JPH06189766A - Dna sequence coding zona pellucida czp2 of canine ovum - Google Patents

Abstract

PURPOSE:To provide a new DNA sequence necessary for the artificial synthesis of CZP2 useful as a contraceptive vaccine antigen of dog. CONSTITUTION:A DNA containing a base sequence coding the total or a part of the amino acid sequence of zona pellucida CZP2 protein of canine ovum of formula. It can be prepared by extracting the total RNA from the ovary of a dog and cloning the total gene of CZP2 by the purification of mRNA with oligo-dt-cellulose and the PCR amplification using a cDNA synthesized from the mRNA as a template DNA.

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to dog egg zona pellucida CZP2.
It relates to a DNA sequence encoding a protein.

[0002]

2. Description of the Prior Art Zona Pellu (ZP)
Cida) is an extracellular matrix that surrounds mammalian egg cells and is composed of several types of glycoproteins called ZP-1, -2, -3, and -4. The egg zona pellucida serves as a sperm receptor on the egg side during insemination, and insemination cannot be established unless the sperm can pass through the egg zona pellucida (Wassarman PM (1990) Develo
pment 108, 1-17). Therefore, contraception is possible if it is possible to somehow prevent sperm from binding to this egg zona pellucida. As one of the methods, it has been reported that an antibody against the zona pellucida can inhibit fertilization in vitro (Shivers, CH et al. (1972) Science, 178: 1211-121).
3, Merck, JP-A-53-26311), and it has also been reported that this protein can be administered to a female mammal as a vaccine antigen to make the individual sterile (Wo).
od DM et al. (1981) Biol. Reprod. 25: 439-450, Skinne.
r SM et al. (1984) Endrocrinology 115: 2418-2432, Mahi
-Brown CA et al. (1985) Biol. Repro. 32: 761-772).
It has been reported that this effect is effective even with a component called ZP-3 alone, and it is considered that it is not necessary for the entire component to be effective. (Sacco AG et al. (1987) Biol. Reprod. 36:
481-490, Millar SE et al. (1989) Science 246: 935-93.
8).

The egg zona pellucida protein component constituting the egg zona pellucida has been subjected to gene cloning to clarify the amino acid sequence and the nucleotide sequence. ZP-3
As for the ingredients called "Mouse (Ringuette MJ
(1988) Dev. Biol. 127: 287-265), Hamster (Kinlo)
ch RA et al. (1990) Dev. Biol. 142: 414-421), human (C
hamberlin ME (1990) Proc. Natl. Acad. Sci. USA 8
7: 6014-6018), and others derived from pigs, dogs, and cats have been clarified by the applicant. Also with respect to components called ZP-2, antibodies to ZP-2 is in vi
It has been reported to inhibit fertilization in vitro (East I.
J. et al. (1985) Dev. Biol. 109: 268-273), the vaccine effect is considered similar to ZP-3. Regarding ZP-2, the mouse (Liang Li-Fang et al. (1990) Mol. Cell. B
iol. 10: 1507-1515) has been clarified.

[0004]

In order to use the natural egg zona pellucida protein as a vaccine antigen, it is necessary to obtain a large amount of egg cells. However, it is not possible to obtain the required amount of egg zona pellucida in vaccinated animals for that reason. or,
When purifying natural egg zona pellucida, there is a risk of mixing with other ovarian tissues, which can cause side effects. On the other hand, if the egg zona pellucida can be artificially synthesized by a method such as a genetic engineering method or a peptide synthesis method, a highly pure egg zona pellucida protein can be produced at low cost.

Therefore, an object of the present invention is to provide a DNA sequence and an amino acid sequence necessary for the artificial synthesis of this dog egg zona pellucida component-2 (CZP2).

[0006]

The present invention provides a DNA containing a nucleotide sequence encoding all or part of the amino acid sequence of the dog egg zona pellucida CZP2 protein shown in SEQ ID NO: 1.

Canine Zona Pell
The determination of the entire nucleotide sequence of the ucida 2) gene and the amino acid sequence deduced therefrom is carried out by the polymerase chain reaction (PC
R) method is used to clone the entire CZP2 gene from dog ovary. For this purpose, common recombinant DNA techniques such as extraction of total RNA from tissues, mRNA with oligo dT cellulose are used.
, CDNA synthesis from mRNA, PCR amplification, insertion of DNA into vector containing phenotypic marker, transformation of competent host cells, screening of target cDNA clone from colony library, positive cD
Isolation of vector DNA from NA clones, DNA sequencing and the like are used (eg Maniatis et al., Molecu.
lar Cloning: A Laboratory Manual (1982); Ward et al., J.
Virol., 9:61 (1972); Saik et al., Science 230: 1350-1354.
(1985)). Details of cloning of the CZP2 gene will be described in Examples below. Here, PCR is carried out using cDNA synthesized from mRNA as a template DNA, and the primers used at this time can be annealed to three groups, that is, the central region, 5'side region and 3'side region of the CZP2 gene, respectively. Divide into primer groups P
CR was performed, and a method of cloning each region gene was adopted. Thereby, nucleotides 75 to 520 (CZP2 _75-520 ) shown in SEQ ID NO: 1; nucleotides 42 to 103 (CZP2 _42-103 ) and nucleotides 1 to 65 (CZP2 _1-65 ); and nucleotide 48, respectively.
The nucleotide sequences of _{7 to} 713 (CZP2 _487-713 ) were determined, and thus the entire DNA sequence encoding the dog egg zona pellucida CZP2 protein was identified. This DNA sequence consists of the 2216 bp nucleotide sequence shown in SEQ ID NO: 1, of which the CZP2 reading frame is composed of 2139 bp from nucleotide number 46 to 2184. The amino acid sequence deduced from this DNA sequence is also shown in SEQ ID NO: 1, and Met ¹ ... His ⁷¹³
Of 713 amino acids.

A specific example of the DNA of the present invention is DNA comprising all or part of nucleotide numbers 46 to 2184 shown in SEQ ID NO: 1. Other examples include all possible nucleotide sequences in the sequence SEQ ID NO: 1 including all corresponding base sequences based on the degeneracy of the amino acid genetic code. These nucleotide sequences also form part of the invention.

The term "peptide" as used herein refers to both short and long peptides. Here, the long-chain peptide also includes a protein.

By expressing the above-defined DNA of the present invention, a CZP2-related peptide can be produced. For example, the method for producing the peptide includes a step of incorporating a DNA consisting of a nucleotide sequence encoding all or a part of the amino acid sequence shown in SEQ ID NO: 1 or a step of incorporating the DNA containing the nucleotide sequence into an appropriate expression vector capable of replication. Transforming an appropriate host with the obtained expression vector, culturing the obtained transformant in an appropriate medium to express the DNA, and collecting the obtained recombinant peptide. Include.

In this case, the vector for expressing the DNA of the present invention is a phage or a plasmid, and usually contains a replication site and a selectable marker sequence. The replication site is
Sequences such as a promoter, a terminator, an origin of replication, a ribosome binding site, etc. which are compatible with the host cell to be transformed can be contained as appropriate. In particular, as a promoter, when a prokaryote is used as a host, a commonly used lac promoter, t
An rp promoter, a bacteriophage λ promoter, etc., a promoter for alcohol dehydrogenase and glycolytic enzymes when yeast is used as a host, and a viral promoter such as SV40 virus promoter when an animal cell is used as a host. Can be mentioned. As the selectable marker sequence, antibiotic resistance genes such as ampicillin and tetracycline resistance genes are commonly used. The foreign gene to be expressed is inserted downstream of the promoter.

In addition, the host cell may use both prokaryote and eukaryote. Prokaryotes include bacteria such as Escherichia coli, Bacillus subtilis and actinomycetes, and eukaryotes include yeast, insect cells, plant cells, animal cells and the like. These host cells are appropriately selected depending on the presence or absence of a sugar chain structure of the target peptide, and generally, a eukaryote is used when it is desired to synthesize a peptide containing a sugar chain. However, the sugar chain structure thereof does not necessarily have to match the natural peptide of interest as long as the necessary immunocompetence is achieved.

Alternatively, the CZP2-related peptides could be made by chemical peptide synthesis. Regarding peptide synthesis, Biochemistry Laboratory 1 Protein Chemistry IV-
Chemical modification and peptide synthesis-p. 205-495, 197.
The technology described in the 7th year (ed. By the Japanese Biochemical Society) can be used.

The CZP2-related peptide obtained by the above-mentioned method can be used in a dog contraceptive vaccine containing the peptide as an antigen. In addition to the peptides, the vaccine usually contains aluminum hydroxide, calcium phosphate, muramyl dipeptide, adjuvants such as Freund's complete or incomplete adjuvant, oils and a suitable diluent, if necessary, and the solution, emulsion or suspension is used. It can be formulated in a turbid form. In the case of an antigen peptide having a low amino acid number, a heterologous protein such as KLH (Keyhole Limpet Hemocyanin) may be bound to enhance the immunocompetence.

[0015]

The invention is illustrated in more detail by the following non-limiting examples.

Cloning of CZP2 gene 1. CZP2 central region (CZP2 _75-520 ) gene
The template DNA used for the rolling PCR was prepared as follows.

First, mRNA was extracted from dog ovary. The extraction procedure was to crush dog ovaries into powder using a blender under liquid nitrogen, and use a commercially available mRNA extraction kit (FastTrack mRNA ISOLATION KIT, Invitroge
Dog ovarian mRNA was prepared according to the extraction method of n). A commercially available cDNA synthesis kit (RiboClone cD
It was converted into cDNA using NA Synthesis System, Promega) and used as a template DNA for PCR.

MRNA extraction 10 ml of the Lysis solution in the kit was added to 1 g of frozen powdered ovaries, and Dounce Homogenizer was added.
Homogenize (10 to 12 strokes). This is further passed through an 18 G syringe and slowly shaken at 45 ° C. for 2 hours. 4000x after incubation
g, centrifuge for 10 minutes, and collect the supernatant, taking care not to collect a precipitate. Add 5M to this supernatant to 0.5M
After adding the NaCl solution and mixing, the resulting white precipitate is cut through a 21G syringe. In addition to this, B in the kit separately
50 mg of oligo dT cellulose prepared with an inding solution is added, and mixed by inversion at room temperature for 1 hour to react.
After completion of the reaction, the mixture is centrifuged at 2000 xg for 10 minutes to collect oligo dT cellulose. Repeat this cellulose pellet for 2
Suspend in 0 ml of Binding solution and wash. This operation is repeated 3 times to wash the oligo dT cellulose.
The washed cellulose is packed in the spin column included in the kit. At the stage of packing in this spin column, the spin column is further washed with a binding solution, and the spin column is centrifuged at 2000 × g for 10 seconds, and repeatedly washed until the OD _{280 of the} recovered solution becomes 0.05 or less. After cleaning Bi
Centrifuge off the Nding solution and remove the elution solution in the kit.
Add 2 ml to fully suspend the cellulose pellets. Collect the eluate by centrifugation at 2000 xg for 10 seconds,
Again, 0.15 ml of the elution solution was added to this cellulose pellet, and the suspension was resuspended and centrifuged at 2000 × g for 1 minute to completely recover the eluate from the cellulose pellet. With these two elution operations, 0.35 ml of recovered liquid is obtained. To this, 0.15 volume of the 2M sodium acetate solution included in the kit is added, and 2.5 volume of 100% ethanol is further added, and after mixing, -70 Let stand until it freezes to ℃. 16000 after freezing
Centrifuge at xg for 15 minutes to collect mRNA. The mRNA pellet is washed twice with cold 70% ethanol, dried with a vacuum evaporator, and then dissolved in an appropriate amount of sterile water. A portion is appropriately diluted and scanning is performed between OD _{320 and 220,} and the amount of mRNA is calculated from the absorbance value of OD ₂₆₀ .
Thus, 7.7 μg of mRNA was purified from 1 g of dog ovary. Treat all reagents and instruments handled to prevent decomposition by RNase.

After mixing 1 μg of cDNA synthetic mRNA with 0.5 μg of dT primer, 7
Incubate at 0 ° C for 5 minutes, then return to room temperature and use the first-strand synthesis reagent of the kit (first-strand buffer, dithiothreitol solution, deoxynucleoside triphosphate mixture, ribonuclease inhibitor solution, sodium pyrophosphate solution, AMV reverse transcriptase). Was added and reacted at 42 ° C. for 1 hour. Next, the second strand synthesis reagent (second strand buffer, dithiothreitol, NAD solution, DNA polymerase I, RNaseH, ligase) of the kit is added to add 14
The reaction was carried out at ℃ for 2 hours. After the reaction was completed, the mixture was heated at 70 ° C for 10 minutes, cooled with ice, and then added with T4DN.
A polymerase I was added and reacted at 37 ° C for 10 minutes,
The reaction is terminated with 0.2M EDTA. The cDNA thus prepared is used as a template DNA for the next PCR.

Gene cloning by PCR The PCR reaction is performed using a commercially available PCR kit reagent (GeneAmp DNA
Amplification Reagent Kit, Perkin Elmer Cetus) and PCR automation equipment (DNA Thermal Cycler, Perkin Elm
er Cetus) was used.

The primer is MZP2 (Mouse Zona Pel
lucida; Liang. LF, Chamow. SM & Dean, J. (199
0) Mol. Cell. Biol. 10, 1507-1515) and PZP2 (partially cloned by the applicant of the present invention and currently being cloned), the following two primers were prepared. An automated DNA synthesizer (Cyclone Plus DNA Synthesizer, Milli Gen / Biosea) was used for primer synthesis.
rch) was used.

[0022]

[Table 1] (However, [] represents a mix.) PCR was performed with the dog ovary cDNA and the primer 1 and the primer 2. The reaction condition is 94 ° C for 30 seconds, 55
℃ -1 minute, 72 ℃ -2 minutes as 1 cycle, this 40
After the cycle is performed, 72 ° C.-7 minutes is added once. After completion of the reaction, an equal amount of chloroform is added to remove the mineral oil from the reaction solution, and 1/10 volume of 3M sodium acetate (pH 5.2) and 3 times volume of cold ethanol are added thereto to precipitate the DNA with ethanol. . After drying the precipitated DNA,
It is dissolved in an appropriate amount of water and completely digested with KpnI and SalI. This is subjected to low melting point agarose gel electrophoresis to cut out a DNA of about 1200 bp. DN from the gel
GENECLEAN II (BIO 101) is used for extraction of A. This D
NA was previously digested with KpnI and SalI and ligated to a large fragment of pUC18 vector which was similarly purified from agarose gel using a ligation kit (Takara Shuzo),
E. coli JM109 is transformed (this transformant is called pCZP2 _75-520 / JM109). This is seeded on an LB plate containing ampicillin, and 5 ml of the grown colony is cultured and the QIAGEN Hi PurityPlasmid Kit (QIAGE
N) was used to purify the plasmid. A part of the purified plasmid was digested with KpnI and SalI to obtain the desired size DN.
It was used to confirm that A was incorporated, and the rest was used for a normal double-stranded sequence. Sequencing was carried out by treating the plasmid with an alkali, and then dideoxy termination chain method DNA sequence kit (SEQUENASEVERSION 2.07-deaza-dGTP Kit,
USB). As a result, the following sequences were determined.

The determined nucleotide sequence of CZP2 _75-520 :

[0024]

[Table 2] 5'CTTCTGTGGTGGATCCATTTAGTTTTGAATTGTTGAACTGTACTTCTATCCTGGACCCAGAAAGCTCA CCCTGAAGGCCCCATATGAGACCTGTAGCAGGAGAGTGCTTGGCCAGCATCAGATGGCCATCAGACTCACGG ACAACAATGCTGCTTCAAGACATAAGGCTTTCATGTATCAGATCAGCTGTCCAGTTATGCAAACAGAAGAAA CCCATGAGCATGCAGGATCCACAATCTGCACAAAAGATTCCATGTCTTTTACCTTTAACATTATTCCTGGCA TGGCTGATGAAAATAGCAATCCCAGTGGTGGGAAATGGATGATGGAGGTTGATGATGCAAAAGCTCAAAATC TGACTCTTCGGGAGGCCTTGATGCAAGGATATAATTTCCTGTTTGATAGCCACAGGCTCAGTGTCCAAGTGT CATTCAATGCCACTGGAGTCACTCACTACATGCAAGGTAACAGTCACCTCTACACAGTGCCTCTGAAGCTTA TACACACATCTCCTGGGCAGAAGATCATCTTAACAACACGAGTACTTTGTATGTCAGATCCCGTGACCTGTA ACGCCACACACATGACCCTCACCATACCAGAGTTTCCTGGGAAACTACAGTCTGTGAGATTTGAAAACACGA ACTTTGCTGTAAGCCAGCTGCACAACCATGGGATTGATAAAGAAGAATTAAACGGCTTGAGGTTACACTTCA GCAAATCTCTTCTCAAAATGAACTCCTCTGAAAAATGCTACCCTATCAGTTCTACTTAGCATCTCTCAGGCT GACCTTTGAACGGGACACGGTTTCCACAGTGGTTTATCCTGAGTGTGTTTGTGAGCCACCAGTTACTATAGT TACAGGTGACCTGTGTACCCAGGATGGGTTTATGGATGTCAAGGTCTACAGCCACCAAACAAAACCAGCTCT AAACTTGGATACCCTCGGAGTGGGAGACTCCTCCTGCC AACCTACTTTCAAGGCTCCATCACAAGGGTTAAC ACTGTTTCACATCCCCCTAAATGGATGTGGAACAAGACTTAAGTTCAAAGGTGACACAGTCATCTATGAAAA TGAAATACATGCTCTCTGGACAGATCTCCCTCCAAGCACAATTTCCAGAGATAGTGAATTCAGAATGACTGT GAAGTGCCATTACAGCAGAGATGACCTGCTGATAAATACCAATGTCCAAAGTCTTCCTCCTCCCGTGGCCTC AGTGAGGCCTGGTCCACTTGCCTTAATCCTGCAAACCTACCCAGATAAATCCTATTTGCGACCCTATGGGGA TAAGGGGTATCCTGTGGTGAGATATCTCCGCCAACCAATTTAC 3 '2. Cloning of 3'side region gene CZ using the following four primers and dog ovary cDNA
The remaining 3'side gene of P2 was cloned and sequenced.

The following primers 3, 4 and 5 were prepared from the sequence of CZP2 _75-520 previously determined, and primer 6 was prepared from the poly A sequence of mRNA.

[0026]

[Table 3] These primers were prepared using an automatic DNA synthesizer. The PCR conditions are as follows.

[0027]

[Table 4] First PCR: Primer 3 and Primer 6 Template DNA: Canine ovary cDNA PCR conditions: 94 ° C-30 seconds, 45 ° C-1 minute, 72 ° C-
2 minutes, 30 times 72 ° C-5 minutes, once 2nd PCR: primer 4 and primer 6 Template DNA: 1st PCR product PCR conditions: 94 ° C-30 seconds, 50 ° C-1 minute, 72 ° C-
2 minutes, 30 times 72 ° C.-5 minutes, 1 time Third PCR: Primer 5 and Primer 6 Template DNA: Second PCR product PCR conditions: Same as second PCR conditions.

A part of the PCR products obtained three times is electrophoresed on a 2% agarose gel to confirm the amplified DNA band by ethidium bromide staining. As a result, a band of about 700 bp was detected in the third PCR product. This third PCR product was ethanol precipitated and then EcoR
After digestion with I and SalI, electrophoresis was carried out on a low melting point agarose gel and the desired 700 bp DNA was analyzed by GE from the gel.
Purified using NECLEAN II (BIO 101). This purified DNA was ligated to a large fragment of pUC18 which had been previously digested with the same EcoRI and SalI using a ligation kit (Takara Shuzo). After transforming Escherichia coli JM109, the transformant that has been seeded on the LB plate containing ampicillin is picked up (this transformant is called pCZP2 _487-713 / JM109). This was cultured in LB medium containing 5 ml ampicillin, and the plasmid was purified (QIAGEN Hi Purity Plasmid Kit). A part of the purified plasmid was digested with EcoRI and SalI and used to confirm that the DNA of the desired size was incorporated, and the rest was used for a normal double-stranded sequence. Sequencing is carried out by treating the plasmid with an alkali and then using the dideoxy termination chain method DNA sequence kit (SEQUENASE VERSIO
N 2.07-deaza-dGTP Kit, USB). As a result, the following sequences were determined.

The determined nucleotide sequence of CZP2 _487-713 :

[0030]

[Table 5] 5'CACTTGCCTTAATCCTGCAAACCTACCCAGATAAATCCTATTTGCGACCCTATGGGGATAAGGAGTAT CCTGTGGTGAGATACCTCCGCCAACCAATTTACCTGGAAGTGAAAGTCCTAAATAGGGCTGACCCCAACATC AAGCTGGTCTTAGATGATTGCTGGGCAACACCCACCATGGACCCAGCCTCACTCCCCCAGTGGAATATTGTC ATGGATGGCTGTGAATACAATCTGGACAACTACAGAACGACCTTCCATCCAGTTGGCTCCTCTGTGACCTAC CCTACTCACTATCGGAGGTTTGATGTGAAGACCTTTGCCTTTATAGCAGAGGCCCAAGTGCTTGCTAGCCTG GTCTACTTCCACTGCCCCGCATTAATCTGCAATCCGACTGTCTCCTGACTCCCCTCTGTGTTCTGTGACTTG CCCTGTATCATCCAGGCACAGGCGAGCCACAGGCAGTACTGCAGAAGAGAAGATGATAGTAAGTCTCCCGGG ACCCATCCTCCTGTTGGCAGACAGCTCTTCACTCAGAGATGGTGTGGACTCAAAAGGGCACAGGGCTGCTGG ATATGTTGCTTTTAAAACTGTAGTGGCTGTGGCTGCCTTAGCAGGCCTTGTGGCTGCTCTAGGTCTCATCAT CTACCTGCGTAAGAAAAGAACCATGGTGTTAAATCACTAAGGATTTTCAAATAAAGTGTTTGTTAAAGT 3 '3. Cloning of 5'side region gene For the 5'side region of CZP2, cDNA was prepared based on the sequence of CZP2 _75-520 and cloned by using this as a template (Michael A. Frohman, Michael K.
Dush, and Gail R. Martin (1988) Proc. Natl. Acad.
Sci. USA 85,8998-9002; Osamu Ohara, Robert L. Dor
it and Walter Gilbert (1989) Proc. Natl. Acad. Sc
i. USA 86, 5673-5677).

Gene cloning of CZP2 _42-103 region The following three primers were synthesized from the sequence of CZP2 _75-520 determined in advance.

[0032]

[Table 6] Single-stranded cDNA was prepared from dog ovary mRNA based on primer 7. RiboClon for single-stranded cDNA synthesis
e cDNA Synthesis System (Promega) was used. Specifically, 0.5 μg of canine ovary mRNA was added with 0.5 μg of primer 7 and the mixture was incubated at 70 ° C. for 5 minutes and then slowly returned to room temperature, followed by 10 × first strand buffer, 100 mM DD.
T 10mM dNTP mix, RNasin ribonuclease inhibitor, 40
Add 1 mM mM Napyrophosphate and reverse transcriptase at 42 ℃
Incubate for a period of time to synthesize single-stranded cDNA. After reaction 1
Phenol / chloroform extraction is performed once, and the supernatant is applied to a span column (Pharmacia) that has been pre-equilibrated with TE (10 mM Tris-HCl pH7.5, 1 mM EDTA).
The recovered liquid is ethanol-precipitated together with Eta-precipitated mate (Nippon Gene). Next, a reaction of adding poly A to the 3'side of the synthesized single-stranded cDNA is performed. In particular,
After drying the precipitated single-stranded cDNA, dissolve it in water and
After processing for 2 minutes, quench on ice, dATP and 5 x tailing
Buffer, terminal deoxynucleotidyl-transferase (Be
thesda Research Laboratories) at 37 ° C for 10
Incubate for 15 minutes at 65 ° C. TE was added to this to dilute it and the template DNA for PCR (5'CZP2-cDN
It is referred to as A). The PCR conditions are as follows.

[0033]

[Table 7] First PCR: Primer 8 and Primer 6 Template DNA: 5'CZP2-cDNA PCR conditions: 94 ° C-30 seconds, 45 ° C-1 minute, 72 ° C-
2 minutes, 30 times 72 ° C, 5 minutes, 2nd PCR: primer 9 and primer 6 Template DNA: 1st PCR product PCR conditions: 94 ° C-30 seconds, 50 ° C-1 minute, 72 ° C-
2 minutes, 30 times 72 ° C, 5 minutes.

A part of the PCR product obtained twice is electrophoresed on a 2% agarose gel. D with ethidium bromide
NA was stained. As a result, a DNA band of about 250 bp was detected. This 250 bp DNA was added to pUC18
In order to subclone into EcoRI and SalI, the PCR product is subjected to chloroform removal of mineral oil and ethanol precipitation. The precipitate is dried, dissolved in water and digested with EcoRI and SalI. 2% after completion of reaction
The target 250 bp band is separated by low melting point agarose electrophoresis and cut out from the gel using GENECLEAN II (BIO 101). This is EcoRI, Sal beforehand
The large fragment of pUC18 digested with I is ligated with a ligation kit (Takara Shuzo). E. coli /
JM109 was transformed and plated on an LB plate containing ampicillin (this transformant was transformed into pCZP2 _42-103 / JM
109). Pick up the growing colony, 5
Culture in LB medium containing ampicillin, QUIAGEN, H
Purify the plasmid using the i Purity Plasmid Kit.
A part of the purified plasmid was EcoRI, SalI
After digestion to confirm that the DNA of the desired size was incorporated, the rest was subjected to a normal double-stranded sequence. Sequencing is carried out by treating the plasmid with an alkali, and then using the dideoxy termination chain method DNA sequence kit (SEQUENASE
VERSION 2.07-deaza-dGTP Kit, USB). As a result, the following sequences were determined.

The determined nucleotide sequence of pCZP2 _42-103 :

[0036]

TABLE 8 5'ACTCAGTTGGTGAATCCCATCTTCCCAGGTACTGTCATTTGCCATGAAAATAAAATGACAGTGGAATT TCAAAGGGATCTTGGCACCAAAAAATGGCATGCATCTGTGGTGGATCCATTTAGTTTTGAATTGTTGAACTG TACTTCTATCCTGGACCCAGAAAAGCTCACCCTGAAGGCCCCATATGA3 'to prepare the following primers based on CZP2 _1-65 sequence determined on gene cloning of regions (CZP2 _42-103), further 5' was cloned side region genes. The PCR conditions are as follows.

[0037]

[Table 9] First PCR: Primer 8 and Primer 6 Template DNA: 5'CZP2-cDNA PCR conditions: 94 ° C-30 seconds, 45 ° C-1 minute, 72 ° C-
2 minutes, 30 times 72 ° C, 5 minutes, 2nd PCR: primer 10 and primer 6 Template DNA: 1st PCR product PCR conditions: 94 ° C-30 seconds, 50 ° C-1 minute, 72 ° C-
2 minutes, 30 times 72 ° C, 5 minutes, 3rd PCR: Primer 11 and primer 6 Template DNA: 2nd PCR product PCR conditions: 94 ° C-30 seconds, 55 ° C-1 minute, 72 ° C-
2 minutes, 30 times 72 ° C, 5 minutes.

A part of the PCR product obtained three times is electrophoresed on a 2% agarose gel. D with ethidium bromide
NA was stained. As a result, a DNA band of about 300 bp was detected. This 300 bp DNA is called pUC18
For subcloning into KpnI and SalI of
Remove the mineral oil from the PCR product with chloroform and ethanol precipitate. The precipitate is dried, dissolved in water and digested with KpnI and SalI. After completion of the reaction, the product is separated by 2% low-melting point agarose electrophoresis and the desired 300 bp band is cut out and extracted from the gel using GENECLEAN II (BIO 101). This is ligated to a large fragment of pUC18 that has been digested with KpnI and SalI in advance using a ligation kit (Takara Shuzo). E. coli JM109 was transformed, plated on LB plates containing ampicillin (a transformant called pCZP2 _1-65 / JM109). The grown colonies are picked up and cultured in 5 ml of LB medium containing ampicillin, and QUIAGEN Hi Purity Plas
Purify the plasmid using the mid Kit. A part of the purified plasmid was digested with KpnI and SalI to confirm that the DNA of the desired size had been incorporated, and then the rest was subjected to a normal double-stranded sequence. Sequencing is carried out by treating the plasmid with an alkali and then using the dideoxy termination chain method DNA sequence kit (SEQUENASE VERSION 2.07).
-deaza-dGTP Kit, USB). as a result,
The following sequences were determined.

The determined nucleotide sequence of CZP2 _1-65 :

[0040]

[Table 10] 5'GGGCGTCTACCCACCTACCTGGCTGATTTGGTGGTACGTTTGGCCATGGCATGCAAACAGAAAGGAGA CAGTGGGAGTCCCTCAAGCTGGTTTAGTGCAGATTGGAGCACCTACAGGTCACTTTCTTTATTCTTCATCCT TGTGACTTCCCTCCATCAT4TCCATCCATCAT4CTCAGTCATCAT4CTCAGTCACATCAT4GTCAGTCCCATCATAG4GTCATCCACATCATAG4GTCATCCACATCAT4CATGACTCTGCATGCATGACCATGCATGCATGACCATGCATGCATGACATGACTCTGAG
ZP2 _1-65 , CZP2 _42-103 , CZP2 _75-520 , CZP
2 _487-713 ), the entire base sequence (2216nt) of dog egg zona pellucida-2 (CZP2) shown in the sequence listing below.
And the amino acid sequence (713) were revealed.

[0041]

Elucidation of the DNA sequence of the canine egg zona pellucida CZP2 gene according to the present invention has made it possible to supply a large amount of CZP2-related peptides using a genetic engineering method or a method such as peptide synthesis. . The resulting peptide is useful as a vaccine antigen for contraception or infertility in dogs.

[0042]

[Sequence list]

 SEQ ID NO: 1 Sequence Length: 2216 Sequence Type: Nucleic Acid Number of Strands: Double Strand Topology: Linear Sequence Type: cDNA to mRNA Origin: Organ Name: Dog Tissue Type: Ovarian Cell Type: Egg Sequence: gggcgtctac ccacctacct ggctgatttg gtggtacgtt tggcc atg gca tgc aaa 57 Met Ala Cys Lys 1 cag aaa gga gac agt ggg agt ccc tca agc tgg ttt agt gca gat tgg 105 Gln Lys Gly Serp Asp Ser Tly Serp Ser Gly Serp Ser Tly Serp 5 10 15 20 agc acc tac agg tca ctt tct tta ttc ttc atc ctt gtg act tca gtg 153 Ser Thr Tyr Arg Ser Leu Ser Leu Phe Phe Ile Leu Val Thr Ser Val 25 30 35 aac tca gta ggt gtt atg cag ttg gtg aat ccc atc ttc cca ggt act 201 Asn Ser Val Gly Val Met Gln Leu Val Asn Pro Ile Phe Pro Gly Thr 40 45 50 gtc att tgc cat gaa aat aaa atg aca gtg gaa ttt cca agg gat ctt 249 Val Ile Cys His Glu Asn Lys Met Thr Val Glu Phe Pro Arg Asp Leu 55 60 65 ggc acc aaa aaa tgg cat gca tct gtg gtg gat cca ttt agt ttt gaa 297 Gly Thr Lys Lys Trp His Ala Ser Val Val Asp Pro Phe Ser Phe Glu 70 75 80 ttg ttg aac tgt act tct atc ctg gac cca gaa aag ctc acc ctg aag 345 Leu Leu Asn Cys Thr Ser Ile Leu Asp Pro Glu Lys Leu Thr Leu Lys 85 90 95 100 gcc cca tat gag acc tgt agc agg aga gtg ctt ggc cag cat cag atg 393 Ala Pro Tyr Glu Thr Cys Ser Arg Arg Val Leu Gly Gln His Gln Met 105 110 115 gcc atc aga ctc acg gac aac aat gct gct tca aga cat aag gct ttc 441 Ala Ile Arg Leu Thr Asp Asn Asn Ala Ala Ser Arg His Lys Ala Phe 120 125 130 atg tat cag atc agc tgt cca gtt atg caa aca gaa gaa acc cat gag 489 Met Tyr Gln Ile Ser Cys Pro Val Met Gln Thr Glu Glu Thr His Glu 135 140 145 cat gca gga tcc aca atc tgc aca aaa gat tcc atg tct ttt acc ttt 537 His Ala Gly Ser Thr Ile Cys Thr Lys Asp Ser Met Ser Phe Thr Phe 150 155 160 aac att att cct ggc atg gct gat gaa aat agc aat ccc agt ggt ggg 585 Asn Ile Ile Pro Gly Met Ala Asp Glu Asn Ser Asn Pro Ser Gly Gly 165 170 175 180 aaa tgg atg atg gag gtt gat gat gca aaa gct caa aat ctg act ctt 633 Lys Trp Met Met Glu Val Asp As p Ala Lys Ala Gln Asn Leu Thr Leu 185 190 195 cgg gag gcc ttg atg caa gga tat aat ttc ctg ttt gat agc cac agg 681 Arg Glu Ala Leu Met Gln Gly Tyr Asn Phe Leu Phe Asp Ser His Arg 200 205 210 ctc agt gtc caa gtg tca ttc aat gcc act gga gtc act cac tac atg 729 Leu Ser Val Gln Val Ser Phe Asn Ala Thr Gly Val Thr His Tyr Met 215 220 225 caa ggt aac agt cac ctc tac aca gtg cct ctg aag ctt ata cac aca 777 Gln Gly Asn Ser His Leu Tyr Thr Val Pro Leu Lys Leu Ile His Thr 230 235 240 tct cct ggg cag aag atc atc tta aca aca cga gta ctt tgt atg tca 825 Ser Pro Gly Gln Lys Ile Ile Leu Thr Thr Arg Val Leu Cys Met Ser 245 250 255 260 gat ccc gtg acc tgt aac gcc aca cac atg acc ctc acc ata cca gag 873 Asp Pro Val Thr Cys Asn Ala Thr His Met Thr Leu Thr Ile Pro Glu 265 270 275 ttt cct ggg aaa cta cag tct gtg aga ttt gaa aac acg aac ttt gct 921 Phe Pro Gly Lys Leu Gln Ser Val Arg Phe Glu Asn Thr Asn Phe Ala 280 285 290 gta agc cag ctg cac aac cat ggg att gat aaa gaa gaa tta aac ggc 969 Val Ser Gln Leu H is Asn His Gly Ile Asp Lys Glu Glu Leu Asn Gly 295 300 305 ttg agg tta cac ttc agc aaa tct ctt ctc aaa atg aac tcc tct gaa 1017 Leu Arg Leu His Phe Ser Lys Ser Leu Leu Lys Met Asn Ser Ser Glu 310 315 320 aaa tgc cta ccc tat cag ttc tac tta gca tct ctc agg ctg acc ttt 1065 Lys Cys Leu Pro Tyr Gln Phe Tyr Leu Ala Ser Leu Arg Leu Thr Phe 325 330 335 340 gaa cgg gac acg gtt tcc aca gtg gag tatct tgt gtt tgt gag 1113 Glu Arg Asp Thr Val Ser Thr Val Val Tyr Pro Glu Cys Val Cys Glu 345 350 355 cca cca gtt act ata gtt aca ggt gac ctg tgt acc cag gat ggg ttt 1161 Pro Pro Val Thr Ile Val Thr Gly Asp Leu Cys Thr Gln Asp Gly Phe 360 365 370 atg gat gtc aag gtc tac agc cac caa aca aaa cca gct cta aac ttg 1209 Met Asp Val Lys Val Tyr Ser His Gln Thr Lys Pro Ala Leu Asn Leu 375 380 385 gat acc ctc gga gtg gga gac tcc tcc tgc caa cct act ttc aag gct 1257 Asp Thr Leu Gly Val Gly Asp Ser Ser Cys Gln Pro Thr Phe Lys Ala 390 395 400 cca tca caa ggg tta aca ctg ttt cac atc ccc cta aat gga tgt gga 130 5 Pro Ser Gln Gly Leu Thr Leu Phe His Ile Pro Leu Asn Gly Cys Gly 405 410 415 420 aca aga ctt aag ttc aaa ggt gac aca gtc atc tat gaa aat gaa ata 1353 Thr Arg Leu Lys Phe Lys Gly Asp Thr Val Ile Tyr Glu Asn Glu Ile 425 430 435 cat gct ctc tgg aca gat ctc cct cca agc aca att tcc aga gat agt 1401 His Ala Leu Trp Thr Asp Leu Pro Pro Ser Thr Ile Ser Arg Asp Ser 440 445 450 gaa ttc aga atg act gtg aag tgc cat tac agc aga gat gac ctg ctg 1449 Glu Phe Arg Met Thr Val Lys Cys His Tyr Ser Arg Asp Asp Leu Leu 455 460 465 ata aat acc aat gtc caa agt ctt cct cct ccc gtg gcc tca gtg ang 1497 Ile Asle Val Gln Ser Leu Pro Pro Pro Val Ala Ser Val Arg 470 475 480 cct ggt cca ctt gcc tta atc ctg caa acc tac cca gat aaa tcc tat 1545 Pro Gly Pro Leu Ala Leu Ile Leu Gln Thr Tyr Pro Asp Lys Ser Tyr 485 490 495 500 ttg cga ccc tat ggg gat aag gag tat cct gtg gtg aga tac ctc cgc 1593 Leu Arg Pro Tyr Gly Asp Lys Glu Tyr Pro Val Val Arg Tyr Leu Arg 505 510 515 caa cca att tac ctg gaa gtg aa aaa gtc agg gct gac ccc aac 1641 Gln Pro Ile Tyr Leu Glu Val Lys Val Leu Asn Arg Ala Asp Pro Asn 520 525 530 atc aag ctg gtc tta gat gat tgc tgg gca aca ccc acc atg gac cca 1689 Ile Lys Leu Val Leu Asp Asp Cy Trp Ala Thr Pro Thr Met Asp Pro 535 540 545 gcc tca ctc ccc cag tgg aat att gtc atg gat ggc tgt gaa tac aat 1737 Ala Ser Leu Pro Gln Trp Asn Ile Val Met Asp Gly Cys Glu Tyr Asn 550 555 560 ctg gac aac tac aga acg acc ttc cat cca gtt ggc tcc tct gtg acc 1785 Leu Asp Asn Tyr Arg Thr Thr Phe His Pro Val Gly Ser Ser Val Thr 565 570 575 580 tac cct act cac tat cgg agg ttt gat gtg aag acc ttt gcc ttt ata 1833 Tyr Pro Thr His Tyr Arg Arg Phe Asp Val Lys Thr Phe Ala Phe Ile 585 590 595 gca gag gcc caa gtg ctt gct agc ctg gtc tac ttc cac tgc acc gca 1881 Ala Glu Ala Gln Val Leu Ala Ser Leu Val Tyr Phe Cys Thr Ala 600 605 610 tta atc tgc aat cga ctg tct cct gac tcc cct ctg tgt tct gtg act 1929 Leu Ile Cys Asn Arg Leu Ser Pro Asp Ser Pro Leu Cys Ser Val Thr 615 620 625 tgc cct gta tca tcc agg cac agg cga gcc aca ggc agt act gca gaa 1977 Cys Pro Val Ser Ser Arg His Arg Arg Ala Thr Gly Ser Thr Ala Glu 630 635 640 gag aag atg ata gta agt ctc ccg gga ccc atc ctc ctg ttg gca gac 2025 Glu Lys Met Ile Val Ser Leu Pro Gly Pro Ile Leu Leu Leu Ala Asp 645 650 655 660 agc tct tca ctc aga gat ggt gtg gac tca aaa ggg cac agg gct gct 2073 Ser Ser Ser Leu Arg Asp Gly Val Asp Ser Lys Gly His Arg Ala Ala 665 670 675 gga tat gtt gct ttt aaa act gta gtg gct gtg gct gcc tta gca ggc 2121 Gly Tyr Val Ala Phe Lys Thr Val Val Ala Val Ala Ala Leu Ala Gly 680 685 690 ctt gtg gct gct cta ggt ctc atc atc tac cgt aag aaa aga acc 2169 Leu Val Ala Ala Leu Gly Leu Ile Ile Tyr Leu Arg Lys Lys Arg Thr 695 700 705 atg gtg tta aat cac taaggatttt caaataaagt gtttgttaaa gt 2216 Met Val Leu Asn His 710

Claims (1)

[Claims] 1. A dog egg zona pellucida CZ shown in SEQ ID NO: 1.
A DNA containing a nucleotide sequence encoding all or part of the amino acid sequence of P2 protein.