mNUC-delZ, and has been deposited with the Institute of Biotechnology, Ministry of International Trade and Industry, Industrial Technology Institute; Deposit No: FERM P-12568, Date of deposit: October 11, 1991 >>). Then, this E. coli was cultured in the same manner as that for expressing the mouse Nuc protein,
Depending on the cutting process, C including leucine zipper
Deletion of 157 amino acid residues from the end (from 199th to 4th)
(Deletion up to the 55th position) occurs, a protein having a molecular weight of 32,674 and an isoelectric point of 5.08 is produced, and is separated and purified in the same manner as in Nuc, thereby obtaining a peptide fragment-deficient mutant protein DelZ. I was able to.
The amount of DelZ produced was 10 m / l of the original culture solution.
It was g.

[0117]

[Example 12] In Example 11, instead of PmaCI, when Eco47 III was used for the cleavage, 33 amino acid residues were deleted from the C-terminal, the molecular weight was 44,861, and the isoelectric point was 4. 89 protein was produced and separated and purified in the same manner as in Nuc to obtain a peptide fragment-deficient mutant protein D
ElC could be obtained. The amount of DelC produced is
It was 10 mg per liter of the original culture (this DelC
Escherichia coli that produces Escherichia coli is named mNUC-delC, and has been deposited with the Institute of Biotechnology, Institute of Industrial Science and Technology, Ministry of International Trade and Industry (deposit number: FERM P-12567, deposit date: October 11, 1991).

[0118]

Example 13 mNUCs-λLc cleaved with Xbal
The l plasmid was further cleaved with the restriction enzyme AccI, the ends were then aligned with the Klenow fragment, and self-ligated with T4 DNA ligase to give E. coli XL1-b.
lue was transformed to construct mNUC-λLcl plasmid. Then, the following procedure was performed to prepare a protein lacking the basic amino acid region that is considered to be the DNA-binding active portion of Nuc. First, a PCR primer was prepared immediately after the basic amino acid region. It has 18 bases of complementarity to the mouse Nuc cDNA,
And having restriction enzymes BamHI and SacI site, 5'-GCGAGCTCCGGATCCCTGGGCA
It is a 31mer of GCCAAGCCCAG-3 '.

The 31mer and T7 primer (5'-
AATACGACTCACTATAG-3 '),
PCR using mNUCs-λLcl plasmid as a template
I went. The condition is 94 ° C lmin. , 55 ℃ 2m
in. , 72 ° C., 3 min, 25 times. The PCR product, a DNA fragment of about 0.9 Kb, was cleaved with restriction enzymes Sac1 and Xbal, and the λLcl plasmid was used as an eye-catching enzyme Sa.
It was cloned into those cut with cl and Xbal.
The plasmid was cleaved with restriction enzymes EcoRI and BamHI, and an EcoRI-Sau3AI fragment (about 0.5 Kb) cleaved from the mNUC-λLcl plasmid was cloned therein.

Thus, a gene fragment-deficient mutant clone corresponding to the basic amino acid region was obtained. Escherichia coli transformed with this clone was cultivated to produce a protein having a molecular weight of 42,528 and an isoelectric point of 4.53 in which the basic amino acid region has 64 amino acid residues deleted (deletion from the 158th position to the 220th position). Thus, DelB, which is a peptide fragment-deficient mutant protein, could be obtained. Incidentally, D
The production amount of elB was 10 mg per liter of the original culture solution (E. coli that produces this DelB was mNUC-de.
It is named IB and has been deposited at the Institute of Biotechnology, Ministry of International Trade and Industry, Industrial Technology Institute. << Deposit Number: FERM P-12
566, Deposit date: October 11, 1991 >>).

In the above description and in the drawings, the alphabets in the amino acid sequences indicate the following amino acids, respectively.

[0122]

INDUSTRIAL APPLICABILITY According to the present invention, the presence of a DNA-binding protein which enhances the production of anti-DNA antibody can be determined simply by MRL / l.
Not only from the mice KML 1 _-7 cells was demonstrated to be present in widely tissue within cells in normal animals as well as autoimmune diseases animals only. Furthermore, the gene encoding this enhancer was cloned, recombined into Escherichia coli or the like, gene expression was performed, and it became possible to produce the enhancer protein. Then, using this protein as an antigen, it became possible to measure an antibody against this enhancement factor produced and present in the living body. In addition, by immunizing animals with this protein as an antigen,
It became possible to produce polyclonal antibodies and monoclonal antibodies in vitro, and it became possible to quantify the DNA binding protein using these antibodies. In this way, the present p55 human Nuc protein, mouse Nuc protein or an antibody thereto can be used for grasping, diagnosing and treating the pathological condition of patients with autoimmune diseases and animals.

In particular, the monoclonal antibody can be applied to the diagnosis and treatment of human autoimmune diseases, immunodeficiency diseases, metabolic diseases, genetic diseases, cancer and the like.

As described above, the present invention is not limited to biological science,
The significance of the present invention is epoch-making and extremely important because it can be utilized not only for basic research in basic medicine but also for diagnosis and treatment in clinical medicine.

[Brief description of drawings]

Figure 1 is a graph showing the relationship between the mixing capacity of the serum-free medium culture supernatant of the prior application KML 1 _-7 cells and anti-DNA antibody production enhancing activity

FIG. 2 is a graph showing the PFC activity of each fraction when the fraction containing this enhancement factor was charged to an AcA54 column and further purified by gel filtration.

FIG. 3 shows the concentration of NaCl and PFC activity and protein concentration of each fraction when the fraction containing the present enhancement factor shown in FIG. 2 was applied to a DEAE-Sephadex A-50 column and further eluted with a buffer containing NaCl. And graph showing the relationship with nucleic acid concentration

FIG. 4 shows that the fraction containing this enhancement factor shown in FIG.
A graph showing the elution position of this enhancement factor and the acetonitrile concentration of each fraction, and the electrophoretic pattern for determining the molecular weight of this enhancement factor when injected into 5PWRP and subjected to HPLC and eluted with acetonitrile (CH ₃ CN). Showing the graph

FIG. 5 is a sequence diagram showing a nucleotide sequence of a DNA fragment containing a mouse gene encoding the present enhancement factor p55Nuc obtained in the example of the present invention and an amino acid sequence corresponding thereto.

FIG. 6 P of this enhancement factor p55 mouse Nuc cDNA
Diagram showing the method of recloning into Lerner vector using CR

FIG. 7 is a comparison diagram of the nucleotide sequence of the DNA fragment containing the human gene encoding the enhancement factor p55Nuc (upper row) and the nucleotide sequence of the DNA fragment containing the mouse gene (lower row) obtained in the examples of the present invention ( In the figure, | indicates that they are common.)

FIG. 8 is a comparison diagram of the human amino acid sequence (upper row) and the mouse amino acid sequence (lower row) of this enhancement factor p55Nuc.

FIG. 9: Ler using PCR of human Nuc cDNA
and a diagram showing a method of recloning into a Lerner vector and Lerner vector λLcl and human Nuc cDN
Diagram showing the base sequence of the A leader part

FIG. 10: PelB signal pep of λLcl
Diagram showing that mNUC is ligated downstream of side after amplification by PCR

FIG. 11 is a diagram showing a generation process of DelZ and DelC.

FIG. 12 is a diagram showing a generation process of DelB.

FIG. 13: rNuc, DelB, DelZ and DelC
Diagram showing the schematic structure of each protein in

FIG. 14 is a graph showing the biological activity of rNuc, DelB and DelZ proteins.

Continuation of the front page (51) Int.Cl. ⁵ Identification number Office reference number FI technical display location C12N 15/10 15/12 ZNA C12P 21/00 C 8214-4B 21/08 8214-4B C12Q 1/68 A 7823 -4B G01N 33/53 D 8310-2J // (C12P 21/00 C12R 1:19) (C12P 21/08 C12R 1:19) (72) Inventor Keiji Miura 1-141 Taiko, Midori-ku, Aichi Prefecture (72) Inventor Yasukazu Tanuma 1-1019 Komoncho, Hachioji-shi, Tokyo (72) Inventor Yoshikazu Kurosawa 1-39 Ogimachi, Meito-ku, Nagoya-shi, Aichi (72) Inventor Akira Awaya Yabe, Totsuka-ku, Yokohama-shi, Kanagawa Town 1541

Claims (28)

[Claims] 1. A protein derived from a biological tissue / cell, which enhances anti-DNA antibody production and binds to DNA. 2. The DNA binding protein according to claim 1, wherein the biological tissue / cell is a tissue / cell of an autoimmune disease animal or an animal not corresponding to an autoimmune disease. 3. The DNA binding protein according to claim 2, wherein the biological tissue / cell is a human or mouse organ, organ-derived cell or lymphoid cell. 4. A biological tissue-cells, according to claim 3, wherein the DNA-binding protein, which is a MRL / l KML 1 _-7 cell lines derived from lymphoid cells of mice. 5. A DNA binding protein MRL / l mouse anti-DNA of _KML 1 -7 cell lines derived from lymphoid cells of
The DNA binding protein according to claim 3, which is derived from a human having a high homology with the protein which is an antibody production enhancing factor. 6. A gene derived from a biological tissue / cell, which has a nucleotide sequence which corresponds to the amino acid sequence of a protein which enhances anti-DNA antibody production and binds to DNA. 7. A DNA fragment containing the gene according to claim 6. 8. The DNA fragment according to claim 6 or 7, wherein the gene contained therein encodes the mouse-derived DNA binding protein according to claim 4. 9. The DNA fragment according to claim 6 or 7, wherein the gene contained therein encodes the human-derived DNA binding protein according to claim 5. 10. A DNA fragment which can be obtained by selecting an appropriate base sequence of the gene according to claim 6 and amplifying it by the PCR method using the base sequence or an approximate base sequence as a primer. 11. KML 1 _-7 under cell lines exist serum, was cultured to confluence, concentrated in large quantities cultured culture supernatant in a serum-free medium, adsorbed on the anion exchange resin, 0.2 M The method for producing a DNA-binding protein according to claim 1, wherein the eluted fraction is purified by adding the above salt. 12. A DNA fragment containing a gene of interest, which is obtained by performing plaque hybridization as a result of plaque hybridization using the DNA fragment according to claim 7 as a probe. 13. As a result of performing plaque hybridization using the DNA fragment according to claim 7 as a probe, a DNA fragment containing the gene of interest is obtained by utilizing the fact that it hybridizes. Method of manufacturing. 14. The DNA according to claim 8 as a probe.
The method according to claim 13, wherein the fragment is selected to obtain the DNA fragment according to claim 9 which encodes the human-derived DNA binding protein according to claim 5. 15. The DNA according to claim 9 as a probe.
The method according to claim 13, wherein the fragment is selected to obtain the DNA fragment according to claim 8 which encodes the mouse-derived DNA binding protein according to claim 4. 16. A method for cloning a target gene by performing plaque hybridization using the gene according to claim 6 as a probe. 17. The gene according to claim 6 as a gene according to claim 5.
The method according to claim 15, wherein the gene encoding the human-derived DNA binding protein is selected. 18. The gene according to claim 6 as a gene according to claim 4.
The method according to claim 16, wherein the gene encoding the mouse-derived DNA binding protein is selected. 19. The gene according to claim 6, which encodes the DNA-binding protein according to claim 4, or the DNA fragment according to claim 7, is expressed in various recombinant microorganisms such as Escherichia coli and yeast. Claim 4
A method for producing the described DNA binding protein. 20. The DNA-binding protein according to claim 1 is used as an antigen, whereby the D present in a living body.
A method for measuring the abundance of an antibody against an NA-binding protein. 21. An antibody of an animal obtained by immunizing an animal with the DNA-binding protein according to claim 1 as an antigen. 22. The antibody according to claim 21, wherein the DNA binding protein according to claim 4 or 5 is selected as the DNA binding protein. 23. The antibody according to claim 21, wherein the antibody is a polyclonal antibody. 24. The antibody according to claim 21, wherein the antibody is a monoclonal antibody. 25. A method for preparing and producing an antibody of an animal, which is obtained by immunizing an animal with the DNA-binding protein according to claim 1 as an antigen. 26. RI using the antibody according to claim 21.
A method for measuring the amount of a DNA binding protein in blood, body fluid or tissue of an animal by measuring A, EIA, FIA or the like, and a method for demonstrating the presence thereof. 27. A polyclonal antibody or a monoclonal antibody is selected as the antibody.
6. The measuring method according to 6. 28. A therapeutic agent for a disease associated with overproduction of the DNA binding protein according to claim 1, which uses the antibody according to claim 21.