JPH0614784A - Dna coding feline ovum clear zone fzp-3, its expressing peptide, and contraceptive vaccine containing the pfptide - Google Patents

Abstract

PURPOSE:To provide the novel DNA useful for the production of a polypeptide to be added to vaccines used for the contraception of cats. CONSTITUTION:The DNA containing a base sequence coding all or a part of the amino acid sequence of feline ovum clear zone FZP-3 protein of the formula, e.g. a DNA comprising the base sequence of nucleotide No.25-1296 of the formula. The DNA is produced by isolating the ZP-3 gene from the CDNA library of the feline ovum clear zone and subsequently cloning the ZP-3 gene by a general recombination DNA technique.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION The present invention relates to a cat egg transparent zone FZP-
DNA encoding 3 protein amino acid sequence, this DNA
The present invention relates to a method for producing an FZP-3-related recombinant peptide by expression of F. The present invention also relates to the recombinant peptide.
The invention further relates to a feline contraceptive vaccine containing the recombinant peptide and a method of contracepting a feline with the vaccine.

[0002]

BACKGROUND OF THE INVENTION Mammal egg zona pellucida
Is an extracellular matrix that surrounds the oocyte and is usually a ZP such as ZP-1, ZP-2, ZP-3 and ZP-4.
It is composed of glycoproteins. These ZP glycoproteins are formed in the early stage of oocyte growth and early stage of cell differentiation of follicles, and have a role of protecting the oocyte and fetus until they are implanted in the uterine wall. Further, these ZP glycoproteins also have an important function in the fertilization process in which sperm attaches to the ZP glycoprotein of the egg zona pellucida and enters the egg zona pellucida. In particular, the ZP-3 protein is known to first bind to sperm in the fertilization process (Wassarman P.
M. “20NA PELLUCIDA GLYCOPROTEINS” Am. Rev. Bioche
m. 1988, 57: 415-442).

Therefore, by blocking the ZP glycoprotein to which sperm can bind, fertilization is inhibited and, as a result, contraception or infertility becomes possible (Merck, JP 53-263).
11 publication). If an egg zona pellucida protein containing ZP glycoprotein is administered as a vaccine antigen to female mammals, an antibody against the antigen is produced in vivo , which serves as a blocking agent to inhibit fertilization or follicular development. (Skinner SM et al. (1984) Endocrinology 115: 241
8-2432; Mahi-Brown CA et al. (1985) Biol Reprod 32:76.
1-772; Sacco AG et al. (1987) Biol Reprod 36: 481-490.
). These antigens are known as so-called contraceptive vaccines, and the contraceptive method using this vaccine is known as an immunological contraceptive method, unlike the conventional contraceptive methods such as pill, IUD, condom, rhythm method, and sterilization. To be

Examples of contraceptive vaccines include, for example, Japanese Patent Laid-Open No.
Solubilized transparent belt described in JP-A-3-26311 (Merck), JP-A-3-502571 (Zonagen) and
SE Millar et al., Science 246 , 935-938 (1989).
Recombinant zona pellucida polypeptides, synthetic peptides, etc. are disclosed. Furthermore, as the DNA encoding the ZP-3 protein, mouse (MJ RinguetteJ et al.,
Dev. Biol. 127 , 287-295 (1988)) and human (MECh
amberlin and J. Dean (1990) Proc. Natl. Acad. Sci. US
A 87 , 6014 to 6018) have been reported.

[0005]

The contraceptive method for mammals which directly uses a solubilized egg zona pellucida as a vaccine antigen has a drawback that a large amount of ovaries are required to obtain the antigen, and the egg zona pellucida Other ovarian tissues are mixed in to purify the band, which may cause side effects.

On the other hand, a contraceptive method using a recombinant zona pellucida polypeptide obtained by using genetic engineering technology is
It has an advantage that the polypeptide can be produced with high purity and at low cost. However, regarding cats, the primary structure of the egg zona pellucida ZP protein is unknown, and the application of immunological contraception to cats is not known. For this reason, contraceptive methods are currently adopted that use castration by surgery as the only means.

The present inventors obtained the ZP-3 gene from the feline egg zona pellucida cDNA library, cloned it, and determined the nucleotide sequence and deduced amino acid sequence of the ZP-3 gene.

Therefore, an object of the present invention is to provide a cat egg transparent zone F
To provide a DNA encoding a ZP-3 protein or a fragment thereof.

Another object of the present invention is to provide a method for producing the FZP-3-related recombinant peptide by expressing the DNA in a suitable expression system.

Another object of the present invention is to provide an FZP-3 related recombinant peptide obtained by the above method.

Still another object of the present invention is to provide a cat contraceptive vaccine containing the recombinant peptide, and a method for contracepting a cat using the vaccine.

[0012]

The present invention provides a DNA containing a nucleotide sequence encoding all or part of the amino acid sequence of the feline egg zona pellucida FZP-3 protein represented by SEQ ID NO: 1.

The cloning of the feline egg zona pellucida FZP-3 gene can be carried out using a general recombinant DNA technique. Among such techniques are extraction of total RNA from cells or tissues, purification of mRNA by Oligo dt, conversion of mRNA into cDNA, PCR (Polymerase).
Chain Reaction) Amplification, Insertion of DNA into vector containing phenotypic marker, Transformation of competent host cell, Screening of target cDNA clone from colony library, Isolation of vector DNA from positive cDNA clone, Sequencing etc. are included.

An example of a specific DNA sequencing procedure is shown below.

Total RNA obtained from cat ovaries was prepared using, for example, Wa
rd et al. (J. Virol., 9 , 61 (1972)). That is, homogenize frozen and crushed ovaries,
After centrifugation, the cells are lysed, the nuclei are pelleted by centrifugation, the supernatant containing the total RNA is purified by phenol / chloroform extraction, and ethanol is added to the aqueous phase in the presence of sodium chloride to precipitate the total RNA. Next, oligo d
MRNA is purified from total RNA preparations using T-cellulose chromatography (Oppermann et al., Virolog.
y, 108 , 47 (1981)).

A complementary strand DNA is extended with a reverse transcriptase using a random primer, a dT primer or the like for poly (A) ⁺ mRNA, RNA is separated with RNAase H, and a double strand is obtained with DNA polymerase I. Synthesize cDNA.

In order to prepare a cDNA library, a linker is ligated to both ends of the obtained double-stranded cDNA, the linker is introduced into a λ phage vector, and further in vitro packaging is performed to obtain phage particles. E. coli strains were infected with these phage particles and cultured on an agar medium to obtain λ
Form lytic plaques of phage. After the plaques are transferred and fixed on a nitrocellulose membrane, the phage plaques in which the DNA encoding the FZP-3 protein is incorporated are identified by immunoscreening or hybridization with a DNA probe.

The obtained phage DNA is digested with a restriction enzyme, and the obtained DNA fragment is subcloned into a plasmid having a similar restriction enzyme site.

D encoding the obtained FZP-3 protein
Digest the plasmid containing NA with various restriction enzymes,
Each fragment is subcloned into the M13 phage vector.

Single-stranded DN was obtained from the obtained phage plaque.
A is prepared and the nucleotide sequence of each fragment is determined by the M13 dideoxy method.

In order to amplify the gene encoding the FZP-3 protein without introducing it into the λ phage vector during this operation step, the cDNA containing the gene was amplified by the PCR method (Saiki, RK et al. (1985) Science 230, 1350). -1354; Le
e, CC et al. (1988) Science 239, 1288-1291; Frohman,
MA et al. (1988) Proc. Natl. Acad. Sci. USA 85, 8998-
9002) can be multiplied. The primers used were mouse egg zona pellucida MZP-3 (MJ Ringuette et al. (1988) Dev. Biol. 127 , 287-295) or human egg zona pellucida HZP-3 (ME Chamberlin and J. Dean (1990).
Proc. Natl. Acad. Sci USA 87 , 6014-6018) based on the known gene sequence. For example,
As a primer

[0022]

[Table 1] Primer 1: 5'GATGCCCTGGGTTACACGACCTTCTC3 'Primer 2: 5'AGGAA [G, T] ATCAG [G, T] GGCCC [C, T] AC [G, A] GTGACATC [T, A] GCTTTC 3'used It is possible ([] represents a mix).

According to the above-mentioned procedure, the full length cat egg transparent zone FZ
The DNA sequence encoding the P-3 protein has been determined. This DNA sequence consists of the nucleotide sequence of 1305 bp shown in SEQ ID NO: 1, of which the FZP-3 reading frame is composed of 1272 bp from nucleotide number 25 to 1296. The amino acid sequence deduced from this DNA sequence is also shown in SEQ ID NO: 1, and is composed of 424 amino acids of Met ¹ ... Gln ⁴²⁴ .

Specific examples of the DNA of the present invention include all or part of the nucleotide sequence of nucleotide numbers 25 to 1296 shown in SEQ ID NO: 1, particularly nucleotide numbers 340 to 112.
It is a DNA consisting of two nucleotide sequences. Other examples include all possible base sequences in the sequence of SEQ ID NO: 1 including all corresponding bases based on the degeneracy of the amino acid genetic code. All of these base sequences form part of the present invention.

1, 2 and 3, the deduced partial amino acid sequence (Asp) of the feline egg zona pellucida FZP-3 protein of the present invention is shown.
¹⁰⁶ ………… Leu ³⁶⁶ ), MJ Ringuette et al. (Dev.
Biol. 127 , 287-295) Reported mouse egg zona pellucida M
Although shown by comparison with the deduced amino acid sequence of ZP-3 protein, the homology between both amino acid sequences was high within the range of comparison, and the homology was 71% including the primer region.

The present invention further provides a method for producing a recombinant peptide containing all or part of the feline egg zona pellucida FZP-3 protein amino acid sequence shown in SEQ ID NO: 1. This method comprises a step of incorporating a DNA consisting of a nucleotide sequence encoding all or part of the amino acid sequence shown in SEQ ID NO: 1 or a step of incorporating a DNA containing the nucleotide sequence into an appropriate expression vector capable of replicating. The steps of transforming an appropriate host, culturing the obtained transformant in an appropriate medium to express the DNA, and recovering the obtained recombinant peptide are included.

[0027] In accordance with an embodiment of the present invention, examples of suitable transformants E. coli strain pMAL-c-FZP3 ₂₆₁ / JM1
It is 09. The recombinant peptide produced by this transformant is Asp ¹⁰⁶ ..... L shown in SEQ ID NO: 1.
A peptide containing the amino acid sequence of eu ³⁶⁶ (recombinant FZ
P3 ₂₆₁ )).

As used herein, the term "peptide" refers to both short and long peptides. Here, the long-chain peptide also includes a protein.

The vector for expressing the DNA of the present invention is a phage or a plasmid, and usually contains a replication site and a selectable marker sequence. The replication site may appropriately contain sequences such as a promoter, a terminator, an origin of replication, a ribosome binding site, etc. which are compatible with the host cell to be transformed. In particular, as a promoter, when a prokaryote is used as a host, a commonly used lac promoter, trp promoter, bacteriophage λ promoter, etc. are used, and when a yeast is used as a promoter, a promoter for alcohol dehydrogenase or glycolytic enzymes is used. When an animal cell is used as a host, a viral promoter such as SV40 viral promoter can be used. As the selectable marker sequence, antibiotic resistance genes such as ampicillin and tetracycline resistance genes are commonly used.

The foreign gene to be expressed is inserted downstream of the promoter.

Host cells may be both prokaryotic and eukaryotic. Prokaryotes include bacteria such as Escherichia coli, Bacillus subtilis and actinomycetes, and eukaryotes include yeast, insect cells, plant cells, animal cells and the like. These host cells are appropriately selected depending on the presence or absence of a sugar chain structure of the target peptide, and generally, a eukaryote is used when it is desired to synthesize a peptide containing a sugar chain. However, the sugar chain structure thereof does not necessarily have to match the natural peptide of interest as long as the necessary immunocompetence is achieved.

The present invention also provides a recombinant peptide containing all or a part of the feline egg zona pellucida FZP-3 protein amino acid sequence shown in SEQ ID NO: 1. Of course, the recombinant peptide of the present invention may consist of all or part of the amino acid sequence (for example, the amino acid sequence of amino acid numbers 106 to 366).

The recombinant peptide obtained by the method of the present invention is
When administered to a female cat as a contraceptive vaccine antigen, in
Any substance capable of binding to the feline egg zona pellucida FZP-3 glycoprotein in vivo and producing an antibody against the peptide capable of inhibiting sperm binding or follicular development can be used. Therefore, the peptide may be modified, such as substitution, deletion, addition, modification such as phosphorylation or sulfation, etc. within a range that does not impair such a function. This modification can be carried out both at the gene level and at the peptide level.

It will be apparent to those skilled in the art that, although outside the scope of the present invention, the peptides described above can also be made by chemical peptide synthesis. Regarding peptide synthesis, the techniques described in Biochemistry Experiment Course 1 Protein Chemistry IV-Chemical Modification and Peptide Synthesis-pages 205 to 495, 1977 (edited by the Japanese Biochemical Society) can be applied.

As described above, the FZP-3 recombinant peptide has been found to have high homology with mouse-derived MZP-3. About the mouse, SE Millar (Scie
nce 246 , 935-938; IJ East et al. (1985) Dev. Biol.
109 , 268) et al. In the MZP-3 amino acid sequence (Fig. 3).
Phe ³³⁶ ………… Arg342 peptide consisting of 16 amino acids is a protein derived from shellfish KLH (Keyhole Limpet Hemoc).
It has been reported that female mice can be sterilized by immunizing female mice with yanin) conjugated thereto. Based on the high homology between the FZP-3 recombinant peptide and the mouse MZP-3 protein, the present inventors have confirmed that the recombinant peptide of the present invention is effective as a contraceptive vaccine antigen by simulating MZP-3. A method utilizing a contraceptive experiment of mice with an antigen was adopted. Specifically, as an immunogen, recombinant MZP3 _107-369 corresponding to recombinant FZP3 ₂₆₁ (expressed peptide containing mouse ZP3 sequence Asp ¹⁰⁷ ... Leu ³⁶⁹ in FIGS. 1 to 3)
Was produced by genetic engineering, and the obtained MZP3 _107-369 protein was immunized into female mice to examine the efficacy of contraception. S.
Similar to E. Millar et al., It was found that immunized mice gave very effective contraceptive results (Fig. 8).
This result indicates that in cats as well, if the corresponding cat ZP3 antigen (FZP3) is used as a vaccine antigen, similar contraceptive control can be performed in cats as well.

The invention therefore further provides a feline contraceptive vaccine containing an effective amount of the recombinant peptide as defined above according to the invention.

In addition to the purified recombinant peptide, the vaccine is
Generally, it may be formulated in solution, emulsion or suspension form, optionally containing aluminum hydroxide, calcium phosphate, muramyl dipeptide, adjuvants such as Freund's complete or incomplete adjuvant, oils and suitable diluents. . In the case of a low amino acid number antigenic peptide, a heterologous protein such as KLH may be bound to enhance immunocompetence.

As another type of vaccine antigen,
The anti-idiotype antibody of the polyclonal or monoclonal antibody with respect to the FZP-3 sperm binding region related epitope in FZP-3 recombinant peptide or the epitope which induces the antibody which leads to the growth suppression of a follicle is mentioned. These antibodies can be prepared according to a conventional method.

The present invention also provides a method of contraception in a cat, which comprises administering the above vaccine to a female cat to immunize it.

Vaccination conditions such as dose and administration method are not particularly limited, but preferably, the dose is several mg to several tens of mg FZP3 antigen / cat when injected, and the route of administration is parenteral. Administration, especially subcutaneous, intradermal, intraperitoneal or intramuscular injection, is preferred. As an immunization regimen, generally, a method is used in which a feline having fertility is inoculated with a vaccine containing an effective amount of the FZP3 antigen, and then immunized several times every two weeks. At this time, in the case of the first immunization, usually,
An adjuvant, such as Freund's complete adjuvant, may be included in the vaccine preparation.

[0041]

The invention is illustrated in more detail by the following non-limiting examples.

Example 1 Construction of FZP-3 cDNA library of feline egg zona pellucida
Manufacturing : 1 g of a cat ovary was frozen in liquid nitrogen and then pulverized into a powder using a blender. This is a commercially available mRNA
Extraction Kit (FastTrack mRNA ISOLATION KIT, Invitr
gen)) and the feline ovary mRN
A was prepared. Specifically, 10 g of the Lysis solution in the kit was added to 1 g of frozen powdered ovary and Dounce was added.
Homogenizer (10-12)
Stroke). This is further passed through an 18 G syringe and slowly shaken at 45 ° C. for 2 hours. After completion of the incubation, centrifuge at 4000 xg for 10 minutes, and collect the supernatant, taking care not to collect a precipitate. A 5 M NaCl solution is added to the supernatant so that the concentration becomes 0.5 M, and the white precipitate generated after mixing is cut through a 21 G syringe. To this, 50 mg of oligo dT cellulose separately prepared with the Binding solution in the kit was added, and the mixture was mixed by inversion at room temperature for 1 hour to react. 2000 × g, 10 after reaction
Centrifuge for minutes to collect oligo dT cellulose. The cellulose pellet is again suspended in 20 ml of Binding solution and washed. This operation is repeated 3 times to wash the oligo dT cellulose. The washed cellulose is packed in the spin column attached to the kit. When the spin column is packed, it is further washed with a Binding solution, and the spin column is centrifuged at 2000 × g for 10 seconds to repeatedly wash the collected solution until the OD ₂₈₀ becomes 0.05 or less. After washing, remove the Binding solution by centrifugation,
Add 0.2 ml of the elution solution in the kit to fully suspend the cellulose pellet. Centrifuge at 2000 xg for 10 seconds and collect the eluate.
After adding 15 ml of the elution solution and resuspending it, centrifuging at 2000 xg for 1 minute, the eluate is completely recovered from the cellulose pellet. With these two elution operations, 0.35 ml of recovered liquid can be obtained. To this was added 0.15 volume of 2M sodium acetate solution in the kit, and 100% ethanol was added to 2.
Add 5 volumes and mix, then leave to freeze at -70 ° C. After freezing, centrifugation is performed at 16000 × g for 15 minutes to recover mRNA. The mRNA pellet is washed twice with cold 70% ethanol, dried with a vacuum evaporator, and then dissolved in an appropriate amount of sterile water. And appropriately diluted part mRN from the absorbance value of OD ₂₆₀ performs scanning between OD _320-230
Calculate the amount of A. Thus, 7.7 μg of mRNA was purified from 1 g of ovary. All reagents and instruments handled are R
A treatment was applied to prevent decomposition by Nase.

Next, the obtained mRNA was analyzed by Gubler & Hof
A commercially available cDNA synthesis kit (Promega) based on the fman method.
Oligo-dT) according to the manufacturer's instructions
Was used as the template DNA for the PCR method. In particular,
After mixing 1 μg of mRNA with 0.5 μg of dT primer 7
Incubate at 0 ° C for 5 minutes, then return to room temperature and use the first-strand synthesis reagent (first-strand buffer, dithiothreitol solution, deoxynucleoside triphosphate mixture, ribonuclease inhibitor solution, sodium pyrophosphate solution, AMV reverse transcriptase) in the kit. ) Was added and reacted at 42 ° C. for 1 hour. Next, add the second strand synthesis reagent (second strand buffer, dithiothreitol, NAD solution, DNA polymerase I, RNaseH, ligase) from the kit to 1
The reaction was carried out at 4 ° C for 2 hours. After completion of the reaction, the mixture was heated at 70 ° C for 10 minutes, cooled with ice, and then added with T4DNA.
Polymerase I was added and reacted at 37 ° C. for 10 minutes,
The reaction was terminated with 2M EDTA. The cDNA thus prepared is used as a template DNA for the next PCR.

In order to amplify the obtained template DNA, a commercially available PCR kit reagent (GeneAmp DNA Amplification Re
PCR reaction was performed according to the manufacturer's instructions using an agent Kit, Perkin Elmer Cetus) and a PCR automation device (DNA Thermal Cycler, Perkin Elmer Cetus). The reaction conditions are as follows. 1) Heat denaturation step: 94
℃, 1 minute, 2) Primer annealing step:
60 ° C., 2 minutes, 3) Primer extension step: 72
After performing a total of 30 cycles with 3 cycles consisting of 3 minutes at 37 ° C as one cycle, one extension step of the primer at 72 ° C for 7 minutes was performed once to complete one round of PCR.

The primer used at this time was MZP-3 derived from mouse egg zona pellucida (MJ Chamberlin et al. (1988) De
v. Biol. 127 , 287-295) and H derived from human egg zona pellucida
ZP-3 (ME Chamberlin and J. Dean (1990) Proc. N
atl. Acad. Sci. USA 87 , 6014-6018),

[0046]

[Table 2] Primer 1: 5'GATGCCCTGGTGTACAGCACCTTTCCT3 'Primer 2: 5'AGGAA [G, T] ATCAG [G, T] GGCCC [C, T] AC [G, A] GTGACATC [T, A] GCTTC3' (however, , [] Represents a mix).

The amplified product was electrophoresed on 0.8% agarose gel and stained with ethidium bromide for about 80 minutes.
It was confirmed that about 0 bp of DNA was amplified. A commercially available DNA extraction kit (GENECLEA
NII, BIO101) and purified according to the manufacturer's instructions and subcloned into a commercially available vector.

Sequencing of FZP-3 cDNA The obtained cDNA was blunt -ended using DNA Blunting Kit (TAKARA) according to the manufacturer's instructions, and ligated to the SmaI site of pUC119 vector using DNA ligation kit (TAKARA). . Then, the competent cells E. E. coli DH5α was transformed by a conventional method. The transformant was treated with 20 μg / ml Xgal, 100.
The white colonies that had grown were picked up by plating on an LB-plate containing μg / ml of ampicillin, and then small-scale culture was performed in a culture medium (ampicillin-LB medium).

Commercially available plasmid preparation kit (QIAGEN H
i Purity Plasmid Kit, QIAGEN) to recover the plasmid according to the manufacturer's instruction
After performing alkali denaturation treatment according to the sequence method,
DNA sequence kit for dideoxy chain termination method (SEQU
ENSE VERSION 2.07-deaza-dGTP Kit, USB) F
The base sequence and deduced amino acid sequence of ZP-3 cDNA were determined. Both of these determined sequences are shown in SEQ ID NO: 1 in the sequence listing. The obtained FZP-3 gene has 2
A 783 bp nucleotide sequence encoding 61 amino acids (nucleotide numbers 340 to 1122; FZP3 _261).
(Gene).

Cat egg zona pellucida-3 (FZP3) whole gene distribution
Sequence determination Further cloning of FZP3 revealed the gene and amino acid sequences of all FZP3.

(1) Cloning of 3'side region Using the following four primers and feline ovary cDNA, FZ
The remaining 3'side gene of P3 was cloned and sequenced.

The following primers 3 and 4 were prepared from the sequence of FZP3 ₂₆₁ and primer 5 was prepared from the poly A sequence of mRNA using an automatic DNA synthesizer.

[0053]

[Table 3] Primer 3: 5'TCCTGGAGGGCTGTCCCCACCTACAC3 'Primer 4: 5'GAT GAATTC AGACCGTGGCACAAGATG ^EcoRI GCTTCC3' Primer 5: 5'ACA GTCGAC TTTTTTTTTT3 'mRNA extracted by the above method, ^SalI.
As in the case of the synthesis, the Pharmacia cDNA synthesis kit was used, and the cDNA was prepared using the oligo dT primer.
Converted to. PC using this cat ovary cDNA as a template
R was performed. PCR is GeneAmp DNA Amplification R
eagent Kit (Perkin Elmer Cetus) and DNA Thermal
Cycler (Perkin Elmer Cetus) was used.

[0054]

[Table 4] First PCR-primers: 3 and 5; template DNA: feline ovary cDNA; PCR conditions: 94 ° C-30 seconds, 45 ° C-1 minute, 72 ° C-
2 minutes, 30 times 2nd PCR-primer: 4 and 5; template DNA: 1st PCR product; PCR conditions: 94 ° C-30 seconds, 50 ° C-1 minute, 72 ° C-
2 minutes, 30 times; 72 ° C.-5 minutes, once 2 times A part of the PCR product is electrophoresed on a 2% agarose gel, and the amplified DNA band is confirmed by ethidium bromide staining. As a result, a band of about 300 bp was detected in the second PCR product. This second P
The CR product was precipitated with ethanol, digested with EcoRI and SalI, and then electrophoresed on a low melting point agarose gel.
Generate the desired 300 bp DNA from the gel by GENECLEA
Purified using N II (BIO 101). This purified DNA was ligated to a large fragment of pUC18 which had been previously digested with the same EcoRI and SalI using a ligation kit (Takara Shuzo). After transforming Escherichia coli JM109, it is plated on an LB plate containing ampicillin, and the transformed strain that has grown is picked up. This 5
The plasmid was purified by culturing in LB medium containing ml ampicillin (QIAGENHi Purity Plasmid).
Kit). A part of the purified plasmid is Ec
After digestion with oRI and SalI to confirm that the DNA of the desired size was incorporated, the rest was used for normal double-stranded sequence for gene sequencing. Sequencing was carried out by treating the plasmid with an alkali, and then using the dideoxy termination chain method DNA sequence kit (SEQUENASE VE).
RSION 2.07-deaza-dGTP Ki
t, USB). As a result, the following sequences were determined.

[0055]

[Table 5] 5'GAAGCGGATA TCACCGTGGG GCCTCTGATC TTCCTGC GGA AAG GCT GCC GAT CGT GGT GTG GAG GGG TCG ACC TCG CCT CAC ACC TCT GTG ATG GTG GGC ATA GGC CTG GCC ACG GTG TTA TCC CTG ACT CTG GCT CCC ACC GTCTCT AGG AGG CAT CAC ACT GCT TCC CGT CCT ATG ATC TGC CCT GTG TCT GCT TCC CAA TAAAAGAAA3 '(2) Cloning of 5'side region The 5'side region of FZP3 was prepared as a cDNA based on a known FZP3 sequence. PCR was performed using this as a template for cloning (Michael A. Frohman, Michael K.
Dush, and Gail R. Martin (1988) Proc. Natl. Acad.
Sci USA 85, 8998-9002. Osamu Ohara, Robert L. Dor
it, and Walter Gilbert (1989) Proc.Natl. Acad. Sc
i. USA 86, 5673-5677).

The following three primers were synthesized from the sequence of FZP3 ₂₆₁ .

[0057]

[Table 6] Primer 6: 5'GCTATGCCTGGGGTAACGGCACTC3 'Primer 7: 5'AATGGGAACTTCCGCGCGGTTGGT3' Primer 8: 5'GAT GAATTC GGACAGGTTTCCCAT 3'A single chain cDNA derived from a single-stranded cDNA ovary mRNA based on ^EcoRI primer 6. RiboClo is used for the synthesis of single-stranded cDNA.
ne cDNA Systhesis System (Promega) was used. Specifically, 0.5 μg of primer 6 was added to 0.5 μg of cat ovary mRNA, and the mixture was kept warm at 70 ° C. for 5 minutes and then slowly returned to room temperature. Continued 10 × first strand buffer, 100mM D
DT, 10mM dNTP mix, RNasin ribonuclease inhibitor,
40 mM Napyrophosphate and reverse transcriptase are added and incubated at 42 ° C for 1 hour to synthesize single-stranded cDNA.
After completion of the reaction, phenol / chloroform extraction was performed once, and the supernatant was equilibrated with TE (10 mM Tris-HCl pH7.5, 1 mM EDTA) in advance on a span column (Pharma).
cia). The recovered liquid is ethanol-precipitated together with eta-precipitated mate (Nippon Gene). Next synthesized 1
A reaction of adding poly A to the 3'side of the single-stranded cDNA was performed. Specifically, after drying the precipitated single-stranded cDNA,
It was dissolved in water, treated at 94 ° C for 2 minutes, and then rapidly cooled on ice.
TP and 5 × tailing Buffer, terminal deoxynucleotidy
Add l-transferase (Bethesda Research Laboratories) and incubate at 37 ° C for 10 minutes, 65 ° C for 15 minutes. TE is added to this to dilute it and PCR template DNA
(5'CZP3-cDNA).

[0058]

[Table 7] First PCR-Primers: 7 and 5; Template DNA: 5'CZP3cDNA; PCR conditions: 94 ° C-30 seconds, 45 ° C-1 minute, 72 ° C-
2 minutes, 30 times 2nd PCR-primer: 8 and 5; template DNA: 1st PCR product; PCR conditions: 94 ° C-30 seconds, 50 ° C-1 minute, 72 ° C-
2 minutes, 30 times; 72 ° C., 5 minutes A part of the second PCR product was electrophoresed on a 2% agarose gel. DNA was stained with ethidium bromide. As a result, a DNA band of about 500 bp was detected. This 500 bp DNA was used for Eco of pUC18.
PCR for subcloning into RI and SalI
The product was subjected to chloroform to remove mineral oil, followed by ethanol precipitation. The precipitate was dried and dissolved in water, then Ec
Digested with oRI and SalI. After completion of the reaction, the product was separated by 2% low-melting point agarose electrophoresis and the desired 500 bp band was cut out and extracted from the gel using GENECLEAN II (BIO 101). This is EcoRI,
The large fragment of pUC18 digested with SalI was ligated with a ligation kit (Takara Shuzo). This was transformed into Escherichia coli JM109 to obtain ampicillin-containing LB.
Seed on the plate, pick up the growing colony, 5m
1 LB medium containing ampicillin was cultured and QUIAGE
The plasmid was purified using N, Hi Purity Plasmid Kit. A part of the purified plasmid was digested with EcoRI and SalI to obtain the desired size of DN.
After confirming that A was incorporated, the rest was used for an ordinary double-stranded sequence. Sequencing is carried out by treating the plasmid with an alkali, and then using the dideoxy termination chain method DNA sequence kit (SEQUENASE VERSION).
2.07-deaza-dGTP Kit, USB)
Was used to determine. As a result, the following sequences were determined.

[0059]

[Table 8] 5'CCAGCGGGAG TGAGCGTAGG CGCC ATG GGG CTG AGC TAC GGG CTT TTC ATC TGT T TT CTG CTT TGG GCA GGC ACG GGG CTG TGC TAT CCC CCA ACC ACC ACC GAG GAT A AG ACC CAC CCC TCG TTG CCA TCA AGC CCC TCA AGC GTG GTG GAA GAG TGT CGG CAT G CC TGG CTG GTG GTC AAC GTC AGC AAA AAC CTT TTT GGT ACT GGG AGG CTT GTG A GG CCT GCA GAC CTC ACC CTG GGT CCG GAG AAC TGT GAG CCC CTG ATC TCT GGG G AC TCA GAT GAT ACG GTC AGG TTT GAA GTC GAG CTG CAC AAG TGT GGC AAC AGC G TG CAG GTG ACC GAA GATGCCCTGG TGTATAGCAC CTTCCTGCTC CACAACCCCC GCCCC 3'above, the FZP3 ₂₆₁ sequence shown above and the F determined further
From the two sequences of the 3'side and 5'side of ZP3, the feline egg zona pellucida-3 (F
The entire base sequence (1305 bp) and the entire amino acid sequence (424) of ZP3) were revealed.

Example 2 Construction of Expression Vector Commercially available expression vector pMAL-c (New England Biolab
s, which is a vector that expresses the target protein in a fusion manner with maltose binding protein. ) EcoRI
An FZP3 ₂₆₁ gene (having a sequence of nucleotide numbers 340 to 1122 shown in SEQ ID NO: 1) is inserted into the site and SalI site to construct an expression vector. To this end, Eco at the 5'side of the FZP3 ₂₆₁ gene.
Stop site (TAA) and Sal on the 3'side of the RI site
The I site was prepared as follows (FIG. 4).

Using an automatic DNA synthesizer, the following two primers having an EcoRI site, a stop codon and a SalI site were synthesized.

[0062]

[Table 9] _EcoRI primer 1: 5'CCT GAATTC GATGCCCTGGTGTAC3 'primer 2: 5'CAG GTCGACTTA CAGGAATATCAGTGGG ^{SalI Stop} 3'Gene Amp DNA using this primer and the plasmid used for the sequence of the above FZP3 ₂₆₁ gene as a template DNA
PCR (Polymerase Chain Reaction) was performed using Amplification Reagent Kit (Perkin Elmer Cetus) and DNA Thermal Cycler (Perkin Elmer Cetus).
The reaction conditions are 94 ° C-30 seconds, 55 ° C-1 minute, 72 ° C-
2 minutes is set as 1 cycle, and after performing this for 40 cycles 72
Add -7 min once. After completion of the reaction, an equivalent amount of chloroform was added to remove the mineral oil from the reaction solution, and 1/10 volume of 3M sodium acetate (pH 5.2) was added to this.
DNA was ethanol precipitated by adding 3 volumes of cold ethanol. The precipitated DNA was dried and then completely digested with EcoRI and SalI dissolved in an appropriate amount of water. This was subjected to low melting point agarose gel electrophoresis to cut out a DNA of about 800 bp. Extraction of DNA from gel is GE
NECLEAN II (BIO 101) was used. This DNA was ligated to a large fragment of pMAL-c vector which was previously digested with EcoRI and SalI and similarly purified from agarose gel using a ligation kit (Takara Shuzo), and transformed into Escherichia coli JM109. This was seeded on an LB plate containing ampicillin, 2 ml of the grown colony was cultured, and QIAGENi Purity P
The plasmid was purified with the lasmid Kit (QIAGEN). The purified plasmids are EcoRI and SalI
It was confirmed by digestion that the desired FZP3 ₂₆₁ fragment was incorporated. The transformant obtained was pMAL-c-F.
It is named ZP3 ₂₆₁ / JM109.

Confirmation of Recombinant FZP3 ₂₆₁ Protein Expression Confirmation of recombinant FZP3 ₂₆₁ protein expression was carried out by Western blotting using anti-PZP3 serum.

The above pMAL containing the constructed expression vector
-C-FZP3 ₂₆₁ / JM109 culture was absorbance at 2mlLB- ampicillin media strains IPTG upon reaching a 600nm = 0.4 (isopyropyl-β- D-thiogalact
oside) was added to a final concentration of 0.3 mM, the culture was continued for 3 hours, and the cells were collected by centrifugation. After suspending these cells in a small amount of water, part of them is Laemm
The sample was solubilized in a sample buffer (reducing condition) of the li method and subjected to SDS-polyacrylamide gel electrophoresis in a polyacrylamide gel in the usual manner. After completion of the electrophoresis, the protein was transferred from the polylyacrylamide gel to a nitrocellulose filter using a commercially available electrotransfer device. Use this filter with 2% skim milk-T
BST (10 mM Tris-HCl pH7.5, 0.14M NaCl, 0.1% Tween
Anti-PZP diluted with 500 times after soaking in 20) and blocking
3 sera (serum confirmed to react specifically with porcine egg zona pellucida-3 fraction by Western blotting after immunizing mice with natural pig egg zona pellucida-3 fraction. Antibodies against E. coli were absorbed. It had been removed and was confirmed to react with the feline egg zona pellucida by the indirect fluorescent antibody method on frozen sections) and reacted overnight at 4 ° C. Normal mouse serum is similarly used as a negative control. After completion of the reaction, the plate was washed 3 times with TBST and then diluted 1000 times with a commercially available alkaline phosphatase-labeled anti-mouse I
Reacted with g (G, M, A) antibody. After the reaction, TBS
Wash 3 times with T, and use NBT (nitro blue tetrazo
lium) and BCIP (bromochloroindoly phosphate). As shown in FIG. 5, color development was observed that reacted with anti-PZP3 serum but not normal serum. From this, the expression of the recombinant FZP3 ₂₆₁ protein was confirmed.

Example 3 Examination of Contraceptive Vaccine Effect of Recombinant FZP3 Antigen A contraceptive vaccine experiment using mice as a simulation in order to confirm the effectiveness of recombinant FZP3 ₂₆₁ protein produced by genetic engineering as a contraceptive vaccine antigen. And confirmed the effect. Therefore, recombinant FZP3
_A recombinant MZP3 _107-369 having the same region as ₂₆₁ was prepared.

[0066] (1) MZP3 _107-369 Gene cloning and MZP3 _107-369 gene corresponding to the expression FZP3 ₂₆₁ gene was cloned as follows.

Mouse ovarian mRNA was isolated from Invitrog
En company's mRNA extraction kit (FastTrack mRNA ISOLATI
ON KIT). Specifically, 10 ml of Lysis solution was added to frozen mouse ovary Ig and Doun was added.
Homogenize (10-12 strokes) with ce Homogenizer. These are further shredded through an 18 G syringe and slowly shaken at 45 ° C. for 2 hours. After incubation, centrifuge at 4,000 xg for 10 minutes, and collect the supernatant, taking care not to take a precipitate. 0.5 in this supernatant
A 5 M NaCl solution is added so as to give M, and the white precipitate formed after mixing is shredded through a 21 G syringe. to this,
Add 50 mg of oligo dT cellulose prepared separately with the Binding solution in the kit and mix by inversion at room temperature for 1 hour. After completion of the reaction, the mixture is centrifuged at 2000 × g for 10 minutes to collect oligo dT cellulose. The cellulose pellet is suspended again in 20 ml of Binding solution and then centrifuged at 2000 × g for 10 minutes to collect oligo dT cellulose. This washing operation is repeated 3 times. The thus washed oligo dT cellulose is packed in a spin column attached to the kit. The oligo dT cellulose packed in the spin column is further washed with the Binding solution, and the spin column is centrifuged at 2000 × g for 10 minutes to collect the solution. The washing operation is repeated until the OD _{260 of the} recovered solution becomes 0.05 or less. After washing, 0.2 ml of Elution solution in the kit is added to sufficiently suspend oligo dT cellulose. And 2000
Collect the eluate by centrifugation at × g for 10 seconds. 0.1 again
The eluate is collected after adding 5 ml of Elution solution to the oligo dT cellulose pellet to suspend it. This 2
Add 0.15 volumes of 2M sodium acetate in the kit to 0.35 ml of the recovered solution obtained by performing the operation 100%.
After further mixing 2.5 volumes of Enotol, it was frozen at -70 ° C to precipitate mRNA. The precipitate is collected by centrifugation at 16000 xg for 15 minutes. The precipitate is washed twice with cold 70% Enotal, dried with a vacuum evaporator, and then dissolved in an appropriate amount of sterile water. Properly dilute a part of the OD
The scanning is carried _out between _{320 and 230,} and the amount of mRNA is calculated from the absorbance value of OD ₂₆₀ . Thus, 19.2 μg of mRNA was purified from 1 g of ovary. The reagents and instruments used were all treated to prevent decomposition by RNase.

Next, the obtained mRNA was designated as Guler
& Hoffman (Gubler, U. and Hoffman, B., GE
Pharmacia c based on NE 25, 263 (1983) method
It was converted to cDNA using a DNA synthesis kit. Specifically, 20 μl of 5 μg of mRNA was dissolved in sterile water, and
Incubate at 0 ° C. for 10 minutes and then quench in ice. After adding 1 μl of DTT (Dithiothreitol) to this, 1st s
Transfer to trand mix and mix gently with pipette, 37 ℃,
Let react for 1 hour. This was used as a template DNA for cloning the MZP3 _107-369 gene. The primers 1 and 2 used to construct the expression vector gene of FZP3 ₂₆₁ were also used to _construct this MZP3 _107-369 expression gene. Specifically, PCR was carried out under the same conditions using 4 μl of the above 1st strand mix and primers 1 and 2. As a result, the amplified MZP3 _107-369 (FIG. 6) was digested with EcoRI and SalI in the same manner as in the case of FZP3 ₂₆₁ , and pMA was also used.
The L-c vector was incorporated into the EcoRI and SalI sites. FZP3 ₂₆₁ transformation to transform strain JM109 in the same manner as when the (pMAL-c-MZP3 _107-369
/ JM109) was obtained. The candidate strain was cultured in the same manner as in the case of confirming the expression of FZP3 ₂₆₁ protein, and the expression of MZP3 _107-369 was confirmed by Western blotting with anti-PZP3 serum.

(2) Purification of expressed MZP3 _107-369 protein After _{culturing the} MZP3 _107-369 expressing strain in 100 ml of LB medium containing 40 μg / ml of ampicillin overnight, 20 ml thereof was _{added to} 1 L of Rich medium containing 2 g of glucose. After inoculation and culturing until the absorbance at 600 nm reached 0.4, IPTG was added to a final concentration of 0.3 mM, and the culturing was continued for another 3 hours, and then the cells were collected by centrifugation. The collected bacterial cells were Lysis solution (10
mM Na ₂ HPO ₄ , 30 mM NaCl, 0.25% Tween 20, 10 mM β-m
ercaptoethanol, 10mM EDTA pH8.0, 10mM EGTA pH7.0,
1mM PMSF) to suspend at 5g cells / L, 1mg
/ Ml lysozyme was added and the mixture was incubated in ice for 30 minutes, and then sonicated to crush the cells. 5M more
Add NaCl to 0.5M and add 9000 ×
The supernatant was recovered by centrifugation for 30 minutes. This supernatant was added to the column solution (10mM sodium phosphate pH7.2, 0.5M NaCl, 1m
M sodium azide, 10mM β-mercaptoethanol, 1mM EGTA
pH7.0) + 0.25% Tween20 diluted 5 times,
Amylose resin separately equilibrated with column solution
Adsorbed on an affinity column. After washing the amylose resin with 3 times the volume of the column container + 0.25% Tween 20 and then with the 5 times the volume of the column solution, the elution solution (column solution + 10 mM maltose, 10 mM β-mercaptoethanol, 1 mM)
The protein fraction was collected by absorption of OD ₂₈₀ eluted with EGTA pH 7.0). The collected protein fraction was dialyzed against a 0.15 M NaCl solution and then concentrated using Centriprep 10 (AMICON). Figure 7: Affinity purified MZP3
_107-369 fusion protein was run on SDS-PAGE and then CB
B stained. MZP3 thus prepared
_{The 107-369} fusion protein was used as a vaccine antigen in the mouse contraceptive vaccine experiment described below to confirm the efficacy of the antigen.

(3) Mouse Contraceptive Vaccine Experiment Six female mice (6 weeks old) were intraperitoneally administered with 50 μg of MZP3 _107-369 fusion protein / mouse using Freund's complete adjuvant, and two weeks later, Freund's incomplete adjuvant was used. Then, immunization was performed in the same manner every other two weeks, and one week after the immunization, blood was collected from the eye to examine antibody production in blood. To confirm the production of antibody that reacts with the mouse zona pellucida, frozen sections of mouse ovary were stained using the indirect fluorescent antibody method. Specifically, a frozen section of mouse ovary was prepared, and the prepared ovary tissue section was blocked with 10% horse serum and then reacted with appropriately diluted mouse serum at 4 ° C. overnight. After washing 3 times with PBS, FITC
A labeled anti-mouse Ig (G, M, A) antibody was reacted. After completion of the reaction, the plate was washed 3 times and then examined using a fluorescence microscope to see if the egg zona pellucida in the ovary was stained. As a result, fluorescence was begun to be recognized around the third immune serum, and antibody production was confirmed. A total of 6 immunizations were performed. After the completion of the sixth blood collection, they started living together with female mice. After that, we continued to live together until pregnancy was confirmed, and examined whether or not to become pregnant. Mating was also confirmed by vaginal plaque. For comparison, a group (control group) was similarly immunized with only the fusion protein portion.

The results are shown in FIG. MZP3
_{Immunization with the 107-369} fusion protein showed slight variations in the antibody titer, but in all 6 immunized female mice, an antibody reactive with the egg zona pellucida was induced. It was not detected in the control group. In the control group, all 5 had children within 2 months after cohabiting with the male. On the other hand, in the immunized group, only 5 months after cohabiting, only one mouse has a baby, and the remaining 5 mice have no baby. The average number of offspring in the control group is 4.8, whereas that in the immunization group is 1.0. These results indicate that the recombinant MZP3 _107-369 antigen vaccine is clearly effective in contraception of female mice and that the sterility induced by this vaccine is reversible rather than permanent. It also indicates that there is. This contraceptive vaccine controls sterility (contraception period, contraceptive period,
It is possible to control the number of children).

This result proves that similar control of contraception can be achieved in cats by using the corresponding cat ZP3 antigen (FZP3) as a vaccine antigen.

[0073]

EFFECT OF THE INVENTION FZ obtained by expressing a DNA sequence encoding the feline egg zona pellucida FZP-3 protein amino acid sequence
P-3 related recombinant peptides are useful as vaccine antigens for cat contraception or infertility.

[0074]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 1305 bp Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: cDNA to mRNA Source: Organ name: Female Tissue type: Ovary Sequence: CCAGCGGGAG TGAGCGTAGG CGCC ATG GGG CTG AGC TAC GGG CTT TTC ATC 51 Met Gly Leu Ser Tyr Gly Leu Phe Ile 15 TGT TTT CTG CTT TGG GCA GGC ACG GGG CTG TGC TAT CCC CCA ACC ACC 99 Cys Phe Leu Leu Gly Leu Tru Ala Leu Cys Tyr Pro Pro Thr Thr 10 15 20 25 ACC GAG GAT AAG ACC CAC CCC TCG TTG CCA TCA AGC CCC TCT GTG GTG 147 Thr Glu Asp Lys Thr His Pro Ser Leu Pro Ser Ser Pro Ser Val Val 30 35 40 GAA GAG TGT CGG CAT GCC TGG CTG GTG GTC AAC GTC AGC AAA AAC CTT 195 Glu Glu Cys Arg His Ala Trp Leu Val Val Asn Val Ser Lys Asn Leu 45 50 55 TTT GGT ACT GGG AGG CTT GTG AGG CCT GCA GAC CTC ACC CTG GGT CCG 243 Phe Gly Thr Gly Arg Leu Val Arg Pro Ala Asp Leu Thr Leu Gly Pro 60 65 70 GAG AAC TGT GAG CCC CTG ATC TCT GGG GAC TCA GAT GAT ACG GTC AGG 291 Glu Asn Cys Glu Pro Leu Ile Ser Gly Asp Ser Asp Asp Thr Val Arg 75 80 85 TTT GAA GTC GAG CTG CAC AAG TGT GGC AAC AGC GTG CAG GTG ACC GAA 339 Phe Glu Val Glu Leu His Lys Cys Gly Asn Ser Val Gln Val Thr Glu 90 95 100 105 GGAT GCC CTG GTG TAC AGC ACC TTC CTG CTC CAC AAC CCC CGC CCC ATG 387 Asp Ala Leu Val Tyr Ser Thr Phe Leu Leu His Asn Pro Arg Pro Met 110 115 120 GGA AAC CTG TCC ATC CTG AGG ACC AAC CGC GCG GAA GTT CCC ATT GAG 435 Gly Asn Leu Ser Ile Leu Arg Thr Asn Arg Ala Glu Val Pro Ile Glu 125 130 135 TGC CGT TAC CCC AGG CAT AGC AAC GTG AGC AGC GAG GCC ATC CTG CCC 483 Cys Arg Tyr Pro Arg His Ser Asn Val Ser Ser Glu Ala Ile Leu Pro 140 145 150 ACC TGG GTG CCC TTC AGG ACC ACA ATG CTC TCA GAG GAG AAG CTG GCT 531 Thr Trp Val Pro Phe Arg Thr Thr Met Leu Ser Glu Glu Lys Leu Ala 155 160 165 TTC TCT CTG CGC CTG ATG GAG GAG GAC TGG GGC TCC GAG AAG CAG TCC 579 Phe Ser Leu Arg Leu Met Glu Glu Asp Trp Gly Ser Glu Lys Gln Ser 170 175 180 185 CCC ACT TTC CAG TTG GGA GAC CTA GCC CAC CTC CAG GCC GAA GTC CAC 627 Pro Thr Phe Gln Leu Gly Asp Leu Ala His Leu Gln Ala Glu Val His 190 195 200 ACC GGC CGC CAC ATA CCA CTG CGA CTG TTT GTG GAC TAC TGT GTG GCC 675 Thr Gly Arg His Ile Pro Leu Arg Leu Phe Val Asp Tyr Cys Val Ala 205 210 215 ACG CTG ACA CCA GAC CAG AAC GCC TCT CCT CAT CAC ACC ATC GTG GAC 723 Thr Leu Thr Pro Asp Gln Asn Ala Ser Pro His His Thr Ile Val Asp 220 225 230 TTC CAC GGC TGT CTC GTG GAT GGT CTC TCT GAT GCC TCT TCT GCC TTC 771 Phe His Gly Cys Leu Val Asp Gly Leu Ser Asp Ala Ser Ser Ala Phe 235 240 245 AAA GCC CCC AGA CCC AGG CCG GAG ACT CTC CAG TTC ACA GTA GAC ACG 819 Lys Ala Pro Arg Pro Arg Pro Glu Thr Leu Gln Phe Thr Val Asp Thr 250 255 260 265 TTC CAC TTT GCT AAT GAC CCC AGA AAC ATG ATC TAT ATC ACC TGC CAT 867 Phe His Phe Ala Asn Asp Pro Arg Asn Met Ile Tyr Ile Thr Cys His 270 275 280 CTG AAA GTC ACT CCA GCT AGC CGA GTC CCA GAC CAG CTA AAC AAA GCC 915 Leu Lys Val Thr Pro Ala Ser Arg Val Pro Asp Gln Leu Asn Lys Ala 285 290 295 TGT TCC TTC ATC AAG TCT TCT AAC AGG TGG TTC CCA GTA GAA GGC CCT 963 Cys Ser Phe Ile Lys Ser Ser Asn Arg Trp Phe Pro Val Glu Gly Pro 300 305 310 GCT GAC ATC TGT AAC TGT TGT AAC AAA GGT AGC TGT GGC CTT CAG GGC 1011 Ala Asp Ile Cys Asn Cys Cys Asn Lys Gly Ser Cys Gly Leu Gln Gly 315 320 325 CGT TCC TGG AGG CTG TCC CAC CTA CAC AGA CCG TGG CAC AAG ATG GCT 1059 Arg Ser Trp Arg Leu Ser His Leu His Arg Pro Trp His Lys Met Ala 330 335 340 345 TCC CGA AAT CGC AGG CAT GTG ACC GAA GAA GCA GAT GTC ACT GTA GGG 1107 Ser Arg Asn Arg Arg His Val Thr Glu Glu Ala Asp Val Thr Val Gly 350 355 360 CCA CTG ATA TTC CTG GGA AAG GCT GCC GAT CGT GGT GTG GAG GGG TCG 1155 Pro Leu Ile Phe Leu Gly Lys Ala Ala Asp Arg Gly Val Glu Gly Ser 365 370 375 ACC TCG CCT CAC ACC TCT GTG ATG GTG GGC ATA GGC CTG GCC ACG GTG 1203 Thr Ser Pro His Thr Ser Val Met Val Gly Ile Gly Leu Ala Thr Val 380 385 390 TTA TCC CTG ACT CTG GCT ACC ATT GTC CTG GGT CTC GCC AGG AGG CAT 1251 Leu Ser Leu Thr Leu Ala Thr Ile Val Leu Gly Leu Ala Arg Arg His 395 400 405 CAC ACT GCT TCC CGT CCT ATG ATC TGC CCT G TG TCT GCT TCC CAA 1296 His Thr Ala Ser Arg Pro Met Ile Cys Pro Val Ser Ala Ser Gln 410 415 420 TAAAAGAAA 1305

[Brief description of drawings]

FIG. 1 shows a comparison of deduced amino acid sequences of mouse and feline egg zona pellucida ZP-3 determined by genetic engineering techniques.

FIG. 2 shows a comparison of the deduced amino acid sequences of mouse and feline egg zona pellucida ZP-3 (continuation of the sequence of FIG. 1) determined by genetic engineering techniques.

FIG. 3 shows a comparison of the deduced amino acid sequences of mouse and feline egg zona pellucida ZP-3 (continuation of the sequence in FIG. 2) determined by genetic engineering techniques.

FIG. 4 shows the feline egg zona pellucida FZP3 ₂₆₁ gene sequence for expression along with the amino acid sequence.

FIG. 5 is a Western blot photograph confirming the expression of recombinant FZP3 ₂₆₁ antigen. Lane 1 is a molecular weight marker, lanes 2 and 6 are pMAL-c-FZP3.
₂₆₁ / JM109- # 5, lanes 3 and 7 are pMAL-c.
-FZP3 ₂₆₁ / JM109- # 11, lanes 4 and 8 are pMAL-c-PZP4 _1-198 / JM109, lane 5
And 9 are pMAL-c / JM109.

FIG. 6 shows the mouse egg zona pellucida MZP3 for expression.
_{The 107-369} gene sequence is shown along with the amino acid sequence.

FIG. 7. This figure shows affinity-purified recombinant M
It is a SDS-PAGE photograph of ZP3 _107-369 fusion protein. Lane 1 shows a molecular weight marker, and lane 2 shows the fusion protein.

FIG. 8 This figure shows infertility and litter _{size of} mice immunized or not immunized with recombinant MZP3 _107-369 antigen.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] June 30, 1993

[Procedure Amendment 1]

[Document name to be amended] Statement

[Name of item to be corrected] Figure 5

[Correction method] Change

[Correction content]

FIG. 5 is an electrophoretic (Western blot) photograph confirming the expression of recombinant FZP3 ₂₆₁ antigen. Lane 1 is a molecular weight marker, lanes 2 and 6 are pMA.
L-c-FZP3 ₂₆₁ / JM109- # 5, lane 3
And 7 are pMAL-c-FZP3 ₂₆₁ / JM109- #.
11, lanes 4 and 8 are pMAL-c-PZP4
_1-198 / JM109, lanes 5 and 9 are pMAL-c.
/ JM109.

[Procedure Amendment 2]

[Document name to be amended] Statement

[Name of item to be corrected] Figure 7

[Correction method] Change

[Correction content]

FIG. 7 This is an electrophoretic photograph of affinity-purified recombinant MZP3 _107-369 fusion protein. Lane 1 shows a molecular weight marker, and lane 2 shows the fusion protein.

 ─────────────────────────────────────────────────── ─── Continuation of the front page (72) Inventor Masanori Suzuki 1-3-1 Nishitsurugaoka, Oi-cho, Iruma-gun, Saitama Tonen Research Institute

Claims (10)

[Claims] 1. A feline egg zona pellucida FZ shown in SEQ ID NO: 1.
A DNA containing a nucleotide sequence encoding all or part of the amino acid sequence of the P-3 protein. 2. The DNA according to claim 1, wherein the base sequence is the whole or a part of the base sequence of nucleotide numbers 25 to 1296 shown in SEQ ID NO: 1. 3. The DNA according to claim 2, wherein the base sequence comprises the sequence of nucleotide numbers 340 to 1122 shown in SEQ ID NO: 1. 4. The feline egg zona pellucida FZ shown in SEQ ID NO: 1.
A method for producing a recombinant peptide containing all or part of the amino acid sequence of P-3 protein, wherein the DNA according to claim 1, 2 or 3 is incorporated into an appropriate replicable expression vector,
Transforming an appropriate host with the obtained expression vector, culturing the obtained transformant in an appropriate medium, expressing said DNA, and recovering the obtained recombinant peptide. Method. 5. The E. coli strain pMAL- is used as the transformant.
The method according to claim 4, which is c-FZP3 ₂₆₁ / JM109. 6. The feline egg zona pellucida FZ shown in SEQ ID NO: 1.
A recombinant peptide containing all or part of the amino acid sequence of the P-3 protein. 7. A recombinant peptide consisting of all or part of the amino acid sequence shown in SEQ ID NO: 1. 8. Amino acid number 10 shown in SEQ ID NO: 1
A recombinant peptide consisting of the amino acid sequence of 6 to 366. 9. A cat contraceptive vaccine containing an effective amount of the recombinant peptide according to any one of claims 6 to 8. 10. A method of contraception for a cat, which comprises administering the vaccine according to claim 9 to a female cat to immunize it.