JPH05501951A - Recombinant human thyroid peroxidase - Google Patents

Abstract

Recombinant human thyroid peroxidase (hTPO) is described. DNA sequences encoding a truncated, secretable and enzymatically active hTPO protein are disclosed, as well as vectors, including plasmids, comprising these sequences, and hosts transformed with the said vectors. Non-thyroidal eukaryotic expression has been achieved. hTPO according to the invention, and antibodies directed against hTPO, are disclosed and are useful in the detection, diagnosis and therapy of immune disease, including Hashimoto's thyroiditis.

Description

[Detailed description of the invention] 16. Human thyroid peroxidizer produced by the host cell according to claim 15. or a functional or chemical derivative thereof.

17. A method for producing human thyroid peroxidase, comprising secretory human thyroid peroxidase. The host cell of claim 15 under conditions that permit expression and secretion of oxidase. A method comprising culturing and recovering the human thyroid peroxidase. .

18. An antibody against human thyroid peroxidase according to claim 16.

19. A method for detecting human thyroid peroxidase in a sample, the method comprising: The sample is also contacted with the antibody of claim 18, wherein the antibody is detectably labeled. human thyroid peroxidase in the sample and the detectably labeled A complex is formed between the identified antibody and the complex is formed or detecting the uncomplexed detectably labeled antibody. Method.

20. A kit for the detection of human thyroid peroxidase in a sample, comprising: , comprising one or more containers, one of the containers being a container according to claim 18. A kit comprising an antibody, the antibody being detectably labeled. .

21. A method for detecting antibodies against human thyroid peroxidase in a sample. samples expected to have antibodies against human thyroid peroxidase. contacting with the recombinant human thyroid peroxidase of claim 16, wherein said Recombinant human thyroid peroxidase is detectably targeted and an antibody against human thyroid peroxidase present in the detectably labeled It was &! A complex is formed with I-replacement human thyroid peroxidase, and A detectably labeled &l complexed or uncomplexed A method comprising detecting recombinant human thyroid peroxidase.

22. Kit for detection of human thyroid peroxidase in samples and a container means comprising one or more containers, one of the containers being according to claim 16. comprising the recombinant human thyroid peroxidase described above; A chelate characterized by being labeled with detectable oxidase.

Engraving (no changes to the content) Specification human peroxidase Golden ball■! scenery , Ru ni, Ru reference This application is U.S. Patent Application No. 077472,070 filed January 30, 1990. The latter is a continuation-in-part application of U.S. Patent Application No. 07 filed on July 31, 1989. This is a continuation-in-part application of No./388.044.

Yuri ■ standing! The present invention relates to the fields of molecular biology and immunology. More specifically, the present invention Related to the production of recombinant human thyroid peroxidase in eukaryotic cells do. The invention further provides a method of using recombinant human thyroid peroxidase, and especially in the diagnosis of immune disorders, such as thyroiditis. Regarding methods of using human thyroid peroxidase.

, Ru'nona- Hashimoto thyroiditis is the most common autoimmune endocrine disorder and affects the adult female population. A large number of thyroid glands affect up to 15% of patients, at least asymptomatically (1.2). Antibodies to glandular antigens are present in the serum of these patients, and thyroglobulin ( thyroglobulin) and thyroid [including microsomal J antigen] (3.4). Other antigens of less importance or uncertainty may be DNA antigen (3), tubulin (5), DNA (6) and autoimmune thyroid disease-related Includes serial antigen 1 (ATRA I) (7).

Antibodies against microsomal antigens are expressed on the cell surface (8,9) and Hashimoto et al. Of greater importance than antibodies against thyroglobulin in the pathogenesis of thyroiditis Believable. This is because anti-microsomal antibodies (MSA) are used during the active phase of the disease. 1.10.11) and complement fixation (8).

Therefore, these antibodies are more likely to initiate damage to thyroid cells.

A major recent discovery regarding Hashimoto thyroiditis is that the previously incorrectly defined microscopic the somatic antigen is at least in part thyroid peroxidase (TPO); It is the main enzyme involved in the synthesis of thyroid hormones. This conclusion is Based on immunological evidence (12-15), these proteins Molecular cloning of cDNAs (16-19) and their derived amino acids This was confirmed by the finding that the acid sequences are identical (18, 20).

Prior to the present invention, suitable preparations of recombinant TPO were used to treat /S Shimoto's thyroiditis. for the study of postulated abnormalities in immune regulation, or available for demonstration of relevant specific Bi[I cell and T cell epitopes. It has not been. In this regard, the molecular mechanisms involved in the pathogenesis of Hashimoto thyroiditis Our understanding of the mechanism is important for other disorders, for example, when pure antigens (acetylcholine receptors) Myopathy (21.22) is a disease in which the epitope has been defined It is far behind that of dystonia.

Human TPO (hTPo) immunopurified with monoclonal antibody (mAb) were available, but of limited value because: (a) human thyroid glands; (b) difficulty in purifying this membrane-bound antigen; and (c) highly Contamination with other abundant thyroid autoantigens, such as thyroglobulin.

h, TPO fragment is a recombinant bacterial (β-galactosidase) fusion protein and the fusion protein with the serum of numerous Hashimoto thyroiditis patients. Reactivity with small fragments of TPO expressed as (18) has been reported. death However, those data were difficult to interpret. Because the puller used assays require extensive preadsorption of polyclonal antisera (7) and This is because there is a possibility that a negative result may occur.

For example, suppose that 19 out of 20 Hashimoto thyroiditis patient sera are reactive. The reported fusion protein f (reference, 18, clone C2) originally described in Immunoprecipitation with anti-β-galactosidase mAb resulted in EL I SA assay. was found to react with serum from patients with Hashimoto thyroiditis ( 40).

Thus, bacterial fusion proteins also have limited value for the following reasons: (a) A combination of fragments that reacts with all Hashimoto serum has not been discovered; (b) The conformation of the fusion protein is different from that of the natural protein and (c) bacterial products may be added to immune cells in culture. and may be toxic.

Matasato Naru 11 To obtain full-length hTPo free of other potential thyroid antigens, we Expression of recombinant hTPO in pharyngeal eukaryotic cells was achieved. Similar to natural hTPo , this recombinant hTPO is enzymatically active, expressed on the cell surface, and fused. It is not a synthetic protein.

The recombinant hTPo of the invention, in certain methods, contains "anti-microsomal" antibodies. It is recognized in serum from patients with Hashimoto thyroiditis. in this disease All 36 halves selected to represent the range of anti-microsomal antibodies seen. Serum from patients with Shimoto thyroiditis reacts with recombinant hTPo expressed in euptans of the present invention. It was sex.

One object of the invention therefore relates to immunopurified natural proteins or or without suffering from the drawbacks associated with previously available recombinant fusion proteins. The objective is to provide a convenient and economical source of recombinant hTPO. thus, This invention represents a number of important advances in the characterization of human thyroid microsomal antigens. and pave the way for substantial further development in this field.

Recombinantly produced, enzymatically active human thyroid peroxidase in non-thyroid eukaryotes Expressed in biological cells. Unlike previously reported bacterial fusion proteins, this Protein conformation is controlled by β-galactosidase fusion protein. unimpeded. Furthermore, unlike proteins produced by bacteria, TPO It is lycodylated. Demonstration of functional TPO activity was demonstrated using conventionally cloned cDNA It clearly shows that A (IS, 17, Eng. 8.19) is in fact TPO.

Experiments using recombinant hTPO of the invention expressed in non-thyroid eukaryotic cells showed that TPO is the main agent in Hashimoto thyroiditis, independent of any other thyroid antigens. prove that it is an important autoantigen. In this way, all 36 hashimos tested Sera from patients with thyroiditis showed a specifically reacted with recombinant hTPo in a quantitative manner. Traditional immunological research Although it was strongly suggested that microsomal antibodies react with hTPo (12-15), Possible contamination of immunopurified hTPO antigens with other unidentified thyroid antigens It was difficult to eliminate. produced by the CHO-T'P'O cells of the present invention. or be found in it. Thyroid (or, in fact, human) protein Only the texture is hTPo. Both normal subjects and patients with Hashimoto thyroiditis human serum from a species of CHO cells that were not transfected. or contains antibodies that react with two or more antigens, but patients with Hashimoto thyroiditis Only human serum reacts with recombinant hTPo.

The invention also applies to polyacrylamide gel electrophoresis (PAGE) and Western Microsomal antigens appeared as doublets when analyzed by plotting. Shedding light on conventional observations (33, 41, 42). If the doublet is two separate tampers It is unknown whether they represent proteins or are partial degradation products of a single protein. It wasn't. Kimte et al. identified two forms of hTPO mRNA and cDNA. observed and suggested the possibility of differential splicing of the transcript of the first TPO. (19). Nagayama et al. reported the presence of four different forms of hTPo mRNA transcripts in glandular cells. (43), a doublet as the product of a single intron-free hTPO gene. The present invention's findings strongly argue against the possibility of differential splicing. Ru.

Recalling the data of et al. (33), membrane-bound hTP.

may be linked to other unidentified proteins through disulfide bonds. It suggests that. Another interpretation, consistent with Taurog et al.'s model (44), is that TPO The intra-regional disulfide bonds modify the gel migration behavior of TPO, allowing for numerous morphologies. It means to make it appear. The main antigen (under non-reducing conditions) is 107 kD. In contrast to the observation of human thyroid microsomes (41) that The main immunogenic form in transfected CHO cells is approximately 200k. It has a mass of D and is converted into a single band of approximately 110 kD upon reduction. Observations were made under one condition. This difference occurs in different cell types (human and CHO). can be related to the diverse expression of TPO in . However, it is also The main band of the 107 kD protein from human thyroid microsomes was analyzed in a non-reduced manner. A 200kD protein is generated by PAGE under normal conditions. It has been reported (41). In addition, 110 after reduction of recombinant hTPO protein. The present discovery of a reduction in the kD signal supports other development methods using natural microsomal antigens. Matches (45, 46). Thus, in its natural state, human TPO Exist as multimers or associate with other membrane proteins of similar size It exists as such. Epitope recognition by autoantibodies is conformasin dependent. There is something that happens.

The derived amino acid sequence of hTPo is in recombinant full-length hTPO and therefore naturally Naturally, there is a signal peptide in hTPO, and the carboxy terminus of the protein At the end (amino acid residues 846-870) there is a putative membrane spanning region (transmembrane (16.17.19.5) 4). Naturally occurring hTPO has been shown to be a thyroid cell surface protein. Ta. Recombinant enzymatically active hTPo can also be stably transfected. It is associated with the cell membrane in nonthyroid eukaryotic cells (48).

Without wishing to be bound by any particular theory, it is believed that the signal peptide transports human TPO across the cell membrane. However, the hydrophobic region of hTPo is embedded within the cell membrane, which allows it to be directed into the cell. The inventor hypothesized that secretion from the cells would be prevented.

For the purposes of the present invention, the "secretory" of recombinant hTPO is defined as Recombinant hTPo is directed through the host cell membrane and removed from the cell membrane. means. Conventionally, the hydrophobic regions 846-870 of hTPo are transmembrane. There is no functional evidence that this corresponds to a domain.

The present invention demonstrates the presence of transmembrane domains in hTPO and 0 site-specific mutations demonstrating that Po is primarily an enzyme directed outside the cell. Mutagenesis creates a stop codon immediately within this putative transmembrane domain. When inserted upstream, hTPo is converted into a secreted protein; The quality is enzymatically active and immunologically intact. Introduce a stop codon By excising hTPO by 85 residues, the carboxyl terminus (933 residues) was removed. (mino acid) was taken out. A mutated protein inserted into a euphyte expression vector. The hTPo cDNA was stably transfected into CHO cells. C Cellular 3SS-methionine labeled protein using serum from patients with Shimoto thyroiditis Immunoprecipitation and PAGE showed a doublet of 105-101 kD. contrast Generally, cells transfected with wild-type hTPo have a 112-105 kD Brought a doublet.

In pulse-chase experiments, CH expressing excised hTPo protein O cells are present at levels that progressively accumulate over 24 hours after a 4-hour chase. , secreted immunoprecipitable TPO into the medium. In contrast, wild-type hTPo The present CHO cells did not release immunoprecipitable TPO into the medium. intracellular The secreted truncated form of hTPo, in contrast to the doublet expressed in Appeared as a single band with less mobility. The enzymatic activity of TPO is mutated In conditioned medium from CHO cells transfected with TPo was present in conditioned medium from cells expressing wild-type hTPo. did not exist. The stability of the mutated protein is similar to that of wild-type hTPo. It appeared like.

The secreted form of hTPo can be used for structural and immunological studies if large amounts of soluble TPO protein can be generated for both diagnostic and diagnostic uses. Wear.

Thus, in one embodiment, according to the invention, recombinant enzymatically active TP Ol or a functional or chemical derivative thereof is provided.

In other embodiments, hTPo produced by a non-thyroid eukaryotic cell is provided. Ru.

In other embodiments, the invention provides enzymatically active and immunologically intact recombinant hTPOl or its functional or chemical inducer, which is capable of being purified and secreted. A conductor is provided.

Note that other aspects of the present invention are pECE-HTPO, pHTP.

(Ml)-ECE-3V2-DHFR, pHTPo-DHFR-28, pHTP From the group consisting of o-DHFR-4C and pHTPO-DHFR-4C-MTX comprising the selected plasmid.

Also according to the invention, non-thyroid eukaryotes transformed with these plasmids cells and transformed cells under conditions that allow expression of hTPo. And hTP.

A method for producing hTPo is provided, comprising recovering hTPo.

In yet other embodiments, the invention provides antibodies to hTPo of the invention.

Furthermore, according to the present invention, the sample can be treated with antibodies against full-length recombinant hTPo or secreted contact with an antibody against possible hTPo, where the antibody is detectably labeled. thus detecting the complex between hTPo and the detectably labeled antibody in the sample. labeled antibodies formed and complexed or uncomplexed. A method of detecting hTPo in a sample is provided comprising detecting hTPo in a sample.

In an additional embodiment, the container means comprises one or more containers; h in the sample, one of which contains a detectably labeled antibody to hTPO. A kit for detecting TPo is provided.

Furthermore, according to the invention, the sample can be either full-length m-recombinant hTPo or secretable recombinant hTPo. hTPo, and the relationship between the hTPO-specific antibody in the sample and the recombinant hTPo is forming a complex and detecting the complexed antibody. A method is provided for detecting antibodies to hTPo in.

In the additional M, the container means comprises one or more containers; One contains recombinant hTPo and uses a kit to detect antibodies against hTPo in the sample. will be provided.

These and other non-limiting aspects of the invention will become apparent to those skilled in the art from the following detailed description of the invention. It would be obvious to anyone.

Mold plate■! Taruseijuhada and construction of expression plasmid pHTPo-ECE. pHTPO-BS (upper cloth) Digested with Notl, blunted the ends with Klenow fragment of DNA polymerase I, and This DNA was then digested with XbaI. This vector = 2.95kb) and HTPO cDNA fragments (3.1 kb) were released due to their similar sizes. The Bluescript vector that was created is further added to Scal. After digestion, good separation was obtained by agarose gel electrophoresis. mammalian expression vector -p ECE (25) (upper) was digested with EcoRI, and the ends were digested with DNA polymer. The DNA was then blunted with Klenow fragment of Klenow enzyme II, and the DNA was subsequently digested with Xbal. Next Then, the digested pHTPo-BS and pECE fragments were treated with 74 DNA polymerase. (26), the resulting plasmid pHTPo-ECE (bottom) was Competent XLI-Blue Cells (Stratgene, Sun, CA) transfected into Diego).

L, Fluorescence-activated cells of CHO cells transfected with pHPo-ECE. Rousoter (FAC3) analysis. CHO-HTPOl 2b cells are described here. It was processed so that

Panel A: Phycoerythrin (PE) labeled without pre-exposure to human serum. Cells exposed to second antibody only.

Panel B: Serum from a patient with Hashimoto thyroiditis (ELISA value of 1779) (1 :100), followed by incubation in PE-labeled second antibody. cells that were not incubated.

Panel C: In serum and PE of patients with Hashimoto thyroiditis described in panel 2. Cells incubated sequentially in labeled secondary antibody.

Panel D: as in panel C, but lacking anti-microsomal antibodies. Serum from a normal individual was used.

Panels E and F: Panels C and F plotted to show the forward scanter. The same data as in D. These data show that normal serum and The relative sizes of the cell populations that react with serum from patients with Shimoto's thyroiditis are the same.

against human thyroid microsomes or against recombinant human) TPO. Linear regression analysis of EL I SA using antibodies.

Concave soil, against human thyroid microsomes or against recombinant human) TPO. Linear regression analysis of EL I SA using antibodies (1/1000 dilution). rca rdiff” refers to the source of microsomal antigen in both FIGS. 3 and 4.

Dish 5. pECE-HTPO1pH7'Po-DHPR-2B and pHTPo- The relative observed in CHO cells transfected with DHFR-4C Figure 3 shows the TPO activity plotted against methotrexate concentration.

Nucleotide sequence of human TPO gene after two site-directed mutagenesis. The mutation is 2 A stop codon and an EcoR1 site for confirmation were added to the human TPO gene in trans. It was introduced just upstream from the membrane region.

Ogaku, cDNA sequence and derived amino acid sequence of human K. peroxidase. Column (17).

2''-1 expression 7' Lasmi f'p HTPO (M1) -ECE-3V2~D A schematic diagram showing HFR.

Production of plasmid pHTPo (Ml)-ECE-3V2-DHPR.

Occurred in plate-shaped, Graves thyroid microsomes and non-thyrophyte cells. A spectrum of anti-MSA levels due to reactivity with recombinant enzymatically active human 1-TPO. Comparison of 51 sera selected to provide anti-MSA assay data. ta is expressed as an ELISA index against standard serum. Anti-hTPO antibody assay Data are absolute optical values normalized to blank well values of o, ooo. Expressed as density (0, D, ) units. (A) Serum dilution 1/100 (4 normal subjects) (B) Serum dilution 1/1000; (C) Blood Clear dilution 1/10.000° dish, human thyroid microsomes (A) and recombinant Two sera (#11 and 27) that react inconsistently with hTPo(B) were found in the panel. Reacted with antigens other than hTPO in sample A at standard (1/100) serum dilution. Ru. The dilution curves also show similar anti- MSA activity is shown using standard serum dilutions.

ELISA assay for anti-hTPO antibodies in plate presentation, standard (1/100) serum dilution. intra-assay variability. Selected to represent low, moderate and high autoantibody levels ELI of 10 replicates of anti-hTPo antibodies on three autoimmune sera Standard deviation above the mean of SA results.

Mutated nucleotides introduced into hTPo by concave Eyu0 site-directed mutagenesis Confirmation by sequencing of the nucleotide positions reported for human TPO It means the response to thing (5). TGA in mutated hTPo-Ml ( 2629-2631bp) and TAG (2641-2643bp) stop code and the EcoRI site are shown on the right.

The nucleotide sequence of wild type hTPo is shown on the left.

(A)) In different clones of transfected CHO cells. Immunoprecipitation of mutated hTPo, CHO: CHO cells without transfection , CHO-TPO; CHO cells transfected with wild-type hTPO; C ) 10-TPO-Ml-POOLED: Transfected with mutated form of hTPO. Pooled colony of transfected CHO cells; CHO-TPO-Ml-D~ ; cloned with the mutated hTPo selected in the cloning cylinder and then expanded. Individual colonies of transfected CHO cells, transfected with 353-methionine Radiate with n! Hashimoto thyroid gland S-labeled and containing high anti-hTPo antibody levels Immunoprecipitation was performed with adenitis serum.

(B) Changes from cell clones to CHO-TPO-Ml- generated by limiting dilution. Immunoprecipitation of different hTPOs. Immunoprecipitation was performed on hives with high anti-hTPO antibody levels. It was carried out using serum from patients with motothyroiditis. The specificity of immunoprecipitation is 10 Sera from normal individuals unable to precipitate 5-101 kD doublets This is shown by the properties of (CON).

On the plate 1. Biosynthesis and processing of TPO. Immunoprecipitation studies of wild type CHO cells expressing hTPo (top panel) and mutated forms of hTPo 3 was carried out using CHO cells (lower panel) transfected with A 4 hour pulse (0 hour chase) using 53-methionine was performed and then and chased unlabeled for the indicated times.

Both the cell lysate and conditioning medium were then added as indicated. Immunoprecipitation was performed for.

Gu Jodan, CHO cells after transfection with wild-type hTPo (cell line C HO-TPO12g) and a mutated form of hTPo. Human TPO enzyme activity in the culture medium of CHO cells (CHO-TPO-Ml-Kl).

The medium was collected after 3 days of culture. TPO enzyme activity in the medium was determined by guaiacol assay. Measured by A. The time course shown is for the oxidized guaiaquo in the assay. accumulation of the enzyme, but not the rate of secretion of the enzyme into the medium.

Concave gland infiltration in Grapes disease, expanded in the absence of (A) antigen. Tl from things! B-cell clones recognize recombinant TPO. clone ten autologus Irradiated PBL-4 color bar; clone 10 PBL 10 control (non-transfected) Cysin) CHO microsomes - striped rods; transcribed with clones + PBL + TPO Specfected CHO microsomes - gray bars. Results are cultured in triplicate Expressed as mean cpm of [3HJ thymidine incorporation in carp. The error bars are the average Standard error (S.

E, M, ) are shown. Similar results were obtained in three or more replicate experiments. It was.

(B) Peripheral blood lymphocytes from patients and normal subjects were compared with control and TPO The cells proliferate in response to both transfected microsomes. PBL single Germany; black bar; PBL+ control microsomes: striped bar, PBL + TPO Transfected microsomes; gray bars. Results are cultured in triplicate Expressed as mean cpm of [3H1 thymidine incorporation from (error bars are S, E, M). 81; Patient from which the T cell clone is derived in Figure 17A; R G; other women with Grapes disease; KH; normal control women. Similar results were obtained in another experiment. obtained from other individuals in the experiment.

JLLL, anti-microsomal/TPO monoclonal antibody 20°10 Pitope determination. The nucleotide sequences of the 5″ and 3″ ends are hTPoc The results were determined for 14 clones selected from the DNA library. these boundaries The field is the number assigned to the previously reported nucleotide (17) in hTPo. Annotated by Least overlap between all 14 clones The region is 881-927bp. the first two nuclei in this span does not constitute a complete codon and therefore corresponds to the derived amino acid sequence shown. It can be defined as between 883 and 927 bp.

-■ In the following description, various methods known to those skilled in the art of molecular biology and immunology will be used. mention. Publications and other materials describing such known methods mentioned are , which are incorporated herein by reference in their entirety, as fully set forth.

A study of standard references describing the general principles of recombinant DNA technology includes: Including: Watson, J.D., et al., Molecular Biology of the Gene 5Vo1. r and rr, issue needle, The Ben j-amin/Cumatngs Publisher+g Co5pany, Inc., Menlo Park, California (1987); Darnell SJ, E, et al., Molecular Cell Biology-, issue needle, 5c ientific American Books, Inc., New York New York (1986); Lewin, B. M., Gene II. Issue needle, John Hiely & 5oz, New York, NY (1985);01(], RJ, et al., Pr1nciples of Ge ne Mn1pulatfon: An Introductions to Genetic Engineering, 2nd edition, publication needle, Universe of California Press, Berkeley, California Lee (1981); and Maniatis, T. et al., Molecular C1on-ing: A Laboratory Manual, issue needle, Co1d Spring Harbor Labora tory, New York Cold Spring Harbor, State (1982).

"Cloning" refers to the insertion of a specific gene or other DNA sequence into a vector molecule. means the use of recombinant technology in vitro. successfully target the desired gene. To clone, the DNA fragment is ligated to a vector molecule and the complex DNA molecule is into a host cell where it can replicate and create a clone carrying the target gene. A method of generating DNA fragments is used to select among receptor host cells. It is necessary to use

rcDNA" is RNA-dependent DNA polymerase (reverse transcriptase) refers to the complementary or copy DNA produced from an RNA template by the action of Ru. Thus, the rcDNA clone is carried in a cloning vector. , refers to a double helix DNA sequence that is complementary to the RNA molecule in question.

rc DNA library is a collection of c-DNA libraries that together make up the entire genome of an organism. Refers to a collection of recombinant DNA molecules containing DNA inserts. This way Eel cDNA libraries are known to those skilled in the art and are available, for example, from Man iatis.

et al., Molecular Clontng:A Laboratory Man It can be prepared by the method described in ual, 5upra.

Generally, the organism from which you wish to clone a particular gene first For the purposes of the present invention, RNA is isolated from cells of mammals, particularly humans. Cell systems are preferred. A currently preferred vector for this purpose is the λ-ZAP vector. .

A "vector" is derived from a plasmid or bacteriophage and contains a DNA molecule into which DNA fragments can be inserted or cloned means. Vectors contain one or more unique restriction sites and have defined can replicate autonomously within a given host or vehicle organism; Sequences cloned can be reproduced. In this way, the rDNA expression vector The vector becomes a host after additional sequences of DNA are integrated into the genome of the autonomous element. refers to any autonomous element that can replicate in the host independently of the host chromosome Ru. Such NA expression vectors include bacterial plasmids and phages. Ru.

"Substantially pure" refers to any antigen of the invention, or any such antigen. This means any gene that contains other antigens or genes, respectively. or would normally be found in nature; Essentially free of other contaminants that may be present in unreleased form. “Functional induction A “fragment,” “variant,” “analog,” or “chemical derivative” of a molecule. means. "Fragment J" of a molecule, e.g., any cDNA sequence of the invention, is , refers to any subset of nucleotides in the molecule. of such molecules "A variant is substantially similar to an entire molecule or a fragment thereof. means a naturally occurring molecule. The analogue J of a molecule is the entire molecule or its means a non-naturally occurring molecule that substantially resembles a fragment.

If the amino acids in both one molecule and the other are substantially the same, then the Molecules are said to be "substantially similar" to other molecules. substantially similar amino acids The molecules will have similar biological activity. In this way, two molecules have similar activity. If they have the same characteristics, they are considered deformed. Because one of the molecules is inside the other even if they contain additional amino acid residues that are not found or This is because if the sequences of the groups are not identical, that term is used herein. here when a molecule has additional chemical moieties that are not normally part of the molecule a molecule is said to be a "chemical derivative" of another molecule. this Such moieties can improve the solubility, absorption, biological half-life, etc. of the molecule. can. Alternatively, these moieties reduce the toxicity of the molecule and improve its desirability. No side effects can be eliminated or weakened. What mediates these effects? The parts that can be used are described, for example, in the following document: Rem1ton' s Pharmaceut-tcal 5 sciences, 16th edition, Mack Publtshing Co., Easton, Pennsylvania (1980) .

Similarly, the "functional derivative J" of the human TPO antigen gene of the present invention is the "functional derivative J" of the human TPO antigen gene of the present invention. ``Fragment J'' is meant to include ``Variants J'' or ``analogues'', which are Co-labeling molecules that are “substantially similar” in leotide sequence and have similar activity. code.

D encoding the human thyroid peroxidase of the present invention, or a functional derivative thereof NA sequences can be recombined with vector DNA according to conventional techniques; Such techniques include: blunt ends or staggered ends (s tagged-ended), restriction enzyme digestion to obtain appropriate ends, necessary Fill-in of sticky ends depending on the alkali to avoid undesired ligation phosphatase treatment and ligation with appropriate gauze. For such operations This technique is described in Ma-niatis, T. et al., 5upra, and is well known in this field.

Nucleic acid molecules, e.g., DNA, contain nucleotides that contain transcriptional and translational regulatory information. contain a code sequence and such sequence encodes a polypeptide. expression of a polypeptide when it is "operably linked" to a polypeptide sequence. It is said that it can be done. Operable linkage is between the regulatory DNA sequence and the expression target. a chain in which DNA sequences are linked in such a way as to allow expression of a gene . The exact nature of the regulatory regions required for gene expression will vary from organism to organism; In general, in prokaryotes, promoters (instructing the initiation of RNA transcription) and DNA sequences that, when transcribed into RNA, signal the initiation of protein synthesis. It will include the promoter N region containing both sequences. These areas are 5”-non-coding sequences that are usually involved in the initiation of transcription and translation, e.g. sequences, capping sequences, CAAT sequences, etc.

If necessary, add 3' non-coding to the gene sequence that directs the genetic information of the protein. The code area can be obtained by the method described above. This region controls its transcriptional termination control. sequences, such as termination and polyadenylation. instructor The 3'-region naturally adjacent to the DNA sequence that directs the protein's genetic information is By retaining it, a transcription stop signal can be obtained. Transcription stop signal If the molecule is not fully functional in the expression host cell, the 3′ Can be replaced with a region.

Two DNA sequences (e.g., the promoter region sequence and the human thyroid peroxidase sequence) sidase-encoding sequence), the nature of the linkage between two DNA sequences is (1) (2) Thyroid peroxidase inheritance that does not result in the introduction of frame-shift mutations Does not interfere with the ability of the promoter region sequences to direct transcription of child sequences or (3) Thyroid peroxidase to be transcribed by the promoter region sequence A genetic sequence is said to be operably linked if it does not interfere with the capabilities of the sequence.

A promoter is used if it is capable of effecting the transcription of a certain DNA sequence. -region will be operably linked to the DNA sequence, thus In order to express a protein, transcriptional and translational signals recognized by an appropriate host are required. Naru is necessary.

The present invention provides human thyroid peroxidase ( or functional derivatives thereof), but includes expression in eukaryotes (and, in particular, non- Expression in thyroid eukaryotes is preferred.

Preferred prokaryotic hosts include bacteria, such as Escherichia coli (E. coli), Wasp. Bacillus, Streptomyces s), Pseudomonas, Salmonella ++onella), Serratia @ (Serratia), etc.

The most preferred prokaryotic host is L.

Other intestinal bacteria, such as Salmonella typhimurium Serratia marcescens or Serratia marc escens), and various Pseudomonas spp. Seeds can also be used. Under these conditions, proteins are converted into glycosyl cannot be converted into Prokaryotic hosts contain replicons and Must be compatible with control sequences.

Prokaryotic cells [e.g., E, codan, Bacillus subtilis, B. Pseudomonas, Streptomyces (Pseudomonas) In order to express human thyroid peroxidase protein in human operably linking the TPO-encoding sequence to a functional prokaryotic promoter; It is necessary. Such promoters may be constitutive or more Preferably, it is regulatable (i.e. inducible or derepressible) can. An example of a constitutive promoter is the int promoter of bacteriophage λ. -, the bla promoter of the β-lactamase gene of pBR322, and pB CAT protein of the chloramphenicol aethyltransferase gene of R325. Includes motors, etc. Examples of prokaryotic inducible promoters include: Includes: the major right and left promoters of bacteriophage λ (PL and pl), E. coli trp, recA.

IacZ, '1acI, and gal promoters, α-amylase (Ulma nen, 1. et al., J. Bactrology, 162:176 18 2 (1985) and the σ-28-specific promoter of B. subtilis (B, 5ubtilis). (Gilman, M, Z, et al., Gene, 32: 1l-20( 1984)), a bacteriophage probiotic of the genus Bacillus. Motor (Cr-yczan, T, J., Molecular Biology of Bacillus Genus (The Mo1ecular Bi-ology of the Bacillus) , AC+demic Press, Inc., New York (1982)) , and the Streptomyces promoter ( Society ardXJ, M, et al., Mo1. Gen, Genet, 203:468-4 78 (1986)). Prokaryotic promoters are generally described in the following literature: Viewed: G11ck, B, R,, J, Ind, Microbiol , Top: 277282 (1987); Centatiempo XY, , Bioc he+wie 68: 505 516 (1986); and Gottes man, S,, Ann, Rev, Genet, 18: 415-442 (1984).

Proper expression in prokaryotic cells also depends on linkages upstream of the gene-encoding sequence. Requires the presence of a posome binding site.

Such liposome binding sites are described, for example, in Gold, L. et al., An-n, R. ev, described in the old crobio1.35: 365 404 (1981) There is.

The most preferred hosts are eukaryotic hosts, including yeast, insects, fungi, and in vivo or mammalian cells in tissue culture. Mammalian cells are protein molecules, including glycosylation or glycosylation at the correct sites. Provide post-translational modification. Mammalian cells that can be useful as hosts include Fibroblast-derived cells, such as VERO or CHO-Kl, or lymphoid cells derived from, for example, hybridoma 5P210-AG14 or myeloma P3X 63Sg8, and derivatives thereof. CHO cells are currently the preferred mammalian It is an animal host cell. CO3 cells also express human thyroid peroxidase. Convenient eukaryote for the study of the regulation of expression of thyroid peroxidase and human thyroid peroxidase It is the host of things.

For mammalian cell hosts, a number of possible vector systems are available for expression of human TPO. Available for use. A wide variety of transcriptional and translational regulatory sequences are available, depending on the nature of the host. and can be used. Transcriptional and translational regulatory signals can be derived from viral sources, e.g. For example, viruses derived from adenovirus, bovine papilloma virus, simian virus, etc. where regulatory signals are directed to specific genes with high levels of expression. Related. Alternatively, mammalian expression products such as actin, collagen, Promoters such as those from myosin can be used.

Transcription initiation regulatory signals that allow repression or activation can be selected; In this way, gene expression can be regulated. Regulatory signals that are temperature sensitive are In this case, it is possible to suppress or initiate expression by changing the temperature. or can be subject to chemical regulation, e.g. metabolites. .

Yeast offers substantial advantages, it also encompasses glycosylation, post-translational Modifications of the peptide can be performed. For the production of desired proteins in yeast Strong promoter sequences and high copy number plasmids available There are numerous recombinant DNA methods available. Yeast is a cloned mammal A peptide that recognizes a leader sequence on a gene product of and has a leader sequence. (i.e., a prepeptide).

Furthermore, for example, ubiquitin hydrase (ubiquitin hy-dro ubiquitin-human TPO fusion protein by using the high quality biosynthesis can be achieved.

The fusion proteins so produced may be processed in vivo or can be purified and processed in vitro, with specific amino-terminal sequences enables the synthesis of human TPO protein with Direct yeast (or bacterial) origin This method avoids the problems associated with the retention of methionine residues from the start codon at present. I can do it. 5abtn et al., Bio/Technol.

7(7): 705-709 (1989); Miller et al., Bio/Te chno1.7(7):698-704 (1989).

Glycolytic enzymes produced in large quantities when yeast grow in a medium rich in glucose Contains promoter and stop elements from actively expressed genes encoding Any of a range of yeast gene expression systems can be utilized. Known glycolytic systems Genes also provide highly efficient transcriptional control signals. For example, phosphog Utilizes promoter and terminator signals of lysate kinase gene can do.

In insects) TPO or its I! Production of functional derivatives is within the skill of the art, e.g. Baculovirus engineered to express human TPO by known methods This can be achieved by infecting an insect host with a. In this way, 1 In one B case, the human TPO-encoding sequence was replaced with a viral polyhydrin protein. can be operably linked to regulatory regions of proteins (Jasny, 5cien). ce 238: 1653 (1987)) 6 infected with recombinant baculovirus. cultured insect cells, or the living insect itself, is capable of producing total protein. A large amount of human TPO protein, about 20-50%, can be produced. alive When insects that are Currently preferred for.

As mentioned above, human thyroid peroxidase protein in eukaryotic hosts Expression of the analog requires the use of eukaryotic regulatory regions. Such MM is generally Contains sufficient promoter region to direct the initiation of RNA synthesis cormorant. Preferred eukaryotic promoters include the following: Thionene I gene promoter 01am-er, D. et al., J. Mo1. Ap pl, Gen, 273-288 (1982); TK protein of herpesvirus. Romotor (McKnight, S, Ce1l 31: 355-365 (1982)); Early promoter of SV40 (Benoist, C , et al., Nature (London) 290: 304-310 (1981) ); yeast ga14 gene promoter (Johnston, S.A., et al., P roc, Natl, Acad, Sci.

The current and preferred promoter is the SV40 promoter.

As is widely known, eukaryotic mRNA translation encodes the primary methionine. is initiated at the codon that causes For this reason, eukaryotic promoters and human T The linkage between the DNA sequence encoding the PO protein (or a functional derivative thereof) The binding contains an intervening codon (i.e., AUG) that can encode methionine. It is preferable to ensure that it does not contain. The presence of such a codon indicates that the fusion tag forms a protein (AUG codon is identical to the DNA sequence encoding human TPO) reading frame) or frame-shifted. (If AUG has the same lead as the DNA sequence encoding human TPO) (if not present in the drawing frame).

h) The TPO-encoding sequence and the operably linked promoter are non-replicable. As a DNA (or RNA) molecule made by a receptor in a prokaryotic or eukaryotic cell where a non-replicating DNA (or RNA) molecule can be introduced into a linear segment. or, more preferably, a closed, covalent, circular molecule. Can be done. Such molecules cannot replicate autonomously, so the human TPO protein Protein expression can occur through transient expression of introduced sequences. a Alternatively, permanent expression may occur through integration of introduced sequences into the host chromosome. It can happen.

In one embodiment, integrating the desired gene sequence into the chromosome of the host cell. Use vectors that can. Stable introduced DNA into their chromosomes The integrated cells are prepared using a single test tube that allows selection of host cells containing the expression vector. Alternatively, selection can be made by introducing two or more markers. marker - Prototrophy to auxotrophic mutants, biolethal resistance, e.g. or heavy metals, such as copper. selectable marker remains The gene can be directly linked to the DNA gene sequence to be expressed or can be co-transformed. It can be introduced into the same cell by fection. More elements , single-chain binding protein m, may be required for optimal synthesis of RNA. . These elements contain splicing signals as well as transcriptional promoters and enhancers. sensor 1 and a stop signal.

cDNA expression vectors incorporating such elements include 0kay-aexa, H,,Mo1. Ce11. Biol, 3: 280 (1983). Includes what is being said.

In the preferred tq mode, the introduced sequence replicates autonomously in the recipient host. will be incorporated into a plasmid or viral vector that can . Any of a wide variety of vectors can be used for this purpose. specific Important factors in the selection of plasmid or viral vectors include: Contain: Recognize recipient cells that contain the vector and do not contain the vector the ease with which they can be selected from recipient cells; the number of copies of the vector that can be transferred between host cells of different species; You can do it if you want. Preferred prokaryotic vectors are plasmids, For example, including plasmids that can replicate in E. coliO (e.g. For example, pBR322, Co1E1. pscroll, pAcYc184゜like this Plasmids are described, for example, in Manfatis, T. et al., Mo-1 ecular. Cloning: A Laboratory Manual, Publisher, Co1 d Spring Harbor Laboratory, New York cold. Spring Harbor (1982)). Bacillus ( Bacillus Ilus) plasmids are pc194, pc221, pT12 7 etc. Such a plasmid is derived from Grycza-n, T., The Molecular Biology of the genus Chirus he Bacillus i), Academic Press, 2s-York (19 1112), pp. 307-329. suitable streptomyces The plasmid of the genus Stretonces is prJ101 (Ke ndall.

K, J, et al., J, Bactriol, 169:4177-4183 (198 7)), and Streptomyces bacteriophages, such as φC31 ( Chater, F., et al., 6th International Conference on the Biology of Actinomycetales. Symposium (Sixth International sys+posiu m-on Actjnoa+ycetales Biology), Akad esiai Kaido, Budapest, Budapest (1986), pp. 45-54), Plasma of Pseudomonas rIi4 (Pseudomonas) Sumid, John, J. F., et al. (Rev, Infe - preferred eukaryotic Plasmids include BPV, cotton cinnabar, SV40.2-micron circle, etc. or derivatives thereof. Such plasmids are commonly used in this field. Known (Botstein, D., et al., Miami Wntr, Sy* p, 19:265-274 (1982): Broach, J. R., et al., Yeast Molecular biology of Satucharomyces: life cycle and genetics (The Molec ular Biol-ogy of the Yeast 5accharo* yces: Ltfe Cycle and Inherita-nce), Co 1d Spring) Labor Laboratory, -s- York Cold Spring Harbor, 5p, 445-470 (1981); Br. oach, 1ogy:A Comprehensive Treatise, Vol, 3, Gene Expressin.

Academic Press, New York, pp. 563-608 (19 80)).

Once a vector or DNA sequence containing one or more constructs is ready for expression. Once prepared, the vector or one or more DNA constructs can be used in a variety of suitable ways. can be introduced into a suitable host cell by any suitable means, wherein Such means include: biochemical means, such as transformation, transfection, conjugation, protoplast fusion, calcium phosphate precipitation, and applications using polycations, e.g. diethylaminoethyl (DEAE) Dextran, and mechanical means such as electroporation, direct microscopy injection, and microprojectile (biodegradation) collision (Joh Nston et al., 5science 240 (4858): 1538 (198 8)) etc.

After introduction of the vector, recipient cells are selected for proliferation of vector-containing cells. The cells are grown in selective media. One mater contains two or more cloned gene sequences. Expression of the sequence can be used for the production of human TPO protein, or for the production of fragments of this protein. bring about. This may occur in the transformed cells themselves or in these cells. This can be done after inducing differentiation.

The expressed protein can be processed under IP standard conditions, e.g. extraction, precipitation, chromatography. separation and purification by methods such as affinity chromatography, electrophoresis, etc. Can be done. For example, cells can be collected by centrifugation or lysed using an appropriate buffer. and protein by column chromatography, e.g. DEAE-Cellulo. ester, phosphocellulose, polyribocytosyl acid-agarose, hydroxyapatase by column chromatography or by electrophoresis or immunoprecipitation. can be separated more easily. Alternatively, human TPO or a functional derivative thereof may be It can be isolated by using human TPO antibodies. Such antibodies are not well known. It can be obtained by the methods described below, some of which will be described later.

Make it hTPo. The term “Antibody J (Ab)” or “monoclonal antibody” (mA b) complete molecules capable of binding antigen as well as fragments thereof (e.g. F ab or F(ab')z fragment). Fab and F( ab')z fragments lack the Fc fragment of the intact antibody and disappear more rapidly from the circulation; and can have less non-specific tissue binding of intact antibodies (Wha I et al., J. Nucl. Med, 24: 316 3251983)).

Antibodies according to the invention can be prepared by any of a variety of methods. example For example, administering cells expressing human TPO protein or a functional derivative thereof to an animal. of serum containing polyclonal antibodies capable of binding human TPO. production can be induced.

In a preferred method, the antibody according to the invention is a mAb.

Such mAbs can be fabricated using hybridoma technology (Ko Kohler et al., Nature 256: 495 (1975); Kohler Cell hybridoma (Monoclonal Ar+tibodtes) and T-Cell Hybridomas), Elsevier, New York, pp. 563-681 (1981)).

Generally, such procedures involve immunizing an animal with a human) TPO antigen.

Lung cells from such animals are extracted and fused with an appropriate myeloma cell line. duty Any suitable myeloma cell line can be used in accordance with the present invention. occurs after fusion Hybridoma cells were selectively maintained in HAT medium, then -ands, J, R, et al. (Gastroenterology 80: 225-232 (1981)) by the limiting dilution culture method.

The hybridoma cells obtained through such selection are then evaluated to Clones that secrete antibodies capable of binding the TPO antigen are identified.

Antibodies according to the invention are also polyclonal or, preferably, regional. It can be a region-specific polyclonal antibody. Region-specific polyclonal anti- Bodies and methods of using them are disclosed in co-pending U.S. application Ser. No. 06/731.470. , filed May 7, 1985 (the disclosure of which is incorporated herein by reference). ing.

Antibodies against human TPO according to the invention can be prepared using standard antibodies known in the art. Well suited for immunodiagnostic assays, where such assays are referred to as immunoassays or Sand-in” assays, e.g. forward sand-in, reverse sand-in and simultaneous sandwich assays. Antibodies can be conveniently determined by those skilled in the art. used in any number of combinations so that it can be determined without the use of extensive experiments. acceptable specificity, sensitivity, and Precision immunoassays can be performed.

Standard reference works describing general principles of immunology include iRo itt, 1. Es5entfal Ima+unology, published to 6th edition Company, Blackwell 5 scientific Publications , Oxford (198B); Ktmball SJ], Introd uction to Ia+muno-1ogy, 3rd edition, publisher, Macai llan Publishing Co., New York (1986); Ro itt, 1. et al., 1ml Iunology, Publisher, GowerMedic al Publishing Ltd, London (1985); Cam pbell, A3, 'Monoclonal Antibody Techn ”, edited by Burdon, R. et al., Laboratory Techn. iques in Biochemistry and Mo1ecular Bi-ology, Vol. 13, Publisher, Elsevier, Amstel Dam (1984); Iein, Jo, Ia+sunology: Th e 5science of 5elf-Nonself Dis-cri+*1 nation, John Publishers, John Wiely & 5ons, New York (1982); and Kennet, R. et al., eds., Monocl. onalAntibodies, Hybrfdoma: A New Dimensional sion in Btological Ana-1yses, Publisher, Pl. enu* Press, New York (1980).

``Detection'' refers to determining the presence or absence of a substance, or is intended to encompass quantifying the amount of. Thus, the term is qualitative meaning the use of the substances, compositions and methods of the invention for quantitative and quantitative determinations. .

Other hybridomas that secrete mAbs of the same specificity as those described here. Separation can be achieved by anti-idiotype screening techniques.

Potocnrjak et al., 5science 215: 1637 (198 2) To put it simply, anti-idiotype (anti-1d) antibodies are antigen-bound antibodies. Antibodies that recognize unique antigenic determinants commonly associated with binding sites. Id antibody is , an animal of the same species and genotype (e.g. mouse strain) as the mAb source. Prepared by immunization with mAb to prepare anti-rd against can be done.

The immunized animals were tested with antibodies against these idiotypic antigenic determinants (anti-1d recognizes the idiotypic antigenic determinants of the immunizing antibody by producing antibodies (antibodies). will understand and respond to it.

Using anti-Id antibodies specific for idiotypic antigenic determinants on a given mAb, by using other B cells or hybrids that share that idiotype. Doma clones can be identified. between the antibody products of the two clones. Idiotypic identity refers to the fact that the antibody products of two clones share the same antigenic epitope. improve your chances of recognizing a group.

Anti-1d antibodies can also be used as "immunogens" to stimulate immune responses in other animals. can be induced to produce so-called anti-anti-Id antibodies. anti-anti- 1d can be epitopically identical to the original mAb that elicits anti-Id. Ru.

Thus, by using antibodies against idiotypic determinants of mAbs, , other clones expressing antibodies of the same specificity can be identified.

Therefore, mAbs raised against hTPo antigens can be used to test appropriate animals, e.g. For example, anti-Id antibodies can be induced in BAL B/c mice. . Lung cells from such immunized animals are used to secrete anti-1dmAb. Anti-1d hybridomas can be produced. Furthermore, anti-1dmAb as a carrier, For example, coupling to keyhole limpet hemocyanin (KLH) and can be used to immunize additional BAL B/c mice. this sera from these mice contained the original mAb specific for the hTPo epitope. will contain an anti-anti-1d antibody with binding properties; thus, the anti-1d mAb will contain possessing their own idiotypic epitopes or Pitopes, such as hTPo, have structurally similar “idiotopes”. Probably.

For replication, cells of the hybridoma of the invention are cultured in vivo or in vitro. can be done. In vivo production of high titer mAbs makes this the preferred production method. It is said that Briefly, cells from individual hybridomas are Brimmed BAL B/c mice were injected intraperitoneally to receive a high concentration of Ascites fluid containing the desired mAb is produced. Isotype IgM or IgG The mAbs were prepared using column chromatography methods well known to those skilled in the art. , such as from ascites fluid or culture supernatant fluid.

The antibodies according to the invention are particularly suitable for use in immunoassays, where the antibodies are It can be used in phase or bound to a solid phase support. Furthermore, this Antibodies in these immunoassays can be detectably labeled in a variety of ways. Ru.

There are many different labels and labeling methods known in the art. Book Examples of the types of labels that can be used in the invention include, but are not limited to: Not limited to: enzymes, radioisotopes, fluorescent compounds, chemiluminescent compounds, living organisms Luminescent compounds and metal chelates. Those skilled in the art will know of other labels suitable for binding to antibodies. or confirm it by using routine experiments. You will be able to do it. Furthermore, the attachment of these labels to antibodies is within the skill of the art. This can be accomplished using known standard techniques.

One way in which an antibody according to the invention can be detectably labeled is to label the antibody with an enzyme. It is to combine with. This enzyme subsequently, upon later exposure to its substrate, For example, chemical constituents that can be detected by spectrophotometric or fluorometric means. will react with the substrate in such a way as to produce a component. Detectably label the antibody Examples of enzymes that can be used to enzyme, staphylococcal nuclease, delta-V-steroid, yeast-loving clone Matography dehydrogenase, alpha glycerophosphate dehydrogenase enzyme, triosephosphate isomerase, biothione-avidin peroxy Dase, horseradish peroxidase, alkaline phosphatase, aspa Laginase, glucose oxidase, beta-galactosidase, ribonuclease ase, urease, catalase, glucose-V■-phosphate dehydrogen enzymes, glucoamylase and acetylcholinesterase.

The presence of a detectably labeled antibody also indicates that the antibody may be labeled with a radioisotope. The radioisotope can then be detected by a gamma counter or The present invention can be measured by means such as a scintillation counter. Particularly useful isotopes for the purpose of! l(, 118■, ko"P,"3%" C, "Cr," C1% "Co," "Co," 5qFe, and 7SSe.

Additionally, by labeling antibodies with fluorescent compounds, detectably labeled antibodies can be can be detected. When a fluorescently labeled antibody is exposed to light of the appropriate wavelength, Its presence can be detected due to the fluorescence of the dye. most commonly used Examples of fluorescently labeled compounds include fluorescein, isothiocyanates, and rhodamines. phycoerythrin, phycocyanin, allophycocyanin, 0-phthalal Dehyde and fluorescein.

Antibodies of the invention may also be used with fluorescently emitting metals such as 1s2Eu or other lanthanides. The sequence can be used to detectably label. These metals are e.g. chelating groups such as diethylenetriaminopentaic acid M (DTPA) or Can be attached to antibody molecules using ethylenediaminetetraacetic acid (EDTA) can.

Antibodies can also be detected by coupling them to chemiluminescent compounds. It can be labeled as such. The presence of the chemiluminescent targeted antibody then indicates that the chemical reaction Determined by detecting the presence of luminescence that occurs during the process. especially useful Examples of chemiluminescent labeling compounds are luminal, isoluminol, theromatic (t heromatic) acridinium ester, imidazole, acridinium salts, oxalate esters, and dioxetanes.

Similarly, bioluminescent compounds can be used to label antibodies according to the invention. Ru. Bioluminescence is a type of chemiluminescence found in biological systems, Here the catalytic protein increases the efficiency of the chemiluminescent reaction. Presence of bioluminescent antibodies presence is determined by detecting the presence of luminescence. Biogenic material important for labeling purposes. Photoactive compounds include luciferin, luciferase and aequorin.

Antibodies of the invention and substantially purified antibodies are ideally suited for the preparation of kits. . Such a kit may include one or more containers, e.g. comprising a carrier means compartmentalized to receive alumina, tubing, etc.; Each container consists of a separate element of the assay to be used.

The types of assays that can be incorporated into kit formats are numerous and, for example, Examples include competitive and non-competitive assays. Using the antibody of the present invention Typical examples of assays that can be used include radioimmunoassay (RIA), enzyme immunoassay, immunoassay (EIA), enzyme-linked immunosorbent assay (ELISA), and immunoassay (EIA), enzyme-linked immunosorbent assay (ELISA), and This is an immunoassay, or sandwich measurement.

The term “immunometric assay” or “sandwich immunoassay” refers to simultaneous Includes immunoassays, forward immunoassays and reverse immunoassays It means to do. Those terms are well understood by those skilled in the art. person skilled in the art It will also be appreciated that antibodies according to the invention are currently known or will become available in the future. Other variations and formats of assays that can be developed will be useful. child These are intended to be included within the scope of this invention.

Forward sandwich assays are described, for example, in U.S. Pat. No. 3,867,517. , U.S. Pat. No. 4,012,294 and U.S. Pat. No. 4.37610. It is. The reverse sandwich assay is described, for example, in U.S. Patent No. 4.098. No. 876 and U.S. Pat. No. 4.376,110.

In a preferred mode of conducting the assay, some type of "blocker" is present in the ink. present in the cultivation medium (usually in which the labeled soluble antibody has been converted). It is very important to. Adding “blockers” to remove non-specific substances present in experimental samples Human antibodies against foreign proteins, proteases, or mouse immunoglobulins is cross-linked with an antibody on a solid support or with a radiolabeled indicator antibody. or destroy it to avoid producing false positive or false negative results. I will do it. Therefore, the selection of "blockers" Substantially adds to the uniqueness of Sei.

The same class or subclass (isotype) used in the assay a certain number of irrelevant (i.e. non-specific) antibodies (e.g. IgG+, IgG+ Gz, , IgM, etc.) can be used as "blockers".

The concentration of the “blocker” (usually 1 to I00t1g/μm) maintains appropriate sensitivity. , and undesirable cross-reactive proteins present in human serum. This is important in order to prevent unwanted interference. In addition, buffers containing “Bronker” The system needs to be optimized. Preferred buffers are weak organic buffers in the physiological pH range. Acids such as imidazole, HEPPS, MOPS.

Based on TES, ADA, ACES, HEPSSP I PES, TRIS, etc. It is something. Less preferred buffers are inorganic buffers, e.g. carbonate, porate or carbonate. Finally, known protease inhibitors should be added to the buffer containing the "blocker" (usually 0.01-10μ g/ml).

There are a number of solid phase immunosorbents that have been used and can be used in the present invention. There are adsorbents. Well-known immunoadsorbents include glass, polystyrene, Including polypropylene, dextran, nylon and other materials, these tubes, beads, and tubes formed from or coated with materials such as This can be in the form of microtiter plates or microtiter plates. immobilized antibody immunized Antibodies are attached to solid-phase immunosorbents by covalent bonding, such as through amide or ester linkages. Co-bound or physically bound, either by technique or by adsorption. can be done. Those skilled in the art will appreciate that numerous other suitable solid phase immunoadsorbents and Do you know how to immobilize antibodies or use one that is no more than routine experimentation? You can use this to confirm it.

For in vivo, in vitro or in situ diagnosis, labels, e.g. radionuclides, are can be attached to antibodies according to the invention directly or by using intermediate functional groups. I can do it. To attach radioisotopes present as metal cations to antibodies An intermediate group often used is diethylenetriaminepentaacetic acid (DTPA). ). Typical examples of metal cations bound in this method are: Yes: “”Tc, 123), ■’IN%”1%?Ju,”Cux”Ga and “Ga.” Antibodies of the invention may also be labeled with non-radioactive isotopes for diagnostic purposes. can be understood. Elements that are particularly useful in this method are IS? Gd, “Mn,’” D)’%” Cr and 56Fe.

The DNA sequence encoding hTPo of the present invention or a fragment thereof can be used as a DNA probe. complementary DNA according to well-known hybridization methods using Sequences can be separated or detected. Next, the human antigen gene is introduced into the host. Human antigens can be obtained by cloning and expressing.

This human antigen is then used in a diagnostic assay for the corresponding autoantibody. can be used.

Antigens of the invention are isolated in substantially pure form using antibodies according to the invention be able to. Thus, one aspect of the invention provides that anti-hTPo antibodies of the invention Provides substantially pure hTPO characterized in that it is recognized and conjugated to provide In other embodiments, the invention provides one or more directed against hTPo. To separate or purify h,TPO by forming a complex with the above antibody. provide a method for

Substantially pure hTPo of the invention can be subsequently applied to a sample, e.g. serum or urine. can be used to detect or measure antibodies against hTPo in . Thus, one UpJ of the present invention contains antibodies against h, TPO contacting a sample with detectably labeled hTPO and detectably labeling the label. Detecting the presence or amount of antibodies against TPO in the sample, consisting of It consists of methods.

As will be appreciated, immunoreactive fractions or immunoreactive analogs of hTPO may also be , can be used. The term "immunoreactive fraction" refers to hTPo antigen demonstrating equivalent recognition by or binding to the antibody intended to mean any part of. The term “immunoreactive analogue J” refers to or differs from hTPo by two or more amino acids, but with equivalent recognition by anti-hTPo antibodies. is intended to mean a protein that demonstrates identification or binding thereof to an antibody.

TPO n・na T Autoimmune diseases are rare (partly due to continuous activation of T cells by self-antigens). This is thought to be caused by (Janeway).

C., Nature 341: 482 (1989)). Like Hashimoto disease In the case of autoimmune thyroiditis, such self-antigens cause B cells to T-cell receptors, or any other enzymes that can help make antibodies Recognized by T cell upstream receptors involved in autoimmune processes by a well-known mechanism of It can be any epitope of TPO that is recognized.

One method of treatment for autoimmune thyroid disease devised by the present inventor is to Concentrates on inhibition of the action of T lymphocytes involved in the process. T cells, for example, from the thyroid gland in the form of infiltrates extracted from thyroidectomy fragments in thyroid disease. easily available. By studying these infiltrates, we can identify specific T cell anti-inflammatory agents. It is now possible to test the original specificities in vivo for their pathogenic significance. Become.

For example, infiltrating T cells (as well as the circulatory system and lymphoid organs such as lymph nodes and lungs) T cells present in the TPO epitope act as T helper (Th) cells and response and can help B cells make specific anti-TPO antibodies . On the other hand, or in addition, such T cells mediate cellular immune responses and can act on skin cells either directly or through local release of cytokines. Ru. This may occur if TPO-specific cytotoxic T cells are activated or destroys thyroid epithelial cells through an inflammatory response mediated by a class of T cells called can bring about

Such T cell activation or inhibition of activity may, on the one hand, lead to the production of anti-TPO antibodies. or, on the other hand, to inhibit the production of thyroid epithelial cell-damaging T cells. will work for you.

Therefore, the first aspect is to bind to the T cell receptor (TCR) of TPO-specific T cells. Provides peptides that can be combined. Such peptides are effective for at least T cells in TPO. (e.g. Example XIrIy) NP-7 epitope), Useful peptides contain a sequence of about 5 or more amino acids derived from TPO; TPO = derivatives of peptides that can bind to specific T cells. Will. Acts as a natural self-anti-competitive antagonist (thereby Butide inhibits the presentation of antigens to T cells or other antigens in the immune system. Specific cell-cell (e.g. T-T or T-B) interaction and anti-TPO Actions necessary for the development of either antibodies or TPO-specific cellular immunity can be inhibited. (Immunity for autoimmune diseases based on such peptides) For consideration of approaches to epidemic treatment, for example: Acha-Orbea, H. et al. nn, Rev. Immunol, 7: 371-405 (1989)); K u-mar, V, et al. (Ann, Rev. Immunol, 7: 657 6 82 (1989)); Urba-guchi, J. L., et al. (Cell 54: 57) 7-592 (1989)); Wraith, D, C, et al. (Eclipse 57: 709-715 (1989)); Wraith, D., C., et al. (Cell 59 :247-255 (1989); Urban, J. L. et al. (Cell 5 9: 257-271 (1989)); and Janeway, C.A. See Nature 34: 482-483 (1989). these (All references herein incorporated by reference).

Another aspect of the invention provides a pharmaceutical preparation comprising a TPO-related peptide as described above. provide In other embodiments of the invention, autoimmune thyroiditis, such as Hashimoto's disease, A method of treatment comprising: binding to and activating or activating TPO-specific T cells; A method is provided comprising administering a pharmaceutical preparation comprising a peptide that interferes with.

Other approaches to peptide-based therapy that are considered within the scope of the invention include: Vaccines comprising TPO-specific T cells (Cohen, IR, Immuno Rev. 1, Rev. 94: 5 2H1986);

l5III+uno1. Ci I: 491-499 (1986); 5cien tific A+ser, 258:52-60 (1988); Ho5p, Pr ac, pp57 64 (February 15, 1989); Cohen, 1. R, et al. , Iswunol, and ± Jiang 9: 332 335 (1988)) and thus Peptides that mimic the TCR of TPO-specific T cells (Vandenbark, A, A, et al. Nature 341:541 544 (1989); Ho we-11, M, D, et al. 5science 246: 668 67H1989 )). Inducing a “counter-autoimmune” state such preparations to prevent or suppress autoimmune responses to TPO by is administered to an individual. Such counter-autoimmunity is due to the T Also mediated by T cells specific for CR (i.e. TPO-specific) (Cohen, supra, Vandenbark et al., supra, and Su n+D, et al. Nature 332: 843 845 (1989); Eu Roj,! ++5unol.

18: 1993-1999 (1988)).

Therefore, the present invention can act as a "vaccine" and counter-self Concerning T cells specific for TPO that can induce an immune state Ru. Other embodiments include such T cell TCR-mimetic peptides. Still other states The symptoms induced by such TPO = specific and cellular CP peptide vaccines counter-autoimmune action or TPO = specific It relates to T cells that mediate cellular regulation. Another aspect of the invention is this T cell vaccines such as TCP peptides, or counter-autoimmune T cells A pharmaceutical preparation comprising: In yet other embodiments of the invention, autoimmune A method of treating thyroiditis, such as Hashimoto's disease, comprising: a TPO-specific T cell vaccine; TCP Peptide Vaccine, or TPO = Specific Specific and Cellular Counter-Automatic Provided are methods comprising the use of a pharmaceutical preparation comprising any of the autoimmune T cells. .

Another aspect of the invention is to specifically interact with anti-TPOB cells or T cells. and T suppressor (Ts) phosphorus, which suppresses anti-TPO immune responses. Regarding baseball. Such suppression may include suppression of TPO-specific antibody production or TPO-specific antibody production. PO-specific T-cell mediated thyroid damage, e.g. mediated by cytotoxic T cells. or inhibition of TPO-specific delayed hypersensitivity responses. Therefore , in certain embodiments, the present invention provides T cells capable of inducing antigen-specific Ts cells. Epitopes of PO and their development of Ts cells and treatment of autoimmune thyroiditis Regarding the use of Another embodiment is TPO-specific Ts in pharmaceutical preparations. . Yet another! ! This is a treatment method for autoimmune thyroiditis, such as Hashimoto disease. , comprising administration of a pharmaceutical preparation comprising a TPO epitope capable of inducing TS cells. Concerning a method consisting of. Another aspect is that TPO=specific that can suppress anti-TPO responsiveness. treatment of autoimmune thyroiditis by administration of a pharmaceutical preparation comprising target Ts cells. Ru.

For details on suppressor cells, see, for example, Green, D., et al., Ann, Re. v, f+muno1. Above: 439 (1983) and Benacerraf , B, The Biolo of Immunoloic Disease , HP Publishing Co., Inc.

See NY, pp. 49-62 (1983).

The present invention utilizes standard techniques well known to those skilled in the art to identify T cell epitopes or TP (see Example Xll below), and further , the present invention provides characterization of autoimmune TCPs specific for TPO, e.g. Using the method detailed in N.S., F., et al., 169:27 (1989), ,enable. If these autoimmune T cells are prevented from reacting with TPO or If it can be prevented, the effects of thyroiditis can be greatly reduced. Let this solidification be achieved The autoimmune TCP-specific T cells for TPO that may be associated with TPO include, for example, A Ann, Rev. fmunol, 7:371. (1989).

The means and methods for carrying out the invention will become clear to those skilled in the art with reference to the following examples. , can be better understood. These examples do not limit the scope of the invention. stomach.

Real 11th retirement Human Grapes cDNA-ibra 1-1 full length cD in the coding direction A thyroid cDNA library was constructed to maximize NA content. hyperplasia (hype-rplastic) Thyroid tissue is removed from thyroidectomy for Graegis disease. Obtained from a patient who underwent excision surgery. mRNA was extracted according to the method of Han et al. (23). isolated. 15 μg as detailed in Gubler and Hoffman (24). Double-stranded cDNA was synthesized from RNA. Notl and Xba I linker-plater Incorporate the imager/adapter into the cDNA and add it to the 5' and 3' ends of this cDNA. (23). This cDNA was analyzed on an agarose gel (Se aplaque, FMC, Rockland, ME) Size by electrophoresis Selected and digested with Notl and XbaI, Notl- and XbaI- Ligate the cut bacteriophage lambda-Zap using T4 DNA ligase. Gated and packaged (Giga-Pak Gold.

Stratagene, San Diego, CA). Obtained phage live The library contained a total of 2X10' recombinant clones before amplification.

1. Screening of human TPO cDNA This amplified cDNA library was distributed in 4×10’pf per 150 m diameter dish. and partially human TPO cDNA clones (clone 19, The probe was performed using an insert derived from Reference 17). 2 types of positive bacteria A phage clone was isolated. Blue containing human TPO cDNA insert Script phagemid (Bluescript phagemid) Helper phage R according to Stratagene's protocol. 408 and was produced from one of these clones. The obtained recombinant The leuscript plasmid (pHTPo-BS) contains the origin of translation and the polyA protein. Contains human thyroid peroxidase cDNA of 5 to 3060 bases including I was reading. The DNA sequence was obtained using the Sequenase kit and its protocol (Unit ed StatesBiochemical, C1leveland, OH). was determined from this double-stranded plasmid using The sequence within this cDNA is human TPO cDNA, 5° and 3' ends, and 10 oligonucleotides distributed in this cDNA. They were identical in the region adjacent to the cleotide primer (17).

1±1 1 of HTPO-ECE Mammalian cell expression vector pECE (25), William + Rutt Obtained from er (U, C, S, F,). The human TPO cDNA is shown in detail in Figure 1. It was cloned into multiple cloning sites of this vector. enzyme Reactions and DNA manipulations were detailed in Maniatis et al. (26). This was carried out recently.

Urasengo ■ Chinese hamster's tone spectrum by HTPO-ECE 1 to the Chinese hamster ovary cell line CH・0-, 10% calf serum, penile Syrin (125 units/ml), streptomycin (l　OOa　g/ra 1) and amphotericin (ataph-otericn)-B (2,5u The cells were maintained in Hams F12 medium supplemented with g/a+1). to Transfection and 'G418 (GIBCO, Grand l5land , NY) was carried out using the method of Chen and Okay-ama (27). Ta. For transfection, 20 Mg pHTO-ECE and 2 μg p SV2n eo (28) (from Drjohn Baxter, Ll, C, S , F) was used.

20Mg pECE and 2ug pSV2-neo, and 20Mg psV2 A control transfection with -neo alone was performed simultaneously.

Tianshi 5M RNA J and Northern Bro... Total cellular RNA was extracted using the method of Chomczynski and Acch (29). Extracted from 15 Mg of RNA was incubated with Holly as detailed in Maniathes et al. (26). Electrophoresis was carried out in a maldehyde gel. Zeta-probe (Zeta-P Produce the RNA onto a membrane (Biorad, Rfchmon-d, CA). and Amer-sham (Arlington F. 4X using the Multi-Prime Labeling Kit from Lights, IL) 0.56 kb human TPO labeled to a specific activity of 1.09 cpm/μg DNA cDNA probe (clone 31 insert, reference 17) and probe Ta.

Su JLf juice■ west plot Infected CHO cells were extracted to obtain soluble proteins. 5 pieces A dish with a diameter of 100 mm was filled with calcium-magnesium-free phosphate buffered saline (P BS) three times. After inhalation, 10 Mg/ml leupeptin, 0. 5mg/i*l of bacitracin and 2mM of fe Nylmethylsulfonyl fluoride (all, Sigma, St. Louis, MO) 0.5% Triton x-io in the above buffer added (from ).

5ml was added to the first dish. Scrape out this first cell solution and add it to the other four cells in turn. The cells were transferred to a dish. The cell solution was then rotated for 1 hour at 4°C. 10 ．． After centrifugation at 000g for 3 minutes, the supernatant was stored and kept at −20°C until use. Stored at °C. Measure the protein content (30) and 50 Mg of protein. Electrophoresed on a 7.5% polyacrylamide SDS gel in quality/lane ( 31). Proteins were prepared in 25 parts Tris, 192mM glycine, 20% Electroblotting apparatus containing ethanol (Hoeffer, San Fr. nitrocellulose membrane (Schleicher and 5ch-uell, Keene, electrotransfer to Nf() (<30v x 5 hours or overnight at 250eA). In twenty experiments, Transfer is Polyplot semi-dry electrotransfer system (A*erfcan Bionetic, Hayward, CA). The manufacturer completed the work according to the specifications. These films were soaked in TBS (0.1 M trichloride). Rinse once in NaCI (pH 8, 0, 0, 15M), then 0.5% chambered in TBS containing Ien 20 (Si-ga+a, St. Louis, MO). Rinse at warm temperature for 30-60 minutes. After three further rinses with TBS-Tween , thyroid microsomes as detailed in Young and Davis (32). Mouse mAb (33) at 1:250 dilution against antigen followed by 1:250 dilution horseradish peroxidase-conjugated goat anti-mouse IgG antibody ( Sigma, St. Louis.

MO) was used to probe this plot.

In subsequent experiments, Dr. S. M. McLachlen (University Polyclonal brush provided by ty of Waies, Cardiff) Probe CHO-HTPO12b cell extraction using a panel of motothyroiditis sera. I forced it. Anti-microsomal antibody titers are determined by the presence of excess amounts of thyroglobulin (11). It was previously determined by enzyme-linked immunosorbent assay (EL!SA) shown below.

Multiple Hashimoto's thyroiditis sera were added to the Miniblock-45 manifold (Immunet). ics, Cambridge, Mass) overnight at 4°C. It passed through the filter. This membrane was then treated as described above, except that Cali phosphatase conjugated goat anti-human IgG (to Fc fragment) Specificity) (Cappel.

Qrganon Teknika Corp, dest Chester, P A) as the second antibody, 100mM Tris, pH 9,5, 1100III N aCl, nitro blue tetrazolium (0.3 mg/1 in 5 mM MaCl) i1) and 5-bromo-4-chloro-3-indolyl-phosphate (0,15 mg/ml).

Su11 juice■ Self--FAC3 CHO-HTPO12b cells were processed as detailed in Ellis et al. (34). Ta. Briefly, cells from a 100 m diameter dish were treated with mild trypsin. and the cells were incubated with Hams F12 medium, 10% calf serum (see above). ) and pelletized (5 minutes at 4°C 1100X). child cells in phosphate buffered saline (PBS), 101 Hepes, pH 7.4.0, The suspension was resuspended in 0.2 ml of 0.05% sodium azide (buffer A). Must be tested serum (2 μl) was added for 30 min at 4°C, followed by 2% calf serum. Rinse twice in the same buffer and resuspend in 0.2 ml of the same buffer. Ta. Fc-specific, affinity-purified, R-phycoerythrin (Caltag, 5outh San Francisco-Co, CA) labeled 25 μm goat anti- - Human IgG was added for an additional 30 minutes at 4°C. After washing three times with buffer A, this of cells were analyzed in a fluorescence-activated cell sorter.

Cell microlysis with trypsin and deoxycholic acid as previously detailed (35) Human TPO activity was assayed after extraction from the genome. In subsequent experiments, A faster method was used. Dulbecco's cells without calcium-magnesium additives Suspended with a rubber scraping rod in 1.5 liters of phosphate buffered saline and 5 Proteins were assayed in μl aliquots. The cells were then incubated for 2 minutes. and pelletized in a microcentrifuge. Chilled 0.1% deoxyco Polymeric acid (0.2 ml/*g cell protein) was added over a period of 10 minutes. This lottery The output was microcentrifuged for 5 minutes and the supernatant was removed for assay. . 1 guaiacol unit at 1.0 -A4 per minute 70, which means that 15 Onwol of guaiacol is oxidized per minute. This corresponds to (36). 1 unit of iodinated peroxidase per minute It is defined as -A353 of 1.0, which means that 13- of 43r++sol per minute. This corresponds to being formed (37).

1 serving 1 Voice of Human Grapes human Grapes' disease thyroid tissue was dispersed, and these cells were previously described in detail. The cells were cultured as described (38). After 3 days of culture, use the above for Western blotting. 12.5 mV/ml for an additional 3 days before assembling and extracting cells as per instructions. Fresh medium containing TSH was added.

1 donation, [ - MSA - for ELTSA about TPO, as hTPo and Microsome comparison Sera from 51 individuals were collected by Dr. S. M. McLachlan (University). ty of Waies CoCo11e of Medicine, Cardi Provided by ff, U, ).

47 of these sera were derived from patients with autoimmune thyroid disease and had low represents a balanced spectrum of anti-MSA titers ranging from low to very high. I chose to do so. Anti-MSA and anti-TGA antibodies were each from 5chardt et al. method (49) and the method of Endo et al. (50) and the method of McLachlan et al. It was measured by a method (51) that was further improved. Gray for anti-MSA assay Human thyroid tissue was created from frozen thyroid tissue obtained during surgery for the treatment of GI disease. Rosome? I prepared $49. All that is left in this microsomal product is To avoid cross-reactivity between thyroglobulin and patient serum, serum was diluted to 100 μg/m l (1,5×10-”M) of thyroglobulin (obtained from the same tissue). buffer at 4°C overnight, then at room temperature for 2 hours before assaying. It was prepared and adsorbed (49).

Chinese hamster ovary (CHO) cells C' expressing enzymatically active human TPO The production of yo-7CHO-HTPO12b) has been previously described. these cells was created by inserting the full-length human TPO cDNA into the expression vector pECE. The cells were infected with the recombinant plasmid pHTPO-ECE. CHO-HT POl 2b and CHO-Kl (near 7)0-le, non-angry staining) cells were added to 10 0 g/L calf serum (FBS), penicillin (125 units/a11), Tamycin (48 Mg/sl) and amphotericin-B (2.5 μg/ml) ) was grown in Ham's F-12 medium. 100-cells The cells were grown to confluence in a dish and treated with Dulbecco's calcium magnet. Rinse three times with phosphate buffered saline (PBS), then add 10mM trichloride. Sucrose, pH 7°41.0.25M sucrose, 2mM phenylmethylsulfonate lufluoride, 10 Mg/ml leupeptin, 0.5 mg/I11 Bacitra scraped into a solution containing syn (buffer A). Cells with polytron for 20 seconds Homogenize, centrifuge at 100,000 g for 15 minutes at 4'C, and The supernatant was centrifuged at 100.000 g for 1 hour at 4°C. This microsomal base Resuspend the pellet in 0.5 ml of buffer A and incubate in Dounce homogenizer. Homogenized in an icer and then frozen at -80°C until use. protein The content was determined by the Bradforcl method (30). microsomal tan The yield of protein was approximately 100-200 gg per 100 plates of confluent cells.

The serum to be tested is stored in small aliquots at -80°C before use. This assay The process was a slight modification of the method of 5chardt et al. (49). Maru Chiwell Micro-ELISA plate (Dynatech Labs, Cha (VA) in coating buffer (0.05M sodium bicarbonate, pH 9). , 4 μg CHO-HT per well in 3,0,02% sodium azide). coated with PO12b or CHO-Kl microsomal proteins (at 4°C). (overnight). This well was then treated with 0°2M Tris, pi (7, 4, 0, 15M) twice in NaC1 (Lis buffer), 0.2 M Tris, pH 7,4,0, 15M NaCl, 0.05% Tween 20 (Tris-Tween buffer) Rinsed once in Tris buffer and twice in Tris buffer. 100μ in each well m PBS, 50 g/L bovine serum albumin (BSA) (Sigma, St. , Loujs, MO) and allowed to incubate for 20 minutes at room temperature.

After aspiration, the dish was washed twice with Tris buffer and once with Tris-Tween buffer. and washed once with Tris buffer.

Serum samples were added to PBS, 5 g/L BSA 1/100.1/1000 or 1 /10,000. Deposit 100 μl of this diluted serum sample per well. Added in duplicate and incubated for 1 hour at 37°C.

The next well was washed three times with PBS. 100μI peroxidase conjugated, affinity purified, goat anti-human IgG, Fc fragment Specific antibodies (Cappel.

Organo Teknika Corp, Jest Chester, PA) And PBS.

A dilution of 11500 in 250 g/L FBS was added to each well and 3 It was incubated at 7°C for 1 hour.

The wells were then washed four times with Tris-Tween buffer. 10 in each well 0μI of substrate solution (12a+1 0.23M citric acid, 0.26M sodium phosphate) Lium pH 5.0 solution + 12uL of 30% H20z + 4.2mg of ortho- phenylenediamine) was added and allowed to incubate for 30 minutes at room temperature.

The reaction was stopped by adding 100 μl of 20% sulfuric acid to each well. . EL I SAO value (OD490 nm) to micro-ELISA reader were measured and normalized (blanked) to wells containing no antigen.

Sl[L Human TPO cDNA oligonucleotide・゛　6A, Method Phagemid Blue Script (Stratagene, San Diego .

oligonucleotide-specific modification of the non-coding strand of human TPO cDNA in CA). It was used as a template for different induction. Molecular Energy Core Facility Molecular Gene-ttcs Core Facility ), San Francisco Veterans Affairs Medical Center Veterans’ Administration Medica, ICe 52bp mutant primer synthesized by (5'-AGG CTCCCTCGGGTGACTTGAATTCCCATGTAGCTGGCT GCTCTGCTGATCG-3') is a putative membrane-spar of this protein. It is designed to create two stop codons immediately upstream of the coding region. subordinate Therefore, TGA, TA, and G codons are respectively human TPOC DNA (17) 2629-2631. bp and 2641-2643bp. good For screening of favorable mutations, the E c o R, r restriction site (2630- GAATTC) of 2653 bp was created along with this first stop (TGA) codon. Got it. This mutagenesis method is used to create the plasmid pHTPo (Ml)-BS. Its manufacturer's protocol (Muta-gene phagemid in vitro mutagenesis) Induction kit, Biorad, R4ct+a+and.

CA).

After confirmation of the mutation by nucleotide screening (52) (Fig. 13), this pHTP cDNA with NotI.

(Ml)-BS was excised by digestion, and the ends were digested with DNA polymerase I. Planted with know fragment and digested with XbaT The cDNA was released. This mutant c DNA (3,05k b) was To make TPO(Ml)-ECE-3V2-DHFR, Blasmi Fp 5V2 -DHFR-ECE-HTPO with wild type human TPO cDNA.

This plasmid was developed by Dr. Willi-ata Rutter (lJniver city of California, San Francisco) and Kano , by Gordon Ringgold (Syntex, Pa1o Alto) Expression vectors pECE (25) and pSV2-dhfr ( 53). Briefly, pSV2-DHFR-ECE-HT PO was digested with 5alI, and the ends were digested with DNA polymerase and hTPOc by digestion with Xbar. It releases DNA. The remaining vector (pSV2-DHFR-EC E) was treated with bacterial alkaline phosphatase, gel purified, and - Quagarose (FMCBioProducts, Rockand ME) and collect it. Mutant hTPO cDNA recovered with G-Plaque agarose ligated into this vector.

Chestnut chestnut Restriction enzymes, T4 DNA ligase and DNA polymerase I, Frenow fragment Bethesda Research Laboratories (Ga. Ithersburg, MD), New England Biolabs (B everly, MA) or Boehringer-Mannheim (Indi apolis, IN).

B. Results and discussion Already generated human thyroid cDNA live in lambda gtll (17) Multiple screening of the library yielded only fragments of TPO cDNA. The new Thyroid gcDNA library in Lambda-Zap were prepared as detailed herein. Plasmid containing full-length human TPO cDNA pHTPo-BS was obtained from this library.

pHTPo-ECE was added to pHTPO-BS and mammals according to the method shown in FIG. from the mammalian expression vector pECE (25) and subsequent cell transection. used for transfection.

Chinese hamster ovary cells to pHPo-ECE and PSV2-neo TP by co-transfection and Northern blot analysis. Twelve clones were tested for the presence of OmRNA. 4 types of pHTPo-E CE transfection cell lines (CHO-HTPO4, CHO-HTPOl, 2, CHO-HTPOl 4 and CHO-HTPOl 7) and one type of control PSV2-neo-transfected cell line (CHO-psV2-ne Total cellular RNA (15 μg/lane) from Northern blot analysis using a TPO cDNA probe was performed. for comparison , prepared from human thyroid gland from a patient with Grages' disease. 1μg polyA+mRN I used A. 28S and 18S liposomal RNA markers and RNA molecules A weight ladder (B, R, L, Gaithersburg, MD) was used for molecular weight determination. It was used for

Four of these clones and one of the four controls (pSV 2-neo alone) clones were cloned using the pHTPO-ECE-transfection vector. A 3°3 kb mRNA band was shown in the lawn. This transfection The size of TPO mRNA in human CHO cells is significantly different from that in Graves' thyroid cells. The reason is probably <pHT The SV40 port at the 3' end of the human TPO cDNA in the PO-ECE plasmid. This may be due to the addition of the Lee-A-encoding region (see Figure 1).

TP using a mouse monoclonal anti-human thyroid microsomal antibody (33). Western profiling of proteins extracted from O-transfected CHO cells. The assay (under reducing conditions) shows that the predicted 1 for human thyroid peroxidase 05-110 kD immunoreactive protein was shown. (12, 39). be concise The pHTPO-ECE-transfected cell line (CHO-HTPO 4, CHO-HTPOl 2, CHO-HTPOl 4, CHO-HTPOl 7 ), co-transfected with pECE and psV2-neo. Troll cell line and transfected with psV2-neo alone. 50 μg of membrane protein from other control cell lines or deoxycholic acid ( DOC) - 30 μg of extracted protein was added to SDS polyacrylamide under reducing conditions. Submit to dog gel electrophoresis. This protein was electroporated onto a nitrocellulose membrane. transfer and then immunization with thyroid microsomal antigens as described herein. (33).

Strong enzyme activity was observed in clone CHOHTPO12 and by limiting dilution. In the subclones CHO-TPO12b and CHO-TPO12g obtained by (Table I).

Weaker enzyme activity was detected in other clones.

TPO activity in CHO-TPO12 clones was determined by TSH stimulation in monolayer culture. Stimulated stimulation - TPO activity in Rebus thyrocytes was almost equivalent (Table I).

This recombinant human TPO, like natural TPO in thyroid cells, is introduced into this gene. to determine whether it is expressed in the surface layer of transfected CHO cells. To assay, CHO-HTPOl 2b cells were subjected to FAC3 analysis (Figure 2 ).

High titer MSA Hashimoto serum (ELISA value 1.772; normal value) of these cells <0.2) (11) incubation of these cells with control blood This resulted in approximately 100 times higher fluorescence intensity than when incubated with supernatant ( Figure 2). Similar results were obtained with three Hashimoto sera. control serum and The size of both cells incubated with Hashimoto serum was the same (Figure 3 E and 3F), this suggests that differences in cell size may to some extent influence the signal. deny the possibility that the difference is important.

Next, a series of Western blot studies were performed on the previously reported Using a panel of Hashimoto serum containing known anti-microsomal antibodies, CHO- This was carried out using a protein derived from TPO12b. Tested under non-reducing conditions All 29 types of Hashimoto serum differ from the 3 types of normal serum in that they have a major broad tongue. It reacted with a Park band and a faint double band of about 110 kD. as a whole, In a study conducted under non-reducing conditions, a total of 36 Hashimoto's sera were tested. However, the six control sera did not react with these bands. deer However, inter-experimental variations in the intensities of these bands and the sameness of large numbers of samples Methodological limitations in time analysis preclude comparison of results for all samples tested. Ru.

Nevertheless, in a single large experiment, the strongest signal was associated with the highest antimicrobial It is clear that the somatic antibody EL I is found in serum with SA values. go Some sera recognized protein bands other than those predicted for TPO. .

These bands correspond to the wild-type CHO antigen (shown below), a 110 kD The obvious TPO=Pb-like signal was also a non-specific wild-type CHO signal.

This will be discussed in more detail below.

Wastewater treatment performed under reducing and non-reducing conditions (using β-mercaptoethanol) Comparison of recombinant TPO signals on tan plots showed that upon reduction . (a) Loss of 200kD broadband; (b) Loss of 110kD signal mutations, so they no longer clearly show double bands; and (C) the characteristic A decrease in the differential signal and therefore some weak sera became negative. Approximately 110k The aforementioned non-immune serum that reacts with band D is not TPO but wild-type CH○ protein. Corresponds to quality.

The specificity of the 200 kD and 100 kD bands discussed above is similar to that of the wild-type non-T In two separate experiments utilizing POl-transfectosigon CHO cells. It will be investigated. In the first experiment, test under the most favorable conditions (i.e., non-reducing). Selected positive Hashimoto sera tested contained 200kD or 100kD proteins. The band didn't respond. The second experiment was carried out in advance by reacting with a 110 kD band. This suggests that the non-immune serum shown is falsely positive. to wild type CHO cells This signal is strong despite the use of unfavorable conditions (i.e. reduction). won.

Serial dilutions of two Hashimoto sera were performed to assess the sensitivity of detecting specific signals. Western blot analysis was performed by. In CHO-TPOl 2b The amount of TPO produced is when these Hashimoto serums are diluted 3000 times or more. It was enough to even detect it.

H) TPO contains 5 glycosylation sites. Therefore, recognized by Hashimoto serum Carbohydrate components are important in the morphology of epitopes in human TPO antigens. I tested it to see if it was there. Tunica, an inhibitor of protein glycosylation Isin (tunicaa+yctn) 0. At 5mg/1ml for 20 hours CHO-TPOl 2 bll [Tan extracted from I cell] pre-cultured Western blot analysis was performed for protein content. I chose this length of time because , the longest period of handling without obvious signs of cytotoxicity (i.e., reduction in cell number) This is because it is the time when you can do it. Tunicamycin treatment has a significant effect on antigen recognition. therefore, carbohydrate components are important components of microsomal antigen epitopes. Suggests that the scales may not be minute. In a control experiment, IIN( Tunicamycin treatment under U conditions induces radiolabeled D-glue into the protein. Reduced the integration of lucosamine to 56.3 ± 4.8% (mean amount SD; n = 3) Ta.

ELrSA performed using antibodies specific for microsomal antigen (MSA) compared with ELISA performed with antibodies specific for recombinant human TPO of the present invention. (Figure 3).

A very good correlation (0,8385249) was obtained. In fact, anti-MSA The underlying ELISA is shown as “out of range” in Figure 3 resulting in false positives. ), these were not seen in the ELISA based on anti-recombinant human) TPO antibodies. It was.

These false positives are due to a nonspecific reaction between anti-thioglobulin antibodies and microsomes. and these appear to be given by the linear regression calculations for Figure 3. was not included.

Support for this idea can be found in FIG. This is shown in Figure 3 However, at high dilution (1/1000) High dilution numbers not shown indicate data points outside the range seen at low dilutions. It can be seen from FIG. 4 that the correlation (0, 9060773) was significantly higher. As a result, <EL> based on anti-MSA It is strongly suggested that the reduced specificity of ISA is in fact a function of antigenic contaminants. do. The problem that reduces assay specificity is that non-recombinant, affinity This problem can be solved by using purified TPO. However, truly pure affini Achieving the production of tea-refined natural TPO is extremely difficult and otherwise ineffective. It has been proven that it is possible. These problems can be solved by using the recombinant human TPO antibody of the present invention. This can be avoided by using the original.

To further test this specificity, as the source of antigen in the ELISA step, Reconstituted human TPO was compared with Graves' thyroid microsomes. This recombinant hTP o is present in microsomes prepared from non-thyroid, non-human eukaryotic cell lines and therefore h It cannot contain thyroid-specific antigens other than TPo.

Nevertheless, serum from patients with autoimmune thyroiditis is highly sensitive to a vast array of antigens. Some of them contain antibodies against Chinese hamster Usui (CHO). cells (48), each serum sample was combined with a control non-sensitized sample. Microsomes prepared from stained CH○ cells are also assayed.

Standard (1/10 0)! A moderately good correlation was obtained in the comparison of 51 types of sera (r= o, 668; p<0.001) (Figure, 10A). However, it is clear how many There was a value that was far off. In particular, two sera (sera #11 and 27, Figure 10. A, large circles and squares, respectively) and very Those that were positive were similar to the four normal sera in the anti-hTPo antibody assay. (Figure 10.A, four data points in the quadrilateral near the origin) to). Several other sera, primarily in the higher range of activity, also have higher levels of activity than recombinant hTPo. A clearly higher value was also shown by the thyroid microsome preparation (FIG. 1OA).

At the same serum dilution, a lower correlation exists between thyroglobulin and recombinant hT as antigens. found between the values obtained by Po (r=0.315; pro, 05).

In autoimmune serum containing antibodies against multiple antigens, the different antibodies They tend to have different affinities for their antigens. Serial dilutions of serum antibodies - Different ELISA value profiles based on the affinity of each antigen interaction will bring about. In thyroid microsomal preparations, TPO is the main is an autoantigen, this allows the same serum dilution curve to be applied to thyroid microsomes and should be seen in assays using recombinant TPO. In support of this hypothesis thyroid microsomes at a serum dilution of 1/1000 or 1/10.000. The correlation in EL I SA values between and human TPO was higher (r = 0.906 and 0,902; p<0.001) (Figures 10B and 10C), thyroid Two types of microsomes are strongly positive, but recombinant hTPo antigen is not positive. sera were surprisingly no longer clearly different between these two assays. (FIGS. 10B and 10C). The dilution curves for these two sera are anti-MSA. and anti-hTPO antibody assays (Figures 11A and 11B), We demonstrate that these sera react with antigens other than hTPo with low affinity. . These two sera have surprisingly high levels of anti-thyroglobulin antibodies. It is also distinguished by On the other hand, other sera with similar anti-MSA levels ( 1/100 serum dilution) resulted in normal dilution curves in both assays. (Serum #12 and 2 days, Figures 11A and IIB) The anti-hTPo antibody ELrSA data of To compensate for the possible interference, TCHO-HTPO microsomes and C Also shown is the difference between the values obtained using HO-Kl microsomes.

The thyroid microsoparator using these calibration data for each of the three serum dilution rates No significant changes were observed in the correlation between the sample and recombinant hTPo assays.

Anti-CHO for 47 sera from patients with autoimmune thyroid disease tested -1 antibody EL I SA value is standard dilution <1/1. OO) Nite 0. It was 164±0.0663D (SD above the mean).

The accuracy of the anti-hTPo antibody ELISA is due to its representativeness of the spectrum of autoantibody capabilities. The evaluation was performed using three types of serum selected from the following.

Interassay deviation at standard serum dilution (1/100) expressed as mean ± SD (10 times for each serum) (Figure 12) is 0°346 ± 0.18 (low potency serum), 0.599±0.44 (medium potency serum) and 0.923±0.94 (high potency serum) Met. The coefficient of variation (CV) for these three sera was 5.12% each. , 7.39% and 10.2%. Interassay CV (7 times for each serum) ) were 5.36%, 7.63% and 7.29%, respectively.

In another embodiment of the invention, human TPO is expressed in CHO cells using different plasmids. Surprisingly, we found that it was possible to significantly increase the . dihydrofolate reductase (DHFR) - Create a TPO construct, in which both genes (DHFR and TPO) are SV4 0 promoter (Figure 4). CHO cells infected by these structures Screening of pHTPO-DHFR-2B and pf(TPO-DHFR-2B) Two plasmids named R-4C, pECE-HTPO plasmid We present a plasmid that immediately expresses three times as much antigen as that obtained using provided.

pECE-HTPO, pHTPo-DHFR-2B and PHTPO-DHFR- Relative TPO found in CHO cells transfected with 4C Activity is shown plotted against methotrexate in Figure 5. Furthermore, p One particular subclone, designated DHFR-TPO-4C-MTX, relatively large amounts of TP than either structure (unless they are isolated) It was found that O was expressed.

Figure 5. pHTP with increasing methotrexate concentration.

-DHFR-2B and pHTPo-DHFR-4C plasmids CHO expression reaches a plateau. No connection to any particular theory. However, one possible explanation for this observation is that the expressed full-length T The PO gene is toxic to host CHO cells and at high methotrexate concentrations T The purpose is to provide selection for DHFR rather than PO.

The full-length TPO gene is membrane-bound, so if the expressed protein If it somehow dissociates from this membrane, it increases the production of TPO in CHO cells. The inventor hypothesized that this could be possible. Therefore, from this gene secretion of human TPO by identifying and deleting transmembrane sequences of We conducted an experiment to make a mold.

Premature termination in the synthesis of hTPo n) changes the size of the hTPo-Ml protein from 933 to 848 amino acids. It is thought to be made smaller. Original full-length human TPO in Bluescript The cDNA clone (pHTPO-BS) was converted into plasmid pHTPo (Ml) - subjected to site-directed mutagenesis to create BS. Single-stranded DN A template is made 52-mer oligonucleotide probe labeled for mutagenesis was used. This mutagenesis is performed from the transmembrane region of the human TPO gene. Two stop codons and a confirmation EcoR1 site were incorporated into the upstream region. (Figure 6). The entire full-length TPO gene is shown in FIG. 7 for comparison.

As a result of the mutation, a “short” protein is secreted by the host cell rather than membrane bound. TPO protein was expressed. This mutant hTPo gene is Cleno was excised from pHTPo(ML)-BS using tl and Xba1. uborimerase) and the expression plasmid pHTPo pECE-3V2 to create (Ml)-ECE-3V2-DHFR (Figure 8) - It was inserted into the relevant site of DHFR. CHO cells dyed with plasmid The cells apparently produced a truncated human TPO protein. This protein is It is believed that it retains the antigenic properties of the full-length protein and therefore constitutes the aspect of Plasmid pHTP○(Ml)-ECE-3V2-DHFR The structure of is summarized in FIG.

Plasmid pHTP containing mutant hTPO cDNA.

Stable transfection of CHO cells with (Ml)-ECE-3V2-DHFR After lysis, individual colonies of cells (CHO-TPO-Ml) were cultured for TPO expression. (Figure 14).

Since the kinetics of the potentially secreted hTPo-Ml protein is unknown, CH Expression of this protein in O cell lysates was first screened. Toi The reason is that even if the protein is mostly secreted, the specific TPO may not be detectable. This is because certain things are expected. Randomly selected CHO-TPO-Ml clone showed evidence of diverse cellular TPO expression (Figure 14). Has Hashimoto thyroiditis Approximately 105-101 kD DNA was extracted from lysates of these clones by serum from patients who Brett was specifically immunoprecipitated. Transfection with wild type hTPO cDNA In CHO cells, Hashimoto serum has a larger size, i.e. 112-10 5kD doublets were immunoprecipitated and untransfected CHO cells In cells, no doublets were detected (as previously observed (48)). Figure 14A). What are CHO cells transfected with wild type and TPO? (48), those cells were treated with Hashimoto thyroiditis serum and fluorescently labeled evidenced by lack of immunofluorescence when incubated with anti-human IgG antibody. As shown, immunoreactive TPO is present on the cell surface of CHO-TPO-Ml cells. It was lacking.

To determine whether the mutant hTPo-Ml is a secreted protein, h Pulse-chase biosynthesis and processing of both TPo-Ml and wild-type hTPo This was investigated in an experiment. First, the clone with the highest expression of truncated TPO CHO-TPO-Ml-K (Figure 14A) was subcloned by limiting dilution. and one cell line (CHO-TPO-Ml-Kl) for further studies. (Fig. 14B), radiolabeled hTPo-M over a 24-hour follow-up period. 1 protein is secreted from the cells into the medium and determined by immunoprecipitation with No. 1 Shimoto serum. detected (Figure 15). This secreted protein is present in the medium after a 4-hour chase. , the levels accumulated progressively over 24 hours. Interestingly, secreted The immunoprecipitable hTPo-Ml protein, compared to its cell-associated form, Appears on polyacrylamide gels as a single band with smaller electrophoretic mobility do. In contrast, CHO cells expressing wild-type hTPo have no detectable No immunoprecipitable substances were secreted. Cell-associated hTPo and hTPo-M l proteins are similarly stable, and their radiolabeled immunoprecipitates remain stable for 0 to 4 hours. increased during tracking.

Radiolabeled immunoprecipitable wild-type hTPo protein at 24-hour chase. The amount of tissue was similar to baseline (0 hours). CHO-TPO-Ml- The decrease in signal observed between 4 and 24 hours in Kl cell lysates is due to their occurs in parallel with an increase in signal in the cell's medium. This therefore means that the present invention Supports the concept of secreted proteins comprising separate embodiments.

Immunoprecipitable substances released into the medium by CHO-TPO-Ml-Kl cells are Conditioned media were tested for TPO enzymatic activity to verify that TPO is actually TPO. I tried it. The medium from CHO cells expressing mutant hTPO contains TPO activity (1 , 0 guaiacol units/10-medium) was clearly present (FIG. 16). in contrast , previously described (48) strong TPO activity present in the lysates of those cells. Nevertheless, no detectable There was no appreciable enzymatic activity (Figure 16).

boiled Human thyroid cells 4.7 3.0 4, 5 3.4 Implementation Graves' TPO1 T-line utilizes the availability of recombinant TPO Then, the in vivo self-selection of T cells specific for this self-antigen released into the thyroid gland population was performed. I watched the outbreak 8 times.

A. Decision As previously described (Londei, M. et al., 5cie L and non- Due to the detachment of adherent cells, patients with persistently recurrent Greges disease and high titer Thyroidectomy of a 26-year-old woman with antithyroid microsomal antibodies (1:640) Outgoing specimen (CX81: HLA-A1.2; B8,37; DR3, DRw52 Infiltrating mononuclear cells were extracted from DQw2). Activated cells are RPM Recombinant IL-2 (Aj　inomo　to- 20ng/w+1) and 1 week of growth in 10% human serum. I let it grow.

Irradiated autologous peripheral blood lymphocytes as supporting cells, 0KT3 monoclonal anti- Cells were non-specifically expanded for an additional 2 weeks by adding IL-2 (30 ng/d) and IL-2. After expansion, 0KT3/IL-2 and DR-matched antigen-presenting cells (APCs) Cloning was performed by limiting dilution (0.5 cells/well). Update all clones proliferation and maintenance of 0KT3/IL-2 and HLA-mismatched irradiated supporting cells. This was done by restimulation every 1 to 2 weeks. The end of the nutrient supply cycle and it Cells were assayed a minimum of 5 days after their last IL-2 exposure.

Proliferation assays were performed over three days in three identical microtiter plates. . 200μ! irradiated autologous T cells in 10% human serum. PBL (2-5×10′) from the following sources was added. 1 μl of raw microsomes (tan A protein concentration of 5 mg/d) was added to each well. During the last six hours of Anse After adding 1 μCi of [3H1 thymidine, cells were filtered through a glass fiber filter. was obtained and scintillation counted.

Sea d! The powder purified by gradient centrifugation (Lymphoprep-Nycomed) Peripheral blood mononuclear cells were cultured in microtiter wells containing 200 μ2 of 10% human serum. 10S111 cells were incubated per well. In the same way as above, 1~ 2 μl of control or TPO microsomes were added per well. 5 to 5 cultures incubate for 6 days and with [ffH]thymidine for the last 6-18 hours. After short-term labeling, cells were harvested and scintillation counted.

Expression Hector p using the complete human TPO cDNA cloned into ECE Transfection of CHO cells and transfected cells and Preparation of cellular microsomes from transfected and untransfected cells is as described above. It was as expected.

B. Enguo In vivo activated thyroid-infiltrating TtiB cells were selected by growth in recombinant IL-2. Ta. The resulting population was then treated with anti-CIB3 antibody (OKT) in combination with IL-2. 3) caused further proliferation in a non-specific manner. The system induced in this way is Consistently, against autologous thyroid epithelial cells without the addition of antigen-presenting cells (APCs) showed a remarkable response. For example, when measured as the incorporation of radiolabeled thymidine, , the following levels of T cell stimulation were observed: T cells: 51±3 cpm; Thyroid epithelial cells (TEC): 62 ± 8 cpm; T cells + TEC: 6108 ± 11 040cp.

T cells can be isolated by plating this system at limiting dilution (0.5 cells/well). Loans were obtained and then further expanded using IL-2 and 0KT3. instructor As a result, antigen-specific selection before screening of clones was avoided.

The complete sequence of the human)-TPO cDNA was transformed into a mammalian expressed H. p. Cloned into ECE and Chinese Hamster Ovary (CHO) cells was transfected. Those transfected cells have high levels of expresses immunoreactive and enzymatically active TPO. transfected Microsomes prepared from CHO cells contained 24 clones derived from the intrathyroidal population. was found to induce significant proliferation of 5 of the clones (Fig. 17A). So These cells showed no response to untransfected CHO microsomes. It didn't show at all.

In contrast, peripheral blood T-cells from the same individual, another patient with Graes' disease, or a normal control. Cells (PBL) were divided into transfected and untransfected preparations. (Figure 17B). For proteins derived from CHO cells PBL reactivity is similar to that described in other xenogeneic cell extracts [ Van Vliat, E., et al., Euro, J., Iwnunol.

19: 213-216 (1989)], so this is not surprising. However However, until now, CHO Miku cells have not been transfected with thyroid-derived T cells. Since no response to the losome was observed (Figure 17A and Table ■), This demonstrates differences in the antigen repertoire between thyroid infiltrating cells and peripheral blood T cells. .

Table■ Table■ Table■ As shown in the sub-table ■, two types of T cells Motif operation method (Rothbard, J.B., Ann, In5t, Pa5te ur 137E: 518-526 (1986); Delisis, C, et al. Proc, Natl, Acad, Sci, USA 82: 7048-705 2 (1985)). 10 types of synthetic peps based on TPO sequence Clones were further screened using a panel of TiDs. TPO microsome Two clones (C43 and cIO5) show only a small response to ( Table ■) is for the peptide (NP-7) corresponding to residues 535-551 of TPO. showed a specific response (Tables ■ and ■). The entire TPO microsomal preparation contains no Two additional clones (C75 and C104) that were responsive to NP-7 showed a significant response. In contrast, highly reactive towards TPO microsomes Five clones (C25, C39, C65, C69°C103) are NP- 7 did not respond (Table ■).

No response to NP-7 was observed in the patient's peripheral blood T cells (PBL Only = 609 ± 190 cpm; PBL + NP-7 (10u g/d) = 302 ±38 cpm).

C0 consideration Deficiency in recognition of NP-7 by TPO-responsive clones is quite distinct from NP-7 Suggests the existence of additional T cell epitopes on TPO. TPO arrangement (NP-7) Although epitope-specific antibodies are frequently present in thyroid infiltrates, , has little or no response to total TPO presented by peripheral blood-derived APCs. This finding is noteworthy.

These results indicate that a significant proportion of activated T cells infiltrating the target tissue The most important feature in human organ-specific autoimmunity is the recognition of specific antigenic proteins. Provides the first clear evidence. This is the collagen in the joints in rheumatoid arthritis. Consistent with the discovery of type-specific T cells (Londei, M. et al., Proc.

Natl Acad, Sci, USA 86: 636-640 (1985) ), their results indicate that the T cell epitope site in TPO (residues 535-551) and at least two distinct epitopes on a single target molecule in the same individual. It also provides evidence that it exists. Such information can be obtained from appropriate peptides as described above. of great importance for the design of immunotherapy-based immunotherapies.

1 boat ± 1 TPO B epitope ・ Human TPO recognized by antibodies in serum of patients with autoimmune thyroid disease to the native TPO to precisely define the epitope at the amino acid level. A panel of mAbs raised against was studied. TP of some of those mAbs Since the binding to O was inhibited by the patient's serum, Determination of TPO epitopes indirectly limits disease-associated epitopes. right.

Using this panel of 13 mAbs, we isolated 200-50% of TPO cDNA. Lambda-Zap mill library created to contain only 0bp arbitrary fragments Cleaned.

When expressed as a bacterial fusion protein, 1/6 of a 3.8X106 cDNA fragment will express any 66-166 amino acid fragment of TPO.

For screening, peroxidase-conjugated goat anti-mouse immunoglobulin anti- The binding of mouse anti-T P OmA b (1:40 dilution) was detected using a 1:40 dilution.

A positive plaque was detected by only one of the 13 mAbs tested (mAb-47). Ku was exposed. Although mAb-47 bound TPO with high affinity, the TPO enzyme Did not interfere with activity. Human anti-TPO autoantibodies were tested at a dilution of 1:20. Ab-47 binding was strongly inhibited.

Nucleotide sequences of seven arbitrary selected clones recognized by mAb-47 Decided on the row. All clones overlap in the 2180-2171 bp region. It spanned the same region of the TPO cDNA. This region is the TPO protein It encodes 30 amino acids (positions 698-728) within.

Anti-TPO mAb-47 was one of the 13 mAbs tested because it It is unique in that it recognizes continuous epitopes. Other mAbs are probably Recognizes discontinuous epitopes. mAb-47 to TPO and natural anti-TPO anti Competitive binding of the body limits mAb-47 to natural disease-associated TPO epitopes suggests that.

Further clarifying the molecular and cellular basis of the pathogenesis of autoimmune thyroid disease Therefore, the site on TPO recognized by anti-TPO antibodies in patients with Hashimoto's thyroiditis ( It will be very important to identify the epitope. For investigating this issue: The previous approach was to use immunological probes (polyclonal or monoclonal anti- -TPO antiserum) (55,56-60) and limited proteolytic digestion (61) includes the use of

By those means, several distinct antibody binding regions are present in the TPO. I understand.

However, TPO is a very large antigen (approximately 107 kD), and these techniques The technique was unable to define the precise epitope involved. Therefore, the inventors Using serum from patients with Shimoto's thyroiditis, we detected a large number of hTPO cDNA fragments. Lambatteri phage (lambda-Zap) human thyroid cDNA expression library was screened.

The fragments are each 200-500 bp long and contain 66-166 amino acids. encodes a TPO polypeptide. The complete hTPo protein is 933 amino acids Consists of. β-galactosidar in which the protein is bound to a thyroid protein component These TPO polypeptide fragments are hybrids of 10 kD fragments of is expressed as a so-called bacterial fusion protein.

dish TPO cDNA - Ibouly's +1 = human thyroid peroxidase mentioned above The full-length (3,05 kb) cDNA clone was incubated with EcoRI (BRL La boratories, Gaithersburg, MO) and Notl (B oehringer Mannheim, West Gers+any) Bluescript vector (Stratagene, San Di ego, CA,). Because the vector and insert are of similar length. Please add Bluescript to Scar (New England Biol). abs, Beverly, MA). Agarose gel electrophoresis and electrolysis TPO cDNA was purified by extraction. Then, the cDNA was transformed into 20a+MTri s-HCI, pH 7,5,1,5n+M MnC1= and 100 μg/d DNase I (0,1 ng DNase/u g c DN A) (B RL) into small fragments of arbitrary size (6 minutes at room temperature). 2 %5eaP1aque agarose (FMCBio Products, Roc TPOcD of length 200-500 bp after electrophoresis in Kland, ME, ). NA fragments were collected by electroelution. Both ends of the fragment were treated with DNA polymerase blunt-ended using Renow fragment and unphosphorylated EcoRI attachment ・EcoRr linker (GAATTCG) containing an end and a phosphorylated blunt end GCACGAG) (PharIIacia, Ptsca-taway, N J). 2% 5eaP after phosphorylation with polynucleotide kinase Excess linker was removed by electrophoresis in laque agarose. linker - size-select the ligated cDNA (200-500bp) and electroelute it. Lambda-Zap mill vector, ethanol precipitated, and EcoRI cut It was ligated into Stragene). Packaging (Giga- Pak Gold, Stratagene), then convert the library to XLI-bl- amplified in ue cells (Stratagene). Bluescript Polymerase chain reaction (PCR) (62 ) was used to confirm the size of the cDNA insert. TPO cDNA fragment library The “C2” hTPO cDNA region (55, 56) 17) PCR analysis Two oligonucleotides spanning 1852-2112 bp of the (7)fii region in Po 22-mer primers (5-GGTTACAATGAGTGGAGGGGAGT and and 5'-GTGGCTGTTCTCCCACCAAAAAC) ( 17). PCR (30 cycles) at 94"C for 1 min, 55"C for 2 min and 7 The temperature was 2°C for 1 minute. PCR generation to screen the library Random primer method (Muttipri-1ae; Amer sham, 8rlington Heights, IL) and 3zP- Labeled with αcTP to a specific radioactivity of 0.8XIO” cpm/ugDNA. The cleaning procedure used standard techniques (26). However, O, lX5SC, 1%5D SII buffer solution (1xSSC = 150111M NaCl 1,15a + M Na citrate A final wash (2 times) of 30 minutes at 55°C in pH 7.5) was performed. Nito Autoradiography of cellulose filters was performed using Kodak XAR-5 filters. I went there using Irum.

Screening of TPO sublibrary: Approximately 3 per 150 veterinary dishes X1. Containing TPO cDNA fragment plated on E. coli Y1090 with O’pfu Lambda-Zap mill library Scree as previously described (20) I did a ning. Briefly, after 3.5 Vf at 37°C, 101 isopropyl Nitrocellulose fiber soaked in O-β-D-galactopyranoside (PTG) The filter was incubated at 37°C for 3.5 hours. Take out the filter and use 0.05 TBS buffer (10mM Tris-HCI) containing %Tween.

pH 7,5, in 150mM NaCl) and 2% carnesian milk. Incubate for 15 minutes at room temperature in TBS/Tween containing washed with en and then incubated with antibodies overnight at 4°C. immunochemical Mouse monoclonal against thyroid microsomal antigen for screening Antibody (420,10) (33) was used at a 1:200 dilution. monochrome Because of the strong signal and very low background achieved using natural antibodies, pre-screening with bacterial proteins as previously described (20). Preliminary adsorption was not necessary. Antiserum from 13 patients with Hashimoto thyroiditis at 1:20 It was used under various different conditions at a dilution of 0. lambda gtll library In contrast to previous experiments screening with Hashimoto serum (7), such Screening of lambda-ZAP libraries in serum requires very small backing. ground and generally reduce this non-specific background. No pre-adsorption was required. When pre-adsorption was performed, Y1090 protein The samples were fixed on nitrocellulose filters. In addition, Chinese hummus Tests using recombinant hTPo expressed on the surface of CHO The affinity-purified anti-TPO antibody produced was also used as an immobilized antigen. (48). In this method, 1 d of serum is combined with 0.05% sodium azide and 1 d of serum. Phosphate buffered salt containing mM phenylmethylsulfonyl fluoride (PMSF) diluted 1:10 with solution (PBS). TPO-CHO cells (approximately 108) were lightly incubated. Resuspend by lipsin digestion and dilute in PBS containing 10% calf serum. Let's make it 1. OOOxg for 5 min) and in diluted antibody for 1 h at 4°C. Resuspend. By pelleting the cells and then washing in water-cold PBS , unbound antibody was removed. After collection by centrifugation (1,000xg for 5 minutes) , 15 in PBS containing 0.05% sodium azide and IIIMPMSF. Cells were resuspended in 0mM acetic acid and incubated for 15 minutes at 4°C. NaO Neutralize the acetic acid by adding H and LM Tris, pH 1.5, and centrifuge (100Q Xg for 5 minutes, then 100. OOOXg for 30 min at 4°C) to precipitate the cells. The precipitate material was removed, leaving the affinity purified antibody in the supernatant. affinity spirit The production efficiency was approximately 50% as determined by ELISA (49).

The method for detecting antibodies bound to the fusion protein was as previously described (20). For the mouse anti-microsomal monoclonal antibody, the following antiserum was used: , affinity purified peroxidase conjugate at a dilution of 1:300. Anti-mouse IgG (heavy and light chain specific) (Cappel, Organon.

11est Chester, PA); Polyclonal human antiserum collection , anti-human) IgG (Fc fragment, T chain specific) (Cappe) at a dilution of 1:300. l), 2, 8 mM 4-chloro-1-naphthol (Si-gr*a, St., Louis, MO) was used to develop color. polyclonal antibody screen The quality of the immunological reagents used in the 8), confirmed by the ability of eukaryotic recombinant hTPO to generate a strong signal. I chewed it. Positive clones were plaque purified to homogeneity. For the screening operation Pairing of potential positive plaques by removing the primary (anti-TPO) antibody at A light screening was performed.

The cloned clone (: Plaque-purified lambda-Zap milfage is Each fusion protein contains a fragment of the TPO cDNA that has been detected by antiserum. A Bluesc-ript plasmid was prepared. This operation is performed by the manufacturer (Str Helper phage R408 was used according to the protocol of Atagene.

XLI-blue bacteria (Strata-gene) using rescue phagemid infected. Plasmids were prepared from individual colonies (26) and Ec The size of the cDNA insert was evaluated by digestion with oRI. Selected plastic Nucleotide sequencing of the Smid cDNA insert was performed using dideoxynucleotide sequences. This was carried out by the termination method (52). Software provided by Bionet Nucleotide sequence analysis was performed using software.

bag fruit Epitope for monochrome peroxidase. autoimmune Defining epitopes for anti-TPO antibodies in patients with thyroid disease An immunological screen for the hTPO cDNA fragment subfamily (63) It was first necessary to determine the effectiveness of the training. To this end, Graves' Cloning thyroid microsomal antigen from thyroid cDNA library (7) A monochrome against thyroid microsomal antigen, which has been previously used successfully to A local antibody (33) was used. Created new TPO cDNA fragment library contains 3.8×10− recombinant clones, 1/6 of this number are valid (correct) size (with orientation and reading frame). Insert size is 200-500b It was confirmed that it was within the range of p.

Screening of this library with anti-microsomal antigen monoclonal antibodies The group was screened i,oo.

6-12 positive plaques were given per plaque. 14 positive clones were selected. Randomly selected TPs for the entire TPO gene for partial nucleotide sequencing. The location of the OcDNA insert is schematically depicted. 12 out of 14 clones It had a cDNA insertion fragment of 60-350 bp. Maximum expected 500b Two clones with cDNA inserts slightly larger than ρ (U and Y ) has a double-stranded cDNA insert, as determined by nucleotide sequencing. I understand. Recognition by monoclonal antibodies is an indicator of the success of this method. All of the 14 clones identified contained the same region (746 -1,150bp) (Figure 18). maximum area common to all clones, Therefore, the common epitope index is bases 881-927 (AA AACCCA TGT TTT CCCAT CAA CTCCCG GAG GAG GC CCGG CCGGCC), with a deduced amino acid sequence of only 15 residues (Asn Pr.

Cys Phe Pro lie Gin Leu Pro Glu Glu Ala　Arg　Pro　Ala). Therefore, the monoclonal antibody The epitope recognized by is within this 15 amino acid range.

Microsomal TPO in disease epitope. The same study using serum from patients with Hashimoto thyroiditis. Approximately 40 rounds of screening of the TPO cDNA fragment subfamily yielded no positive clones. Did not give loan. Variations tried were: 1) expressing a TPO fusion protein; Use of different host bacteria (BB4.XLIblue and YIO90); 2) different Anti-human IgG antibodies or broth A3 from different sources as well as different incubators. and 3) variations in antibody binding detection systems, including the use of reaction times and temperatures; and 3) This included the use of 13 different patient sera with anti-TPO activity. lots of serum i.e. without pre-adsorption of bacteria; after adsorption with bacterial lysates; or with recombinant h Tested after affinity purification with TPo. Internal standards for screening operations and As such, monoclonal antibodies always gave the expected number of positive clones.

Quite surprisingly, the (55,56)86 amino acid C Unable to detect epitopes expressed within the 2hTPo polypeptide fragment. won. The fragment library used may lack the CZjff area. Therefore, PC using oligonucleotide primers complementary to each end of the 02 region C2 by R? The presence of region iI was tested. A fragment of expected size (261bp) Fragments were clearly detected. Furthermore, this PCR-generated fragment is used as a probe to detect the By screening the library, approximately 10% of the It was determined that the plaque contained the C2 sequence.

Those by Hashimoto thyroiditis serum in hTPO cDNA fragment library Because of the negative results of Zap Graves Thyroid Library (Oligo-dT Prime and Random Prime (both of which were tested) were also screened using their sera.

The oligo-dT prime library contains a large number of full-length TPO cDNA copies (3,I kb). This allows for eukaryotic development of such cDNA from phage vectors. subcloned into the current plasmid and eukaryotic Chinese hamster - enzymatically active when stably transfected into Usui cells (48). This was evidenced by the ability to express antigenically intact TPO. Despite this 1 This Lambda-Zap mill library TPO expressed in eukaryotic cells (48) When screened with 13 powerful Hashimoto sera that immunologically react strongly with No foreign signals were detected. In their screening a large number of Strongly reactive plaques were observed, which in the absence of patient serum Even reacted with the secondary antibody (anti-human IgG). Graves armor in lambda gtll Similar results were previously observed in a glandular cDNA library (7). So These clones were found in the B lymphocytes of Gragis' thyroid, for which the library was created. It may mean IgG present in

The potential difficulty of protein expression in full-length cDNA phage libraries A termination codon in the 5'-untranslated region of the cDNA insert It is possible to disrupt the translation of foreign proteins inserted downstream of the galactosidase moiety. That is. Two additional approaches were attempted to eliminate this possibility. No. One is similar to the oligo-dT prime library, but with oligo-dT prime libraries. Generated using random primers rather than primers for first-tX cDNA synthesis Random primed human thyroid cDNA lambda-Zap mill library library -ning. This library is biased toward full-length cDNA copies. Contains cDNA clones that The second approach is Lambda-Zap Milk Row Full-length hTPO cDNA clone in the prepared Bluescript plasmid The aim was to delete the 5'-untranslated region from. This deletion makes this plasmid This was done by digesting with XhoI, thereby reducing the 154 bp of the Bluescript plasmid was released. The complete TPO protein (signal peptide) is in reading frame with the tosidase component. (No) was retained. This novel plasmid construct can be used for fusion protein production and packaging. XLl,-Blue host cells (Stratagen e, San Diego CA). random pla Both the immunolibrary and the Xhol deletion mutant were treated with Hashimoto antiserum or Anti-TPO was affinity purified from their serum using recombinant hTPo. No hTPo protein was produced that could be recognized by antibodies.

Consideration The above data is recognized by antibodies against thyroid autoantigens at a precise molecular level. provides an initial definition of the epitope to be identified. Human thyroglobulin (64,65) or polyclonal or monoclonal to TPO (55,56-61) Previous studies using null antibodies have shown that these antibodies recognize different regions on the antigen. However, the 15 amino acid residues do not fit into any small molecular region. It was not possible to localize the pitope. B cell (antigen recognition) epitope Although the small size is under consideration, it is thought to be on the order of 5 to 10 amino acid residues. (66). Therefore, the total range of 15 residues of the present invention is based on the size of the epitope itself. very close to.

A notable finding in this example is that the anti-microsomal/TPO monoclonal antibody A positive result when using TPO and a natural anti-TPO antibody associated with the disease can recognize the 66-166 amino acid TPO fragment expressed in the library. There is a marked difference between Unlike many linear T cell epitopes , natural B-cell epitopes are more conformational and are also dependent on the secondary structure of the molecule. will be influenced even by the tertiary structure, far away in the linear structure. Close proximity of disulfide bonds and loops in sometimes folded proteins may contribute to the formation of B cell epitopes. This data is based on disease-related This suggests that the epitope for anti-TPO antibodies is highly conformational.

lonely ヱ Ichi no ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni ni no ni ni ni ni ni' s \n 1. The above examples include recombinant human T as a natural membrane-associated enzyme and a truncated secreted protein. Expression of PO (hTPo) will be explained.

In this example, overexpression of the secreted form of recombinant hTPo in eukaryotic cells is described. hTPo gene amplification was performed using mouse dihydrofolate reductase (dh This was achieved using a vector containing the fr) gene. Stably transfected cha Innie's Hamster Usui (CHO) cells were treated with gradually increasing concentrations of methotrexe. The cells were grown in the presence of MTX. TPO expression was determined using an anti-TPO antibody. Immunologically determined by enzyme-linked immunosorbent assay (ELISA) . Attempts to also overexpress the wild-type intermembrane-associated enzyme have rarely yielded favorable results. I didn't. Although some amplification of native hTPo is observed, selection by MTX Prior to the onset of selective restriction, the protein expression observed in some high-producing cell lines It was not possible to achieve expression levels significantly higher than the Fact, 1 Above 100 n MTX, the immunoreactive hTPO content of cells was actually reduced. . In contrast, up to a final MTX concentration of 10,000 nM, the cleaved secreted form of hT A progressive overexpression of Po was observed. Genome from transfected cells Slot-plot analysis of DNA revealed that the dhfr and truncated hTPo genes showed equivalent amplification. High level expression of secreted hTPOO is associated with numerous biological effects. The present invention provides a means for obtaining immunologically active proteins and TPO proteins.

扛粁和墾方五 Plasmids 5V2-DHFR-ec e-hTPo and 5V2-dhfr -ece-hTPo-ml: Sufficient length h in expression vector pECE The TPO cDNA was expressed in the expression vector psV2-dhfr (Kano, Gordon). Supplied by Ringgold, 5ynt-ex, Palo Alto, CA ) was digested with EcoRI, and the ends were digested with DNA polymerase the vector by bacterial alkaline phosphatase. treated with atase. Plant-terminated linear vector and cDN A and recombinant plasmid p5V2-DHFR-ECE-HTPO was formed. hT generated in Bluescript by site-directed mutagenesis P.

The cDNA encoding the secreted form of (hTPo-Ml) was transferred to the plasmid p5V2- In DHFR-ECE-HTPO, the wild type was replaced with TPO cDNA, and p SV2-DHFR-ECE-HTPO-Ml was produced.

5V2-DHFR-ECE-HTPO and SV2-DH to CHOdhfr- FR-ECE-HTPO-Ml for transfectan and methotrexate By: CHOdhfr-cell (CHO-DG44; Kano, RobertSc hinke, 5tanford University, Pa1o Alto, (supplied by CA), 10% fetal bovine serum, penicillin (100 U/d) , gentamicin (40μg/d) and amphotericin B (2゜5μg) The cells were maintained in Harm's F-12 medium supplemented with /d).

Transfection with plasmid DNA (i0 μg) was performed using calcium phosphate. This was carried out by the silica precipitation method (27). Transfected cells were grown as above. thymidine supplemented with dialyzed 10% fetal bovine serum and antibiotics. Selected in guanidine-1 and hyposanthin-free Ham's F-12 medium. I chose. Individual clones are selected by cloning cylinder and high-resolution Two clones (clone CHO-HTPO-2B and and CHO-HTPO-C4C) were subsequently used for amplification. Methotrexe (MTX) was added to this selective cell culture medium at an initial concentration of 3.3oM and Surviving cells were harvested and expanded. Methotrexate concentration, 10. O 3.33x increments until reaching a final concentration of OOnm (100 μM) continuously increased.

ELI Danpachi of CHO-h, T　P　O and CHO-hTPo-Ml: Heteru and MTX-treated CHO-hTPo cells with human serum (Dr. EL I of chlan, Cardiff, Waies, UK) SA was prepared using cellular microsomes as described above to produce 5charts. This method was improved from the method of Fle, (49).

hTPo-Ml protein is secreted into the medium of CHO-hTPO-Ml cells Therefore, 3-day conditioned medium was collected from these cells. The data from these media Proteins were precipitated and processed as described above. ELI of human serum Antigen for SA, 100μ of dialyzed protein precipitate per well! ,vinegar 2x coating buffer (0.1 M sodium bicarbonate, pH 9.3 and 0.0 Approximately 300 ug of protein solution diluted 1:1 in 4% sodium azide) It was passed as One or more ELrSA used for all MTX concentrations Since the values are 11000n used throughout the assay for individual cell types, Reported as an ELISA index referring to MTX values. the same serum to individual cells Diameter of CHOhTPo Ml cells surviving at ELTXjJ degree of type 1° O++o Freeze cells from confluent dishes and replate (100 m dishes) until confluent. Maintain at -80 °C until grown and used for genomic DNA extraction. Ta. Cells were water-cooled, calcium- and magnesium-free Dulbecco of phosphate buffered saline (PBS-CMF) 3 times. Next, the cells Scrape from the dish and collect by centrifugation at 200 rpm for 10 minutes at 4°C. Ta. The pellets were prepared in 320 mM sucrose, 10n+H Tris-C1, pH 7. ,5,5-gate MgCfz, 2 volumes of a solution of 1% Triton X-100 (100 ~200 μm) and kept on ice for 30 minutes. suspension, 25 Centrifuge for 15 minutes at 0 rpm (4°C) and transfer the pellet to a 10 m Solution of M NaCP, 101 Tris-CP, % pH 7,5, 10mM EDTA The mixture was resuspended in a solution of 4°5. RNase digestion (10a+g/d for 60 minutes at room temperature) After addition of 4.5 ul of DNase-free RNase), incubate overnight at 37°C. Digested with proteinase (10% 5D30.5d-1-10mg/- (addition of 0.1 - The DNA was then buffered with 0.1M Tris-buffered Phenol; pH 7.4, CHCEz, 4% isoamyl alcohol (1 , :1. ) two or three times (until the aqueous phase becomes clear), followed by CH ( Equal volume extractions were performed with 1,4% isoamyl alcohol. DNA, 3 M sodium acetate (p[I5.2) by 0.1 volume and 2 volumes of ethanol Precipitated for 2 hours at 80°C and pelleted with TE (10n+M Tris, p )18.Resuspended in 0.1mM EDTA, )0.5.

The quality and quantity of genomic DNA samples were determined by agarose gel electrophoresis and 260 nm Evaluation was made by OD at . Genomic DNA from confluent cells in 100III11 dishes Yield was 40-160 μg.

CHO-hTPo-Ml slot...pro...: CHO-hTPo-Ml thin Genomic DNA (15 μg) from the cells was digested with EcoRI and TE buffered. resuspended in solution and requantified by OD at 260 nm. This DNA a Recoat (1,0,0,5 or 0.25μg) in 0.4N NaOH1101 of EDTA solution, boiled for 10 minutes, and placed on ice. 0. Nylon membrane filter (Hybond-N) rinsed with 4N NlOH. RPN, 305ON, Amersh-am Corporation , ArliArlln Heights, IL), slot-plot device (Minifold II, 5chleicher & 5chuell, K eeene, NH) and its walls in a 0.4N NaOH solution 0.5- Rinse further and vacuum dry. Individual 0.5-genomic DNA samples was added per well, briefly evacuated, and the wells were soaked with 0.4N NaO. Rinse with 0.5 d of H solution and dry in vacuo. take out the filter , briefly 2XSSC (0.3M NaCf, 0.03M Sodium Citrate) , pf 17.0) and air dried. Genomic DNA UV Irradiation (UV 5tratalinker2400, Stratagene, La Jalla, CA) and label the filter. A 0.3 kb fragment of mouse dhfr cDNA derived from PCR Probed, washed, and autoradiographically processed. 01IX SSC (0,01'5M NaCl2.O,0015M Sodium Citrate) , reliable removal of the first label after boiling for 1 hour in a 0.1% SDS solution. Subsequently, the filter was injected with a 0.56 kb human TPO cDNA fragment. re-probed with pigment, washed and photographed.

■ Recombinant plasmids pSV2-d, hfr-ece-h, TP.

and pSV2-cihr r-ece-hTPo-Ml, CHOd h f r- cells and CHO-TPO and CHO-TPO, respectively. -Ml cell line was generated. These cell lines were incubated with 1000 (membrane-associated hTPo) or gradually increases (by 3.33 times) up to 10,000 (secreted hTPo). ) MT) grown at one time, where each cycle requires a minimum of 3 weeks. Individual The cells at the amplification step were cryopreserved and after the final amplification step, the immunoreactive hTPo Re-plated for comparison of expression levels.

Microsociation from cell lines CHO-HTP○-25 and CHO-HTPO-C4C The content of wild-type membrane-associated human I-TPO in the murine fraction was determined by -TPO antibody) and quantified immunologically by ELISA. for both cell lines In some cases, some degree of amplification of TPO immunoreactivity occurs with increasing MTX concentrations. , and reached a maximum at MTX of 1100n. After this rise, 1MM There was a gradual decrease in immunoreactive TPO protein levels at high MTXI degrees. high CHO-HTPO- which is a highly basic (pre-MTX) h, TPo-containing cell line. There was minimal increase in TPO expression in C4C. CHO-HT　P　O-2 Although there is a high rate of increase in TPO expression in B cells, the maximum level achieved is It was only slightly higher than the level in O-HTPO-C4C cells. CH During MTX-induced gene amplification in O-HTPO and CHO-HTPO-Ml cells, 100-333 nM than at lower concentrations, with a delay in proliferation to confluency of viable cells. There appeared to be high cell death at the MTX stage.

Compared to limited overexpression of TPO by intermembrane coupling of the enzyme, CHO-HTP Overexpression of the secreted form of hTPo by O-M1 cells was even higher. these In cells, most TPO is secreted into the medium, and most TPO is did not survive. TPO expression decreased to baseline starting at 333 nM MTX. and gradually increased up to the highest concentration used (10 uM). rose. CHO- using either dhfr or hTPO DNA probes. Slot-plot analysis of genomic DNA from HTPO-Ml cells It showed an amplification pattern similar to that of protein expression.

A comparison has been made of membrane-associated (CHO-HTPO) for immunological detection in ELISA. -2B cells) and secreted proteins (CHO-HTPO-M1 cells). This was done with the amount of TPO available. Confluent CHO-HTPO-Ml cells ( Conditioned medium for 3 days from one 100 m dish of 10 μM MTX) was mixed with CHO- Prepared from 100III11 dishes of HTPO-2B cells (100 nM MTX) Enough TPO protein for ELISA plate wells compared to microsomes Produced protein. Both of these cell lines produce their highest levels of TPO. expressed the present.

five-pronged stem Hashimoto's - TPO cutoff by TPO Carbohydrate components on hTPo are recognized by anti-hTPO antibodies in Hashimoto disease can contribute to the epitope identified. This is a protein expressed in eukaryotic cells. This is because unlike protein proteins, bacterial fusion proteins are not glycosylated. be. Little is known about the carbohydrate components in hTPo. human TPO (67) and microsomal antigen (6 days) were combined with lectin concanavalin A. be combined. The latter is also a lentil lectin (68). parts are combined. The hTPo carbohydrate structure can be N-linked, O-linked or both. It is unknown whether this is the case. In this example, the nature of the carbohydrate component of hTPo is The quality was tested and hTPO carbohydrate was found to be a naturally occurring enzyme in Hashimoto disease. The molecules that play a role in the structure of the pitope were tested.

How to get the moon ・-Baing and hTP.

Mankounukiden: Human h　P　O　(CHO-TP　O12g) is emitted stably. Expressing Chinese hamster Usui (CHO) cells (4 days old) were added to 10% bovine embryos. baby serum, 100 U/d of penicillin, 40 μg/d of gentamicin and 2. F12 medium containing 5 μg/d amphotericin B (contained in 100 day diameter dishes) The cells were cultured in For radiolabeling, subconfluent cells were treated with calcium and and rinsed twice with magnesium-free phosphate buffer solution (PBS-CMF). , and then methionine-free F1 containing 10% dialyzed fetal calf serum. 2 medium (3d/dish) for 15-20 minutes.

Next, 353-methionine (1100 or more, Ci/mmol; Amersham, Add ArliArlln Heights, IL) to the medium at 0°2mC. 1/d) and incubation continued for 2-4 hours at 37°C. excluding medium , and cells were rinsed twice with PBS-CMF and incubated in water-cooled PBS-CMF. Scrape off, pelletize at 000xg (40°C) for 10 minutes, and add the same buffer solution 1. Wash once with 0d and the cell pellet was soaked in homogenization buffer (50Il1 M Hep e s, pH 7, 5, 1% Triton X-100, 0, 1d Phenylmethylsulfonyl fluoride, bacitracin at 2 tag/ydl, 0. 25 mM TLCK (N-p-tosyl-1-lysine chloro-methyl ketone) and 0.1mM leupeptin (Sigma Chemical Co, +St, L ouis, MO)) (0.3 d/dish cells). Shake for 1 hour at room temperature. After that, the mixture was heated to 100. Centrifuge at OOOXg (4°C) for 1 hour, then The supernatant was diluted with immunoprecipitation buffer (10a+M sodium phosphate, po7.2, I M Na C1, 0.1% sodium dodecyl sulfate, 0.5% NP-40 and and 2mM EDTA).

Solubilized cellular protein IIIdl was added to 10% rgG-3°rb (staffy). Staphylococcus A) (The Enzy Center, Maiden, MA) for 10 min at room temperature twice. Absorb, then 10. IgG-3or by centrifugation for 30 minutes in OOOXg b was removed. High titers of anti-hTPo antibodies (ELI >1,50,0,0,000 units) Add Hashimoto disease serum with SA reading) to a final dilution of 1:200. Ta.

Similar results were obtained with three separate sera. Incubate overnight at 4°C. After vation, 150 μl of IgG-3orb is added and the tube is placed at room temperature. It was rotated for 2 to 4 hours. rgG-3orb, 10. 5 times in OOOXg Harvested by centrifugation, washed five times with immunoprecipitation buffer IIIN, and then , 10mM Tris, pH 7.5, 2111M EDTA and 0.5% Dodecyl Washed once with sodium sulfate solution. Finally, the beret of 501 in Laemmli sample buffer (31) containing dithiothreitol (DTT). Resuspend, boil for 3 min, and apply to a 6% polyacrylamide gel for 0 min. The molecular weight markers (Sigma; St. Louis, MO) were as follows: 2 05 kD myosin 7116 kD β-galactosidase; 97 kD phosphoryl lase b; 66 kD bovine serum albumin; 45 kD ovalbumin. auto Radiographic processing was performed with Kodak XAR-5 film.

? - Glycodyl of human TPO: immunoprecipitated as above. and radiolabeled recombinant hTPo bound to IgG-3orb. were recovered in enzymatic digestion buffer rather than Laemmli sample buffer. . Enzymatic digestion (18 hours at 37°C) was performed with the following enzymes: endoglycanase. F (Boehringer-FIannheita, 111eat Germ any, 30 U/d; 100o+M sodium phosphate buffer, pH 6, 0,501M EDTA, 0.1% 5DSS, 1% β-mercaptoethanol and 1% NP40i solution; endoglycanase H (Boehringer, 0 ．． 2 U/d; Same buffer as Endo F (however, EDTA has been removed) O-glycanase (Boehringer, 2.5 U/d, same slow as Endo H) solution); and neuraminidase (Sigma, IU/d; 100 mM sodium acetate, pH 5,2,5IIIM EDTA and 1% β-mel captoethanol). As a control, to monitor hTPo degradation, individual The experiment involved samples that were incubated simultaneously without the addition of enzyme. .

Lectin Affinity Chromatography: Surfactant activity of CHO-TPO cells The drug extract (5 to 7 100-diameter dishes) was treated with 353-methionine for maintenance. (see above), and Concanavalin A (ConA ), peanut agglutinin (PNA), wheat germ agglutinin (WGA) , Ricinus communis ageltin (RCA I) and Ulex Europaeus (UEA-F) agarose-binding lectin (All from Vector Laboratories, Burltngame A 2-bed volume column (purchased from Co., Ltd., CA) was used. Apply to column For the sample (0,3d), for each individual lectin = WGA and RCAI-1mM EDTA; ConA-1+*M CaCj2. ．． 1m M's Mn Ci! z; PNA 1mM CaClz, 1++M Mg Cj2z; UEA F Buffer A (supplemented with 1mM CaCl2) 20111M Tris HCl pH7,4,150IIM Na Cj2.0.1 % Triton X-100) to a volume of 10 d. to the column After application, unbound proteins are removed by washing with buffer A50d. It was removed. The specifically adsorbed proteins were isolated from the following (all at 300 wM): ) (WGA, N-acetylglucosamine, PNA and RCAI, D-galactose Con A, α-methyl-D-mannoside; and UEA-F, α-flose ) 25d. Collect both 0.5d and liquid scintillation Counted for radioactivity by counter. 2 containing the peak of eluted radioactivity The seed fractions were pooled (ld) and anti-hT in the serum of patients with Hashimoto disease. Subjected to immunoprecipitation with PO antibody, followed by polyacrylamide electrophoresis and Subjected to autoradiography (see above).

■ The derived amino acid sequence of human TP○ (17, 19, 54) corresponds to the extracellular domain of the enzyme. It is suggested that there are five main possible glycosylation sites. this is , Asn-x-3er/Thr (x refers to any amino acid and the third position is Tripe for the glycosylation site (which can be either Ser or Thr) It is based on the Petit de algorithm.

The carbohydrate chain can be attached to an Asn residue (N-linked) or a Ser or Thr residue. It can be bonded to a group (〇-bond).

The hTPo carbohydrate moiety is N-linked, O-linked, or both. and also information about the characteristics of the carbohydrate components. To obtain information, hipo was quenched by a number of deglycosylation enzymes of varying specificity. It became. Expressing recombinant hTPo to prepare radiolabeled hTPo The protein in the Chinese hamster ovary (CI(O)) was expressed as ff5. radioactively labeled with 3-methionine and subsequently present in the serum of patients with Hashimoto disease. Immunoprecipitation was performed using anti-hTPo antibody. Based on Western plot analysis As observed previously (48), recombinant hTPO is approximately 115 kD and 110 kD doublets, and their 115 kD and 110 kD doublets The relative advantages of the two approaches vary from experiment to experiment. Two types of chitobiose core Breaks glycosidic bonds between N-acetylglucosamine (GlcNac) residues Both complexes and polymannose (70) N-linked glycans are removed by Digestion with endoglycosidase (endo)F is performed by electrolysis of hTPo doublets. The electrophoretic mobility was increased to approximately 110 kD and 105 kD. polymannose acts similarly to EndoF, but on complex glycans EndoF Endo H, which acts differently than It was converted into a 105kD doublet. In contrast, 〇-linked glycans and O-glycanases and neuraminidases, excluding the terminal and terminal neuraminic acids, are The mobility of the signaled hTPo was not changed. These data indicate that human TPO Suggests that it contains only remannose N-linked glycans.

Lectin affinity chromatography (69) reveals hTPo carbohydrate components. provided additional support for the polymannose nature of Therefore, the radioactive label The recombinant hTPO was retained only on concanavalin A-Sepharose; Here, the hTP○ binds to the N-linked oligosaccharide with high affinity, and here In both cases, the outer mannose residues of the two species are unsubstituted or replaced by another mannose residue. (, -2). The bound hTPo is 30011M α- It can be eluted with methyl-D-mannoside. TPO is wheat germ agglutinin ( specificity for terminal and internal GIcNac and terminal neuraminic acid), Ricinasco Munis agglutinin 1 (RCAI) (Bee with terminal galactose residue and tree antenna N-bonds (highest affinity for oligosaccharides), peanuts (terminal Gal-β-1,3-Ga INa c) or Urex Elobae Ulex europaeus (terminal a-nee L-fucose) It was.

After determining the types of carbohydrates present in recombinant human TPO, the inventors determined that these residues on hTPO recognized by anti-hTPO antibodies in Hashimoto disease. We investigated which disease-related epitopes play a role.

Radiolabeled recombinant hTPo was transferred to Concanavalin A-Sepharose Affiliate. First, a portion was prepared by using nitty chromatography, and then three different types of chromatography were used. digested with canase and finally, to the anti-hTPo antibody in Hashimoto disease. The cells were subjected to immunoprecipitation. Chitobiose core due to Endo F and Endo H Complete removal of N-linked carbohydrate chains distal to the base did not prevent antibody binding. these From the perspective of experimental complexity, it is important to note the completeness of the N-glycanase treatment. It is. Therefore, after deglycosylation, all of the immunoprecipitated hTPO is pupa (110 kD and 105 kD) existed as a doublet. as an additional control Digestion with O-glycanase resulted in the unmodified hTPo form (115 kD and 110 kD).

Consider The study demonstrated that thyroid microsomal antigen (68) and immunopurified valve recombinant human It was shown that TPo (67) is bound by concanavalin A. However However, the present inventor has developed other methods based on the properties of oligo W (glycan) in human TPO. are not aware of the data. Recombinant human in non-thyroid eukaryotic cells as above By exploiting the expression of TPO, our data provide a novel contrast to this control. provide regulatory information.

Therefore, glycan enzymatic digestion and differential lectin affinity chromatography According to both authors, the data presented in this example covers all carbohydrate components on hTPo. is bound to the Asn residue (N-bond) and not bound to Ser or Thr. Yes (〇-Connection) Provide strong evidence. Furthermore, selective deglycosylation by Endo H zylation (70) and selective sensitivity to concanavalin A (69). This suggests that the N-linked oligosaccharides are of the polymannose type.

Most importantly from the perspective of the pathogenesis of Hashimoto disease, our data suggest that h Oligo plaque present in TPo is found in the blood of patients with autoimmune thyroid disease, mainly Hashimoto disease. significantly affected the epitope recognized by anti-hTPO antibody in the supernatant. It suggests that there is no.

Glycans of recombinant hTPo Components are structurally the same as those in TPO present in human thyroid cells in vivo It is assumed from this example that .

Chinese hamster ovary cells express hTPo polypeptides in a manner different from human thyroid cells. Glycosylation of the peptide chain cannot be excluded, but perhaps such differences is not important. Therefore, polypeptide glycosylation patterns in yeast and bacteria Unlike in Chinese hamster ovary eukaryotic cells, glycosylation in Chinese hamster ovary eukaryotic cells is , very similar to, but not identical to, glycosylation in human thyroid cells. do not have. Additional support for this hypothesis is found in Chinese hamster ovary cells. recombinant hTPo is functional at the same levels present in human thyroid cells in monolayer culture. being functionally active. In addition, Hashimoto disease containing anti-microsomal antibodies Virtually all serum from patients was analyzed by Western plot analysis (48) and E This form of recombinant human TPO can be recognized by LISA. Therefore, According to the definition, the modified human) TPO of the present invention contains appropriate disease-related epitopes on hTPo. Contains taupe.

Removal of carbohydrate components on human TPO results in anti-hTPo antibodies in Hashimoto disease serum. The discovery of the present invention, which does not affect the antigenicity of the molecule with respect to recognition by the body, In agreement with the data obtained with kamycin (see Example XI), kamycin However, our data are even more powerful.

Finally, our data demonstrate that oligosaccharide components in hTPo are One of the “natural” epitopes recognized by anti-hTPo antibodies in human serum. This suggests that it is not a department. However, the glycosylated portion of the molecule , altering the interaction of an antibody with its epitope, e.g. by changing the affinity of that interaction. It is possible to influence by by any particular theory Not linked but recognized by both polyclonal and kinoclonal antibodies There is a strong recognition that the majority of epitopes encountered are discontinuous. In other words, Due to the folding of the peptide chain, the 3D structure of the protein can be widely distributed as an epitope. juxtaposed to closely separated, “discontinuous” regions of the polypeptide chain. lacks the peptide fragment or the bacterial fusion protein β-galactosidase may be modified by the enzyme component.

The data of the present invention demonstrate that the epitope on TPO (B-cell epitope) by antibodies Regarding recognition. These B-cell epitopes are major histocompatibility antigen (MHC) Restrictive aspects recognize that the epitope is distinct from that displayed on T-cells. (71). B-cell epitopes mediate damage to the thyroid by the immune system. and T-cell epitopes are probably important in autoimmune processes. It is probably relatively important in the initiation of

Takashi first visit ant4bocHes, J rmmunol Methods, 1982; 55:155-168゜55. Libert, F., Flood Works 1. (198 7) EMBOJ, 6:4193-4196゜57, Doble, N.D. , Tateko 1. (1988) Immunol, 64+23-29゜58,' Ruf, J., LLLL, (1989) Endocrjnol. 125:1211-1218゜59,' Lajng, P. (1986) J, CHn, Lab, InmunoL 19:19-23゜62, 5a ikj, R, ni, Taiji LL, (198B) 5science 239: 487-491゜64, Male, D, Ni,, ml engineering 1. (1985) Invnunol, 54:419-426゜65, Fukuma, N. Rainbow” L (1989) Immunol, 67:129-’DI.

67, Ruf J, , (1987) Acta Endocrjn ol, 5upp1.281:49-566 days, ajita Y,, etc. al, (1985) FEBS Lett, 187:334-338゜69 , Merkle R, , e-engineering 1. (1987) Meth, Enzy mo+, 138+232-259゜70, Thotakura N, R,, -Rainbow, (+987) Meth, EnzymoT, 13B+350-359° FIG, 2C FIG.5 GAG GCA ATT GAG GCG CCCATT TCA GAA G AG TTA CAG CCG TGA AAA TT^CsCAGC AGT GCA GTT GGCTGA GAA GAG CAA AAA A GA ATG AGA GCG CTG GCT GTG bTG TCT ! 4ET Arg Alc Leu AIQ V (11 Lpu Ser! 35 162 GTCACG CTG GTT ATG GCCTGCACA CAA GCC TTC DingTCCCCTTCATCTCG AGA GGGVQI Thr Le u　VQI　Met　AIQ　Cys　Thr　Glu＾IαPh+＞　Phe Pro PheIle Spr A Ni @Gly To AA GAA CTCCTT TGG GG^^AG CCT G^GG^G TCT CGT GTCTCT AGCGTCTTG G`G Sys Glu Leu Leu Trp Gly Lys Pro Glu Glu Ser Arg VQI Ser Spr V+k戟@Leu Glu GAA　AGCAAG　CGCCTG　GTG　GACACCGCCATG　T ACGCCACG ATG CAG AGA AACCTCGlu Ser L ys kg Leu Val Asp Thr AIQ Met Tyr AI Q Dinghr Met Gln Arg Osn, Leu AAG^AA AGA G[lA ATCCTT TCT GGA GCT C AG CTT CTG TCT TTT TCCAAA CsT CCT Lys Lys Arg Gly I Ie Leu Ser Giy Ala Gin Leu Leu Ser Phe Ser Ly sword @Leu Pr.

351 37EI GAG CCA ACA AGCGGA GTG An GCCCGA GCA GCA GAG ATA AIQ GAA ACA TC` AT^ Glu Pro Thr Spr Gly VQI 112^1 (I Arg AIQ^Ici Glu Ile Mpt Glu Thr@Ser IIe 405 4:+2 CAA GCG ATG AAA AGA^^^GTCAAACCTG MA A CT CAA CAA TCA CACCAT CCA AbG Gln AIQ Met Lys＾rg Lys VQI Asn Leu L ys Thr Gln Gln Ser Gin Hls oro Thr GAT GCT TTA TC^ GAA G^T CTG CTG AGCA TC＾Ding TGC＾　AACATG　TCT　G(to i　TGs　CTC FI6.7 Pro Tyr Met Leu Pro Pro Lys Cys Pro^ sn Thr Cys Leu^(a Asn Lys TKaichi @Arg CCCATCAGAGGA GCT TGCAACAACAGA GACCAC CCC＾GA　TGG　GGCGCCTCCAACPro　Ile　Thr　G ly Ala Cys Asn Asn Arg Asp) Its Pro Arg　Trp　Gly　Al=@Ser　Asn AC et al CCCTG GCA CGA TGG CTCCCT CCA GT CTAT　GAG　GACGGCTTCAGT　CAG　CbC Thr AIQ Leu Alo Arg Trp Leu Pro Pro VQI Tyr Glu Asp Gly Phe Ser@Gin Pr.

Arg Gly Dingrp Asn Pro Gly Phe Leu Tyr Asn Gly Phe Pro Lpu Pro Pro@Vcl Arg Glu Vat Thr Arg Hls vllllie Gln VQI Ser^sn Glu VQI Vnl T)y-^5pO5p^5p FI6.7 (control) VQI Gly Ala Leu Hls Gin I IOlie Thr Lpu　Arg　Asp　Yr　Ilp　Pro　Arg@I(e　LEIL 1 1485 15+2 GGA CCCGAG GCC TCCAG CAG TACGTG GGT CCCTAT GAA GGCTAT GACTCCACCGly Pro G lu^IQ Php Gin Gin Tyr VQI Gly Pro Ty r　Glu　Gly　Tyr＾sp　S■Chichi@Thr [5:19 1566 GCCAAACCCCACT GTG TCCAAC [IT[J TTC CCA CA GCCGCCTTCC(ic TTC[ll[ICC`T GCCACG ATCCACCC (i CTG GT [i AGG^GG CT G GACGCCA [llCTTCCAG GAG CACbji Alo Thr rip H2S Pro Leu VQI Arg Arg Leu Asp AIQSer Phe G[n G[u gls Pr.

Go to 6 CCTG CCCGCG CTG TGG CTG CACCAG GCT To TTCTTCAGCCC TGG ＾CA TTA CsC ^sp Leu Pro Gly Leu Trp LEIIJ H2S GI n to IQ Phe Phe Ser Pro Trp Th Chichi@Leu Leu CG Ding GGA 66 G[ltT TTG GACCCA CTA ＾Ding＾ CGA G [iCCTT CTT GCA AGA CC` GCCAAA ＾rg　Gly　Gly　Gly　Lpu　Asp　Pro　Leu　I　le Arg Gly Leu Leu AIQ llrg P Nitjun@AIQ Ly s CTG CAG GTG CAG CAT CAG CTG ATG AACG AG　GAG　CT[I　ACG　GA^　^GG　CTCsTT　GTG Leu Gin Vcl Gln Asp Gin L+>u Met Asn Glu Glu Leu Thr Glu Arg LeP@Phe VQI IEIO91836 C Ding G TCC^^T TCCAGCACCTTG CAT CTG GCG TCCATCAACCTG CAG AGG GGCCGGLEIuSer A sn Ser Ser Thr Leu Asp Lpu AIQ Ser I lp Asn Leu Gln Arg@Gly Arg 1B63 1890 GACCACGGG CTG CCA GGT TACAAT GAG TGG AGG GAG TTCTGCGGCCTG CCT CmllC to S11 Hls Gly Leu Pro Gly Tyr Asn Glu Dingrp Arg Giu Phe Cys Gly Le Fu@Pro Arg seu Glu Thr Pro ^(α^sp Leu Ser Tty A lc Ile ^In Spr Arg Ser Vat `la Asp FIG. 7 (continued) ^AG ATCC1G GACTTG T^C^^G CAT CCT CAC AAC＾ICGAT GTCTGG CTG GGA GGb Lys I le Lpu Asp Leu Dingyr Lys His Pro Asp Asn Ile Asp Val Trp Le Fu@Gly Gly Leu Ala Glu Asn Phe Leu Pro Arg Ala＾ rg Thr Gly Pro Lpu Phe＾IaCy Katana@Leu ATT GGG ^^G CAG ATG ^^G GCT CTG CGG CACGGT GACTGG TTT Ding GG TGG G`[J AAC lle Gly Lys Gin Met Lys Ago Leu Arg Asp Gly Asp Trp Phe Trp Trp@Glu Asn 5er Hls Vat PheThr A11) AIQ Gln Arg Arg　Glu　Leu　Glu　Lys　Hls　Ser@Leu　Ser ^In Al(l^Ia Gln Asp Ser Glu Gin Glu Ser AIQ Gly Met Glu Gly ArgOsp Thr Hls　Arg　Lpu　Pro　Arg^l(L　Leu　AAATTCAI Q TTCCCA A^^ TCA CC [I TACGACTCT TTT CCA　AACACA　GGC＾A＾　DingChi@C1M 2997　3[124 ^TCAGCAGG ACG ACT 61st TTCCCA ACA CG [ i GTA ^^T CTA GTA CCA TGT CfT AGT ■^CTCT CAG GCA TGG A Ding GA^T AAA TGT TA T ACCTGCAAA AAA AAA 8^^pHTPo-Ml-ECE- 5V2-DHFRFIG, 9 human thyroid CHO-HTPO microsome FI6.10A Hi I/Thyroid CHO-HTPO microsome FIG, 10B human thyroid CHO-HTPO microsome FIG, IOC optical density FIG. 11A optical density CHO-HTPO micro room FIG, 11B optical density (490nm) serum sample FIG. 12 ACGT ACGT hTPo　hTPo-MI FIG. 13 D FIG. 14A D FIG. 14B (wild type) 1 to CHO-TPO-Ml- (end removal) Chase time 0 4 81224 04 81224 cells medium FIG. 15 OD (470nm) minutes FIG. 16 FIG. 17A PBL81 PBL RG PBL KHFIG, 17B 883　AACCCA　TGT　TTTCCCATA　CAA　CTCCCG　 GAG GAG GCCCGG CCG GCC927FIG, 1B Procedural amendment (formality) %formula% 1.Display of the incident PCT/US90104289 1990 Patent Application No. 511542 2. Name of the invention Recombinant human thyroid peroxidase 3. Person who makes corrections Relationship to the incident: Patent applicant Name: Labopode Pasil 4. Agent Address: 8-10-5 Toranomon-chome, Minato-ku, Tokyo 105, Date of amendment order 6. Subject of correction (1) The “inventor” and “Patent applicant” column (2) Translation of the description and claims (3) Power of attorney 7. Contents of amendment (1) (3) As per attached sheet (2) Translation of the description and claims (no change in content) 8. List of attached documents (1) One copy of the corrected document pursuant to the provisions of Article 184-5, Paragraph 1 of the Patent Act (2) Translation of the specification and scope of claims (1 copy each) (3) Power of attorney and its translation (1 copy each) 1 letter (4) Address change and certificate of enrollment/non-enrollment and their translations: 1 copy each (5) Statement of reasons (1 copy) International v4sai report “””’l””’1Aet”l-’N’PCT/US90104289

Claims (22)

[Claims] 1. Enzymatically active recombinant human thyroid peroxidase, or its functional or is a chemical derivative. 2. The human thyroid gland tissue according to claim 1, which is produced by eukaryotic cells other than thyroid cells. - Oxidase. 3. pECE-HTPO, pHTPO(M1)-ECE-SV2-DHFR, p HTPO-DHFR-2B, pHTPO-DHFR-4C and pHTPO-DH A plasmid selected from the group consisting of FR-4C-MTX. 4. Eukaryotes other than thyroid cells transformed with the plasmid according to claim 3 cell. 5. 5. The form of claim 4 under conditions that permit expression of human thyroid peroxidase. Culturing the transformed cells and collecting the human thyroid peroxidase A method for producing human thyroid peroxidase, comprising: 6. An antibody against human thyroid peroxidase according to claim 1. 7. A method for detecting human thyroid peroxidase in a sample, the method comprising: contacting the pull with the antibody of claim 6, wherein the antibody is detectably labeled. human thyroid peroxidase in the sample and the detectably labeled A complex is formed between the antibody and the antibody forming the complex or detecting a detectably labeled antibody that has not formed a body. Law. 8. A kit for the detection of human thyroid peroxidase in a sample, the kit comprising: container means comprising one or more containers, one of the containers comprising an antibody according to claim 6; 1. A kit comprising: said antibody being detectably labeled. 9. A method for detecting antibodies against human thyroid peroxidase in a sample, the method comprising: , request samples expected to have antibodies to human thyroid peroxidase. the recombinant human thyroid peroxidase according to claim 1; Human thyroid peroxidase is detectably labeled and present in the sample. an antibody against human thyroid peroxidase present and said detectably labeled A complex is formed between recombinant human thyroid peroxidase and a detectably labeled recombinant human shell formed or uncomplexed. Detecting peroxidase. 10. Key for detection of antibodies against human thyroid peroxidase in samples a container means comprising one or more containers, one of the containers being defined by the claim. 1, comprising the recombinant human thyroid peroxidase according to 1. A kit characterized in that glandular peroxidase is detectably labeled. 11. Recombinant DNA encoding human thyroid peroxidase secreted from cells A array. 12. 12. Said sequence has a stop codon upstream from the transmembrane domain. DNA sequence as described. 13. The sequence encodes amino acid residues 846-870 as shown in FIG. 13. The DNA sequence according to claim 12, having a stop codon upstream from leotide. 14. A vector comprising a DNA sequence according to claim 11, 12 or 13. 15. A host cell transformed with the vector according to claim 14. 16. Human thyroid peroxidizer produced by the host cell according to claim 15. or a functional or chemical derivative thereof. 17. A method for producing human thyroid peroxidase, the method comprising: The host cell of claim 15 under conditions that permit expression and secretion of oxidase. A method comprising culturing and recovering the human thyroid peroxidase. . 18. An antibody against human thyroid peroxidase according to claim 16. 19. A method for detecting human thyroid peroxidase in a sample, the method comprising: The sample is also contacted with the antibody of claim 18, wherein the antibody is detectably labeled. human thyroid peroxidase in the sample and the detectably labeled A complex is formed between the identified antibody and the complex is formed or detecting the uncomplexed detectably labeled antibody. Method. 20. A kit for the detection of human thyroid peroxidase in a sample, comprising: , comprising one or more containers, one of the containers being a container according to claim 18. A kit comprising an antibody, the antibody being detectably labeled. . 21. A method for detecting antibodies against human thyroid peroxidase in a sample. sample expected to have antibodies against human thyroid peroxidase. contacting with the recombinant human thyroid peroxidase of claim 16, wherein said Recombinant human thyroid peroxidase is detectably targeted and an antibody against human thyroid peroxidase present in the detectably labeled A complex is formed between the recombinant human thyroid peroxidase and the complex. A detectably labeled recombinant human body that has formed a complex or is not complexed. A method comprising detecting thyroid peroxidase. 22. Kit for detection of human thyroid peroxidase in samples and a container means comprising one or more containers, one of the containers being according to claim 16. comprising the recombinant human thyroid peroxidase described above; A kit characterized in that oxidase is detectably labeled.