JPH0541988A - Production of rat bfgf protein - Google Patents

Abstract

PURPOSE:To obtain the subject protein useful for medicines, reagents, etc., in an industrially advantageous way by cluturing a transformant having a vector containing a base sequence coding rat basic fibroblast growth factor protein and T7 promoter at an upstream site of the protein. CONSTITUTION:A plasmid incorporated with a gene coding rat basic fibroblast growth factor (bFGF) protein is treated with restriction enzyme EcoRI to take out the DNA fragment coding rat bFGF, and this fragment is introduced into a vector plasmid followed by mutation using a relevant primer to effect conversion of the gene so that the amino acid just before a matured-type rat bFGF is Met; along with this, restriction enzyme ndeI-recognition site is introduced into the gene which is then nicked with restriction enzymes NdeI and Bgl followed by binding T7 promoter to the gene, thus obtaining the objective vector containing the base sequence coding rat bFGF protein and the T7 promoter at its upstream site.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to rat basic fibroblast growth factor (hereinafter referred to as rat bFGF in the present specification).
Sometimes abbreviated. ) A technique for producing a protein.

[0002]

BACKGROUND OF THE INVENTION bFGF is a basic polypeptide hormone with a molecular weight of about 17,000 that is secreted mainly from the pituitary gland, and was originally isolated as a factor showing a strong growth-promoting effect on fibroblasts such as BALB / c3T3 cells [D. .Gospo
darowicz; Nature: 249 : 123 (197)
4)]. However, it was subsequently found to have a growth promoting effect on almost all cells derived from mesoderm [D. Gospodar.
owicz et al .: National Cancer Institute Monograph
h) 48 ; 109 (1978)]. Among them, the angiogenic action of bFGF, together with the cell growth promoting action, characterizes this factor. The gene encoding rat bFGF is
Kurokawa et al. (Nacleic Acids Research 16 : 5201,198
8, Japanese Patent Laid-Open No. 63-307898).

[0003]

[Problems to be Solved by the Invention] When a recombinant protein is produced using Escherichia coli, it is often accumulated by forming a water-insoluble inclusion body. When the target substance is isolated and purified from such inclusion bodies, a method of adding a protein denaturing agent to solubilize the target substance is usually employed. However, even if the above-mentioned gene encoding rat bFGF is expressed and accumulated in Escherichia coli and such a solubilized protein is prepared, the solubilized protein is inactive and reactivated. The technology to do so has not been established yet. Therefore, if it is possible to accumulate rat bFGF in a large amount in an active state using a genetic engineering technique and to isolate and purify it in a high yield, it is particularly advantageous when used as a drug, reagent, etc. Establishing a good production method is an important issue.

[0004]

[Means for Solving the Problems] Generally, when a gene product is mass-produced using a genetic engineering technique, selection of a host-vector system and a promoter is an important issue, and it differs from gene to gene. The present inventors have found that rat bFG
As a result of various studies on an efficient expression system of F, an Escherichia coli gene expression system using the T7 promoter for expressing rat bFGF gene [FW Studier et al., Journal of Molecular Biology 189, 118-].
130 (1986)] was found to be excellent. Furthermore, although this T7 promoter is known to be a strong promoter, the accumulated proteins sometimes form inclusion bodies and the like, and most of them accumulate in an inactive state. Therefore, various studies were repeated in order to accumulate a large amount in the active state, and an efficient isolation and purification method was found. As a result of further research based on these findings, the present inventors have completed the present invention.

The present invention provides (1). A nucleotide sequence encoding a rat basic fibroblast growth factor (bFGF) protein and a vector containing a T7 promoter upstream thereof,
(2). A method for producing rat bFGF, which comprises culturing the transformant carrying the vector according to (1) above and (3). The transformant according to (2) above in a medium.

The rat bFGF protein of the present invention includes:
Rat bFGF and its muteins are mentioned. As the rat bFGF, in the sequence shown in FIG. 1 and FIG. 2 (sequence listing: SEQ ID NO: 1), the Pro next to the N-terminal Met is the first and the C-terminal Ser is the 145th.
Examples include peptides consisting of individual amino acids. Further, it may have Met added to the N-terminal. The mutein is a mutation in the amino acid sequence of the original peptide or protein. Therefore, the mutation includes addition of amino acids, deletion of constituent amino acids, and substitution with other amino acids. The addition of the amino acid includes
Examples thereof include those having at least one amino acid added. Examples of the deletion of the constituent amino acids include those lacking at least one rat bFGF constituent amino acid. Examples of the substitution with the other amino acid include substitution of at least one rat bFGF constituent amino acid with another amino acid. The at least one amino acid in the mutein in which at least one amino acid is added to rat bFGF does not include a methionine attributed to the initiation codon used for expressing the peptide and a signal peptide.

The number of added amino acids is at least 1, but any number may be used as long as the characteristics of rat bFGF are not lost. More preferably, rat bFG
Homology (homology) with F has been recognized, and some or all of the amino acid sequences of proteins showing similar activity can be mentioned. At least one rat b of rat bFGF
The number of constituent amino acids missing in the mutein lacking FGF constituent amino acids may be any number as long as the characteristics of rat bFGF are not lost. Rat bFG
In the mutein in which at least one rat bFGF-constituting amino acid of F is replaced with another amino acid, the number of at least one rat bFGF-constituting amino acid before substitution may be any number as long as the characteristics of rat bFGF are not lost. Good.

Examples of constituent amino acids before substitution include cysteine and other than cysteine.
Cysteine is particularly preferred. Examples of constituent amino acids other than cysteine as the constituent amino acids before substitution include aspartic acid, arginine, glycine, valine and the like. When the constituent amino acid before substitution is cysteine, the substituted amino acid is preferably, for example, a neutral amino acid. Specific examples of the neutral amino acid include glycine, valine, alanine, leucine, isoleucine, tyrosine, phenylalanine, histidine, tryptophan, serine, threonine and methionine. Particularly, serine and threonine are preferable. When the constituent amino acid before substitution is other than cysteine, another amino acid that is substituted is, for example, the amino acid before substitution in terms of hydrophilicity, hydrophobicity or charge of the amino acid. Choose ones with different properties. Specifically, when the amino acid before substitution is aspartic acid, examples of the amino acid after substitution include asparagine, threonine, valine, phenylalanine, and arginine, with asparagine and arginine being particularly preferred. When the amino acid before substitution is arginine, the amino acids after substitution are glutamine, threonine,
Examples thereof include leucine, phenylalanine, and aspartic acid, with glutamine being particularly preferred. When the constituent amino acid before substitution is glycine, examples of the amino acid after substitution include threonine, leucine, phenylalanine, serine, glutamic acid, and arginine, with threonine being particularly preferred. When the constituent amino acid before substitution is serine, examples of the amino acid after substitution include methionine, alanine, leucine, cysteine, glutamine, arginine, and aspartic acid, with methionine being particularly preferred. When the constituent amino acid before substitution is valine, examples of the amino acid after substitution include serine, leucine, proline, glycine, lysine and aspartic acid, with serine being particularly preferred. As the original constituent amino acids before substitution, aspartic acid, arginine, glycine, serine and valine are preferable. As the amino acid after substitution, asparagine, glutamine, arginine, threonine, methionine, serine and leucine are preferable. The most preferable substituted mutein is one in which cysteine, which is a constituent amino acid, is replaced with serine. The mutein may be a combination of two or three of the above additions, deletions and substitutions.

To produce the mutein, a site-directed mutagenesis technique is adopted. The technique is well known and is described by L.F. Racer (Lather, RF) and Jay P. Lecoq (Le
coq, JP), Genetic engineering (Gene
tic Engineering), Academic Press (1983)
(Year) pages 31-50. Oligonucleotide-directed mutagenesis is by Smith, M.
And Gillam, S., Genetic Engineering: Principles and Methods, Plenum Press (19)
81) 3 vol. 1-32. (a) A single-stranded DNA consisting of a single strand of the rat bFGF structural gene is hybridized with a mutant oligonucleotide primer (a codon for cysteine that should be replaced by this single strand, or in some cases paired with this codon). The above-mentioned primer is complementary to the region containing the antisense triplet, provided that the mismatch between the codon for the other amino acid encoding the codon, or in some cases the antisense triplet, is not limited to this. ), (B) extend the primer with DNA polymerase,
Form a mutant heterodimer,
And (c) replicate this mutant heterodimer. Next, a phage DN carrying the mutated gene
A is isolated and integrated into a plasmid. A mutein can be produced by transforming an appropriate host with the plasmid thus obtained and culturing the obtained transformant in a medium. As the T7 promoter used in the present invention, 17 kinds of promoters found on T7 DNA [JL Oakley et al., Proc. Natl. Acad.
Sci, USA, 74 : 4266-4270 (197).
7), MD Rosa, Cell 16 : 815-825 (197).
9), N. Panayotatos et al., Nature 280 : 35 (197).
9), JJ Dunn et al., J. Mol. Biol. 166 : 477-5.
35 (1983)], but φ10 promoter [AH Rosenberg et al., Gene 56 : 125-135 (1)
987)] is preferred.

Examples of the base vector used in the vector of the present invention include pBR322, pUC8, pUC9, p
MB9, pKC7, pACYC177, pKN410 and the like can be mentioned. The vector used in the present invention is constructed by incorporating a T7 promoter and a transcription terminator into the above vector. Such vectors include p
ET-1, pET-2, pET-3, pET-4, pET-5
[AH Rosenberg, Gene 56 : 125-135 (198
7)], but preferably pET-3C
[Id.] Is used. A transcription terminator is incorporated into the vector of the present invention. Examples of the transcription terminator include a terminator that operates in the system of Escherichia coli, preferably Tφ terminator [FW Studier
Et al., J. Mol. Biol. 189 : 113-130 (198).
6)] is used.

The host of the transformant used in the present invention is T7 RNA polymerase gene (eg, T7 gene 1) [FW Studier et al., J. Mol. Biol. 189 : 113.
-130 (1986)] incorporated E. coli strain, or
T7 RNA polymerase gene (eg, T7 gene 1)
And T7 lysozyme gene, that is, T7 gene 3.5
[FW Studier et al., J. Mol. Biol. 189 : 113-1.
30 (1986)], for example MM294, D
Any of H-1, C600, BL21, etc. may be used. Preferably, MM294 strain and BL21 strain in which λ phage incorporating T7 gene 1 is lysogenized or which holds a plasmid having T7 gene 3.5 are further used. In this case, the promoter of T7 gene 1 is the lac promoter whose expression is induced by isopropyl-1-thio-β-D-galactopyranoside (sometimes abbreviated as IPTG). In order to incorporate the T7 RNA polymerase gene, it may be directly incorporated into E. coli DNA, or a λ phage having the T7 RNA polymerase gene, such as DE3 [FW Studier].
Et al., J. Mol. Biol. 189 : 113-130 (1986)] may be lysogenized in host E. coli. The λ phage lysogenization method is preferably used. In order to retain the T7 lysozyme gene in Escherichia coli, it may be directly incorporated into Escherichia coli DNA, or it may be incorporated into another plasmid which can coexist, and the plasmid may be introduced into host Escherichia coli.
Preferably, a method of introducing and integrating on another plasmid is used.

The transformant used in the present invention is the above-mentioned R
A gene for expressing a T7 promoter, an E. coli strain into which an NA polymerase gene (eg, T7 gene 1) is incorporated,
Usual way e.g. Proc in plasmid carrying the transcription terminator Natl Acad Sci, USA 6 9: ... 211
0 (1972), Gene 17 : 107 (1982) and the like. In this case, the host to be used is transformed with a plasmid having the T7 lysozyme gene in advance, and the obtained transformant is 2
The plasmids of different species may be held simultaneously.

When culturing the transformant, a liquid medium is suitable as a medium used for culturing, and it should contain a carbon source, a nitrogen source, an inorganic substance and the like necessary for the growth of the transformant. Be done. Examples of carbon sources include glucose, dextrin, soluble starch, sucrose, etc.Examples of nitrogen sources include ammonium salts, nitrates, corn steep liquor, peptone, casein, casamino acid, meat extract, soybean meal, potato extract Inorganic or organic substances such as, and examples of the inorganic substances include calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like. In addition, yeast extract, vitamins, growth promoting factor and the like may be added. The pH of the medium is preferably about 6-8.

The medium for culturing the E. coli transformant is, for example, M9 medium containing glucose and casamino acid.
[Miller, Journal of Experiments in Molecular Genetics (Journal of Ex
periments in Molecular Genetics), 431-43
3, Cold Spring Harbor Laboratory, New Yo
rk 1972)] is preferred. Furthermore, you may use the culture medium which added the iron ion source to this culture medium. The iron ion source refers to a substance that becomes iron ions when made into a solution or a substance used in the form of iron ions, and examples thereof include iron salts. Preferably divalent or trivalent iron inorganic salt
(Eg ferrous chloride, ferric chloride, ferrous sulfate, ferric sulfate 2
Iron, ferric phosphate, ferric nitrate) and the like are preferable. The iron ion source is about 10 ⁻⁶ to 10 ⁻⁴ M, more preferably about 5 × 1.
0 ^{−6 to} 5 × 10 ⁻⁵ M is added. Culture is usually about 15 ~
It is carried out at 43 ° C. for about 3 to 72 hours, preferably about 12 to 48 hours, and if necessary, aeration and stirring can be added.

For gene expression, it is preferable to add IPTG during culture. As a result, T7 gene 1 (RNA polymerase gene) linked to the downstream of the lac promoter is expressed, and the T7 phage RNA polymerase 1 produced specifically operates the T7 promoter. In the prior art, expression of the lac promoter is 0.1-20 mM, preferably 1-2 mM.
It was found that the protein accumulated when the expression was induced by adding this concentration of IPTG may form an inclusion body and the like and be accumulated as an inactive body. Therefore, as a result of various studies on a method of accumulating in a dissolved state, it was found that the purpose can be achieved only by adding about 3 to 500 μM, more preferably about 6 to 200 μM of IPTG during the culture. In addition, in the case of large-scale culture such as tank culture, the amount of IPTG added is preferably about 10 to 500 μM, and in the case of small-scale culture such as flask culture, the amount of IPTG added is approximately 3 μM. It is preferably set to -100 μM. The first addition time of IPTG is about 1 to 24 hours, more preferably about 3 to 12 hours after the start of culture,
The logarithmic growth phase is preferred. Thereafter, they are added intermittently or continuously as needed. The temperature at which IPTG is added to the medium and cultured is about 20 to 42 ° C, more preferably about 20 to 30 ° C. Instead of isopropylthiogalactopyranoside, for example, propylthiogalactopyranoside, methylthiogalactopyranoside, butylthiogalactopyranoside, cyclohexylthiogalactopyranoside, etc. may be used in some cases.

The rat bFGF protein of the present invention can be separated and purified from the above culture by the following method, for example. When the rat bFGF protein of the present invention is extracted from cultured cells or cells, the cells or cells are collected by a known method after culturing, and disrupted with glass beads, French press, ultrasonic treatment, lysozyme and
(Or) Freezing and thawing is used. Especially, the method of crushing with glass beads is preferable. As a result of various studies on the method for purifying the rat bFGF protein of the present invention from the above supernatant, affinity chromatography using a crosslinked polysaccharide sulfate ester as a carrier, ion exchange using a synthetic polymer having a sulfonic acid group as an exchange group By combining chromatography and chromatography using the synthetic polymer for gel filtration as the carrier one or more times, a highly pure preparation can be obtained in an extremely high yield.

The crosslinked polysaccharide sulfate ester used in the present invention includes crosslinked cellulose sulfate ester,
Examples include crosslinked agarose sulfate or crosslinked dextran sulfate. The cellulose is preferably a polysaccharide in which glucose is β-1,4-bonded, and has a molecular weight of about 50,000 to 2,000,000. Specific examples thereof include crystalline cellulose Avicel (manufactured by Asahi Kasei Kogyo Co., Ltd.) and Cellulofine (manufactured by Chisso Co., Ltd.). The agarose is a polysaccharide that is a main component of agar and is [D-galactosyl- (β1 → 4)-
It has a repeating structure of 3,6-anhydro-L-galactosyl- (α1 → 3)]. Those having a molecular weight of about 10,000 to 5,000,000 are preferable. Specific examples thereof include Sepharose 2B, 4B, Sepharose 6B (Pharmacia (Sweden)) and the like. As the above dextran,
For example, D- mainly composed of α (1 → 6) bonds produced by the action of microorganisms such as Leuconostoc mesenteroides from sucrose
It is a glucose polymer and has an average molecular weight of about 1000 to
40 million are preferable.

The cross-linked polysaccharide sulfate used in the present invention is a cross-linking agent known per se from the above-mentioned polysaccharides such as dextran, agarose and cellulose.
For example, it is obtained by sulfuric acid esterification of a crosslinked polysaccharide obtained by crosslinking by a method known per se using a crosslinking agent such as epichlorohydrin or 2,3-dibromopropanol. Cross-linked polysaccharides are commercially available, for example Sephadex G-10, G-15, G
-25, G-50, G-100 (crosslinked dextran), Sepharose CL-2B, CL-4B, CL-6B (crosslinked agarose) can be purchased from Pharmacia (Sweden). Also, cellulofine (crosslinked cellulose)
It can be purchased from Chisso Corporation under the product name of. A known sulfuric acid esterifying agent such as chlorosulfonic acid or anhydrous sulfuric acid ester is allowed to act on these crosslinked polysaccharides to synthesize the desired crosslinked polysaccharide sulfuric acid ester. The crosslinked cellulose sulfate is sold by Seikagaku Corporation under the trade name of sulfated cellulofine (crosslinked cellulose sulfate). Examples of cross-linked dextran sulfate include sulfated Sephadex. Examples of the crosslinked agarose sulfate include sulfated sepharose. The crosslinked polysaccharide sulfate ester used in the present invention may be in a salt form. Examples of the salt include sodium, potassium, ammonium, trimethylammonium and the like.
The sodium salt is particularly preferable. The cross-linked polysaccharide sulfate ester used in the present invention is preferably water-insoluble and gelled in a hydrated state.

In the present invention, as a method for purifying and obtaining rat bFGF protein using a crosslinked polysaccharide sulfate, the method of subjecting to affinity chromatography described below can be mentioned. The rat bFGF protein-containing solution is an aqueous medium containing rat bFGF protein. Examples of the aqueous medium include water and those mainly composed of water, and buffer solutions such as phosphate buffer solution, citrate buffer solution, Tris-hydrochloric acid buffer solution in order to prevent inactivation of rat bFGF protein. At pH
Is preferably adjusted to about 3 to 10. Then the rat
The pH of the bFGF protein-containing solution is adjusted to a range of about 5.0 to 9.0, and the conductivity thereof is diluted with distilled water as necessary so as to be about 15 mmho or less. Obtained rat bFGF
The protein-containing solution is brought into contact with the crosslinked polysaccharide sulfate ester gel. For this purpose, either a batch method or a column method may be used, but the column method is more suitable in terms of easiness of operation. In the case of the column method, after pre-filling the column with the cross-linked polysaccharide sulfate gel, the column is thoroughly filled with an appropriate buffer solution such as 50 mM citrate buffer solution (pH 7.0) containing 0.4 M NaCl. Wash to equilibrate. The amount of gel used varies depending on the type of the rat b FGF protein-containing solution to be loaded, but it is approximately 1 to 5 per 1 mg of rat b FGF protein.
A range of 0 ml is desirable. Then, the above-mentioned rat bFGF protein-containing solution is loaded onto the column. The load speed can be selected within the range of SV = about 0.1 to 5.0. After loading, the column is thoroughly washed, and the ionic strength of the buffer is increased according to a conventional method to elute and collect the rat bFGF protein. To increase the ionic strength, salts such as NaCl are added or a high-concentration buffer solution is used so that the electric conductivity is about 15 mmho or more, more preferably 30 mmho or more. The elution method may be either a batch method or a concentration gradient elution method.
In the case of the concentration gradient elution method, for example, NaCl is gradually increased from about 0 to 2.0 M to elute and collect. In this way, extremely high-purity rat bFGF protein can be obtained in good yield.

Examples of the synthetic polymer having a sulfonic acid group as an exchange group used in the present invention include hydrophilic vinyl polymers, styrenedivinylbenzene polymers,
A polymer obtained by directly or indirectly introducing a sulfonic acid group into an acrylamide polymer or the like can be mentioned. Among them, SP (sulfopropyl) -Toyopearl (Tosoh Corporation) and SP-Cosmosil (Cosmo Bio Co., Ltd.) in which a sulfonic acid group is introduced into a hydrophilic vinyl polymer are used in terms of recovery rate and operability. preferable. When performing chromatography, the salt concentration of the partially purified rat bFGF protein-containing solution is adjusted to, for example, about 50 mM or less in the case of a phosphate buffer solution, and adsorbed to the above resin at a pH of about 5 to 7. The adsorption may be either batch type or column type, but column type is preferable from the viewpoint of operability. Elution from the resin is performed by increasing the salt concentration. The elution method may be a batch method or a method using a concentration gradient. When the batch method is used, for example, about 500 mM to 2 is added to the above phosphate buffer solution.
It can be carried out using a buffer solution in which NaCl is added so as to give M. Also, a citrate buffer may be used instead of the phosphate buffer. The temperature is about 1 to 25 ° C., preferably about 1 to 10 ° C., and about 4 ° C. is particularly preferable. Examples of the synthetic polymer for gel filtration used in the present invention include hydrophilic vinyl polymers and polyacrylamide polymers. Of these, Toyopearl HW (Tosoh Corp.), which is a hydrophilic vinyl polymer, is preferable in terms of gel durability and operability. When the partially purified rat bFGF protein-containing solution is treated with, for example, a Toyopearl HW-50F column, a phosphate buffer, a citrate buffer or the like can be used as a developing solvent. It is advantageous to use liquid (pH 7.0). The temperature is about 1 to 25 ° C, preferably about 1 to 10 ° C, but about 4 ° C is particularly preferable.

A method other than the above method may be used as one of the purification steps. In the method, for example, as a carrier for ion exchange chromatography, a carrier using a natural product such as cellulose, agarose, dextran, or an inorganic substance such as glass beads can be used. In addition, as a carrier for gel filtration, cellulose,
Gels mainly composed of natural substances such as agarose and dextran, and those based on inorganic substances such as glass beads can also be used.

The thus-obtained preparation can be dialyzed and freeze-dried to give a dry powder. Furthermore, adding and storing serum albumin as a carrier
This is preferable because it can prevent the sample from adsorbing to the container. Also, the coexistence of a trace amount of a reducing agent in the purification process or the storage process is suitable for preventing the oxidation of the preparation. As the reducing agent, β-mercaptoethanol, dithiothreitol,
Examples include glutathione. In this way, a substantially pure rat bFGF protein of the present invention, which is substantially free of pyrodiene and endotoxin, is obtained. As the substantially pure rat bFGF protein of the present invention, the rat bFGF protein of the present invention has a protein content of 95% (w / w) or more, more preferably the rat bFGF protein of the present invention is 98. % (W / w) or more.

Rat of the present invention obtained by the above method
The bFGF protein has the action of promoting the proliferation of fibroblasts, the action of promoting the proliferation of vascular endothelial cells, and the action of forming blood vessels. Therefore, the dose and the dosage are the same as those described in JP-A-63-307898. Can be used. It can also be used as a reagent for promoting cell culture. When the rat bFGF protein of the present invention is used as a reagent for promoting cell culture, 1 liter of medium
About 0.01 to 10 μg, more preferably about 0.1
It is preferable to add to the medium so that the concentration becomes ˜1.0 μg.

In the present specification and drawings, when abbreviations are used for bases, amino acids, etc., IUPAC-I
UB Commision on Biochemical Nomenclature
Or an abbreviation commonly used in this field, examples of which are given below. When an amino acid may have optical isomers, L- unless otherwise specified.
Show the body. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxy Cytidine triphosphate ATP: Adenosine triphosphate Tdr: Thymidine EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate Gly: Glycine Ala: Alanine Val: Valine Leu: Leucine Ile: Isoleucine Ser: Serine Thr: Threonine Cys: Cysteine Met: Methionine Glu: Glutamic acid Asp: Aspartic acid Lys: Lysine Arg: Arginine His: Histidine Phe: Phenylalanine Tyr: Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln: Glutamine In addition, in the amino acid sequence in which Met is added to the N-terminal of the amino acid sequence shown in the continuous sequence of FIGS. 1 and 2 (SEQ ID NO: 1), rat bFGF has the following amino acid numbers: Pro located at
It shall be counted as the second.

Plasmid p constructed in Example 1 below
Transformant E. coli MM294 carrying TB1168
(DE3) / pTB1168, pLysS has been deposited at the Fermentation Research Institute (IFO) and the Institute of Microbial Technology (FRI) of the Ministry of International Trade and Industry. The deposit numbers and deposit dates are shown in the following table.

[0026]

The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

Reference Example 1 Method for measuring rat bFGF activity using endothelial cells Rat bFGF activity was measured by the following method.
2 using Dulbecco's MEM medium containing 10% calf serum
50 μl per well was added to a 96-well microtiter plate (flat bottom, Nunc) at 50 μl per well, and a sample diluted serially was then purchased from the American Type Culture Collection. Cells (CRL1395) are seeded at 50 μl (4000 cells) per well and 10%
It was cultured under CO _{2 at} 37 ° C. for 3 days. On the third day, 3-
A 5 mg / ml solution of (4,5-dimethylthiazol-2-yl) -diphenyltetrazolium bromide (dissolved in phosphate buffered saline) was added at 40 μl per well. After 6 hours, add 10% SDS-0.01N HCl to 1
After adding each 100 μl and leaving it in the incubator overnight, the absorbance at a wavelength of 590 nm was measured using a titer tech multiscan [Tada et al., Journal of Immunological Methods.
Methods): 93, 157 (1986)]. Example 1 Preparation of recombinant rat bFGF producing recombinant A plasmid pTB784 (Kurokawa et al., In which a gene encoding rat bFGF (successive ones in FIG. 1 and FIG. 2 (see Sequence Listing, SEQ ID NO: 1)) was incorporated) was prepared. Nucleic Acids Re
search 1 6: 5201,1988) was treated with EcoRI, and cut out a DNA fragment encoding the rat bFGF. This fragment was incorporated into the EcoRI site of the plasmid pTB891 (see European Patent Application Publication No. 326,907) to obtain a mutation primer, CTCCGGC.
AGTGCGGGCATATGAGTGATGCTGC
C (Sequence Listing / SEQ ID NO: 2)
The gene was modified so that the amino acid immediately before the mature rat bFGF would be Met, and the restriction enzyme NdeI recognition site CA
Introduced TAT. Rat bFGF by mutagenesis
The modified sites of the gene are as follows. Next, the mutated plasmid DNA was digested with NdeI.
And digested with BglII and the resulting DNA fragment was inserted into the NdeI-BamHI region of plasmid pET3c to construct plasmid pTB1168 (FIG. 2). Next, λ phage DE3 (FW Studier et al., Journal of Molecular Biology, 189: 113-130, 1986) in which the RNA polymerase gene of T7 phage was integrated into Escherichia coli MM294 strain was lysogenized, and Escherichia coli was obtained. The MM294 (DE3) strain was created. This strain was used as a plasmid pLysS [FW Studie containing the T7 lysozyme gene.
r et al., J. Mol. Biol. 189 : 113-130 (198).
6)] and then transformed with the plasmid pTB1168 described above to give the recombinant Escherichia
coli MM294 (DE3) / pTB1168, pLysS (I
FO 15043, FERM BP-2944) was obtained.

Example 2 LB medium (10 g / l bactotryptone, 5 g / l bacto yeast extract, 5 g / l sodium chloride) added with 100 mg / l sodium ampicillin and chloramphenicol was added to a recombinant E. coli MM294 ( DE3) / pTB11
One platinum loop of 68, pLysS was inoculated and cultured at 37 ° C with shaking. IP when turbidity reaches 120 klet units
TG was added to 0.1 mM, and the culture was continued for another 3 hours. The cells were collected by centrifugation, and 50 μg / ml lysozyme solution (10% sucrose, 10 mM EDTA, 10
0mM NaCl, 1mM PMSF, 10mM Tris-H
Cl, pH 7.6) was added and left at 4 ° C for 1 hour.
The cells were disrupted by ultrasonic treatment and then centrifuged to obtain a supernatant. The biological activity in this supernatant was measured using the FG derived from bovine pituitary gland.
F was used as a control and DNA synthesis of BALB / 3T3 cells was used as an index [R. Sasada et al., Molecular and Cell].
ular Biology 8 : 588 (1988)]. The result is 1 liter of medium
The amount of bFGF produced per iter is shown below.

Example 3 (1) Cultivation of recombinant Escherichia coli and preparation of cell extract The recombinant Escherichia coli MM294 (DE3) obtained in Example 1
/ PTB1168, pLysS was cultured in M9 medium containing 1.5% glucose and 1.5% high case. K
When the lett value reaches about 500, IPTG is set to about 0.
It was added to 1 mM and the culture was continued for another 15 hours. After the completion of the culture, the cells were collected by centrifugation, and the amount of the cells was 5 times the wet weight of 25 mM phosphate buffer (pH 6.0, 0.0.
Suspended in 2 mM (p-amidinophenyl) methanesulfonyl fluoride hydrochloride). After adding glass beads (diameter 0.25 to 0.5 mm) to the suspension, the cells were destroyed by vigorous stirring using a bead beater. The cell disruption liquid was centrifuged to obtain a supernatant, which was used as a cell extract. (2) Purification of rat bFGF 935 ml of the cell extract obtained in the above (1) (culture solution 440
(Corresponding to 0 ml) was double-diluted with distilled water and then equilibrated with 50 mM citrate buffer (pH 7.0), a sulfated cellulofine (Seikagaku Corporation) column (3.2 cm × 25).
cm). The column was washed with 2000 ml of 50 mM citrate buffer (pH 7.0) and then 50 mM citrate buffer containing 1 M sodium chloride (pH 7.
0) The protein was eluted by passing through 1000 ml. Rat bF
Fractions having GF activity were collected and diluted 3-fold with distilled water, and then heparin column Shodex AF-pak HR-2094 (2
The sample was loaded on a high performance liquid chromatograph (HPLC, Varian, USA) equipped with cm × 25 cm, Showa Denko KK. 50 mM column containing 0.4 M sodium chloride
After washing with a citrate buffer (pH 7.0), a rat chloride bFGF was eluted by preparing a sodium chloride concentration gradient according to the program shown below.

Buffer A: 50 mM sodium citrate buffer (pH 7.0) Buffer B: 2 M sodium chloride-50 mM sodium citrate buffer (pH 7.0) Elution program: 0 minutes (20% B), 10 minutes (20%
B), 15 minutes (45% B), 65 minutes (85% B), 75
Min (95% B) Flow rate: 5 ml / min Detection wavelength: 280 nm Under these conditions, rats were eluted for 31 to 36 minutes.
bFGF was eluted. Active fractions were collected, concentrated and desalted by ultrafiltration, and then SP-Cosmosil column (0.75 x
HPLC equipped with 7.5 cm, Cosmo Bio Co., Ltd.
Loaded on. Column is 50 mM citrate buffer (pH
After washing with 7.0), a sodium chloride concentration gradient was prepared according to the program shown below to elute rat bFGF.

Buffer A: 50 mM sodium citrate buffer (pH 7.0) Buffer B: 2M sodium chloride-50 mM sodium citrate buffer (pH 7.0) Elution program: 0 minutes (0% B), 1 minute (15% B),
35 minutes (60% B) Flow rate: 1.0 ml / min Detection wavelength: 280 nm Figure 4 shows the elution pattern of rat bFGF under these conditions.
Shown in. The fraction eluted during the elution time of 11 to 13 minutes was obtained as purified rat bFGF. Acquisition amount 35 mg. This preparation was electrophoresed as a single band having a molecular weight of about 16,000 on SDS-polyacrylamide gel electrophoresis under reducing and non-reducing conditions.

Example 4 A purified rat bFGF preparation (200 pmol) was loaded on a gas phase protein sequencer (Applied Biosystems, USA), and the amino terminal amino acid sequence was analyzed. As a result, the sequence up to the 20th residue was completely in agreement with the sequence predicted from the cDNA base sequence.

Example 5 Purified rat bFGF preparation was treated with 6N containing 1% phenol.
After hydrolysis in 110 ° C. for 24 hours at 110 ° C., its amino acid composition was determined. Cysteine was quantified as cysteic acid after oxidation of performic acid. The obtained amino acid composition analysis values (shown in Table 1) agreed with the composition values predicted from the nucleotide sequence of cDNA.

[0034]

[Table 1] Amino acid composition of rat bFGF

[0035]

According to the method of the present invention, rat bFGF can be accumulated in a large amount and in an active state.
It is advantageous in industrial mass production.

[0036]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 441 bases Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Complementary DNA Origin organism name: Rat strain name: SD

SEQ ID NO: 2 Sequence length: 33 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA Sequence characteristics: Primer Sequence: CTCCGGCAGT GCGGGGCATAT GAGTGATGCT GCC 33

SEQ ID NO: 3 Sequence Length: 15 Sequence Type: Nucleic Acid Number of Strands: Double Strands Topology: Linear Sequence Type: Synthetic DNA Sequence: ACTTCCGCTTC CCGCA 15 TGAAGCGAAG GGCGT

SEQ ID NO: 4 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Synthetic DNA Sequence: ACTCATATGC CCGCA 15 TGAGTATACG GGCGT

[Brief description of drawings]

1 and

FIG. 2 shows the nucleotide sequence of cDNA encoding rat bFGF and the amino acid sequence determined therefrom. However, ATG (Met) is added to the N-terminal.

FIG. 3 shows the plasmid pTB11 obtained in Example 1.
68 shows a construction drawing of 68.

FIG. 4 shows the elution pattern of rat bFGF obtained in Example 3.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Office reference number FI technical display location C12R 1:19) (C12P 21/02 C12R 1:19)

Claims (5)

[Claims] 1. A rat basic fibroblast growth factor (bFG).
F) A nucleotide sequence encoding a protein and T7 upstream thereof
A vector containing a promoter. 2. A transformant carrying the vector according to claim 1. 3. A method for producing rat bFGF, which comprises culturing the transformant according to claim 2 in a medium. 4. The transformant according to claim 2, wherein about 3 to 500 μM of isopropylthiogalactopyranoside (IPTG) is added to the medium during the logarithmic growth phase, and the transformant is cultured. Manufacturing method. 5. The production method according to claim 3, wherein the rat bFGF-containing solution thus obtained is purified by chromatography using a crosslinked polysaccharide sulfate ester, a synthetic polymer having a sulfonic acid group as an exchange group or a synthetic polymer for gel filtration as a carrier. ..