JPH05508995A - Heterologous protein production reading Streptomyces vector - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] 20. Streptomyces transfected with the claimed nucleic acid sequence cell.

21. Streptotransfected with the NA vector according to claim 7 Mrs Cell.

22 Strep transfected with the DNA vector according to claim 10 Tomyces cells.

Specification Field of invention of Streptomyces vectors for production of heterologous proteins The present invention relates to the production of heterologous proteins in microorganisms. More specifically, the present invention includes: Nucleic acids for the expression of heterologous proteins, especially soluble CD-4 proteins, in Streptomyces Regarding sequences and expression vectors.

Background of the invention The main route of HIV virus infection is through attachment of the virus to the CD4 protein. be reached. CD4 (also called T4) is a major histocompatibility complex class II molecule It is a T cell surface glycoprotein associated with However, CD4 is also an HIV-1 envelope. It is a target of the glycoprotein gp120. HIV-1 virus is present on CD4 on target cells. Once bound, the viral RNA is released by direct fusion of the juxtaposed virus and plasma membrane. introduced into target cells [Maddon et al., Ce11.54:86 5-874 (1988)].

What is the DNA sequence of CD4? -7 Maddon et al, Ce1l , 42:93-104 (1985)]. More mature than this Extracellular region of CD4 protein containing four immunoglobulin-like domains (Vl-V4) , a transmembrane domain and a charged intracellular domain of approximately 40 amino acids. (see Maddon et al., supra).

Recombinant soluble derivatives of CD4, such as sT4, can be used with transmembrane and A protein that retains the ability to bind to gp120 even when the cytoplasmic domain is deleted. Ru. sT4 also inhibits both viral infectivity and HIV-transmitted fusion cell formation. It has also been shown that [Deen et al., Nature 331:82 82-84 (198 Co.) This inhibition inhibits sT4 protein and HIV gp120 envelope. It arises from protein association and therefore competes with the natural CD4 protein at the cell surface.

The mechanism by which CD4 and soluble CD4 inhibit virus infectivity and cell fusion formation is not fully understood. It has not been completely elucidated. In vitro, soluble CD4 or to HIV-2-infected cells without a concomitant increase in other viral proteins. It appears to induce the release of 20. This means that CD4 is a passive inhibitor of HIV-1. - meaning that it is an active inhibitor.

However, in vivo, sT4 protein and similar soluble CD4 protein is rapidly removed from the serum. This rapid removal is due to the HIV action of soluble CD4. significantly limits its clinical application as an inhibitor.

Several soluble CD4 chimeras were constructed to prolong serum clearance time. . Traunecker et al., Nature 331:84-86 (1988)], the carboxy-terminal portion of the protein was CD4 chimera (VIV2 and VIV2V3V 4) Disclosed. Tralanecka et al. further demonstrated that these structures are myeloma details. It is disclosed that it was expressed in cells.

Later, Traunecker et al., Natu re 339:68-70 (1989)] is murine IgM or IgG2 heavy chain Discloses a CD4 chimera (VIV2) fused to a constant region. These construction pots It is disclosed that a pentamer was formed.

Seed (EP-8-325, 262, published July 26, 1989) and Capon et al., WO 39, published April 6, 1989. 102922) is a CD4 chimera fused to the heavy and light constant regions of human IgG. Disclosed. The proteins disclosed by Seed and Capon et al. are both mammalian. in COS, BHK (pup/1 muster kidney) and CHO cells. expressed. As a result, the disclosed CD4 chimera requires less production compared to other expression systems. quality and overall production capacity is limited.

One objective of the present invention is to produce CD4 chimeras in bacterial host systems to reduce production costs. production and serum half-life and/or HI compared to soluble CD4. The goal is to produce CD4 with increased efficacy against infection.

In protein production using recombinant DNA technology, the protein produced by the host cell is Fusions with portions or other proteins are common. these extra parts does not typically participate in the action of the desired protein, but its presence may affect the folding of the desired protein. may interfere with viewing or processing. Therefore, reversing these effects It is desirable to be able to produce proteins as close as possible to natural proteins in order to avoid or reduce Yes. Therefore, another object of the present invention is to provide CD4 derivatives, chimeras and other of the protein in a pure protein sequence that does not contain amino acids derived from the host protein. It is produced in a bacterial host system with only a few added amino acids.

Yet another object of the invention is to generate CD4 chimeras and proteins and chimeras. Does it not contain amino acids derived from host system proteins for producing other proteins? We provide vectors that contain only a few amino acids added to the pure protein sequence. Is Rukoto.

Summary of the invention The present invention is directed to CD in Streptomyces (strepto+wyces). Nucleic Acid Sequences and DNA Vectors Useful in the Production of 4 Chimeric and Other Heterologous Proteins It provides: Nucleic acid sequences of the invention contain substantially 1 to about 6 amino acids. Streptococcus operably linked to a propeptide sequence consisting of the encoding amino acid sequence Stremptoa+yces longispo rus) encodes the signal peptide of the tyrosine inhibitor (LTI) gene during the synthesis of the protein product. After processing to remove the signal peptide formed on the streptomycetes selected to form a protein product with a homogeneous amino terminus in the Ru. In another embodiment of the invention, the propeptide is omitted and the LT The I signal peptide encodes a 1ys-ala-sequence at its 3° end. In other embodiments, the present invention operably binds to a nucleic acid sequence encoding a heterologous protein modified to Streptomyces cells transformed with the nucleic acid sequences or vectors of the present invention and to produce heterologous proteins in Streptomyces using the nucleic acid sequences of the present invention. This method provides a method for

The invention is more particularly pointed out in the appended claims, and preferred embodiments thereof is described below.

Detailed description of the invention The present invention provides a method for injecting CD4 chimeric proteins and other heterologous proteins into Streptomyces. The present invention provides nucleic acid sequences and DNA vectors useful for production. Main departure The nucleic acid sequence of the present invention consists of an amino acid sequence encoding substantially 1 to about 6 amino acids. Streptomyces longisporusti operably linked to the propeptide sequence Is the sequence encoding the signal peptide of the rosin inhibitor (LTI) gene? and the sequence of amino acids formed on the protein product during its synthesis. in Streptomyces after processing to remove the signal peptide The choice is made so that a protein product with a homogeneous amino terminus is formed. preferred In particular, the amino acid sequence of the propeptide is the same as the nucleic acid sequence encoding the signal peptide. processing of the protein product at a position between the end of the propeptide sequence and the beginning of the propeptide sequence. chosen to occur. In a preferred embodiment of the invention, propept The amino acid sequence of thr-1thr-pro-ala-ala-(SEQ I D No: 1) or thr=pro-ala-ala-ala-(SEQ No: 2). is the only amino acid and gives good yields of protein product. The propeptide thr- is more preferred. These embodiments of the invention The nucleic acid sequence of the propeptide preferably has the sequence ACC (encoding thr). ), ACCCCG GCCGCT (SEQ ID No.: 3) (th r-pro-ala-ala, code 5EQIDNO+1) or AC CCCG GCCGCT GCT (SEQ ID No: 4) (thr- code pro-ala-ala-ala-1SEQ III No: 2 ). The nucleic acid sequences of the invention are preferably operably linked to other DNA sequences. An expression vector is formed, which is then used in Streptomyces for production of the heterologous protein. can be inserted into The heterologous protein thus formed is a homogeneous protein consisting of the sequence of the propeptide. It has a high quality N-terminus.

In another embodiment of the invention, the propeptide is omitted and the LTI signal the peptide is modified at the 3' end to encode the sequence 1ya-ala- operably linked to a nucleic acid sequence encoding a heterologous protein. The nucleic acid sequence is Preferably, the expression vector is operably linked to the Pond DNA sequence, which It can then be inserted into Streptomyces for production of foreign proteins. This tool of the present invention In some cases, the signal sequence is cleaved from the foreign protein at the end of the signal sequence. and the N-terminus is 1ya-ala-X (X is the remainder of the heterologous protein) form a heterologous protein with This embodiment of the invention includes CD4 derivatives and chimeras. Extremely advantageous for protein production.

The applicant has surprisingly and unexpectedly discovered that the 2nd position near the N-terminus of CD4 ( By changing just one amino acid in the Vl region), it is efficiently secreted, When processed correctly, the entire LTI signal sequence can be removed, and virtually all LTI signal sequences can be removed. We have found that heterologous proteins can be formed that retain gp120 binding ability. C The nucleic acid sequence encoding the D4 derivative or chimera is 1ya-a at its amino terminus. ovine L3T4 (CD analogue) by changing to encode la- Contains an N-terminal amino acid sequence similar to that of the receptor, and the N-terminus of 1ya-ala- The product having the following is encoded.

This embodiment of the invention may be used to prepare CD4 derivatives or heterologous proteins other than chimeras. If you want to combine the nucleic acid sequence encoding the heterologous protein with two amino acids at its N-terminus, The base encoded by the amino acid is deleted, and 1ya-ala is substituted for the deleted base. - with a sequence encoding the LTI signal peptide, or with a sequence encoding the LTI signal peptide. By simply adding a sequence encoding 1ya-ala- to the 3° end, It can be modified at the amino terminus to encode 1ya-ala-. (And then, Ami) A heterologous protein with a modified N-terminus having the amino acid sequence 1ya-ala- Can be formed in mrs.

Because of the deleterious effect of the added amino acids on the function of the foreign protein, the applicant To avoid problems when forming seed proteins as fusion proteins, The sequence of a naturally occurring protein (or part thereof) that has few or all of the amino acids derived from it. We hoped to produce a heterologous protein with the following properties. The applicant surprisingly found that LTI It is possible to delete or modify the propeptide gene of can form a heterologous protein with an N-terminus of Streptomyces We found that it is efficiently secreted from host cells.

The amino acid sequence surrounding the signal peptide cleavage site is It turns out that this will have a dramatic effect on the Thing. processing and At least two parameters that influence the resulting secretion and production levels of be. Physicochemical properties and effective charges of amino acids in the region surrounding the cleavage site.

Statistical analysis of eukaryotic and prokaryotic signal peptides, signal peptide cleavage analysis shows a clear preference for a particular group of amino acids at particular residues in the surrounding region. [VonHeijne, FEBS Letters 244:439 -446 (1989)]. For example, amino acid residues at positions -3 and 11 are generally small. There is no charge. Alanine is like this! most common amino acids in It is. Additionally, positions -3 and 11 show a clear bias toward certain amino acid groups. vinegar. For example, aromatic charged hydrophobic residues and proline are found in 78 eukaryotic signal peptides. It was not found in 11th place in Chido.

At the amine terminus of the mature protein, proline and glycine are almost absent at the +1 position. Not possible. Both experimental data and statistical analysis show that the cleavage site of bacterial signal peptides is It clearly shows that effective neutrality or negative charges are selected for the edge regions [Li, etal,) is an enzyme for alkaline phosphatase of E. coli. When the amino terminus is mutagenized so that the net charge increases from O to +2, the alkaline This shows a 50-fold reduction in total production of calyphosphatase. Furthermore, the precursor The time required for the body to process the mature product is predicted for the wild-type protein. In contrast, it changed to 30 minutes for the mutant with an effective charge of +2. effective charge Reducing to +1 reduced the severity of this defect somewhat. Above, Smarth et al. ummerse, et al.) is a B-lactamase signal peptide. Various hybrids between chicken muscle triose phosphate isomerase Describes protein. Natural triose phosphate isomerase is - It is not secreted into the periplasm of coli. However, this triosephosphate The arginine residue at position 3 of isomerase is replaced with a proline or serine residue. This protein could then be exported to the veriplasm. These observations indicate that the cleavage site Won 11 shows a clear selectivity of the effective negative charge in the periphery. eijne) gives credibility to the statistical analysis.

The first two amino acid residues 1ys-1ys- of CD4 (in the V1 region) are gp1 20 was found to be absolutely necessary for binding activity. CD with pure N-terminus In an attempt to provide 4 derivatives and chimeras (e.g. KK-VIV2), C It was found that D4 derivatives and chimeras could not be produced.

When the CD4 VIV2 region is fused with the LTI signal sequence, the resulting product is processed into at least two forms. The applicant surprisingly found that Surprisingly, by inserting up to five amino acids, it becomes positively charged. Moving the lysine residue far from the signal peptide cleavage site results in a uniform N-terminus. CD4 heterologous proteins with truncated ends are efficiently transported into the culture medium and still retain gp120 binding. It was found that the combination ability was maintained. Even more surprisingly, the applicant When lysine at position 2 of the D4 molecule is changed to alanine, lysine is present at the N-terminus. Nevertheless, it is possible to produce a uniform CD4 protein with an N-terminus that is close to the pure product. I found it. Furthermore, this heterologous protein is also efficiently secreted into the medium and binds gp120. maintain competence. Heterologous protein produced using the nucleic acid sequence and vector of the present invention has a homogeneous N-terminus. That is, the N-termini of the products have the same amino acid sequence. protein, which offers several advantages over foreign proteins produced as a mixture of several forms. I can do it.

Production costs are reduced due to fewer separation steps required to obtain the desired product in purified form. is low. A single product is preferable to a mixture of heterologous proteins for regulatory approval. stomach. In addition, the natural folding and function of protein products is derived from host system proteins. Facilitated by the absence of amino acids.

In other embodiments, the invention provides a promoter and substantially 1 to about 6 amino acids. operably linked to a propeptide sequence consisting of an oligonucleotide encoding an amino acid The tyrosine inhibitor gene of Streptomyces longisporus was from a heterologous protein-encoding sequence operably linked to a nucleic acid sequence encoding a DNA vectors for the expression of heterologous proteins in Streptomyces Ru. The sequence of amino acids corresponds to the signal formed on the foreign protein during its synthesis. After processing to remove the peptide, homogeneous amino acids in Streptomyces The selection is such that a heterologous protein with a terminal end is formed. Preferably, a heterologous protein The sequence encoding white is the HIV gp120 binding region.

In other embodiments, the invention provides a promoter and a Streptomyces longis Heterologous operably linked to the trypsin inhibitor gene signal sequence of Polus DNA vector for expression of a heterologous protein in Streptomyces consisting of a protein coding sequence It is aimed at the target. The sequence encoding the heterologous protein has a 1ys- addition of a base encoding the amino acid sequence of ala, or two at the 5′ end. Deletion of bases encoding amino acids and lys-ala amino acid sequences of deletion sequences Modified by sequence substitution for sequence code. Preferably for encoding a heterologous protein The sequence is a sequence encoding the HIV gp120 binding region.

Further embodiments of the invention are directed to methods of using the DNA vectors of the invention. , the vector of the present invention is introduced into a Streptomyces host cell, and the host cell is incubated in an appropriate medium. It consists of growing cells.

A further embodiment of the invention is a transfection with a nucleic acid or DNA sequence of the invention. directed against Streptomyces cells.

The CD4 T lymphocyte receptor protein, herein referred to as rCD4J, is a protein found in the HIV envelope. It is a surface glycoprotein that interacts with the protein gp120. This high affinity interaction occurs between gp120 and the extracellular domain of CD4. Extracellular domain of CD4 consists of four regions of limited homology with the variable (V) region of immunoglobulins. Ru.

The general bounding domains of the CD4 variable-like regions (Vl-V4) each consist of 100 amino acids. -109, amino acids 175-184, amino acids 289-298 and amino acids 3 It is 60-369. Thus, as used herein, vl is amino acid 1-183. (approximately). The same goes for others.

Removal of the transmembrane and plasmid domains of CD4 frees the soluble receptor protein. arise. Such a CD4 protein comprises all or part of the external region of the human CD4 receptor. has been shown to inhibit HIV-1 infection and virus-induced cell fusion. [e.g. Deen at al, Nature 331:82-8 4 (1988)]. "HIV gp120 binding domain" used herein The term HIvgp12o binds to and is equivalent to the full-length CD4 receptor protein. has a high affinity for any soluble human CD4 molecule (i.e. trans membrane and plasma domain defects). The binding of CD4 to gp120 Binding affinity was determined by Arthos et al.

Ce1l 57:469-481 (1989)].

The CD4 molecule of the present invention has a minimal HIV gp120 binding region found in domain v1 ( Consists of amino acids 4l-45). Preferably, the V1/2 domain of CD4 or A sequence that is actually equivalent to that (i.e., does not differ by more than 15 amino acids) include. Accordingly, preferred embodiments of the invention are human immunoglobulin constants. It is VIV2 that has been combined with the department.

What is the DNA coding sequence of CD4? -/Maddon et al. , Ce1l 42:93-104 (1985)], and the present specification However, the mature amino terminus of human CD4 is Lys-Lys. , is not Gln-Gly-Lys-Lys reported by Matsuton et al. [Lit tman et al., Ce1l 55:541 (1988)], CD DNA encoding 4 is available from a variety of sources, such as plasmid pT4B. (Matsuton et al. above). Alternatively, the cDNA segment encoding CD4 The offspring are expressed using known methods (e.g., polymerase chain reaction) to express CD4. Can be derived from T lymphocyte mRNA or synthesized using standard DNA synthesis methods .

In addition to the proteins exemplified below, those skilled in the art will recognize that D NA molecules can be easily constructed. For example, amino acid additions, substitutions, deletions, rearrangements (e.g. VIV3, VIV4) and their chemical modifications are obvious to those skilled in the art. That is. However, such derivatives do not retain HIV gp120 binding ability. Must be.

A unique advantage of the CD4-1g chimera of the invention compared to soluble CD4 is that it is highly effective in HIV infection. The aim is to enhance the suppression/inactivation effect of . This is explained in more detail below This can be achieved through acquisition of the Fc effector functions described.

The effector functions originally present in the Fc region of immunoglobulin include serum clearance. extension of time [Nakamura et al., J. Immun, 10] 0:376-383 (296g)], protein A binding [Deisenhofer et al., Biochem 20:2361-2370 (1981)] , Fc receptor binding [and antigen-dependent cell cytotoxicity (ADCC), cytotoxicity] mediated by antibody binding to Fc receptors on T-cells], complement fixation (e.g., C1 4 bonds), dimerization [Davis et al, ^nnu Rev Immu nol 1:87 (1983) and placental transfer [Morgan et al. ,.

^dv Immunol 40:6l-134 (1987) is included.

However, when expressing immunoglobulin-heavy portions, effector functions Some of them are reduced or eliminated. Therefore, the advantages of the present invention are that effector functions are conferred to the molecules of the invention by the addition of amino acids with those functions. Yes, it can be returned. For example, binding of human IgG Fc fragments Crystallographic studies indicate that 21-merization occurs in the hinge region and CH3 domain [ For example, Deisenhofer etal, J Biochem 20+ See 2381-2370 (19U). Therefore, the hinge portion or the CH3 By adding amino acids from the main IgG fragment, which has the ability to dimerize, can produce fragments.

Furthermore, the Fc effector functions described above can be achieved by any suitable immunoglobulin constant. It can also be derived from moieties or isotopes. For example, IgG1, IgG2.1gG3, I gG4, IgGM, IgGA or IgG, preferably IgG1〜human Ig G1 was shown to be the most efficient at killing cells by complement and ADCC. [Bruggeman et al., J Exp Med 16] 6:1351-1361 (1987)]. The IgG1 constant region consists of several domains, Consisting of CHI, hinge (h), CH2 and CH2 [Ellison et al., Nar 10:4071-79 (1981)].

The immunoglobulin constant region of the present invention has the variable region deleted, and has CD4 or its HIVg All or part of a human immunoglobulin heavyweight substituted with a p120 binding fragment. can include parts. Additionally, its gp120 binding fragment. moreover , the gp120 binding domain is directly (i.e., synthesized as a signal polypeptide) immunoglobulin production or expression) or indirectly (i.e., post-synthesis binding). They can be put together in the stationary part.

One embodiment is a majority (i.e., at least 51%) of the CH3 domain or A human immunoglobulin IgG constant region lacking all. Preferably, immunoglobulin The constant region consists of most or all of the CH2 domain. That is, CH2 domain In+ or one hinge (h) fB. Preferred specific examples include -CH1hCH2 , -hCH2 or -CH2. However, the present invention It is not limited to inns.

Another variant of the invention is an aglycosyl compound comprising at least one domain. This is a modified human immunoglobulin constant region. Preferred specific examples are not particularly limited. Notecana squid, -CH2CH3(j(3, -hCH2CH3, -CH2CH3, -hcH2, -CH2 and -CH3 are included. The most preferred embodiments include: Includes, but is not limited to, -hCH2 and -CH2. preferred Preferably, the protein of this embodiment is produced in a bacterial host. More preferably host bacteria is from the genus Streptomyces.

A method for preparing DNA encoding the heavy or light chain constant region of an immunoglobulin is, for example, Robinson et al., published on May 7, 1987. Open PC Application Publication No. 1087102671). Furthermore, those skilled in the art A person can use known methods (e.g., polymerase chain reaction) to synthesize any IgG1 Copying the human IgG1 sequence from an expression cell line, e.g. ARH-77 (from ATCC) It is possible to prepare DNA molecules that encode

Alternatively, the DNA molecule can be synthesized using standard NA synthesis techniques.

In addition to the proteins specifically exemplified herein, those skilled in the art will also recognize the coding of Ig derivatives. DNA molecules can be easily constructed. For example, amino acid additions, substitutions, deletions, rearrangements and their chemical modifications. Other examples include replacement of cysteine residue deletions, Mutagenesis or other immunizations that increase Fc receptor binding and/or CIQ binding This includes the introduction of an Fc region from an epiglobulin molecule. Such derivatives are: have some or all of the Fc effector functions described in .

Depending on which region of IgG is expressed, the resulting chimeric protein is human IgG.

protein A1 complement (particularly CIQ), and appropriate cells of the immune system, e.g. , can bind to antibodies directed against the Fc receptors of macrophages. In addition, complement (and (and other effector functions) from the corresponding sequences simply present on the heavy chain constant region. also appears to depend on other factors. This is because human Ig containing complement-fixing sequences This is because different subclasses of G have different complement fixing abilities.

The recombinant DNA molecules and nucleic acid sequences of the invention further include DNA sequences. may include, for example, regulatory elements, one or more selectable markers, and replication and maintenance functions. It is a vector consisting of a sequence encoding . The regulatory region typically comprises a code of the invention. Contains the promoter found upstream from the code sequence and facilitates RNA polymerase binding and Functions in transcription initiation. In other words, the regulatory elements or regions are operatively bound to the body's DNA molecules. The choice of regulatory region depends on the host cell used. A person skilled in the art can do this as appropriate.

Selectable marker systems are marker genes that confer a new selectable phenotype on transformed cells. Any of a number of known marker systems such as genes may be used. For example, thiostrep Thompson-resistant liposomal methylase [Thompson et al., Gen. e20:51 (19g2) and neomycin phosphotransferase Streptomyces drug resistance such as (Thompson et al, supra) Genes are included.

DNA sequences encoding replication and maintenance functions include, for example, Streptomyces derivatives of Keiser et al., plJ101 derivatives [e.g., Keiser et al., M. ol Gen genetν+5:233 (191112) reference code or strain Ptomyces 5LPI-inducing vector [e.g. Bibb etal, Mol. Gen. Genet 184:230 (1981)]. present invention The vector may contain a marker that allows gene amplification. Streptomycetes Spectinomycin is a marker used to amplify gene copy number in plants. Can be used for resistance.

The invention also relates to host cells transformed with recombinant DNA molecules of the invention. . Such host cells can be grown in a suitable medium and can contain recombinant DNA molecules of the invention. Expresses the protein encoded by. Such host cells can be used in the methods of the invention, i.e. In other words, it can be prepared by transforming a desired host cell with the plasmid of the present invention. . Such transformation can be performed using conventional transformation methods. preferred The host cell belongs to the genus Streptomyces. For example, the host is limited to There is no Nis lividans (S, 1ividans), Nis coerikara -(S.

coelicolor), Niss Alps (8,31bus) and Niss o Ngisporus (S.

1 ongisporus). Preferred embodiments include varnish lividan. and Nis longisbolus. Other suitable host cells include: However, mammalian cells, insect cells, yeast and other bacterial cells (e.g. coli, Salmonella, and Bacillus). Thus, the present invention and its The products are not limited to any particular host cell.

Various promoters are available for the expression of heterologous proteins in Streptomyces. . For example, the Streptomyces galactose operon-inducible promoter [Fo rnwald et al, Proc, Natl, Acad, Sci, USA 84:2130 (1987)], varnish lividans β-galactone Dase gene construction promoter [Eckhardt et al., J. Ba. cteri.

1169:4249 (1987); Brown et al, USP 4 ．． 717.666], xsu-ongisporus trypsin inhibitor gene (Refer to EP-^-264, 175 released on April 20, 1988) or M.H. As reported in M. echinosporsa Temporally regulated promoter [Baum et al., J. Bacteriol 170 Near 1 (1988)]. Termination of transcription in Streptomyces The end region is derived from the 3' end of several Streptomyces genes, e.g. The termination signal at the end of the Streptomyces galactose operon or S. fradiae neomycin phosphotrans It is found at the end of the ferase gene [Thompson et al. ProcNatl Acad Sci USA 80:5190 (1983) can be mentioned. Sequences for protein export in Streptomyces include Nis livida Nis. LEP-10 gene and Nis. longisbolus trypsin inhibitor (LTI) gene (published on April 20, 1988). (See Open EP-^-264, 175). Preferably, but not exclusively, the The export or signal sequence is derived from the LTI gene.

More preferably, the signal sequence is modified as described in the Examples (e.g. additions, substitutions, deletions and/or rearrangements).

For early expression studies, CD4-1g chimeric LTIs as described in further detail in the Examples fused to the prepro sequence. Streptomyces replication for this expression vector The function is plasmid pIJ351 [Keis er et al.

The present invention also provides methods for culturing the transformed host of the present invention in a suitable medium and isolating the protein. A method for producing a protein encoded by a recombinant DNA molecule of the present invention, which comprises It also relates to "Suitable medium" means a medium in which the host can recover the coding sequences of the present invention. This means a medium that can express the protein in a sufficient amount. It is known to those skilled in the art that the medium used depends on the host cell. self-evident. Isolation of the protein thus produced is preferably carried out from the host culture medium. cormorant. That is, the proteins of the invention are preferably exported into the culture medium.

The protein(s) of the invention are isolated and purified using standard methods. For example, extraction, selection selective precipitation, column chromatography, affinity chromatography or An example is electrophoresis. For example, an IgG chimeric protein can be used in a solution containing the chimeric protein. The solution contains immobilized protein A or B that selectively binds to the Fc portion of the fusion protein. It can be purified by passing it through a column containing For example, Re1s et al. , J Immuno 1132:3098-3102 (1984). Then , chimeric proteins can be treated with chaotropic salts or pH changed (e.g., 0.3 M acetic acid). It can be eluted by Alternatively, the proteins of the invention can be used on an anti-CD4 antibody column or on an anti-immune column. It can be purified on an epiglobulin antibody column.

The proteins and protein products of the invention can be used to treat HIV virus infections. Forecast As a preventive measure, CD4-1g chimera can be used against high-risk individuals for AIDS or HIV. to individuals who have been shown to have been exposed to HIV by the presence of antibodies to the virus. disease Administration of an effective amount of the chimeric protein at the early stage of or before the onset of the disease may increase the sensitivity of CD4° lymphocytes. It acts to prevent staining. As a treatment, CD4-1g chimeric HIV infection Administration to the body prevents the spread of the virus outside of cells.

The dosage range of the chimeric protein of the present invention is such that it reduces the symptoms of HIV or HIV infection. This is the range that produces the desired effect. This dose is based on the presence of anti-HIV antibodies, culturable HIV sensitivity as due to the presence of the virus and the presence of 124 antibodies in the patient's serum by fusion cell formation or viral dissemination over a period of time during which infection has been demonstrated. selected to maintain an amount that inhibits or prevents secondary infection. anti-HIV antibody The presence is determined by standard ELISA or Western assays, e.g. anti-gp-12 0, can be measured by using anti-gM1, anti-tat, anti-p55, and anti-p17 antibodies.

Dosage is generally determined based on age, severity of infection, counterindica tion), if any, will vary depending on, for example, immune tolerance. Dose is 0.0 1g/kg/day to 50a+g/kg/day, preferably 0.01 to 1. Q It can vary in mg/kg/day. The chimeric molecule can be administered intravenously, intraperitoneally, intramuscularly or cutaneously. Can be administered below. When administered parenterally, a single injection (e.g., porous) or a scheduled can be achieved by gradual perfusion over Ru.

The proteins of the invention can be used in combination with other agents, e.g. in conjunction with drugs against other HIV proteins such as enzyme, protease or tat. Can be used. Effective treatments for HIV involve both viral transmission and infection of cells. Transmission from cells to cells must also be prevented. The protein may also be used for other antiviral agents, For example, it can also be used in combination with azitothymide (AZT).

The proteins of the invention can also be used as therapeutic agents or inhibitors of CD4+ cell interactions. It can also be used as an agent for the identification of natural, synthetic or recombinant molecules for use. for example, The protein can be used in an ELISA-based method for competitor analysis of the CD4 receptor surface domain. It can be used in screening assays such as protein interactions measured by

This shows that soluble CD4 protein binds to cells expressing HIV env protein. Based on the in vitro data, the proteins of the invention can also be used in vivo. selective targeting molecules for HIV-infected cells in It can also be used as an eting molecule). As a target-specific carrier protein For example, CD4-Ig protein can be used in infectious agents, including delivery of liposomal formulations. It can be used as a carrier protein for the delivery of cytotoxic agents to cells.

The present invention will be explained in more detail with reference to Examples below, but the present invention is not limited thereto. It is not something that will be done.

Example Enzymes used in genetic engineering are obtained from commercial sources and substantially in accordance with the vendor's instructions. I used it accordingly. Unless otherwise specified, Maniatis (Maniatis) ) et al. [Molecular Cloning, Cold Spring Harbor Laboratory arbor Laboratory), 1989]. I went to

Example I Preparation of CD4-IgG chimeras Using recombinant DNA manipulation, various plus Human Hing was added to the coding sequence for the v1v2 domain of CD4. followed by the e-CH2 or Hinge-CH2-CH3 region, which is compatible with various host cells. Functions in cells.

The VIV2 region contains amino acids 1-183 [Maddon et al. The cell ing e-CH2-CH3 regions each contain IgG1 amino acids 97 to 2 28 and 97-330 [Ellison et al., N.A. ・R (NAR).

Disclosed in EP-A-331,356 (published on September 6, 1989) Expression vector 5T4184. Plasmid VIV2183 by modifying DHFR Plasmid 5T4184 from which DHFR was obtained. DHFR with EcoRI and Nhe 682 base pairs containing nucleotides 1 to 682 of CD4 DNA The fragment was isolated. This fragment is followed by a TAA stop codon <CD4 amino acids 177 to 183 was ligated to a synthetic linker encoding 183. In addition, the nucleotides of the CD4 sequence Synthesis by changing 693 (G to A) and 696 (C to T) The linker generated the Hindll [site. These nucleotide changes are amino Do not change acid sequence. The resulting fragment flanked by EcoRI and XbaI was One 5T4184. Tie into the EcoRI and Xba1 sites of the DHFR plasmid. I did.

The sequence of the synthetic linker is substantially as follows.

The resulting plasmid VIV2183DHFR contains the mouse β-globin promoter. Regarding the tar, DHFR gene, SV40 polyA region and amino acids 1-183 contains the CD4 coding sequence of V with Hindm disconnecting after VIV2 cryptographic region IV2183DHFR was substantially linearized.

Then Ban1I-Ava! encoding the Hinge-CH2 region! Fragment (Nuku Reotide 299-677, Ellison et al., supra) was added to human IgG. 1 Isolated from cDNA. (The Hind] I[ site was determined by PCR mutagenesis. I introduced it. ) Each fragment was linked to a different VIV2183DH with the following synthetic linker: ligated into the Hindn[ site of the PR plasmid.

1) HindI [l-Ban1I linker + 3' end of VIV2 gene For connecting to the 5° end of geCH2 or Hinge-CH2CH3.

5' AGCTTCCAAGGT to GAGCC]'Co1 8GGTTCCACC 5' 1i) AvaI-HindI[[linker-; stop codon after CH2 coding sequence The 3° end of the Hinge-CH2 fragment is joined to the 5° end of the VIV2 sequence. used to.

5' CCGAGAGTAGTGACTGCAGA) 'ko' CTCATC CTGACGTCTTCGA 5' These constructs Maintaining the correct reading frame without the addition of non-CD4 or non-1gG1 amino acid residues and herein, VIV2-hcH2DHFR and VIV2-hcH2DHFR, respectively. 1l-hcH2cH3cOs vector VIV2-hcH2DHFIJ: and VIV 2-hCH2CH3DHFR was digested with NheI. 1817 and 2147b Each fragment of p was isolated, containing the carboxy terminus of v2, the complete Hinge-CH 2 or Hinge-CH2CH3 coding region, bovine polyA region, mouse β-g It consists of the Robin promoter and part of the mouse DHFR coding region.

(Described later) Vector VIV2183COS2 is a Rouse sarcoma virus TR. .

SV40 early promoter, VIV2, SV40 polyA early region, and mouse Contains the mouse β-globin promoter operably linked to the DHFR coding region. have Digesting VIV2183CO82 with NheI produces the mouse DHFR code. A 1723 bp fragment containing the carboxy terminus of ■2 for the region is removed. .

Next item, VIV2-hcH2DHFR and VIV2-hCH2CH3DHFR The Nhel fragment from It was ligated to the NheI site of vector VIV2183CO32, which has a new reading frame. .

The resulting vectors were transformed into VIV2-hcH2cO3 and 1V2-hCH2CH3C. It was called O8 and was used to transfect CO8 cells.

Construction of VIV2183CO8 Nib 5 Sumi Obtain FVIV2183CO82 to Rutame , plasmid VIV2183DHFR was digested with EcoRI and Xbal.

A 707 bp fragment was isolated that filled the EcoRI site and consisted of the VIV2 coding region. .

This fragment was already cut with SmaI and Xbal to delete the sT4 coding region. It was ligated to the plasmid Rst4COS2 (described below). The obtained plasmid is It was V1v2183voS2.

Construction of Rst4COS2 To obtain the niblasmid Rst4COS2, plus Mid-s t4DHFR [Maddon et al., PCT/WO38101 304, published February 25, 1988, was digested with SmaI and EcoRI.

A 338 bp fragment that fills the EcoR■ site and contains the SV40 early promoter. was isolated. This fragment has already been cut with BamHI and filled in with sticky ends. It was tied to Rst4DHFR (see below). Orient the resulting plasmid. cleaning, and the SV40 early promoter is oriented in the opposite direction to the RSV LTR. The plasmid Rst4cOs2 was selected as plasmid Rst4cOs2.

Construction of R3T4DHFR Niblasmid TND [:l Nors (Connors) et al., DNA, 7: 651-661 (1988)]. Digested with BgllI and HindI[I. Rouse sarcoma virus (RSV) ) A 600 bp fragment containing the LTR was isolated. Hindmr viscous terminal J, Sm A commercially available linker consisting of an aI site, an EcoRIrq coterminus -New England Biolabs , Beverly, ? BgllI and Plasmid 5 was digested with EcoRI to delete the SV40 early promoter. RHV LTR fragment bare in T4DHFR (Maddon et al., supra) A Digested with f II [[ and Xbal. Each part of ■1 (habo 73 amino acids ) and the complete Hinge-CH2 or Hinge-CH2CH3 cryptographic region. Fragments of 746 and 1041 bp were isolated. These AflII-X The ba fragment is disclosed in EP-E-331356 (published September 6, 1989). replacing the AflII-XbaI fragment of plasmid OmpAVIV2, v1v2-hCH2 or 1tVIV2-hCH2CH3L'ft'L or iJi A vector containing the 5-muda Pt promoter and the OmpA signal sequence was Obtained. The vector, which functions in E. coli, was combined with OmpAVIV2-hCH2 and and OmpAVIV2-hCH2CH3.

VEC9-VIV2-hcHL2DHFR, l: and VIV2-hCH2CH3D HFR was digested with AfllI and Xbal. Part and complete of Vl, respectively. 74 containing the Hinge-CH2 or Hinge-CH2CH3 cryptographic region 6 and 1041 bp fragments were isolated. These AflI [[ and Xbal The fragment is the AflI[-XbaI fragment of plasmid 12B1! I changed it. Plasmi 12B1 is Streptomyces lividans (Streptomyces 1). ividans) longisporus trypton inhibition (LTI) promoter and signal sequence (published on April 20, 1988) (see EP-A-264175), as well as a Lasmid pIJ351 [Keisert et al., Molecular General Geltix (]!on, Gen, Genet, ) 185223 (1982)], including the Strebsmycete replication function found in have The obtained vector was transformed into VIVl-hCH2strept and VIV2- hCH2CH3strept, VIV2-Hinge-CH2 or VI LTI signal sequence fused or linked to V2-Hinge-CH2CH3 It becomes more. These vectors function as Strebmycetes and VIV2-hcH2 * or designed to transport VIV2-hCH2CH3 into the culture medium.

However, the naturally occurring LTI protein is expressed as a prepro protein.

That is, the signal sequence is cleaved during secretion, and the pro sequence is cleaved outside the cell. .

As a result, isolated LTI proteins may have heterologous amino termini. v1v2-hcH 2strept and V I V 2-h CH2CH35trept Expression of VIV2-hCH2 or VIV2-hCH2CH3, respectively, is associated with this malformation. : ie, produces a protein with a heterologous amino terminus. Mature protein, i.e. all The ratio of proprotein to mature protein lacking signal sequence amino acid residues depends on the culture conditions. , for example, by changes in pH 1, dissolved oxygen, etc.

Alternatively, the wild type LTI prepro sequence, i.e. signal sequence + propept The protein was modified to obtain a protein with a heterologous amino terminus. The wild-type prepro sequence is Contains amino acids.

Met-^rg-Asn-Thr-^1a-Arg-Trp-Ala-Ala- Thr-Leu-^1a-Leu-Thr-Ala-Thr|^1a- Val-Cys-Gly-Pro-Leu-Thr-Gly-Ala-^1a- Leu-^1a-i-Thr-Pro-^1a-Ala-^Pa-Pro- ^1a-3er　; Here, ↓ represents the cleavage site between the signal sequence and the proprotein.

In construct No. 1, the proprotein sequence was deleted and replaced with Thr (T). (Nari The amino terminus of the mature CD4 protein is KK). Therefore, this chimeric CD4-immunogen The amino terminus of Robulin protein is Thr-Lys-Lys (TKK). already In one construct, the propeptide sequence and the first two of the mature chimeric protein Amino acids were deleted and replaced with Lys-AIa (KA). VIV2-hCH VIV2-hCH2-TKK and VIV2-h It is called CH2-KA. These vectors are respectively Th　-Ly　5-Ly　 The VIV2-hCH2 protein with a heterologous amino terminus of s or Lys-Ala was co-coated with code.

Complete nucleotide sequence and chimeric protein of vector VIV2-hCH2-KA The corresponding amino acid sequence of VIV2-hCH2-KA is disclosed below.

1 ■ Swordsmith Tsumesu αffi Koniro ■ Ee ■ Zuko Sword Co. = Sco λC 01425 C ;’L GItG GIG GCG1℃Ic QC’GA GCCr GG CCAZG TTCA-1: iW'? -C260) ValValValValAs pValSat)IiiiGluAspProGluVilLysPhs^5nT apTy+1476 GIG GCCH-GrG GG C1℃OIT MI’ (D: NG,'CA M:;αI; CG-GS GS 0S277) Vi l　^sp　017　Vil　Glu　Vil　His　^1nAll　shiys Thr Lys Pro Arg Glu flu G1n X578 πko0℃N4σr A! 'G GG Fu CNGπz < G1℃πI :,”f AI’Aα=C℃αλ311)TapL*uAsnGlyLysG luTyrLyiCys’LysVilSerAsnLys^1xuuPr.

3s6ocWrlF; Coco ACGTI ko [Go 组]: 1pCrrCro I Fuco XI Q is20 αλ stone [: Engineering GG Engineering Fusu l5CXS Ro αC sword = Koniωzλ=Tsuχ ;c=csu6180■Inc. Your work σ 3 U T8640, λ engineering N = M ro = ai; Gα = -T ro = ko α ro = Nigo ===to=α wtoo NCAM entered Aαλ construction pressure COα co=Uπ nail roπ 仄2 λ ecoα f17mm (n(7B; 2(χcorrGA:low=c℃) = α = ccx 3: Tame C [zuko;, W zxm942o αfl(A Here, the signal sequence begins at nucleotide 648 and ends at nucleotide 731. Variation: v1 starts at nucleotide 732, ends at nucleotide 1286, and H The 4nge region starts at nucleotide 1287 and ends at nucleotide 1331. , CH2 starts at 1332 and continues to the end of the cipher sequence (.

VIV2-hCH2 was transferred into CHO cells by electroporation. was applied. 15 μl of phosphate buffered sucrose (PB sucrose 0272mM) Claus, 7mM sodium phosphate pH 7, 4, 1mM M g CI! , extinction 15 μg of VIV2-hCH2 DNA suspended in bacterial filtration) was added to 1. OX 10 ’　Mix with CHO cells (0.8ml) and place on ice in Gene Pulsar Cuvette. Tsuto (Gene Pυ1sercuvette) (Pio Lad (Bio- Rad), Richmond, California), Incubated for 15 minutes. This cuvette is then placed in a Gene Pulsar Place it in the electrode chamber of Iorad (B1o-Rad) and apply 700 volts. One pulse of /3 μFd (time constant = 0.7) was delivered to the cells. Place the cells on ice. 0 minutes, then add growth medium (IXITS [insulin, transferrin, serum Rhenium: Collaborative Research arch), Bedford, MA Co., 1x Lipid [Gib Gibco, Grand Island, (including NY) to 10 ml. The cells were then placed in a 96-well microtiter. Plate 3×10s cells/well for a total of 5 plates. 48 After an hour, the medium was transferred to a DHFR selective layer (i.e., nucleoside-free growth medium). medium).

Cells were maintained on selective media for approximately 4 weeks. 15% 5DS-PAGE gel electrophoresis and Western blot analysis using anti-sT4 polyclonal antibody. . The VIV2-hCH2 gene product has a molecular weight of approximately 40. At OOO Dalton Identified by a single yomai band. Plate cells from positive wells for 24 wells and maintained on selective medium until scale-up is easy. scalea Two clones (3F8 and 2F6) were selected for deployment. Clone 3F8 were amplified in selective medium containing 50 nM methotrexate. Cells were placed in 96 wells. Re-plated on microtiter plates at 3X10' cells/well. Growth is 5 Starting with a methotrexate level of 0 nM and increasing according to standard protocols. It was necessary to raise the level after each successful breeding.

Similarly, the VIV2-hCH2CH3 vector was prepared by electroporation. CH○ cells were transfected. Cells were grown on nucleoside-free medium. Western blot analysis using anti-sT4 antibody revealed that the supernatant of wells had no abnormalities. Positive clones were selected by screening. Then supernatant Positive clones were amplified using increasing amounts of methotrexate.

CO8 cells were obtained from ATCC (Rockville, MD). , grown according to ATCC recommended protocols. The cells were then treated with DEAE- Dextran (Pharmacia) 400 g/m 1 and chloroquine (Seed et al., Proceedings of the Nation). Natl Academy of Sciences (Proc Natl Acad 5 ci) 84:3365-3369 (1987)) DMEM containing 100 μM (Dulbecco's minimum essential medium)) Give: 1 (GIBCO ) Grand Island (Grand l5land), 2.5% in NY Nu serum (Collaborative Research (Collaborative Re5e) 10 in Cambridge, MA) Transfected with μg of plasmid DNA. Incubate for 4 hours at 37°C After washing, the medium was removed and the cells were placed in 10% diluted solution in PBS (phosphate buffered saline). Treat with 2 ml of tylsulfoxide at 25° for 3 minutes, remove the medium, and transfer to DMEM. Replaced with.

Both VIV2-hCH2 and VIV2-hCH2CH3 (7) were expressed and cultured. It was transferred into a nutrient medium. Standard in a 6 mm dish (approximately 106 cells) For standard transfections, 20 μg of vIV2-hCH2 accumulated in the medium. Approximately 0.4 μg of material is present in cells that do not contain nuclei. present in the lysate. For comparison, expressed at high levels in several types of mammalian cells. The corresponding value for soluble CD4 protein, i.e. sT4, was 1 μg in the cell lysate. There are two VIV2-hCH2 proteins in the medium. moved as closely spaced fragments. Under non-reducing conditions, approximately 10% of the sample appeared to migrate as a dimer, but VIV2-hCH2 mainly migrated as a dimer. Moved as a marketer. The VIV2-hCH2 protein in the medium was transferred to a Sepharose tree. It bound to fat-bound gP120.

VIV2-hCH2CH3 was analyzed in the same manner as above. This protein is also It is fully expressed as a secreted product, and up to 20-25 μg is present in the culture medium. Up to 1-2 μg was accumulated in the product. Proteins in the medium are SD under reducing conditions. S/PAGE migrated as a single fragment of approximately 50 kD, but cells The lysate sample migrated as two equivalent bands of approximately 40 and 50 kD. . Under non-reducing conditions, VIV2-hCH2CH3 is primarily involved in dimer formation. Migrated as a single fragment with corresponding molecular weight. This protein is safe It bound to gp120 bound to allose.

0, No. 216.747, published on April 1, 1987) and Ar120 (Model Mott et al., Proceedings of the National Academy of Sciences Bu Sciences (Proc Natl Acad 5ci) 82: 8g -92 (1985)), respectively OPMAVIV2 using standard procedures. -hcH2 and OmpAV1v2-hCH2CH3.

Expression of v1v2-hCH2 and VIV2-hCH2CH3 in strain A258 was performed by raising the temperature of the culture medium to 32°C to 42°C (e.g. , Rosenberg et al., Metabolitter Enzymology (Meth Enzymol) Eng 01:123 (1983)).

Expression of VIV2-hCH2 and VIV2-hCH2CH3 in AR120 strain Currently, by adding nalidixic acid (Nal) to the culture medium, the following can be achieved. (e.g., Mott et al., Proceedings of the Nation). Natl Academy of Sciences (Proc Natl Acad 5 ci) 82: 88-92 (1985)). Culture of AR120 , grown at 37°C with an optical density (650 nm) of 0.4 absorbance units; At this time, nalidixic acid was added to a final concentration of 50 μg/ml. culture The cells were kept in a shaking incubator for approximately 5 hours at 37°C, at which point the cells were Induction was stopped by centrifugation followed by cooling.

Cell pellets and clarified cultures upon induction by both heat and Nal The medium (i.e., centrifuged medium) was mixed with VIV2-hCH2 and v1v2. - The expression of hCH2CH3 was analyzed. Both chimeric proteins are fully expressed However, a small proportion of VIV2-hCH2CH3 was detected in the culture medium. (i.e., transferred).

Butisumi FVIV2-hCH2-TKK, VIV2-hC2 Strept and V IV 2-h C3 strep was administered using standard procedures (Hopwoo d) et al., Genetic Manipulation of Streptomyces-La Boratori Norvich, England (1985)) was used to transform Nis livida. Add thiostrepton to the transformation plate. Transformants were isolated by overlaying agar (0.4%) containing 100 μg/m+. Selected. Colonies expressing the protein of interest are then incubated with thiostrepto Tributicase soy broth supplemented with 5 μg/ml e soy broth) medium. All chimeric proteins are grown in culture medium. The VIV2-hCH2 construct was secreted underground, but the VIV2-bCH2CH3 construct It was expressed at higher levels than in constructions. VIV2-hCH2-KA is approximately 14 mg/L expressed.

Example 3 Characterization of CD4-1gG chimera A) Subunit structure.

The naturally occurring molecular forms of secreted VIV2-hCH2-KA and VIV2-hCH2CH3 are , electrophoresis on a 15% 5DS-polyacrylamide gel under non-reducing conditions. It was analyzed by Protein bands were identified by Western blot analysis. The results are shown in Table I.

B) Antibody recognition: All chimeric proteins produced according to the present invention are anti-CD4 antibodies (Dean ( Deen et al., Nature, 331:82-84 (198 8)) and anti-human IgG Fc receptor antibody (Cappel, ? (Malvern, PA). See Table I.

C) gp120 binding: Nis lividans (S, 1ividans), COOS and CHO cells All chimeric proteins produced in Arthoos et al. Immunoprecipitation analysis as described in Cell, 57: 469 (1989)), or binding to gp120 immobilized on sepharose as described below. showed gp120 binding (see table): The sample was added to precipitation (ppt) buffer (containing 0.5% dry milk and 0.1% NP40). dilute to a total volume of 300 μl with phosphate-buffered saline). gp120 sepharose A 50% slurry of beads (100 μm, above) was added to the diluted sample and incubated for 60 min at 4 °C. Incubated for minutes. Spin the sample in a microcentrifuge tube (30 seconds) and The protein/gp-120 Sepharose complex was sedimented. The complex was 400 μm thick. Washed 5 times with ppt buffer and once with water-cold phosphate buffered saline. Rotate the complex again 60 μl of loading buffer (Laemili, resuspended in Nature (Nar Baan), Lambda: 680 (1970), 5 Boil for minutes, load onto a 15% polyacrylamide gel, then Western Plot analysis was performed. Chimeric protein expressed in E. coli (E, co■) were not tested for gp120 binding.

gp120 was obtained from an autologous source. It also includes, for example, American Biotechno It is commercially available from Logic, Cambridge, MA. Se Phallose beads were prepared as follows = 1.0 liter Sepharose C 1-6B (7 Pharmacia Fine Chemicals ne Chemicals), PiscatawaY , N J), Q, 5N NaOH/30% tetrahydrofuran base solution The mixture was reacted with 52.5 ml of shrimp bromohydrin at 40°C for 4 hours. activation center Collect the phase on a sintered glass funnel by filtration and wash thoroughly with 30% THF. to remove unreacted shrimp bromohydrin. until the cleaning solution becomes neutral. The material was further washed with water. This gel was then treated with ethylenediamine (5 0ml) and resuspended overnight. Filter the gel and wash with 0.1M acetic acid followed by water. Unreacted ethylenediamine was removed by doing this. 1.0 liter of gel of water and then reacted with succinic anhydride (25 g) at pH 6.0.

1.0 liter of sodium carbonate solution ( 0.2 M), followed by further washing of the gel with water. Finally, this gel was Washed with lopyl alcohol and stored at 4°C for further use as a moist powder. did.

D) Binding of protein A and protein G/varnish lividance (S, 1iv idans) and VIV2-hCH2 chimeric protein expressed in CQS cells. The protein does not bind to protein A or protein G. In contrast, varnish lividance (S, 1ividans) and v1v2-hC expressed in CO8 cells The H2CH3 chimeric protein has different affinities for both proteins A and G. However, it shows binding affinity. v1v2-hc produced in Streptomyces H2cH3 is Tll grown in cosmm VIV2-hcH2cH31:J All have low affinity for proteins A and G. The results are summarized and shown on the table. .

Table 1. CD4/IgG chimera protein characteristic subunit antibody recognition gp12 0 Protein A & VIV2-hc] 112s, monomer ++ 10-lividans vIV2-hCH2Cos (-/7- + + + - and dimer 111V2-S Lividance Monomer +++++hCH2C)+3 (weak) VIV2-COS Die 7- 10+ +hc112cE13 Example 4-m combination plasmid FTKK-VIV2, TPAA-AA-VIV2AND and KA-VIV2 (7) construction Fusion plasmids TKK-VIV2, TPAA-VIV2, TPAAA-VIV 2 and KA-VIV2 were constructed from plasmid 12B1 as follows.

Construction of Plasmid 12B1, Plasmid 12B1 is a Streptomyces longi Tripe of S. treptoa + yces longisporus VI operatively linked to the syninhibitor (LTI) promoter and signal sequence. V2 (see EP-A-264,175 dated April 20, 1988), and has a Streptomyces replication function as seen in plasmid plJ351. (Keiser et al., Molecular and General Synet. Mol Gen Genet 185:223 (1982)>.

Parental plasmid 12B1 was constructed as follows. (CD4 DNA sequence nucleotide Located between octides 148 and 149: Maddon et al., Cel. l) Place the BbvI cleavage site in the concave circle at nucleotide 150. and 151, site-directed mutagenesis (site dir=cted Mutagenesis (Kunkel, Proceedin) Guess of National Academy of Sciences-L--Guess A (Proc, Natl, Acad, Sci, USA). this mutation (referred to as 1478) containing the coding sequence for amino acid residues 1-129. 5CD4 minigene. This Ec containing the 1478 mutation.

The R1+Hindl 11 fragment was transferred from M13mp18 to pUclg and pUc V1pV2 (1478) was generated. Bb of pUcV1pV2 (1478) After vI digestion, it was digested with the Klenow fragment of DNA polymerase I. fragment) to fill the single-stranded sequence of 5゛, then Hindl Digested with II. HindIIT-blunt end fragment obtained by these operations was digested with AccI, treated with DNA polymerase I Klenow fragment, and Hind Cloned into pLT1450 digested with III. of the obtained plasmid 12B1/1477, the expressed VIV2 protein has 6 amino acids LT at its amino terminus. to contain residues 1 and 2 of the mature LTI protein in addition to the Ipro peptide. , the 5CD4 minigene (amino acid residues) fused to the coding sequence of the LTI signal sequence. groups 1-129). Streptomyces replicon and selectable matrices The marker was pIJ351 (Kieser et al., Molecular General Synetics (Mol gen, Gebet, ) 18 5:223-238 (1982)) with the unique Ps in both plasmids. Cloned into 12B1/1477 by insertion using the tI site. 1 The complete 1v2 minigene (amino acid residue 1- 183), AflI from DHFRVIV2 183#7 of Example] I+XbaI fragment was digested with Aflll and Xbal 12B 1/1 It was inserted into 477.

The resulting plasmid was 12B1.

Plasmid I) LTI4. ) Construction of 0: 0,92kb containing the LTI gene Insert the 5acI-Kpnl fragment into pUC18 digested with 5acl and Kpnl. I entered. This plasmid, pLTT520, was partially digested with EagI, Digested in its entirety with 5alI, then synthesized a synthetic ligand with Eagl and 5alI ends. Linked to the linker (2x strand): 5-GGCCGCCGCCCCCGCG (SEQ ID No: 5) CGGC GGCGGGGGCGCAGCT-5' (SEQ ID No.: 6) This series The plasmid obtained by ligation was inserted with a synthetic linker approximately 0°5 kb from the 5acI site. was screened for insertion into the EagI site located at . This Eag1 site is The 5' end of the LTI gene is located at base pair 86. Obtained plasmid contains the coding sequence and peptide for the LTI promoter and signal peptide. Contains a titanium cleavage site.

Fusion plasmids TKK-VIV2, TPAA-VIV2, TPAAA-Vlv 2 and KA-VIV2 using oligonucleotide mutagenesis to obtain LTI Deleting the pro peptide coding sequence and inserting the selected peptide after the signal peptide cleavage site Created an amino acid coding sequence. M13-heavyweight DNA used for these mutagenesis The 1.1 kb EcoRI-XbaI fragment from 12B1 was digested with EcoRI and It was created by inserting it into M13mp18 that had been digested with It was mp18VIV2/12B1. Oligonucleus used for site-directed mutagenesis Reotide is summarized in Table 3.

Table 3 - Oligonucleotides τKK-VIV2 used to create VIV2 derivatives 2214 5’GCCC8GCACCACTITCTTGGTGGCGAGC GC to GCTCC-:l'τPAA-V1V2 2253 5'-C; CCC AGCACCACTTTCTTAGCGGCC to GCGTGGC-3'TP88 A-VIV2 2254 5'-GCCCAGCACC8CTTTCTTAC AGCGGCCC, GGG-3' to 8-VIV2 22/16 5'-GCCC AGCACCACGGCCTrG to CCAGCGCG to CTCC-]' Table 3 and the nucleotide sequence 2214 is SEQ ID No: 7; Nucleotide sequence 2253 is SEQ ID NO: 8: Nucleotide sequence 2254 is SEQ ID NO:9: Nucleotide sequence 2216 is SEQ ID NO:9 It is 0:10.

0,7 kb EcoRI isolated from RF form of mutagenized mp18VIV2 -AfIII fragment was converted into a 0.75 kb EcoRI-AflI fragment from 12B1. Replace with plasmid pVIV2-2214 (or pTKK-VIV2) , pVIV2-2253 (or pTPAA-VIV2), pVIV2-2 254 (Mataha pTPAAA-VIV2) and pvlV2-2216 (Mataha pTPAAA-VIV2) or pKA-VIV2)　47':. Also known as pTKK-VIV2 VIV2-2214 with modified propeptide sequences as shown in Table 3. containing the LTI signal sequence linked to leonine, the modified propeptide sequence created using oligonucleotide 2214, where the threonine of the column is linked to VIV2. Made. I) VIV2-2253, also known as pTPAA-VIV2, was The modified propeptide sequence thr-pro-ala- as shown in 3. Oligonucleotide 2253 containing the LTI signal sequence linked to ala It was constructed using pVIV2-225, also known as pTPAAA-VIV2 4 with the modified propeptide sequence thr-pro- as shown in Table 3. contains the LTI signal peptide sequence linked to ala-ala-ala; Constructed using oligonucleotide 2254, which in turn is linked to IV2.

pVIV2-2216, also known as pKA-VIV2, was purified as shown in Table 3. Oligos containing the LTI signal peptide sequence linked to VIV2 Constructed using nucleotide 2216.

Example 5 - Construction of βga1 zero KK-vIV2 fusion plasmid βga1 Main KK -VIV2 was constructed from plasmid pβgalsT4/7 by mutagenesis.

pβgalsT4/7 was constructed as follows.

Construction of pβgalsT4/7 plasmid pβgalsT4/7 Constructed from UCst4, plJ702 and p3SSXMCP. p3SSXM CP is pU containing the β-galactosidase promoter and signal sequence. C9 (Viera and Messing), Jin ( 259 (1982)) derivative. For signal peptide cleavage site The 26 base pairs downstream of the coding sequence are the XlIn1 site (Efhard (Eckhardt) et al., Journal of Bacteriology (J, Bac. teriol, ) 169 24249 (1987)). Ba5HI recognition sequence Contains synthetic linkers (Beverly, New England, Massachusetts) Biolab lease (New England Biolabs) in this area , to obtain plasmid p3ssX10. This vector was combined with BamHI and Treated with reverse transcriptase followed by XhoI digestion. reverse transformer The fragment with the Ncol end treated with cryptotase is ligated with this vector, and the plain A blunt end and a 5alI end were obtained. filled-in Bam Ligate the HI site with the filled NcoI site, leaving both the BamHI and NcoI sites was rebuilt. The resulting plasmid was 3SSXMCP. pUCsT4 was treated with XbaI and reverse transcriptase, followed by NcoI digestion. did. Next, this 1.1 kb NcoI-Xbal (RT) fragment was l and T4 were treated with DNA polymerase I, followed by NcoI digestion. It was inserted into p3SSXMCP. The Streptomyces replication function is independent of both plasmids. pIJ702 inserted into p3SSXsT4 through a special BglII site. Obtained from The resulting plasmid was pβgalsT4/7.

pβgal　1.6kb DancoRI-ΔKojo III fragment from st4/7 The 0.75kb coRI-Δ engineering component from mp18VIV2-2214 II fragment to obtain mp18Bgal IVIV2. of a specific part Mutagenesis was used to modify amino acid residues -9 to -1 of the CD4 signal peptide. The -3 and -4 positions of the βgal signal peptide were deleted. luginine residues are changed to asparmate and glutamate, respectively, and matured. The coding sequence for residues 1 to 8 of the β-galactosidase protein is deleted. I set it.

These mutations cause the sequence to 5'-GCCCAGCACCACTTTCTTCGCCGCGTCCTCTA CGGCGCTG-3° (SEQ ID NO: 11) It was carried out using oligonucleotide 2256, which is

Replaced with I-ΔEng±1 Efragment. The resulting plasmid, pVIV2βg a1-2256 (βga l *KK-VIV2) has the following characteristics: ( 1) VIV2 expression is directed by the βgal promoter; (2) the βgal promoter The coding sequence of the Gnar peptide shows that amino acid residue -4 is glutamate and -3 has been modified to be aspartamate, and (3) of VIV2. VIV2 has a β fused to the gal signal sequence.

Example 6 VIV2 expression in Varnish lividans (S, 1ividans) Standard methods (Hopwood et al., Genetic Manipulation Genetic Manipulation of Streptomyces n of Streptomyces) - A Laboratory Manual (A Laboratory Manual), F. Crow & Sons Re. Mitid (F, Crave & 5ons Ltd,), Norwich (Norwich, UK (1985)) from Example 4. pVIV2-2214, pVIV2-2253, pVIV2-2254, pV IV2-2216 and I) v1v2βga l-2256 with varnish lividans (S, 1ividans) 1326 (Bibb et al., Mo1.G En, Genet, Yo 84: 230-240 (1981)) did. Add 3 ml of 04% agar + 100 μg/ml thio to the R2YE transformation plate. Transformants were selected by overlaying with strepton.

Transformants expressing the protein of interest were incubated in tributicase soy broth or is MHI + 5% HycaseSF (40g/liter glucose, 50g /liter HycaseSF, 50g/liter Hysoy, Ig/liter yeast extract, Ig/liter of CaCO4, and 0.001 g/liter of CoCl2 (5 μm supplemented with 7 ml of thiostrepton) . For gp120 binding assay and gp120 affinity taromadography Cell-free supernatants used were harvested from cultures grown in ME1+5% Hycase. Ta.

VIV2 induction when expressed in S. lividans (S, 1ividans) The conductor was first characterized by immunoblotting.

Immunoplot method - cell-free supernatant was diluted with 15% polyacrylamide (30:0.8 ac. Lylamido:bis)-sodium dodecyl sulfate gel (Laemmli ) (1970) Nature + - (Nature) 227: 680-685) separated on top and then transferred to nitrocellulose (Tovbin et al. (1979) Proceedings of the Natural Academy of Sci. Encies Ninis A (Prc, Natl, Acad, Sci) USA) 76: 4350 4354). 2) Cellulose filter v1v2 using rabbit antiserum prepared against modified 5CD4 protein. Detection (Bravner et al. (1985) Gene 40 :191-201). Bound antibodies were detected with 125I-Protein A. immune system The response bands were visualized by autoradiography.

TKK-VIV2, TRAAA-VIV2, TPAAA-VIV2, KA-VI V2 and βgal*KK derivatives appeared as a single immunoreactive band. KK- A doublet appeared from the VIV2 derivative. One of the KK-VIV2 proteins is C It co-migrated with VIV2 obtained from HO cells. Slower than VIV2 reference protein Other bands that migrate with high mobility may be due to incomplete processing of the LTI signal peptide or to LTI signal peptides. It may be the result of processing at another cleavage site in the TI signal peptide. K.K. -Due to the heterogeneity of the products expressed by VIV2 derivatives, further studies are I didn't do it.

The biological activity of these VIV2 derivatives was then determined by gp120 binding. Ta. Quantitative gp120 immunoprecipitation (Arthos et al., Cell ) 5, 469-481 (1989)), it was found that strep Tomyces produced VIV2 protein was fully active. Table 2 shows the results of immunoprecipitation assay. Shown below. I checked VIV211! All conductors have greater than 90% gp120 coupling showed that.

TKK-VIV2, TPAA-VIV2, TPAAA-VIV2 and β-ga VIV2 production of l*KK derivatives at a level of ’t’VIV of 100 mg/ml or higher. Comparisons were made with those obtained from plasmid 12B1 producing 2. TPAA-VI V2 Oh, J-bi TPAAA-VIV21! lV2 expression level of conductor, 12B1 It was comparable to that obtained from KA-VIV2 expression is 12B1? It was 70% of that obtained from TKK-VIV2 expression was obtained from 12B1 It was 30% of the total amount. βgal*KK expression was approximately 1 mg/ml.

Example 7 Plasmid 1) VIV2-2214, pVIV2-2253, pVI V2-2254, pVIV2-2216 and pVIV2βgal-2256 Analysis of N-terminal amino acids of heterologous proteins produced by A, for N-terminal sequencing Streptomycetes using GP-120 Sepharose Affinity Column Purification of VIV2 from cell culture medium 1, preparation of gp120 sepharose Sepharose CL-6B (Phase) via the amino group using active ester chemistry Purified gp120 was immobilized on Pharmacia (Pharmacia).

Approximately 0.25 mg of gp120 was bound to 1 ml of resin, and binding for st4 The capacity was determined to be 20 μg/m+.

2. Preparation of sample from culture medium Fermentation medium containing the VIV2 construct was diluted 5x in column equilibration buffer (see below). Dilute, 20. Centrifuge for 15 minutes at OOOXg and Filtered with a white matter binding filter (Gelmen).

3. Gp120 affinity chromatography Gp120 Sepharose scalar (1.6cm x 6am) to 50mM pH 7.5, 150mM N Equilibrated with aC1. Place the prepared medium sample on the column and adjust the absorbance to the baseline. Wash with equilibration buffer until reaching 50mM Heves pH7, 5, 150mM Na Washing again with C1 removed any non-specifically bound impurities. 0.1M VIV2 was eluted with acetic acid.

4. Peptide from affinity purified v1v2 by using reverse phase HPLC Removal of putido impurities The v1v2 eluted from the affinity column was made into a 0.05% TFA solution. C3 RP-HPLC column (DuPont Pro) equilibrated in 0.05% TFA DuPont Pro) 10/300.4.6cmX250cm) Ta. 1 m with a linear gradient of 0-60% acetonitrile in 0.05% TFA The column was eluted for 60 minutes at l/min. VIV2 product in a single peak for 50 minutes It was eluted as a block. The collected amount is sent to Centricon 3. (Amicon) Concentrate and use for N-terminal sequencing and amino acid analysis used.

B, N-terminal sequencing Confirm the N-terminal amino acid sequence and place the signal peptide at the predicted cleavage site. I checked to see if he showed up. gp120 sepharose affinity chromatograph v1v2 protein was purified from culture supernatant using Raffy and reverse phase HPLC. . Partially purified VIV2 preparations were subjected to polyacrylamide SDS gel electrophoresis. The polyvinyl chloride prepared for further purification and then N-terminal amino acid sequencing was electroeluted into a difluoride (PVDF) membrane (Mazdaria Qlatsud) aria), J. Biol, Chew, 262:10035-10038 ( 1987)). Determine the N-terminal amino acid sequence using a gas-phase protein sequencer. Decided. According to this analysis, fused to the carboxy terminus of the LTI signal peptide VIV2 proteins TKK-VIV2, TPAAKK-VIV2, TPAAAK K-VIV2 and KA-Vlv2 are precisely located at the LTI signal peptide cleavage site. Processed into The N-terminal amino acid sequence is summarized in Table 2. N-terminus of v1v2 peptide The ends are LYS-LYS. However, Bga l*KK-VIV2 derivatives Naturally, the signal sequence was not processed at the cleavage site. In this derivative, LYS-LYS The amino acids before the are the coding sequence at the 3′ end of the β-gal* signal peptide. guided from the line. R(-4)E/R(-3)D signal peptide mutation sequence The Gnal sequence cleavage occurs within the βgal signal sequence from -8 to -7.

TU-V I V 2 Thr-LYS-LYS->90%TPAAKK-V I V 2 Thr-Pro-Ala-Ala-LYS-LYS--->9 0%TPAAAH-V I V 2 Thr-Pro-^1a-^1a-Ala -LYS-LYS--->90%TPAAAKK-V I V 2 LYS- LYS N D (1) KA-V I V 2 LYS-Ala--->90 %Bga1 piece■-VIV2　^1a-^1a-Val-Glu-Asp-^1a -Ala-LYS-LYS > 90% (1) Not measured The above description and examples fully disclose the invention, including preferred embodiments. deer However, the present invention is not limited to the specific examples specifically described above. obvious to those skilled in the art Modifications of the above method that are within the scope of the following claims.

abstract Useful for the production of CD4 chimeric proteins as well as other heterologous proteins in Streptomyces Discloses nucleic acid sequences and DNA vectors. The nucleic acid sequences of the invention substantially A propeptide consisting of an oligonucleotide encoding 1 to about 6 amino acids in Streptomyces longisporus operably linked to the sequence. myceslongisporus) tyrosine inhibitor gene (LTI) The amino acid sequence is a sequence encoding a signal sequence of After processing to remove the signal peptide formed on the foreign protein during synthesis. , resulting in the formation of a heterologous protein with a homogeneous amino terminus in Streptomyces It is selected as follows.

In another embodiment of the invention, the propeptide is omitted and the LTI signal is , a heterologous protein modified to encode a 1ys-ala-sequence at the 3° end. The LTI signal peptide is operably linked to a nucleic acid sequence encoding the LTI signal. Also, books The invention relates to cells transformed with the nucleic acid sequences or vectors of the invention and nuclei of the invention. Producing heterologous proteins in Streptomyces using acid sequences and vectors provide a method.

international search report

Claims (22)

[Claims] 1. A polymer consisting of oligonucleotides encoding substantially 1 to about 6 amino acids. Streptomyces longisporus (St reptomyces longisporus) tyrosine inhibitor inheritance consisting of a nucleic acid sequence encoding a child signal sequence, the amino acid sequence of which is A process that removes the signal peptide formed on the foreign protein during white synthesis. formation of a heterologous protein with a homogeneous amino terminus in Streptomyces. A nucleic acid sequence characterized in that it has been selected to occur. 2. The propeptide sequence is located between the end of the nucleic acid sequence encoding the signal sequence and the propeptide sequence. A signal that allows processing of the heterologous protein to occur at a position between the beginning of the protein sequence. The nucleic acid sequence according to claim 1. 3. The nucleic acid sequence according to claim 2, wherein the propeptide encodes the amino acid threonine. Column. 4. The propeptide has an amino acid sequence, [sequence exists] (SEQ ID NO. 3. The nucleic acid sequence of claim 2 encoding :1). 5. The propeptide has an amino acid sequence, [sequence exists] (SEQ ID NO. 3. The nucleic acid sequence of claim 2 encoding :2). 6. The nucleic acid sequence is a sequence [There is an array] or its derivatives that can act as signal peptides in Streptomyces A claim encoding a signal sequence of Streptomyces longisporus consisting of 1. Nucleic acid sequence according to 1. 7. 7. The nucleic acid sequence of claim 6, wherein said propeptide sequence consists of the sequence ACC. 8. The propeptide sequence is the sequence [there is a sequence] (SEQ ID NO: 3 ) The nucleic acid sequence according to claim 6, consisting of: 9. The propeptide sequence is the sequence [there is a sequence] (SEQ ID NO: 4 ) The nucleic acid sequence according to claim 6, consisting of: 10. Polypeptide modified so that the 3' end encodes Iys-aIa- Streptomyces longis operably linked to a nucleic acid sequence encoding A nucleic acid sequence encoding a tyrosine inhibitor gene signal sequence of A nucleic acid sequence containing 11. a heterologous protein operably linked to a promoter and a nucleic acid sequence according to claim 1; A DNA vector for expression of the heterologous protein in Streptomyces containing the encoding sequence. Tar. 12. The coding sequence of the heterologous protein is a sequence encoding an HIV gp120 binding region. 12. The DNA vector according to claim 11. 13. the coding sequence of the heterologous protein lacks most or all of the CH3 domain HIVg bound to a portion of a human immunoglobulin constant region encoding a polypeptide The DNA vector according to claim 11, which is a sequence encoding a p120 binding region. 14. Promoter and trypsin in Streptomyces longisporus consisting of a coding sequence for a heterologous protein operably linked to an inhibitor gene signal sequence. and the heterologous protein coding sequence has the amino acid sequence Iys-aIa at its 3' end. the addition of a base that encodes or the two amino acids at its 3' end A base is deleted and the amino sequence Iys-aIa is encoded in place of the deleted sequence. The heterologous species in Streptomyces has been modified by substitution with a sequence that DNA vector for protein expression. 15. The coding sequence of the heterologous protein is a sequence encoding an HIV gp120 binding region. The bases encoding the two amino acids at the 3' end are deleted, and the deleted sequence Claim 14, wherein the substitution is made with a sequence encoding the amino acid sequence Iys-aIa. The DNA vector described. 16. The coding sequence of the heterologous protein lacks most or all of the CH3 domain. HIVgp bound to a portion of human immunoglobulin constant region encoding a lipeptidase 120 binding region, two amino acids at its 3' end The base encoding is deleted, and the amino acid sequence Iys-aI is substituted for the deleted sequence. 15. The DNA vector according to claim 14, wherein the DNA vector is substituted with a sequence encoding a. 17. A step of introducing the vector according to claim 12 into a Streptomyces host cell. and a step of growing the host cell in a suitable medium. A method of using the vector according to item 12. 18. A step of introducing the vector according to claim 14 into a Streptomyces host cell. and a step of growing the host cell in a suitable medium. A method of using the vector according to item 14. 19. Streptomyces transfected with the nucleic acid sequence according to claim 1 cell. 20. Streptomyces transfected with the nucleic acid sequence according to claim 6 cell. 21. Streptotransfected with the DNA vector according to claim 7 Mrs Cell. 22. Strep transfected with the DNA vector according to claim 10 Tomyces cells.