JPH05502789A - mucin nucleotide - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] 6. At least five genes encoded by the coding portion of the DNA sequence shown in FIG. A polypeptide containing a contiguous sequence of acid residues.

7. An antibody against the polypeptide according to claim 6.

8. Bearing a detectable label or attached to a solid support, as claimed in claim 7. antibodies.

9. An antibody-producing cell capable of secreting the antibody according to claim N7.

1’O,! The fragment according to claim 1 or 2, or the fragment according to claim 3. or the polypeptide according to claim 6, or claim 7. or a diagnostic kit comprising the antibody described in 8.

11. Claims for use in therapeutic or diagnostic methods for the human or animal body Fragment according to claim 1 or 2, probe according to claim 3, claim 9 Vector described in Box 4, Cell according to Claim 5 or 9, Claim 6 or the antibody according to claim 7 or 8.

12. For the production of drugs used in therapeutic or diagnostic methods for the human or animal body. The fragment according to claim M1 or 2, the probe according to claim 3 A vector according to claim 4, a cell according to claim 15 or 9, a claim The use of the polypeptide according to claim 6 or the antibody according to claim 7 or 8 for.

13. Cancer patients who require treatment or diagnosis, or who are thought to have cancer. an effective non-toxic amount of the fragment according to claim 1 or 2 to a patient; The probe according to claim 3, the vector according to claim 4, and the probe according to claim 5 or 9. the cell according to claim 6, the polypeptide according to claim 6, or the cell according to claim 7 or 8. A method of treatment or diagnosis comprising administering an antibody as described.

14. A sample from a patient is transformed into a fragment according to claim M1 or claim 2. The probe according to box 3, the vector according to claim 4, the probe according to claim 5 or 9 The cell according to claim 6, the polypeptide according to claim 6, or claim 7 or 8 A diagnostic method comprising contacting with an antibody according to.

Specification mucin nucleotide The present invention relates to nucleotide fragments, polypeptides and antibodies, as well as medical Concerning its use in treatment and diagnosis.

International patent application WO-A-88105054 describes human winter epithelial mucin (HPEM). Gene and nucleotide probes, polypeptides, antibodies and adenocarcinomas such as breast cancer Direct repeat sequences contained in antibody-producing cells useful for the diagnosis and treatment of cancer are disclosed.

Here, the present inventor has determined that the nucleotide salt of the gene in the 5' region of the direct repeat sequence. revealed the base sequence (used in the text unless the context suggests otherwise) Designations such as “5” or “3”, “upstream” or “downstream” refer to genomic DNA or its (refers to the non-templated strand of the fragment). 1st Sma I in series repeat sequence 1763 nucleotide salt of the non-template strand containing and upstream of the restriction site The complete arrangement of the groups is shown in FIG. The first SmaI restriction site in the direct repeat sequence shown in Figure 3 is extending the sequence of 1575 nucleotides of the non-template strand containing and upstream of Then, certain parts were revised taking into account the results of repeated experiments. Mold strands are complementary It is this strand that is transcribed into RNA during expression of the gene product. It is de.

In addition to conventional transcription and translation initiation sites and intron splicing sites, This sequence is useful for cancer diagnosis and treatment, as well as protein expression from recombinant vectors. It includes many features that are currently important. These features are described below. The amino acid sequence corresponding to the translated part of the otide sequence is also useful for diagnosis and therapy. Generates useful peptides and therefore antibodies and antibody-producing cells.

In one aspect, the invention provides that the corresponding sequence of code strands shown in FIG. is the same or homologous to the length of the code strand shown in Figure 1. At least a sequence having a sequence identical to or homologous to a corresponding length of a sequence complementary to the sequence. Both represent a nucleic acid fragment containing a portion of 17 consecutive nucleotide bases. Ru.

As used in this text, the term “fragment” refers to restriction endonuclease-generated nucleic acid shall include molecules and synthetic oligonucleotides.

Nucleic acid fragments of the invention can be - heavy or double stranded fragments. , and can also be RNA or DNA fragments.

- The heavy chain fragment has the sequence of Figure 4 or a part thereof, or a sequence homologous thereto. can be a "plus" or cord strand.

If not, - the key fragment is the sequence of Figure 1 or part thereof, or a “minus” or non-coding strand with sequences homologous and complementary to can be. Double-stranded fragments are composed of complementary pairs of strands (i.e. Contains one last strand and one minus strand).

The RNA fragments of the present invention as well as the code (non-template) struc- tures shown in Figure 1 uridylic acid (“U”) residue instead of deoxythymidylic acid (“T”) residue in or complementary to the sequence of the code strand shown in Figure 1. It will contain a U residue in a position complementary to the adenylate ("A") residue of the rand.

Preferably, the nucleic acid fragment of the invention is a double-stranded DNA fragment. . Single strand nucleic acid fragments of the invention are at least 17 nucleotide bases in length. It is. Double-stranded nucleic acid fragments of the invention have at least 17 nucleotide bases. It is the length of the pair. The fragment is at least 20 bases or base pairs long. preferably at least 25 bases or base pairs in length. More preferably, the length is at least 50 bases or base pairs.

Satisfyingly, the 17 nucleotide base sequence is non-repetitive and the code shown in Figure 1. Corresponding length of the code strand, or complementary to the arrangement of Figure 1. Nucleic acid flag with a continuous 17 nucleotide portion of the same sequence as the strand It is almost certain that any new ment will be new. 17 nucleotides or Fragments of the invention that are only nucleotide bases in length have the same sequence as shown in FIG. or have a complementary sequence.

Longer fragments of the invention can be obtained by pairing the sequences of the code strands shown in Figure 1. The corresponding portion or complementary non-coding strand may have homologous sequences.

Nucleic acid fragments of the invention may be derived from corresponding or complementary portions of the sequence of FIG. at least 75% sequence homology, such as 80 or 85%, preferably They preferably have 90 or 95% homology. Deletion, insertion or substitution There is a difference due to The nucleic acid fragment of the invention comprises the code strand of llCl. or complementary part - in addition to the part homologous or identical to the sequence of the code strand, the arrangement of FIG. It can contain arrays that are completely unrelated to columns.

Particularly interesting features within the code strands of Figure 1 are shown in Tables 1-3 below: gnal array Rank 1! * Significance of sequence in PEM 1-2 CG transcription start site 73-75 ATG Translation initiation signal 131-132 GT 1st intron Start of 631-632 AG End of first intron 100-1301 TTC CTGCTGC - occluded by the first intron and l TGCTCCTCAC - occluded Dixonal sequence 633-6371 AGTGCTTACA- (first intron 955-96.0 CCCGGG Sma1 site at the beginning of tandem repeats + In the common sequence: R is A or G, N is A, C, G or T the law of nature, W is A or T, X is Y is C or T.

*The position is the 5′ base position of the PEM sequence numbered as shown in Figure 1. It is.

Key 11+1 in table 25° Furano King arrangement! element jl1 clause V element common array + PE Sequence in M Position Interferon-β sequence GCAJ Lecture i Woo W αA mackerel η Terrorism ix 442 The sequence in Figure 1 is the breast common sequence (Rosen, J.M., “Th e Mannmary Grand, Development, Regulation ion and Function F, Ed, Neville, M, C.

and Daniel, C.W., Plenum Press, pp301-32 2) with 70-80% homology to the promoter region and the first inlet. Contains in Tron. These parts are shown in Table 3 below. ＊＊＊　＊　＊ =289 to -274AGGCTAAAAACTAGAGC* ** ** +230 to +245 GTAAGAATTGCAGACA common RGAAGR AAANTGGACA positions are numbered according to FIG.

* indicates incompatibility with the common sequence.

In the common sequence: R is A or G.

N is A, C, G or T.

Preferred fragments of the invention include transcription and translation initiation signals TA, TA” box, and at least one regulatory element shown in Table 2 above (transcription factor binding site). These fragments contain, in addition to the TATAA box, two or more, e.g. 3.4 or 5 adjustment elements, or adjustments as shown in Table 2 It is more preferable to include all elements. Flanges containing one or more adjustment elements shown in Table 2 The transcriptional and translational components between these sites and from TATAA and Preferably, the relative spacing from the translation start signal is also preserved.

Other preferred fragments of the invention include regions homologous to the breast consensus sequence shown in Table 3. Contains at least one. These fragments are based on the breast consensus sequence shown in Table 3. It is preferable to include both regions having homology to

A fragment containing both regions with homology to the breast consensus sequence is shown in Figure 1. However, these regions are closely related to each other and from the TATAA box, as well as transcriptional and Preferably, the relative spacing from the translation initiation signal is also conserved.

Further preferred fragments of the invention include the TATAA box, transcription and translation opening. initial signal, at least one, preferably two or more modulations as shown in Table 2 elements, and at least one, preferably both, of the breast consensus sequences shown in Table 3. Including areas with same sex. These fragments are characterized in Tables 1.2 and 3. More preferably, the relative spacing between the two is also preserved. Particularly preferred flanges of the present invention The TATA component shown in Figure 1 is downstream of the transcription and translation initiation signal. Sequences upstream of the A box and promoter sequences and transcription and translation initiation signals Polypeptide code whose reading frame is correctly registered using the null TATAA box. Contains a code array. The coding sequence is a polypeptide encoded by a mucin gene. a part or parts thereof, for example a part or parts thereof other than a serially repeated sequence, or a mould. Encoding a polypeptide unrelated to the polypeptide encoded by the Chin gene can be done.

Other particularly preferred fragments of the invention include promoter sequences, TATAA boxes, etc. mucin, transcription and translation initiation signals, and parts of mucin genes, e.g. The first exon (corresponding to bases 1-30 in Figure 1) or a part thereof and/or the second exon Coding sequence corresponding to the xon (corresponding to base 633 and earlier in Figure 1) or a part thereof , for example, one other than the series repeat sequence shown in WO-A-88105054. Include the downstream part of the section with correct reading frame registration.

A particularly preferred feature is that the fragment (i) contains the first 26 salts of the first exon; base 1-1 of the group (base 1-26 in Figure 1) or (ii) its entirety (base 1-26) 30), and/or (iii) a splice for the first intron shown in Table 1. binding/linking sites, as well as non-coding sequences between these sites. non-code The sequence can be the same as or different from the sequence of the first intron shown in Figure 1. Ru. Preferably, they are the same.

Other preferred fragments of the invention include at least the first intron (bases in Figure 1). 231-632). A further preferred fragment of the invention is shown in FIG. 5° upstream of base -423 of - includes at least a portion of the flanking sequence.

Other preferred fragments of the invention correspond to parts of the sequence of Figure 3 in the sequence of Figure 1. Contains corresponding parts.

Further preferred fragments of the invention have any two or more of the above-mentioned preferred characteristics. includes a combination of more than that.

A functional coding sequence for at least a portion of the first or second exon shown in FIG. The fragments of the present invention comprising fragments of the invention that correspond to part or all of the mucin gene product. Useful for producing lipeptides. Such polypeptides, in turn, can be used for example in cancer. For the induction of antibodies for use in prevention or treatment, or in passive immunization and diagnosis of cancer. Immunogen reagent in active immunization against human polymorphic epithelial mucin (HPEM) It is useful. For use in such methods, one of the mucin core proteins Fragments that encode polypeptide chains that are substantially identical to the! Verse 1 and a code containing promoter sequences, marker sequences and splicing or joining sites. extension at either or both of the 5° and 3° ends using coded or non-coding nucleic acid sequences. It can be long. The coding sequence may be different from other parts of the mucin core protein value (e.g. (for example, other than a direct repeat sequence) or other polypeptide chains. Book The fragments of the invention are prepared with suitable readings together with any necessary or desirable flanking sequences. In quota registrations, plasmids, cosmids or viral genomes (e.g. vaccinia (viral genome) into a suitable vector and then ported using conventional methods. Expressed as a repeptide product. In some cases, vectors are used to transform The polypeptide product is produced by culturing suitable cells, harvested and mutated. Can be used as an immunogen to induce active immunity against Chin core protein. [Tartaglia et al., Tibtech, 6, 43: (1988 )].

Fragments of the invention inserting the regulatory elements of Table 2 and/or the mammary consensus sequences of Table 3 functional components downstream of the regulatory elements and/or with appropriate reading frame registration with the mammary consensus sequence. can be used to ensure tissue-specific expression of code sequences. subordinate Therefore, such fragments may contain mucin genes or other codes in cells of epithelial origin. It can be used to express part or the entire code sequence. This application is therapeutic and immunological. sensitization, in which case this fragment and associated coding sequence are administered to the patient. The coding sequence is expressed in epithelial tissue and the therapeutic effect or patient response to the polypeptide is expressed. cause an immune response.

Fragments exist as inserts in vectors such as viral genomic nucleic acids. For example, by inoculating the vector as a modified virus, it can be administered to patients. can be introduced. The vector then directs the in vivo expression of the polypeptide; which in turn becomes an immunogen that induces active immunity against a therapeutic agent or polypeptide. . This strategy includes e.g. fragments and coding sequences in their genomic DNA. By administering modified vaccinia virus, it is possible to treat adenocarcinoma such as breast cancer or ensures the expression of the polypeptide encoded by the HPEM gene for prevention. or ensure tissue-specific expression of other peptides under the control of the regulatory elements in Table 1. It can be adopted to The RNA fragments of the invention are also retro It can be used by administration via a viral vector.

Selection of tissue-specific viral vectors carrying fragments and coding sequences of the invention This further restricts expression of the polypeptide to the desired target tissue.

The fragments of the present invention inhibit the expression of oncoproteins in experimentally transplanted animals. It can also be used for control. Therefore, the regulation of tissue-specific fragments of the present invention Oncogenes such as ras, ergB-2 or int2 expressed under Transplanted mice with can develop mammary tumors, tumor localization and contrast agents etc. It is useful for testing diagnostic drugs for diseases such as cancer, and for testing therapeutic drugs for immune disorders. Nucleic acids of the invention Fragments detect the presence of the corresponding sequence in a sample of DNA or RNA. It is also useful as a hybridization probe for Use as a probe Fragments can be labeled with radionuclides, enzyme labels, fluorescent labels or other conventional It is preferable to label with a detectable label, including a label that allows for direct or indirect detection of Yes. For some applications, probes can be attached to solid supports. plow Matthews et al., Anal, Biochem, 169:1- 25 (1988).

In a further aspect, the invention provides cloning vectors containing fragments of the invention. and expression vectors. Vectors can be, for example, plasmids, cosmids or can be the genomic DNA of a virus. The present invention further provides such host cells containing the encoding and expression vectors, e.g. Display epithelial cells transformed using a functional expression vector containing the present invention.

The invention also provides nucleic acid fragments encoding polypeptides defined below. do. Such fragments can be the fragments defined in the preamble. Wear. However, considering that the genetic code contains redundant parts, the sequence in Figure 2 and the or substantially similar nucleic acid sequences can encode the same polypeptide. .

The nucleic acid fragment of the present invention can be newly produced by conventional nucleic acid synthesis methods. or obtained from human epithelial cells by conventional methods, Huynh et al. "DNA cloning: A Practical Approach" Gl over, D, M, (Ed) IRL, Oxford, Voll, pp49-78 (1985).

Accordingly, the present invention provides a method for treating humans or animals by surgery or drug therapy; for use in diagnostic methods on the human or animal body, and for use in such methods. a probe containing a nucleic acid fragment as defined in the preamble for use in the manufacture of a drug; Also provided are vectors, vectors and transformed cells.

The present invention also provides these fragments, probes, vectors or transformed cells, administering the same in an effective and non-toxic amount to a human or other mammal in need thereof; Treatment of the human or animal body by surgery or drug therapy; In vitro and in vitro diagnostic methods are presented.

Fragments of the present invention, probes, vectors and transformed cells containing the same Methods for producing cells encoded by or controlling the fragments of the present invention The method of expression of the underlying polypeptide is also a feature of the invention. The present invention further relates to FIG. at least 5 amino acid residues encoded by the coding portion of the DNA sequence shown in A polypeptide comprising a sequence of is provided. The polypeptide of the present invention has a small amount (at least 1 0 residues, such as at least 15, more preferably 20 or more residues, and up to Preferably, all the residues have the sequence shown in FIG.

The polypeptide further comprises an N-terminal and and/or C-terminal sequences.

Polymers of the present invention containing five or more amino acid residues encoded by the DNA sequence shown in FIG. Peptides contain small mutations due to substitutions, deletions or insertions of individual amino acid residues be able to. Such polypeptide mutations correspond to portions of the sequence in Figure 2. No more than 20%, preferably no more than 10%, most preferably no more than 5% of the residues in the contiguous portion Preferably below.

The present invention further provides N-acetylgalactosa to serine and/or threonine residues. The above polypeptides modified by the addition of linkages such as By adding oligosaccharide moieties to lugalactosamine or via other linkages A modified polypeptide is provided. Keyhole rimbet hemocyanin, al Optionally modified, conjugated to a carrier protein such as bumin or thyroglobulin Also within the scope of the invention are polypeptides that have been modified.

The polypeptide of the present invention can be produced by synthetic methods or by recombinant DNA methods. can be produced de novo by expression of suitable DNA fragments of human or Can be expressed without glycolylation in non-human cells. alternatively they is the native human mucin glycoprotein (itself a sample of human tissue or body fluid). or expressed and fully processed in human cell lines. [Burchell et al., Cancer Re 5earch.

47:5467-5482. (1987), Gendler et al., P.N.

A, S, 84:6060-6064. (1987) Deglycosylation of It can be obtained by digestion of core protein. The polypeptide of the present invention inducing animal antibodies for use in active and passive immunization of animals, diagnostic tests, and tumors. Useful for localization and, when used with cytotoxic drugs, for tumor treatment .

The invention further provides antibodies against any of the polypeptides described above.

When used in the following sentence, the word “antibody” is F (ab”)! fragment. Polyclonal and monoclonal antibodies with antigen-binding sites such as fragment, and altering the amino acid residue sequence of one or more polypeptide chains. to vary species-specific and/or isotope-specific regions and/or from a heterologous source. Antibodies or fragments thereof that have been chemically or genetically modified to bind to polypeptide chains. shall include fragments.

Particularly for therapeutic applications, the Fab or its complementarity-determining region can be extracted from the species to be treated. Coupling with the Fc region of the induced antibody or the entire backbone (e.g., mouse The Fab region of a monoclonal antibody is administered together with a human Fc region to or to change the isotype of antibodies). It is more suitable to modify the antibody (see EP-A-0239-400). the Such antibodies can be obtained by conventional methods [Eill iams, Tib. Tech., 6:36° (1988)], useful for diagnostic and therapeutic applications such as passive immunization. It is for use.

The term “antibody” used in this text also refers to antibodies produced by recombinant DNA methods. An antibody molecule or fragment thereof as described above, as well as e.g. an initial DNA polymerase. of immunoglobulin heavyweights by random mutations introduced during enzyme chain reaction amplification. It harbors an expressible DNA sequence derived from the DNA encoding the variable domain. E, S, etc. produced in recombinant microorganisms such as Escherichia coli, Nature, 3 41:544-546 (1989). "one domain antibodies" or "dAbs". Such dAbs are A library of randomly mutated DNA sequences was screened to obtain polypeptides of the present invention. of a polypeptide capable of specifically binding to a protein or HPEM core protein. It can be produced by selecting a 'sequence that enables expression.

The antibodies of the invention are particularly suited to HPEM cores expressed by colon, lung, ovarian and especially breast cancers. Reacts with Tampa Kuga but with the corresponding fully processed HPEM is a small value of 0 or does not react. Specifically, the antibody reacts with HPEM core protein is produced by the normal lactating human mammary gland and is fully processed HP Does not react with EM glycoproteins.

The antibody of the present invention is a mucin sugar protein produced by mammary epithelial cells during pregnancy or lactation. A mucin protein expressed by breast epithelial adenocarcinoma cells that does not react significantly with protein. Preferably, it reacts with wood. These antibodies have very little reactivity with benign pore tumors. (and is therefore useful in the diagnosis and localization of breast cancer, as well as in treatment methods.

Further uses of antibodies include detection and/or assessment of severity of breast, colon, ovarian and lung cancer. Includes analytical diagnostic tests for efficacy.

The antibody is a polypeptide expression product of the human mammary epithelial mucin gene, or a flag thereof. other aspects, including screening of cultured cells, especially for nascent expression products. can be used for. In this case, antibodies can be conveniently polyclonal or monoclonal. It can be a reactive antibody.

The invention further provides antibodies conjugated to therapeutically or diagnostically effective ligands.

When antibodies are used therapeutically, the ligand is used to incapacitate or kill transformed cells. It is a lethal agent that is delivered to the cancerous breast or other tissue. Lethal agents include toxins, Radioisotopes and “direct biocides” such as components of complement and cytotoxic agents and other drugs.

For diagnostic use, the antibody is provided on a solid support and a detectable label, such as an enzyme label, a chromophores, fluorophores and radioisotopes and directly and indirectly detectable labels. It can bind to any ligand. The use of monoclonal antibodies is preferred for diagnosis. Yes.

The antibodies of the present invention can be produced by inoculating suitable animals with the polypeptides described above. can be done. Monoclonal antibodies can be prepared using well-known methods, e.g. Kohler & M. Ilstein [Nature, 256+495-497 (1975)] from animals inoculated with mucin core protein or its fragments according to the method. Pancreatic cells are usually grown in a permanent cell line (preferably myeloma cells) that is homologous or xenogeneic to the inoculated animal. system), making it permanent and suitable for cloning and screening. It can be manufactured by performing the following steps.

Antibody-producing cells obtained from animals inoculated with the polypeptide of the present invention and their permanent Such cells constitute another feature of the invention.

The present invention provides for use in surgical, therapeutic or diagnostic methods for the human or animal body. or a policy as defined in the preceding sentence for use in the manufacture of drugs used in such a manner. Presenting peptides, antibodies and antibody producing cells such as hybridomas. The present invention Also, an effective non-toxic amount of the polypeptide or antibody defined in the preamble may be administered to a human in need thereof. Provided are methods of treatment or diagnosis comprising administering to a human or animal.

Expressing a nucleic acid fragment of the invention or otherwise producing a polypeptide of the invention and methods for producing antibodies or fragments thereof, as well as methods for producing antibodies such as permanent cells. A method for producing biogenic cells constitutes a further feature of the invention.

The present invention further provides that the above-mentioned sample suspected of containing abnormal human mucin glycoproteins is A diagnostic test or assay is presented that involves contacting with a defined antibody. That's it Such methods include administering to the patient an antibody with a detectable label, or administering the antibody and Separately, simultaneously or sequentially in any order, with the antibody or fragment thereof. Tumor localization including administration of a labeling agent that can selectively bind is included. medical examination We present diagnostic test kits for cutting tests or analysis. The kit includes antibodies and optionally Suitable labels and other reagents and standard serum, especially for competitive assays including.

The invention will now be further described with reference to the figures of the accompanying drawings. In the diagram: Figure 1 shows the first SmaI restriction site in the direct repeat sequence of WO-A-88105054. The deoxynucleotide base sequence of 1763 bases including and upstream is shown.

Convenient symbols A, C as bases for non-template strands.

Use G and T. The base sequences are arranged in blocks of 10. Non-transcribed sequences are Lowercase letters and transcript sequences are uppercase letters. SPI regulatory elements (Table 2), TATA A box, transcription and translation initiation sites (Table 1) are underlined.

Figure 2 shows the sequence of the first intron starting from the transcription start site (residue 1 in Figure 1) (Figure 1 The sequence of the non-template strand excluding bases 131-632 of the sequence is shown. figure 2 is the predicted sequence of the polypeptide using simple one-letter symbols for amino acid residues. Also shown. Amino acid residues are numbered on the left; nucleotide residues are numbered on the right. That's it. Signal sequences are underlined. The array is the first Sma of serial repeats. It ends at the I part.

Figure 3 shows the first SmaI restriction site in the tandem repeat sequence of WO-A-88105054. The deoxynucleotide base sequence of 1575 bases including and upstream of the non- The bases of the template strand are indicated using the convenient symbols A, C, G and T. non-code The base sequence of the region is arranged in blocks of 10. The exon sequence consists of three It is shown as a block, and the translation codon is underlined. exons 1 and 2, int. The signal sequences for Ron1 and exocis blicing are numbered and labeled. Ru. Tables 1 and 2j; other characteristics listed are boxed. The array is a series repeating array. The sequence ends at the first SmaI site.

The present invention particularly relates to WO-A-88105054 or WO-A-90105142. Disclosed fragments, polypeptides and antibodies or related materials, such as vectors. microorganisms and cells, or Bfochemicaland Biophysica l Re5earch Communications, 165 (2): 64 4-649 (1989) by Abe.

A cDNA fragment with the sequence shown by Mo et al. stomach.

The invention will now be illustrated by the following example: Example 1 In an attempt to obtain clones using 5° unique sequences, two gtlO libraries were used. was screened using tandem repeat probes. The obtained clone lotus All had no unique sequence at the 5' end. So we used another method. 5° array breast cancer cell lines using immobilization-polymerase chain reaction (A-PCR) to obtain A cDNA corresponding to the 5' end of the transcript was synthesized. A-PCR method [Loh, E, Y, etc., 5science.

243: 217-220. (1980)] corresponds to the 5′ end of the transcript. It was used for the synthesis of cDNA. For 5'-end cloning, guanilated total RNA (5 μg) was serially repeated (5°CCAAGCTTGGAGCCCGGGGC CGGCCTGGTGTCCGG3') AMV-reverse transcriptase (Life 5c) in a 40 μl reaction mixture containing primers. used for first strand synthesis using breast cancer cell line (BT20) with [Okayama, H, and Berg, P, Mo1. Ce11. Bi ol, 2:161-170 (1982)]. Reverse transcribe total RNA and transcribe the product It was precipitated using spermine. Poly(dG) tail, terminal deoxytra The cells were introduced using spherase (500 U/ml. Pharmacia). 1 Thermus aquetix (The rmu 5 aq. uat1cus) polymerase (Perkin Elmer Cetus) was amplified using The primers are tandem repeat primers and poly(dG) terminal primers. An poly C ply for 7-(5’ GCATGCGCGCGGCCGCGG AGGCCCCCCCCCCCCC3°) and AN primer (5°GCA TGCGCGCGGCCGCGGAGGCC3°).

After an initial denaturation of 5 min at 94°C, the reaction was annealed at 55°C for 2 min; Extension at 72°C for 2.5 minutes and denaturation at 94°C for 1.5 minutes. Amplification is 30 cycles and the product was precipitated using ethanol. DNA was converted into HindIII and S ac II and separated on a 1.2% agarose gel, approximately 55 The 0bp band was transferred to a DEAE film (Schleicher and 5chuell). ), ligated into pBS-SK'' and isolated from bacteria XL-1 (Strata The cells were transformed into the following gene. This plasmid is called pBS-5'PEM.

All restriction enzymes used were New Eng1 and Biolabs In c, and oligonucleotide primers and probes were obtained from Applie d Synthesized on a Biosystems 380B DNA synthesizer.

Four colonies were selected and sequenced, and the sequences were compared to each other and to the genomic clones of the region. It matched the sequence obtained from. There is an initial ATG before the 72 bp leader sequence, It is consistent with the reading frame of the serial repeats determined previously (Fig. 1), and before the first ATG. The sequence, CCACCATGA, matched the KozaC consensus sequence (Kozac, M. , Nucl, Ac1d, Res, 12:857-872 (1984).

The position of the cap site was precisely mapped using primer extension method. A.T. 21 bp oligonucleotide corresponding to nucleotides 73-93 ending in A of G Brimer (5' AGACTGGGTGCCCGGTGTCAT3') (Figure 1) using T4 polynucleotide kinase (Pha rma c i a) [y-”P] ATP (>5000ci/mmol, Amersham I international plc) and added the same amount of 4M ammonium acetate. Oligonucleotides precipitated three times using removed from. 1x10 labeled Bliv-(1x10) at dpm/picomole 5 dpm) in 120 mmol sodium chloride for 5 minutes at 95°C. total BT20 RNA was annealed, kept at 65°C for 1 hour, and cooled to room temperature.

The annealed primer was treated with 50 mmol of Tris at pH 8.3 at 45°C. 6 mmol magnesium acetate, 10 mmol dithiothreitol, 188 mmol Using 18 units of reverse transcriptase in a total of 50 μI containing 50 μl of dNTPs, 45 Extended for 1 hour at °C. The reaction was stopped by adding 50 mmol EDTA and the RNA was Digested with RNase-A at 37°C for 15 minutes at 0.00 g/m1. did. Samples were then phenol:chloroform extracted before ethanol precipitation. Electrophoresis was performed on a standard 6% sequencing gel and two bands were obtained, which were The result was two Cs at bases 72 and 71 upstream of ATG. sequencing ladder - Seq u e n a, se kit (US Biochemica -Heavy chain standard DNA (M13mp18) from ICorp, ).

The most prominent product is 72 bp, from the 5' end of the oligonucleotide primer. Identical to the number of base pairs to the 5′ end of the PCR-derived clone, and the cDNA corresponds to It has been proven that this corresponds to the entire length of mRNA from 5' to tandem repeats in cells that . The presence of the second band is due to the base 71 as it forms a CpG dinucleotide. This is thought to be due to conflict with reverse transcriptase due to C methylation. Under the same conditions, P Using RNA from Daudi cells that do not express EM mucin, the primer The extension product is recombined when the lambda is grown in RecA+ cells. Therefore, DHIα cells (RecA -) was used. Part of a series repeat sequence (GCT GGGGG) has been implicated as a hotspot for RecA-mediated recombination in E. coli. It is closely related to the rare chi sequence (OCTGGTGG) of lambda phage. Therefore, this reorganization is expected.

Nucleotide sequence of cDNA clone Figure 1 shows DNA from a 5°A-PCR-derived clone containing a consensus sequence of tandem repeats. Indicates an array. Sequences were determined in both directions. The sequence of regions of conserved serial repeats is complete. Although not determined, previously obtained cDNA tandem repeat clones were circularized and sonicated. approximately 40 clones were sequenced [(Gendler et al., J. Biol. , Chem, 263:12820-12823 (1988)].

Predicted amino acid sequence and composition of PEM core protein Core protein amino acid composition has a predominantly tandem repeating amino acid composition.

Serine, threonine, proline, alanine and glycine are amino acids with a temperature of about 60℃. I will do it.

The predicted sequence of the PEM core protein consists of (1) a hydrophobic signal sequence and a regenerative tandem sequence; (2) a distinct region containing the tandem repeat region itself; nothing. At the N-terminus, the first 7 amino acids are followed by a putative signal peptide 13 Amino acids follow. However, attempts to obtain the N-terminal sequence of the core protein were blocked. The actual cleavage site has not been determined as it was hindered by the amino terminus.

signal sequence and the first Sma1 site before it (used to determine the beginning of the tandem repeat) There are 107 amino acids. More than 50% of these amino acids contains reproducing serial iterations. Because the number of serial repeats per molecule is large (we observed 21 or more for the smallest allele), this domain is the core protein of the core protein. [Gend ler, S., et al., cited above]. The sequence of the 20 amino acid tandem repeat unit is broadly Corresponds to the expected sequence for a protein that is extensively O-glycosylated. Iterating Five serine and threonine are found in the protein, four of which are doublets, and this Their glycosylatable sites are separated by proline-rich regions (Fig. (see 2).

w　to　1. o　to　　　w　w rv+loS Octopus- P-IN Nrn ffl Dimensions OI-＜　○　Q　○ Snake 2″ C) (C! Ic/) ro 00 (0(c) (Cri (Q Cri Q e Q　Ol-<　o　○　○ S,) 3C5Q(1) QC/) (engineering ol-QI-ri 21-+-Q((( ＜＜　(＜　OCD　＜ OQl-○I-o γ Q's ○ ○ summary A sequence that is the same as or homologous to the corresponding length of the sequence of the code strand shown in Figure 1. , or a portion of corresponding length of a sequence complementary to the sequence of the code strand shown in Figure 1. at least 17 contiguous nucleotide salts having the same or homologous sequence as A nucleic acid fragment containing a radical moiety.

international search report 1m, mulsM A**w+m, + NIL PCT/GB 90〆0202 0

Claims (14)

[Claims] 1. identical or homologous to the corresponding length of the sequence of the code strand shown in Figure 1. the corresponding length of the sequence or the complementary sequence to the sequence of the code strand shown in Figure 1; at least 17 contiguous nucleotides having a sequence identical or homologous to a portion of A nucleic acid fragment containing a double base portion. 2. below: (a) Signal sequence [There is an array] Here, X is an intron that is present arbitrarily. (b) Breast common sequence ], (c) Breast common sequence [there is a sequence], (d) sequence (a), (b) or is a sequence homologous to (c), and (e) homologous to sequence (a), (b), (c) or (d). 2. A fragment according to claim 1, comprising one or more complementary sequences. 3. The text as claimed in claim 1 or 2, having a detectable label, is attached to a solid support. Hybridization probe containing the fragments shown. 4. Cloning or development comprising the fragment according to claim 1 or 2. Current vector. 5. A transformed cell comprising the cloning or expression vector according to claim 4. . 6. At least five genes encoded by the coding portion of the DNA sequence shown in FIG. A polypeptide containing a contiguous sequence of acid residues. 7. An antibody against the polypeptide according to claim 6. 8. as claimed in claim 7, having a detectable label or attached to a solid support. antibodies. 9. An antibody-producing cell capable of secreting the antibody according to claim 7. 10. Fragment according to claim 1 or 2 or protein according to claim 3 lobe, or the polypeptide according to claim 6, or claim 7 or 8. A diagnostic kit containing the antibody described in . 11. claims for use in methods of treatment or diagnosis on the human or animal body; Fragment according to claim 1 or 2, probe according to claim 3, claim The vector according to box 4, the cell according to claim 5 or 9, the cell according to claim 6 or the antibody according to claim 7 or 8. 12. For the manufacture of drugs used in therapeutic or diagnostic methods for the human or animal body. The fragment according to claim 1 or 2, the probe according to claim 3, a vector according to claim 4, a cell according to claim 5 or 9, a vector according to claim 4, a cell according to claim 5 or 9, Use of the polypeptide according to claim 6 or the antibody according to claim 7 or 8 . 13. Cancer patients who require treatment or diagnosis, or who are believed to have cancer an effective non-toxic amount of the fragment according to claim 1 or 2 to a patient; The probe according to claim 3, the vector according to claim 4, and the probe according to claim 5 or 9. the cell according to claim 6, the polypeptide according to claim 6, or the cell according to claim 7 or 8. A method of treatment or diagnosis comprising administering an antibody as described. 14. A sample from a patient is transformed into a fragment according to claim 1 or 2. The probe according to box 3, the vector according to claim 4, the probe according to claim 5 or 9 The cell according to claim 6, the polypeptide according to claim 6, or claim 7 or 8 A diagnostic method comprising contacting with an antibody according to.