JPH05500657A - How to use toxins - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] 9. The method of claim 8, wherein the biological product is Characterized by being a gene expression product of recombinant DNA or a monoclonal antibody Cell growth methods.

10. A method for proliferating cells or promoting their proliferation, the method comprising: Adding Hepasturella malto/da toxin or a variant or fragment thereof Characteristic cell proliferation method.

+1. A cell that is Pasteurella malto/da blue or a mutant thereof A cell characterized in that it exhibits proliferative properties upon exposure to a t-fragment.

12, a conjugate of Pasteurella malto/da toxin or its mutants (1 A conjugate characterized in that it consists of a single fragment and a means for binding to a specific cell type.

13. The conjugate according to claim 12, wherein the toxin or a fragment 1 thereof, A conjugate that stimulates the specific cell type to proliferate.

14. A method for stimulating a specific cell type in a mammal for proliferation, the method comprising: contemplates administering the conjugate according to claim 13 to said mammal. A cell stimulation method characterized by:

15 A conjugate containing the toxin of Neussorella multnoda or its cell-bound variant. The variant is characterized by consisting of a cell-binding site and a pharmaceutically acceptable compound. A conjugate with.

16. A method for delivering a pharmaceutically active compound to a specific cell type in mammals, which methods include: comprises the administration of the conjugate according to claim 15. R] Method of delivering active compounds to specific cell types.

Specification How to use toxins Prior art and background The present invention relates to Pasteurella multocida (Pasteurella multocida). da) Concerning a novel method for the use of toxins.

The toxin of Pasteurella multocida has been identified as a pathogenic factor in atrophic rhinitis. , the toxin causes diurinary reflex, atrophy, or turbinate bone loss in adult pigs.

In addition, by subcutaneously injecting a crude extract of this toxin, nasal turbinate atrophy can be reversed. (Rutter & Mackenzie, 1984) Specifically, this toxin causes nephropathy, epithelial hyperplasia, osteolysis, and an increase in the number of stent cells. Lesions such as growths appear. Other degenerations, obstructions and hyperplasias of the liver, ureters and and bladder.

By purifying this toxin, the purified toxin has all the above effects. (Chanater et al., 1986b). (For a review, see Cha In 1987, animal health research The Institute for ^nimal Health is the 11th legend of toxins. reports that a child has been cloned (J, M, Rutter, -Vl rulenee Meehansm or Bacterial Pathog ens-, Ed, J.A. Roth, p234).

The international patent application (WO89109617) (published in IG, 1989) is The toxin and its analogues can be used as a vaccine against atrophic rhinitis. It discloses that it can be used as

Surprisingly, we found that the toxin had a significant stimulatory effect on the proliferation of cultured cells. I finally discovered that it shows. We have shown that the toxin is present in 373 cells and one other tissue. It was shown to be a very powerful mutation-inducing agent for blast cells. epithelial] form Regarding growth of growth and counting cells, Due to the circumstances, its mechanism of action is not understood (Chanter at at, 19116b), and the cell proliferation effect caused by toxins is a side effect. It may be the action or repair of damaged tissue. Furthermore, this toxin It is known that beef tallow is toxic to cultured cells (Rutter and Luther, 1984), and in other glass vessels (in vitro Similar cytotoxicity was observed in studies in the o) system. Therefore, recent papers (E lling et al, 198g, Ch6VH16at al, 198 8) describes necrotic toxins extensively, and also The similarities between the La multocida toxin and other necrotic toxins are mentioned.

The object of the present invention is to use Pasteurella malto/da toxin or a fragment or variant thereof; and one or more carriers or diluents. It is to provide.

Advantageously, the composition is suitable for topical administration to the skin or cornea. be.

Furthermore, what we mean by non-immunity is that it does not cause immunity. In other words, induce or assist in eliciting an immune response to the composition. This means that the composition does not contain any ingredients that cause Also, this The composition is not a vaccine and is not used to generate immune serum. However, without proper use, it may exhibit accidental immunogenicity.

Pasteurella maltocida is a virulent strain of Pasteurella multocida, e.g. means a toxin produced from the LP01 strain. avoid ambiguity In order to Deposited with a certain NCIMB under the Butapest Treaty (No, NCIMB) 40158.19119 (Deposited June 26, 1919). In addition, the toxic strain (45/78) was From the Nanowonal Collection of Type Cultures in Ndon, N. Available as CTC12178. Produced by Pasurus multocida As mentioned above, the toxin (hereinafter sometimes abbreviated as PMT) is a porcine atrophic toxin. It is considered to be a pathogenic factor that causes rhinitis, and in the literature so far [dermal breakdown] Dermonecrotic taxin J, “Osteolytic toxin ( osteolytictoxin) J, “Turbina osteolytic toxin (turbina le atrophy toxin) J and “heat labile exotoxin (heat 1 abile exotoxin) J has been called by various names, but this The toxins that have been called by these names are thought to be the same toxin based on the amino acid composition. Ru. However, the characteristics of the toxin isolated from the winged strain of Pasteurella multocida were not investigated. When examined, minor mutations are observed.

The deduced amino acid sequence of PMT (inferred from the DNA sequence) is as follows: Ala was found 76 times, 5.9% Cys was found 8 times, so 0 ．． 62%Asp was found 71 times, so 5.53%Glu was found 100 times. Therefore, 7.78% Phe was found 69 times, so 5.37% Gly was found 69 times. , found 71 times, so 5.53%H1s was found 19 times, so 1.4 8%11e was found 92 times, so 7.16%Lys was found 70 times. Therefore, 5.45% Leu was found 127 times, so 9.88% Met was found 3 times. Found 6 times, so 2,80% Asn was found 73 times, so 5.68% Pro was found 62 times, and 4.82% Gln was found 56 times. , 4.36%Arg was found 58 times, so 4.51%Set was found 97 times. Since 7.55% Thr was found 66 times, 5.14% Mal was found 63 times, so 4.90%Trp was found 13 times, so 1. 40% Tyr is found 53 times, so 4.12% amino acid residues are 1285 The total molecular weight of the toxin is 146.5 kilotaltons (kd).

The toxin gene preferably has the DNA sequence shown in Figure 6 or is identical to It has a DNA sequence encoding the amino acid sequence of And the toxin molecules are Enter the corresponding amino acid sequence. In addition, we used the scleotide sequence and The term "gene" is used to refer to the regulatory sequences.

The term "variant" also refers to minor variants in which the amino acid residues are less than 11. undergoing significant changes (e.g. deletion of one or several residues, conservative substitutions) , minor residue insertions, or minor variations in amino acid structure). , such mutations may affect the ability of the compound to induce 373 cell proliferation or the DNA of 3T3 cells. one that suppresses the synthesis to less than 10% (preferably 20%, 30%, 40%, lower than 50%, 60%, 70%, 80%, or 90%). or does not inhibit cAMP production in 3T3 cells in the assay system below. growth factors (e.g. EGF), DNA synthesis or It has the effect of promoting cAMP production. The mutant is Pasteurella mal shown in Figure 7. 80%, preferably 85%, 90%, 95% to the amino acid sequence of Toshida toxin or have 99% homology.

Conservative substitutions are those in which one or more amino acids are replaced with other amino acids that have the same properties. and this substitution is not substantially altered by conventional polypeptide chemistry. It is assumed that the polypeptide has no secondary structure, preferably tertiary structure. for example , typical examples of such substitutions are alanine or valine for glycine, Arginino or asparagine for luteamine, serine for asparagine , and histidine is substituted for Ritz. Alternatively, the mutant at most 10 (preferably 1 or 2) compared to Lella multocida toxins. ) is deleted. Such deletions may result in a polypeptide It is desirable that this occurs at the loboxyl terminal side. Alternatively, at most 10 (preferably (1 or 2) amino acid residues are added; , preferably occurs at the carboxyl terminus of the polypeptide.

“Fragments” of toxins are related to toxin mutations17 and have favorable cell growth characteristics. It means a fragment that indicates the nature of the element, and is almost the same as the area of the element array. at least 50% homology, preferably 60%, 70%, 80%, 90%, 95% or 99% homology. Such fragments are It is desirable that the molecular weight is at least IO,000.

Useful fragments are those that have the following properties: In other words, Nakai and Bikume's method (Nakal & Kume 1987a, 1987b and M. (Use & Nakal 1985), the approximate molecular weight is Flags for 23000.64000.74000.87000 and 138000 ment is included as a useful fragment.

In this specification, unless otherwise stated, [l! Toxin is the Also included are fragments (fragmen) and variants.

The toxins used in the composition-compromising methods of the invention can be purified by methods known in the art. Isolated and purified from a virulent strain of T. multocida. Therefore, R utter & Mac*enzle (1984), Chanter et al (1986b), Chanter & RuLt■Chichi@ (198 The contents disclosed in the article 9) shall be included in this specification. Also, Toxins can be prepared by known recombinant DNA techniques, and this method As detailed below and as disclosed in international patent application WO109617: shall be included in this specification. Variants and fragments are known It is produced by the expression of a mutant gene obtained by mutation. Fragmen It is possible to convert materials made by recombinant DNA technology or natural materials into protein components. Obtained by digestion with enzymes (see references by Nakai and Kinura) .

Alternatively, Marglin & Merrifield field, ^nn, Rev, Biochat, 39.841-866. 1970) or the method of Arthurton, Shepard and By the Fmoc-polyamide method developed by Bikare et al. A series of purifications consisting of these approaches then yields fragments. .

Nucleotide sequences derived from the Pasurus multocida genome can be analyzed using established methods. prepared based on the complete or partial amino acid sequence of the toxin thus obtained. Screening by DNA probe and genomic sequence hybridization/Gino or by creating a toxin gene library and generating antibodies specific to toxin Fy. (See Example 4 of international patent application w089109617 for details). or toxins from that library using the overlay method detailed below. It can be obtained by screening production clones. this gene The article by Lacks and Chanter (Law & Chanter: j, Gen, Microbiol 136.81-87゜1990) By isolating the 15 kb HpaI fragment, It could also be prepared more directly. In addition, this Lux and Chanter The contents disclosed in the paper are incorporated herein by reference.

The nucleotide sequence can also be expressed by bacteriophage transfection. A bacteriophage-infected strain that has DNA derived from a bacteriophage Multocida genome. Similarly, plus the nucleotide sequence DNA or other genomic factors can be obtained from strains obtained by mating, transformation, etc. cormorant.

Furthermore, it is also possible to synthesize nucleotide sequences encoding toxins, e.g. The method described in the paper by MaLthes et al. (+984) It is possible to synthesize based on Finally, using established methods Mixed genome and synthetic DNA or mixed cDNA, genomic DNA, CD DNA fragments consisting of NA or appropriately synthesized DNA can be ligated to It can also be obtained from synthetic sequences prepared by rinsing. this place each DNA fragment has a portion of the nucleotide sequence encoding the toxin. Ru.

From the above explanation, DNA fragments can be used to generate useful toxins or toxins by gene expression. is used to generate nucleonucleotides with the aim of forming sequences that will produce mutant variants of the toxin. by substitution, addition, insertion or deletion of one or more nucleotides in the code sequence. It may also be modified as

In particular, the invention provides nucleotide sequences substantially as shown in FIGS. 6A and 6B. or a DN consisting of a nucleotide sequence whose sequence has been modified as described above. This relates to the A array. The sequence encoding the entire toxin is sequence 219 in the figure. (or 213) and ends at position 4073. 6th The DNA sequences shown in Figures A and 6B were determined by known methods. It is.

Furthermore, the DNA fragment of the present invention does not produce the complex polypeptide as described above. Other polypeptides linked to the toxin-encoding nucleotide sequence for the purpose of A nucleotide sequence encoding a peptide is contemplated. ljF synthesis polypeptide Another purpose of preparing a toxin is to facilitate purification of the toxin. In this case, the combined The obtained nucleotide sequence is placed in a medium (agate) that ensures gene expression of that sequence. Mu.

* A suitable vector for transforming a suitable host microorganism that can be grown in inserted into the vector. Composite polypep released into the medium after gene expression Tido is recovered by affinity chromatography. In this case, number 2 Antibodies or other ligands reactive against ocular polypeptides are used. purification This second polypeptide is then degraded by a suitable proteolytic enzyme. removed, resulting in the separation of the two polypeptides.

Generally, toxin production consists of the following steps. That is, (a) Pasteurella ma. (b) isolation of the nucleotide sequence encoding the Lutoocida toxin; jllllllll modified Pasteurella maltosi into a modified gene expression vector (e) Insertion of a nucleotide sequence encoding datoxin, (e) into the vector prepared in (b) above. (d) transformation of a suitable host microorganism by a Pasteurella multocida toxin. The above-mentioned (c ) culturing the transformed host microorganism, (e) recovering the toxin produced in the culture medium, and (f) Post-translational processing of toxins as necessary to produce mutants. Ru.

In step (a) of the method, the nucleotide sequence is e.g. It is isolated from the gene library of Lella multocida and its screen Toxic positive clones are identified based on the method described above and the content described below. This is done by screening the

In step (b) of the method, the optional modifications to the sequence include This can be done either before or after the vector is inserted into the vector. Qualifications have already been mentioned. As shown above, one or iI number of nucleotides in the sequence is substituted, added, means undergoing mutation by insertion, deletion, or a combination thereof.

The transformation in step (C) of this method was performed as described by Manfaji et al. carried out by standard methods such as those disclosed in satat, 19g2) It is something that will be done.

The culture of the host microorganism in step (d) of this method uses a commonly used medium. do. For example, Manialis et al. (+982) Using a valine broth medium as disclosed, depending on the type of microorganism, p. I+,? Conditions such as air lane failure, etc. should be made appropriate.

In step (e) of the method, the toxin is recovered by known methods such as precipitation, gel filtration. ion exchange or HPLC reverse phase chromatography or immunoaffinity chromatography Performed by topography.

Apart from the toxins mentioned above, the compositions of the present invention also include a pharmaceutically acceptable carrier or excipient. It also includes excipients. This excipient is used in preparing pharmaceutical compositions. Ru. For example, diluents or suspending agents such as isotonic salts. Therefore, the present invention The composition comprises an effective amount of the toxin and a concentration of the toxin in the composition in advance. and an excipient in an amount to give a predetermined concentration.

The use of this toxin is because it has the effect of promoting cell division. A wide variety of things are possible. For example, it is thought that it can be used to heal wounds. Therefore, the present invention provides treatment for skin ulcers, burns, cuts, abrasions, and cosmetic surgery. Methods for healing wounds sustained by mammals, such as facial wounds, corneal cuts or burns It also provides.

The toxin also promotes bone marrow proliferation after anti-cancer chemotherapy or radiation therapy. It can also be used to For example, bone marrow taken from a patient is treated with toxins and reused. and then return it to the patient. This is because the long-term effects of toxins cause the presence of extracellular toxins. This is because the rate of increase in bone marrow cells increases without the presence of toxins in the cells. Such a proliferation-promoting effect was observed even in the absence of this. Therefore, the present invention This is an aspect of bone marrow cells undergoing some changes due to exposure to toxins. It also includes cells such as (particularly stem cells). At this point, ``some change will occur.'' means that division and/or DNA synthesis are significantly increased compared to the toxin-untreated control group. means promoted.

Additionally, toxins can be used in cell cultures, especially eukaryotic cells (including hybridomas). It is possible to This promotes cell proliferation and the recombinant remains. Generation of transformed cells and their products based on gene expression and viral gene expression Promotes the production of. A further embodiment of the invention therefore provides that Pasteurella Provides media containing Pasuru and Multocida toxins suitable for culturing Multocida toxin cells. It is something to do.

The proliferative properties of cells whose proliferation appears to be enhanced by toxin treatment are due to protein affected by Nase C. However, for those skilled in the art, given cells It is easy to select the preferred method depending on the type and react with the toxin. Will.

The toxin will work in the absence of serum, but the presence of a small amount of serum is desirable. stomach. This is because, for example, the presence of serum facilitates the adhesion of cells to the support. become. Therefore, serum may be reduced from 10% to about 2% or less, such as 1%, 0.5% or less. or even 0.1%. In this way, to reduce serum Therefore, it is possible to reduce the cost required for culture and to simplify the purification process of the culture product as much as possible. It will be very helpful.

In addition, since toxins are known to inhibit cAMP production, E. coli ( Diarrhea, cholera, inflammatory keratosis or excess caused by E, coll) Other conditions caused by excessive CAMP production, such as certain hormone excesses It may be used to cure secretions.

The cell proliferation effect of toxins can also be used to stimulate specific cells in the body. cormorant. The toxin preferably targets the specific cell type required. Therefore, the book According to another embodiment of the invention, the P. multocida toxin or a fragment thereof is provided as a conjugate with a means for binding to certain cells. It will be done.

Here, a conjugate is a substance formed by simply binding a toxin or a fragment thereof with a binding means. (For example, O'Sullivan et al.'s method: 0°5 allivan et al, Anal Bioches + IQo, 100-108.1979) a, or a conjugate is a chemical compound in which the toxin and the means of binding are be synthesized endogenously by standard peptide synthesis methods or recombinant DNA technology. Therefore, the entire molecule obtained can be used inclusively (i.e., the fusion DNA sequence can be (used for gene expression of a single polypeptide product).

The above-mentioned "means for binding to a specific cell type" refers to a molecule that binds to a specific cell type in a living body. For example, antibodies, molecules existing in celestial bodies, fragments thereof, or is a synthetic peptide.

For example, cell binding sites target the conjugate to the bone marrow and gastrointestinal epithelium. bone marrow and Gastrointestinal epithelium divides quickly due to anti-cancer chemotherapy or radiation therapy This is an example of an organization that repeats Therefore, cell binding sites are located in the composition of intestinal villi. (e.g., adhesion or agglutination factor antibodies). or cell junction The conjugate is a low-density adhesive material, such as wax. Rouslahti et al. (Rouslahti & Pierschbacher W. 0114100540) , the peptide arginine/-glycine-asparagine-serine (^r-Gly -^5p-Ser) and those two peptides. It is an intermediate peptide. The nucleotide sequence encoding such a peptide is Pasteurella multocida toxin or a portion of this toxin (upstream or downstream of the toxin) by a known method and incorporated into a gene expression vector in a suitable host. It is used for hybrid peptide production.

Toxins must also be capable of penetrating cell membranes to provide mitogenic effects. It must be the same as the. Therefore, the conjugate confers cell membrane permeability Become something.

However, toxins are used to inhibit the production of cyclic AMP (eAMP). When used, the conjugate does not require cell membrane permeability. The membrane need not be permeable.

Substances that specifically bind to osteoclasts or osteoblasts (e.g. proteins, e.g. toxins or toxin conjugates or The active site of the toxin is a growth factor necessary for osteoblasts to regulate osteoclast function. , adversely affect (increase or decrease) the production of cytokines or vulacrine substances. It is used to alter the interactions between these cells by .

In this case, the balance between bone formation and bone resorption is adjusted. Next, various bones Diseases are caused by different toxin conjugates, e.g. some toxin conjugates promote bone resorption. By promoting bone formation, another toxin conjugate may be used to promote bone formation. Body 23c 6 is an example of a binding substance (M, Hortono et al., “Osteocratic Monoclonal antibody against Sudoma - Determination of osteoclast-specific antigen J (+9 85) Cancer Research Vol. 45, pp. 5663-5669 (M, Horron et al. al, Cancer Res.

45, 5663-5669.1985)).

Toxins or conjugates of toxins conjugated to proteins that specifically bind to lymphocytes The active site of the toxin is activated by overstimulation of pharmaceutically active lymphokines and cytokines. It is used to produce inine or balacrine substances from bulbs. this The toxin conjugate does not cause excessive lymphocyte stimulation that causes malignant transformation of lymphoid cells. It is used to cure conditions such as: This excessive lymphocyte stimulation is acquired Occurs during the incubation period in immunodeficiency syndrome (AIDS) and is required for worsening of the disease. and in infectious processes involving Staphylococcus enterococcus. happen.

Pasteurella multocida toxin itself has at least one cell binding site . Many drugs must be specific for the particular cells they act on. No. For example, as 1, I! Microorganisms used in chemotherapy for cancer These include cytotoxic drugs. The toxin or cell-binding protein itself is a drug may be used as a carrier for transporting Therefore, another embodiment of the invention Pasteurella multocida toxins, cell-bound variants or parts thereof, and drugs. The object of the present invention is to provide a conjugate comprising a chemically active compound.

The term conjugate is used in the same sense as above, and is also used in automated polypeptide synthesis. Additionally, genetic expression of the fused nucleotides allows chemically bonded fragments to and fusion hybrid.

Pharmaceutically active agents in combination with the toxin or a portion thereof may have cytotoxic or antifungal properties. with antiviral drugs such as vincristine, vinblastine or methotrexate. be.

Cellular binding sites for toxins can be determined by labeling candidate sites with radioactive isotopes. and the binding site on the cell surface can be detected.

Or rather, expose the cells to a candidate site and then add a labeled antibody to the site. It can be identified by Furthermore, an international patent application (Wo 84100 540) or Yamada (+983) method can be used. As target cells, Includes bladder, liver and pancreas.

At least some of the various effects exhibited by the toxin and co-fluid in whole or in part. Some include growth factors such as EGF, PDGF, 'FGFb or strengthened by

Preferred embodiments of the invention can be seen in the following non-limiting examples and in the accompanying drawings. It will be described in more detail later.

Drawing description Figure 1 shows recombinant plasmid p7. Control of JL 12 and pAJL13 This is a limited map. The arrow indicates the reading of the tetracycline gene in pAT+53. This indicates the cutting direction. The insertion site in pAJL12 is HpaIl, Cleaved by KpoI, Pvul, PVull, Sal+ or Sst+ do not have. The BamH1 site in parentheses indicates the position of the vector relative to the insertion 5aullA site. The Bam81 site must have been deleted by ligen yam. Right end of insertion site The two Hindl11 sites between the Hindl11 sites at the edges are not mapped. stomach.

Figure 2 shows the agarose of chromosomal DNA isolated from Pasuru U. malt/da LFB3. The results of the gel electrophoresis are shown in lanes 1 to 3. each lane Lane 1 is the control group and is not digested by restriction enzymes: Lane 2 is H It is cut by p a l restriction enzyme treatment: Rare 3 is) lpa It has been cut by lIl restriction enzyme treatment, and the shaded area shows fluorescence under ultraviolet light. The white areas indicate areas that do not emit light, or the white areas indicate bright bands colored by ultraviolet light. vinegar.

Also, along with the results of this electrophoresis, lanes 4-6 are for lanes 1-3, respectively. It shows the results of Southern blotting corresponding to the sample. pAL as a probe JI2 large) lpall fragment note was used.

This shows the results of electrophoresis.

Figure 4 shows Pasteurella malto/da 1. Purely against FB3 purified toxins Purified recombinant that reacted with antiserum from isolated pigs (throat bioteinox pigs) This figure shows the results of cross-immunoelectrophoresis of toxins.

Figure 5 shows the nodobiotic response to the purified toxin of Pasteurella multocida LFB3. This shows the results of immunoplot using Rina pig antiserum as a probe. be. Lane 1 is the purified toxin of Pasteurella malto/da LFB3, lane 2 is the Large intestine al (E, coll) T OX 1 (D purified toxin, rare 3 is pA A recombinant whole-cell library containing the Hpalluminus fragment at the insertion site within LJ12. Sade, lane 4 is colon m(j, eoli) HB1 containing pAT+53. 01 whole cell lysade, and lanes 5-8 are lysates without antibodies against toxins. This corresponds to A1-4.

Figure 6 shows DNA sequence data related to the PMT gene, which is published in the international patent application w. Quoted from o89/09617. Our company is recognized as being more reliable. In the sequence, the 46060th position is ton/ton (C) instead of adenine (A). Also, at the 46161st position, 7 tons (C) is replaced by thymine (T). And Sara +: 2541st is guanine (G) -2 instead of tonton (C) The 542nd one is 7 tons (C) instead of guanine (G). Also, The 110th place is outside the code area! Now, an additional 7t (C) residue is added. Ru.

Figure 7 shows the PMT amino acid sequence sumo based on the nucleotide sequence in Figure 6. It is.

Example 1 Pasteurella multocida toxin preparation strain and culture conditions The LP01 strain of Pasteurella multocida causes atrophic rhinitis (rh). Initis) 01 strain and the pAT153 plasmid that uses this strain as a host are Dr. Noe Gee Williams, Royal Cancer Research Foundation, London liass, 1mparial Cancer Re5earch Fund, It was obtained from (London). All bacteria are 12% (V/V) Cell suspensions were stored at -70°C in glycerol. 7 (Suruu・ For culturing Malto/Da, Nosact Tryptose Pros (Jone) was used as the culture medium. s & Ma+thews, 1975) at a temperature of 37°C. Culture was carried out with stirring. E. coli strains can be cultured on LB agar medium or L gross medium. (Manlatis at al, 1982).

Chemicals and biochemical reagents Restriction enzymes are available from BRL or Biolabs. ). In addition, the usage method is based on the instruction manual attached to each restriction enzyme. there was. Other enzymes are Bollinger Cohon I! 7 (Boeh Ringer Corporation). Ambi/Rin and Te Trazuiclin was obtained from Nguma (Sig++a Ltd.). Also, Agarose was obtained from BRL (BRL).

[”S]-dATP is Amanyam I/Thana/Yonal (Amersha@I obtained from Nternat+ona+). Other chemicals are Obtained from BDH.

Methods of MA separation and cloning of DNA Pasteurella multocida DNA is Part of the method by Ito and Miura (Saguchi & Milira, 1953) It was isolated based on a modified method.

Cells were collected by centrifugation, buffered H (0.15M NaCl, O, 1M EDTA, Washed with pH 8,0).

After washing, turbidize the culture solution with the same buffer solution so that the I/IO is the same as the initial volume of the culture solution. Ta.

Lysozyme (1g/ml) was added and the mixture was incubated at 37°C for 130 minutes. Cubated. It was then rapidly immersed in a dry ice/ascento bath. Continued A solution of (0,1M Tris-HCl, O,IM NaCl 1,1% (W /11) SDS, 50 u g/ml proteinase K.

8 volumes of pH 9) were added and the mixture was incubated at 60° C. for 10 minutes. It was then rapidly frozen. After thawing at 60°C for 130 minutes, an equal volume of phenol ( Maniatis et al., 1982), and the suspension was Stir gently for an hour.

The suspension was centrifuged and the aqueous phase was re-extracted with phenol, remaining after phase separation - The phenol was removed from the aqueous phase. The resulting aqueous phase was treated with a dialysis solution (50++M ) against squirrel-HC1, lomM EDTA, 10ugly M NaCl, pH 8) and underwent dialysis. The gf-1 obtained by i3 folding was subjected to the method of Maniatis et al. 19N). So The purified DNA obtained was stored at 4°C.

Genomic DNA obtained from Pasteurella multocida was segmented with restriction enzyme 5aullA. A fragment consisting of 10 kilobases (Wb) was obtained by digestion. digestive product The substances were fractionated by sugar density gradient centrifugation (Manlatis ol SL,... 191!2). Fractions containing fragments between 7 and 12 kb in size were then selected. system The enzyme-treated DNA was ligated into pAT153 overnight at 15°C. child pAT+53 was previously treated with BamHI and phosphatase. . Strain H8101 obtained from BRL was transformed. and transformed microorganisms The cells were plated on agar medium containing anopinoline (20 Gμg/l). overnight at 37℃ After culturing, the obtained 6500 bacterial colonies were treated with tetracycline (12 Ng / Affect 1)-containing agar medium. 2500 Anopi/Rino Resistant (Apr) Tet Toxicity of racyclino-sensitive (Tc’) colonies to beef tallow genjime (EBL) cells was adjusted by the overlay method (Chanter et al, l1g6m). Beta. and at −70°C in 12% glycerol in microtiter plates. saved.

Plasmids were generated using the method of I, Nyuhoro Ikun, and Park (1sh-Horo 豐). Itz & Burke, 1981). Other molecular biology The technique is described in Maniatis et al. (1982). Based on.

Determination of the nucleotide sequence (/-que///g) The 7-nucleotide sequence of DNA is Taq polymerase kit and Applied Bio/Stems (App) Lied Biosys+avs) 370A It was carried out according to the instructions. The recombinant plasmid obtained from TOX2 was pαI + and the 4.9 Kb fragment was run on an agarose gel. Separate, non-clean: / (Geneclean, 5tra + ech 5ci entific, London) was extracted using Alu Digested with + or 5aullA, M13 (u+lo, ap18 or randomly insert or fragment into M13 (mplo, p19) mp18 or ++p+9) Gel as above before using Manufactured.

protein sea fencing Protein 7-Kninsing is an online 120A-PTH amino acid fraction. Molecule Pride Bio 7 Stem 447A Gas Liquid Protein/-Quencer It was carried out according to the instructions.

Cloning of toxin genes 2500 Ampinrin Resistant (Apr) Tetracycline Sensitivity with Insert Sequence One clone (TOXI) of the competent (Tc”) colonies is associated with toxin production. It was positive. Plasmid pAJL12 obtained from this clone was After purification and testing, all of them showed toxicity.

Analysis of toxin genes Plasmid pAJLl2 contains a lo, 7kb insertion sequence. Figure 1 The restriction map shown in is not a normal one. Because the insert array is )Ipal+ or This is because it is not cleaved by Mspl or cleaved by Haell+ three times. It is only disconnected. These three types of restriction enzymes are guanine (G) and It recognizes only a 4-base pair sequence consisting of (C). This means that the G+ of DNA This suggests that the C ratio is quite low. Restriction enzymes Dra I and 9pe+ are Recognizes a 6 base pair sequence consisting only of adenine (A) and thymine (T), each with a small amount Cut the insert sequence at least 9 and 11 times (results not shown). , 4 solera ・Genomic DNA was obtained from Multocida [5], and the obtained DNA was subjected to Hpal and BiHpa! (2) and subjected to electrophoresis. Then, the 7 lags of the inserted sequence Southern blotting of the gel was performed using the sample as a probe. As shown in Figure 2, Most of the DNA is destroyed by Hpal+ into fragments smaller than 4kb. was made into

However, multiple distinct bands of high molecular weight were observed. And about 15k Band b was hybridized with the probe. 3 other toxicities The single 11f DNA of Pasteurella multocida is also HpaI, which has a similar molecular weight. +Fragment reacted with the probe. Approximately 6kb contained in Hpal digestion product fragment reacted with the probe.

This suggests that simple methods of cloning this gene or its variants Therefore, we extracted large Hpa[+7 fragments and also extracted such fragments. It could be inserted into a suitable vector.

The Hpa+7 fragment obtained from the inserted sequence of pAJL12 was used as a probe. In this case, probes and hybrids from a clone library consisting of 2500 colonies There were 12 colonies that bred, but in the EBL overlay test When tested, none produced toxins. These hybridized colo Preliminary analysis of the plasmids revealed that they contain plasmids of different sizes. Okay, but none of them contained the toxin gene.

subcloning Plasmid pAJL12 was partially digested with 5aullA and consisted of approximately 5 kb. I created a fragment. This corresponds to the estimated size of the toxin gene. 5 Select a fragment of 8kb to 8kb that has been previously cut with BamHI and g) Regenerated into fatase-treated pAT+53. The recombinant was transferred to EBL Toxicity screening was performed using the Burley test. And recombination I had a body. Then, a restriction map of this recombinant was created (Fig. 1), and it was found that pA Located at one end of the insertion sequence of JL12, approximately 0.0. lkb It had a manufactured arrangement. The insertion sequence in the opposite direction from pAJL12 includes at least In one construct, a gene cannot read its own promoter. be.

Purification and toxin properties The toxin contains ambinrin and is grown on an agar medium, and the lysis method of Limku and Broden is used. Toxic recombinant T prepared by the method (Rutter & Brogden) Purified from crude extract of OX1 or TOX2. This crude extract was treated with RNase, With DNase, benzamidine and phenylmethylsulfonyl fluoride Processed. and DEAE Sephacel chromatography and preparative polyamide fractionated by acrylamide gel electrophoresis (ChanLer et al. , 1986b) In the final step, C1, the purified toxin is electrolyzed from polyacrylamide. is eluted. The position of the toxin in each fraction is determined by its toxicity to EBL cells. (Rutter & Luther, 19g4) Analysis of purified toxin from body large intestine @ (g, eoli) Toxin purified from recombinant Regarding the homology and molecular weight of naturally occurring polypeptides, SDS polyacrylic Evaluated by amide electrophoresis. SDS polyacrylamide electrophoresis Based on the method of Laemmli (Laemmli, 1970), the gel was also silver stained (Ch Ancer et al., 1986b).

Throatbiotic pigs (Chanter et al., 1986b) 1 and against the toxin purified from Pasteurella multocida. (A) enzyme-linked immunosorbent assay (ELISA), immunoplot , cytotokinoneutralization test (Rutter & Luther, +984) recombinogenic similarity by cross-immunoelectrophoresis (Moore, 1985). As a result of the investigation, the similarities were recognized.

In ELISA, each microtiter plate 1/-t (Falcono Becton D ・1 Kenoson, Falcon-Becton Dickenson), different Add 100 μl of carbonate/bicarbonate buffer (pH 9,6) containing the toxin at The walls of each well of the plate were coated with toxin after being left overnight. Then the surfactant Phosphate buffer solution (PBS/Tveen) containing (0.03% Tveen 20) Washed with. Then add 1% dehydrogenated skim milk (matrix) to PBS/Tveen solution. Lebell, Cadbury Ltd., Marvel, Cadbury Ltd.) , further added pig antiserum to prepare a series of pig antiserum dilutions, and diluted with different concentrations. Incubate the plate for 1 hour at 37°C with a solution containing swine antiserum. I did it.

The plates were washed three times with PBS/Tveen solution and treated with horseradish peroxidase. Conjugation 1:5OOO Rabbit Anti-Pig Immunoglobulin (Nordi Immunological ・Laboratories, Nordie Immunological Labora Add 10μ+ of each well (incubate at 37°C for 3 hours). I set it. After incubation, wash the plate again and incubate with 10 μm 2N sulfuric acid. o-o buffered to pH 5°0 with citric acid/hydrogen orthophosphate upon quenching. ts% hydrogen peroxide to 100 μl of 0.04% 0-phenyl diamine The plates were therefore processed to develop color. Control wells also contain antigen or porcine anti-blood It was treated in the same manner except for the supernatant. The absorbance of each well was measured using a titretefuku microprobe. Rate reader (Titretec Mieroplate Reader) I measured it with this.

Proteins separated by 5O3-PAGE were analyzed using the method of Tovbin et al. Atal, 1979), Biorad! 2 Transblot apparatus (Transblot apparatus) manufactured by the manufacturer Immunoplots were performed using the protocol recommended by .

Toxicity assays were performed using EBL cells (Rutter & Luther, 1984). ) and the snotty pig (Rutter & Mackenzie, +984) and Bio-Rad's Koomann-staining. The protein 7s degree was estimated by the binding method.

N! from recombinant TOXI and TOX2 (Figure 3). i! The toxins passed It has the same high molecular weight as the toxin purified from T. multocida strain LFB3. ◇Comparing production and purification level, TOXI produces 5 times more toxins than TOX2. , and produced 10 times more than Pasteurella multocida. Also, Pasuru U Maru Similar to Toshida, both recombinants also have a vague band above the Tita band. It was done. For ELISA, checkerdate titration of toxins (Chequerb microtiter plate by titration) toxin and purified toxin from Passorella multocida Dilutions/reeses of otic pig serum were prepared. Pasuruu Malt/Dakara 18 g 7 ml for the toxin obtained or the toxin obtained from the toxic recombinant. The coating buffer is the optimal coating concentration of antigen. At this concentration, serum contains all toxin samples. showed the same titer consisting of 10'. The serum of the control group was free of any toxins. It did not react to the sample either.

In the cytotoxin neutralization test, the titer of swine serum with nodobiotic Toxin purified from T. multocida or recombinant, 10 cytotoxins It was 103 per rank.

Throatbiotic swine response to purified toxin from Pasteurella multocida Cross-immunization of toxins obtained from Pasteurella multocida or recombinant against antiserum Electrophoresis was performed. As a result, a single peak consisting of several closely spaced peaks A precipitate with a typical pattern was obtained (Figure 4). 5DS-PAG The same silver-stained sample of E consists of only one major band. , the blurred band is slightly shifted toward higher molecular weights.

12 recombinants that react with the Hpa I fragment of the inserted sequence of pALJ12? In the immunoproducer analysis of the whole lysate products of the three recombinants selected from Throatbiotic pig serum and anti-toxin purified from fern LFB3 strain There were three corresponding polypeptides. These each have a molecular weight of 76.000. 72,000 and 48,000. Toxic recombinant TOXI and TOX Identical bands were present in all lysate products of 2.

Amino acid analysis of hydrolysis products The attached results (Table 1) show that glinone and alanine are present. This meant that the sample contained a large amount of This is due to Grinnon peak. Depending on the method of natural/staino It's impossible.

We first used the test f4 included in Tris/Guri/Noloff1i&, and An attempt was made to remove proteins contained in the solution by treatment with 0% acetonate. 16 hours After standing at -20°C, protein remained in the supernatant. The first array is tris / obtained from a sample contained in glinone buffer, but due to interference from glinone, it was initially I didn't know the location.

? ? ? KHFF(P)SDFT, VKPVDF Menprano (trademark Immunopyro) An attempt was made to remove glycine using the following procedure.

A 1 cm square PVDF membrane was soaked in ethanol, 50% ethanol/water and then After that, they were soaked in order so that only water was left. After this, heat wrapped in aluminum foil. PVDF memplano was placed on the block (55°C). And this Menplan A sample (30 μg) was placed on the plate in 3 doses of 30 μl each and dried. After that, In order to remove non-contaminants, menpuran was washed with HPLC-grade water. The central part of the membrane containing the quality was cut out and subjected to /- quencher.

(M) KIKHFFNSDFTV At this point, the ends of the array are occluded and are probably undergoing repair.

This shows the N-terminal sequence of the toxin, which is similar to the suggested amino acid sequence. Since it does not match (the first inoloinno is threoni 7), the amino acid data It seems that an error occurred.

Partial sequence data is as follows.

The DNA insertion sequence consisting of a single strand is sample No. 2-33.1ol-124, Al- 24 (minus A17 and A21), and B1-24.

IAI sample NO46 ACAATTAGAGGAGCNGTTANAGGAAGCTATTGAAAG AGGACAGAGGGCAATCTCCIAH sample NO12, 3, 8, l01 11.14.16.17.19, CCTAGTTTCGATTTTAAGGCT TTTGAGAC-29basesI AH sample N014.5.7.9.1 2.15.18.20.21.24GCTTGAAGATAGTGATGTAC AGATTAGAT -29basesIAI Sample No. 110.118, +19.120, +21.123, B3AGTA -54bases IAI sample No. B10 CGCGATATGGGCGCCGGCANTNATCNG -470base sTable 1 Amino acid analysis data MOLARI Enter M of 5 selected AA in F7 117. OER Engineering A) (2EnterlowestNofor Ajl, 1nFB 90.0 91　92　930LES SER155119,2###### 123.21GLY OO,00,0 00,000,00ALA　OO,00,000,000,00cys　o　o , o　o, oo　o, oo　o, o.

VAL 83 63.864.56 65.26 65.97 MET 82 6 3.163.78 64.48 65.18 total amino acids (^^): 131 6.92 Molecular weight (MW) based on column F: 15736 + all samples Picomo Le: 3g, 89 or 0, o<nM Paper sample Picomole: 1.50 Total weight: 6.12μg Most of these data are taken from the estimated sequence data in Figure 7. Change. The anomalies in these include Because it was set to zero, protein was not detected, and asparagine and asparagus were detected. This is likely because glycine is indistinguishable from acids, but glycine is contained in the buffer solution. ).

Example 2: Division of 3T31iB cells Natural Pasteurella multocida toxin (PMT) in mouse Swiss 3T3 cells were grown to confluence and static to assay for whether they modified the cleft response. 3T3 cells were washed and transferred to media with increasing concentrations of PMT. 40 minutes in After quinipane injection, cumulative [3H]-thymidine uptake was measured. we showed that PMT is a very potent NA synthesis inducer in Swiss 3T3 cells. I discovered that. o, 32++g/++I (approximately (1,2pM) is 50% effective Obtained. 100% efficacy was obtained at 1.25 ng/if. This 100% effective The result was the stimulation of DNA synthesis and withdrawal induced by the medium containing 10% tallow serum. be. Therefore, known mitogens (mitogens) for Swiss 3T3 cells. ), PMT at picomolar concentrations elicits other synergistic effects. induces maximum DNA synthesis without the need for additional factors.

We also found that rPMT had a potency comparable to that of the natural toxin in Swiss 373 cells. It was discovered that the amount of hydration stimulates the formation of DNA. O, I 5ng151 (about 0. 50% efficacy was obtained at 1 pM). 100% efficacy is 1, 25ng/ml ( 0.83 pM). In contrast, plus Fission activity was observed in some extracts derived from E. coli transformed with Mido. There wasn't. Therefore, the following experiments were performed using M recombinant toxin.

Many bacterial toxins bind to the outer surface of the plasma membrane and are taken into cells. . Therefore, it is difficult to remove even if you wash it or try to neutralize it with antibodies. this In order to investigate whether rPMT exhibits a mitogenic effect in this way, The plated 3T3 cells were incubated with 15 or 20 ng/ml of rPMT. In order to increase the ink wash, the processing time was varied in several ways]. cells for 30 minutes When exposed to PMTI of 20 ng/cm, even after thorough cleaning, Furthermore, even if incubation is performed using a medium that does not contain toxins, [3) (] - thymidine Uptake of the protein was carried out by subsequent incubation in a medium containing rPMT. = low concentration of rPMT resulted in maximum D after removal of unbound toxin Requires longer pretreatment time to induce NA synthesis. Therefore, rPM The strong fission effect of T persists even after removal of the rPMT-containing medium. other fruits In experiments, cells were treated with 5 ng/ml rPMT for various times and Transferred to medium with or without PMT antiserum. Cells are 5ng/mlrP When treated with MT for 1 hour, the DNA was transferred to a medium containing antiserum. Synthesis was markedly inhibited. In contrast, for a 3-hour treatment, antiserum was added However, the mitogenic effect was not inhibited. Therefore, r PMT is time-dependent , it is likely that the antiserum is contained within the inaccessible funobone/t.

r　Cell proliferation by PMT stimulation Cell number ((3H) to acid-precipitated samples, regardless of confluence and stationary cells) If cell number (rather than midine uptake) is observed over several days, switch The mitogenic (mitogenic) activity of rPMT contained in the culture of S3T3 cells. Gender is also accepted. Confluent and quiescent 3T3 cells are grown in a medium (ip depleted By adding IOng/ml of rPMT to the medium), the density dependence is increased. There is no growth inhibition (i.e., the number of cells is approximately doubled compared to the control group after the addition of aEi). become. rPMT stimulated the resumption of cell proliferation in a concentration-dependent manner. In other experiments, Addition of rPMT to subconfluent 3T3 cells rapidly increased cell proliferation. final saturation Density increased 6 times.

Based on these results, we concluded that - next r PMT treatment is effective in the absence of toxins. We investigated whether this was sufficient to stimulate cell proliferation in menium. Stand still After treating cultured 373 cells with 10 ng/ml rPMT for 24 hours, Wash and trypsinize and seed the medium free of toxins. Ta. As a result, the proliferation of rPMT pretreated cells was significantly increased.

Example 3: Effect of rPMT on DNA synthesis and cell division B in other cells Some mice containing a1b/c line 3T3 cells, NIH-3T3 or 3T6 By growing cell lines to confluence (Balb/c and NIH-3 T3) or by incubation with 0.5% serum (3T6). When left undisturbed, these cell lines showed significant reactivity to rPMT and Cell proliferation is rapidly promoted. The dose-dependent response curve to the stimulus of DNA synthesis is The results are similar to those obtained with Isu3T3 cells. Interestingly, the toxin was found in mouse embryos. DNA synthesis and cell proliferation in tertiary cultures of cells were also stimulated. r　P　M　T The proliferation-promoting effect of is not limited to mouse cells. Table 2 shows rPM T stimulates [3H]-thyminono uptake in static culture of human fibroblasts. Which indicates that. In these cells, PDGF+EGF or more than FGF Toxins are more effective. The effect of rPMT is marked by the presence of these factors (Table 2).

(Hereafter, margin) Table 2 [”H]-thymidine incorporation In the absence of rPMT In the presence of rPMT Incolin 16 75 rFGFb 28 82 EGF 38 104 PDGF 33 119 In Table 2, the numerical values are the average values of two measurements, and the unit is cmpXIo-' It is.

The af of each factor is r　PMT　(long/ml); /ml) ; r F GF b (Sng/ml): E G F (Sn g/ml); and PDGF (long #I). .

10% FBS gave uptake of 139Xlo'epw in the presence of rPMT.

0.5 in static culture using human foreskin fibroblasts that have been passaged 18 times. % FBS for 4 days.

The following abbreviations were used: PMT - Natural toxin rPMT - Pasteurella ma Root/flR PDGF - Platelet-derived growth factor EGF - Epidermal growth factor rFGDb - Recombinant fibroblast growth factor (Baenbuk) PDBu - Folpol 12.13 dibutyrate FBS - Fetal bovine serum DMEM - Dulbecco modified eagle menium (hereinafter referred to as margin) References Chanter, N., Rutter, J.M. and Luther, P. D (1986a), Rapid detection of toxicity c Pa5teurella multocida by an agarov erlay method, Veterinary Record 119. 629-630゜Chanter, N., Rutter, J.M. and Ma. Ckenzie, A. (1986b).

Partial purification of an osteolyti c toxin from Pasteurella multocida, J internal of General 14icrobiology132, 1 0B9-1097° Chanter, N & Rutter, JM (19B9)”Pa5te Urella and Pasteurellosis” 161-195°Ch eville, NF et al (1988) Vet Pathol 25.518-520゜Elling, F et al (198B) Al 'MIS　96.50-55゜Ish-Horowitz, D and Bur ke, JF (1981), Rapid and smid cloning, Nucleic Ac1ds Re5search 9.　2989-2998゜ Jones, P.W. and Matthews, P.R.J. (1975) , Examination of slurry from cattle fo r　pathogenic　bacteria,　Journal ofHyg iene, 74.57-64゜Kume K, & Nakai T (19 E]5) Jpn J Vet Sci 47(5), 829-833-La Ernmli, [, IK (1970), Cleavage of 5t ructural proteins during the assembly of bacteriophage T4゜Nat ure　227,681-685゜Maniatis, T, Fr1tsch , E. F. and Sambrook, J. (1982).

°’Mo1ecular Cloning: A Laboratory Ma nual °’ Co1d Spring Harbor Laboratory , Co1d Spring Harbor, NY (and 2ndEditi on thereof).

Matthe S, I (W D, Zenke, W H, Grundstro m, 'r, 5tau1. s, A.

Wintzerich, M. and Chambon, P. (1984) E. MBOJ 3. 801-805゜Nakai, T & Kume, K (19 87a) FEMS Microbiol Lett 44.　259-265゜ Nakai, T & Kume, K (1987bl Res Vet S ci　42. 232-237M0Ore, LJ & Rutt, er, J M (1987) Antlgeni, c analyzes, ts offimb real proteins from Moraxella bovis, J　C1C11nicalNicrobiolty　25. 2063-207 0-Rimler, R.B. & Brogden, K.A. (1986), AmeriCan jOwn(110fVer:erJ, nar')'Re5 earC1), 47,730-737 Ruoslahti, EI & Pier schbacher, M.D., WO84100540 Rutter, J.M. (1983), Virulence of P multocida in atrophicrhinitis of gnotobiotic pigs 1nfected withE bronchiseptica, Re5ea rch in Veterinary E; science, 34゜287-29 5゜ Rutter, J.M. & Luther P.D. (1984), Ce1l culture assay fortoxigenic Pa5teure lla multocida from atrophic rhinitis ofpigs, Veterinary Record 114.393-39 6゜Rutter, JM and Mackenzie, A (1984), Pathogenesis ofatrophic rhinitis in Pigs: A new perspective.

Veterinary Record 114. 89-90゜5aito, H and Miura, K. (1963), Preparation oftr. transforming deoxyribonucleic acid by Phenol treatment.

Biochimica et Biophysica Acta 72.619 -629゜￥amada, KM (1983) Ann, Rev, Bi ochem, 52.761-99EXAMPLE 1. F Engineering GURE 2EX AMPLE l, F engineering GORE 3EXAMPLE l, FIGURE 4F engineering GURE 5 :↓, 7: Kuwa Sen 7;-%-p:.

? , -Σbit'd -゛-゛'-゛-'-0・L,・y '-# FIGURE 6A FIGURE 6B international search report lIIm+n++e+v-^66--ca+-o-me, PCT/GB 90 100992

Claims (16)

[Claims] 1. A pharmaceutically acceptable non-immunogenic composition, the composition comprising: multocida toxin or a variant or fragment thereof and one or more carriers or 1. A pharmaceutically acceptable non-immunogenic composition comprising: 2. A composition according to claim 1, which is suitable for topical administration to the skin or cornea. 1. A pharmaceutically acceptable non-immunogenic composition suitable for. 3. A composition according to claim 1, which can be administered to or around a wound. 1. A pharmaceutically acceptable, non-immunogenic composition suitable for. 4. A method for promoting wound healing in a mammal, the method comprising: A method for promoting wound healing in mammals, which comprises administering the composition according to item 1. Law. 5. A medium for culturing cells, including the toxins of Pasteurella multocida. or its mutants or fragments, and culture other than Pasteurella multocida. A cell culture medium characterized by being suitable for cultivating cells. 6. The medium according to claim 5, wherein the serum contained in the medium is 2 % or less. 7. A method for growing cells other than Pasteurella multocida, the method comprising: in a medium containing T. multocida toxin or a variant or fragment thereof. A cell proliferation method characterized by comprising cell culture. 8. A method for producing a biological product from cells, the method comprising: characterized by comprising proliferation of cells in a medium containing the toxin of Lella multocida cell proliferation method. 9. 9. The method of claim 8, wherein the biological product is Characterized by being a gene expression product of recombinant DNA or a monoclonal antibody Cell growth methods. 10. A method of proliferating cells or promoting the proliferation of cells, the method comprising: adding Hepasteurella multocida toxin or a variant or fragment thereof. Characteristic cell proliferation method. 11. Pasteurella multocida toxin or a variant or fragment thereof, Cells characterized by exhibiting proliferative properties upon exposure to fragments. 12. a conjugate of Pasteurella multocida toxin or a variant thereof or A conjugate comprising a fragment and a means for binding to a specific cell type. 13. 13. The conjugate of claim 12, wherein said toxin or fragment thereof is A conjugate characterized by stimulating a specific cell type to proliferate. 14. A method for stimulating specific cell types in a mammal for proliferation, the method comprising: comprising administering to said mammal a conjugate according to claim 13. A cell stimulation method characterized by: 15. a conjugate of Pasteurella multocida toxin or a cell-bound variant thereof; characterized by consisting of a body or cell binding site and a pharmaceutically acceptable compound conjugate. 16. A method of delivering a pharmaceutically active compound to a specific cell type in a mammal, the method comprising: comprises the administration of the conjugate according to claim 15. A method of delivering active compounds to specific cell types.