JPH05292995A - Monoclonal antibody, its production and use - Google Patents

Abstract

PURPOSE:To provide a monoclonal antibody binding to human NGF protein. CONSTITUTION:A monoclonal antibody to NGF protein, reactive with human NGF and incapable of recognizing N-terminal part of human NGF. Since the antibody specifically binds to human NGF protein, it can advantageously be used as a determination reagent, etc.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a monoclonal antibody against nerve growth factor (sometimes abbreviated as NGF in this specification) protein, a method for producing the same, and use thereof. Further, the present invention provides a hybridoma producing the monoclonal antibody.

[0002]

2. Description of the Related Art nerve growth factor (N)
GF) is Levi-Monntalcini
[Annual New York Academy of Sciences (Ann. NY Acad. Sci) 55, 330 (195
2)] and Cohen et al. [Procedures]
Of the National Academy of Science USA (Proc. Natl. Acad. Sci. USA) 4
0, 1014 discovered by the (1954)], the differentiation of the peripheral nervous system, is an essential nutritional factor in the growth and survival. Recently, NGF has been shown to have an action of maintaining the survival of cholinergic neurons in the central nervous system [Hefti, Journal of Neuroscience 6 , 2155].
(1986); Hatanaka, et al., Development of Brain Research (Dev. Brain Res.) 39 , 8
5 (1988)], which has attracted attention as a factor having some relation to Alzheimer's disease. Further, when NGF is administered into the brain of aged rats, improvement in memory impairment is observed [Nature, 329 , 65 (1989)], and thus it is expected as a therapeutic drug for senile dementia.

NGF (7 isolated from the submandibular gland of a male mouse)
S NGF) is a complex (α ₂ βγ ₂ ) composed of three subunits of α, β and γ, and the NGF activity is recognized only in the β subunit. β subunit
(βNGF, 2.5S NGF) is a dimer of the same polypeptide consisting of 118 amino acids, the amino acid sequence of which is Argeletti and Bradshaw.
(Bradshaw) (Procedures of the National Academy of Sciences USA)
c.Natl. Acad. Sci. USA), 68 , 2417 (197).
1)].

Scott et al. Succeeded in cloning mouse βNGF from a mouse submandibular gland cDNA library using an oligonucleotide synthesized on the basis of the amino acid sequence of mouse βNGF as a probe [Nature, 302]. , 538 (1983)]. Furthermore, Ullrich et al. Cloned the NGF gene from a library of human genomic DNA using mouse βNGF cDNA as a probe, and the amino acid sequence of human NGF deduced from its nucleotide sequence showed 90% homology with that of mouse NGF. It was shown to have [Nature (Nature), 30 3, 821 (1983) ].

[0005]

[Problems to be Solved by the Invention] Such human NGF
Although the gene has been cloned,
There are few reports that F was detected or isolated. Human N
It is considered that one of the reasons why GF is not detected in the living body is that anti-mouse NGF antibody has been mainly used until now.

[0006]

In view of the above situation, the present inventors have conducted various studies to find a practical means for measuring NGF, and as a result, prepared a monoclonal antibody against NGF that enables the measurement, and As a result of further research based on this, the present invention has been completed. (1), a monoclonal antibody against NGF protein that reacts with human NGF and does not recognize the N-terminal portion of human NGF,
(2), the hybridoma producing the monoclonal antibody according to (1), (3), the hybridoma according to (2) is grown in a liquid medium or in the abdominal cavity of a mammal, wherein (1) (4) The method for detecting and / or quantifying NGF protein, which comprises performing an immunological assay using the monoclonal antibody according to (1) above.

Any NGF protein derived from an animal may be used as the NGF protein for immunizing a mammal, but a β-subunit having a biological activity is more preferable. It may also be the mutein. As a typical example of animal-derived NGF, for example, mouse NGF [Levi-Monntalcini R. et al., J. Exp. Zool.
6: 321 (1951); Varon S. et al., Biochemistry.
6: 2202 (1967)], snake venom-derived NGF [Angel
etti RH, Proc.Natl. Acad. Sci. USA 65: 668
(1970)], guinea pig NGF [HarperG. P. et al., Na
ture 279: 160 (1979)] and human placenta-derived NGF [Goldstein LD et al., Neurochem. Res. 3:
175 (1978)] and the like. As NGF, mouse βNGF cDNA was used as a probe to clone the NGF gene from a human genomic DNA library, and the amino acid sequence deduced from its nucleotide sequence [Urr
ich A. et al., Nature 303: 821 (1983)].

To obtain human NGF, for example, an expression vector containing a DNA having a nucleotide sequence encoding the above-mentioned NGF protein polypeptide is prepared and introduced into an appropriate host cell to produce NGF. Good. Examples of the expression vector include (a) transforming a host with a genomic library prepared from human leukocyte DNA, (b) culturing the obtained transformant, and transforming the transformant by an appropriate method, such as DNA. A plasmid containing the target DNA is isolated by a colony hybridization method using a probe, (c) the target cloned DNA is cut out from the plasmid, and (d) the cloned DNA.
Is linked to the downstream of the promoter in the vehicle.

The expression vector thus obtained is
Human NGF can be produced by incorporating it into an appropriate host (eg, Escherichia coli, Bacillus subtilis, yeast, animal cells) and culturing the obtained transformant in a medium. The human N
The GF protein also includes a mutein of human NGF. The human NGF mutein is originally a mutated amino acid sequence of the original peptide or protein. Therefore, the mutation includes addition of amino acids, deletion of constituent amino acids, and substitution with other amino acids. Examples of the addition of the amino acid include those added with at least one amino acid. Examples of the deletion of the constituent amino acids include those lacking at least one NGF constituent amino acid. Examples of the substitution with the other amino acid include substitution of at least one NGF-constituting amino acid with another amino acid.

The at least one amino acid in the mutein in which at least one amino acid is added to NGF does not include methionine due to the initiation codon used for expressing the peptide and the signal peptide. .. As the number of added amino acids,
There is at least one, but any number may be used as long as the characteristics of NGF are not lost. More preferably, homology with NGF is recognized, and a part or all of the amino acid sequence of a protein showing similar activity can be mentioned.
The mutein in which at least one NGF-constituting amino acid of NGF is deficient may have any number of deficient constitutive amino acids as long as the characteristics of NGF are not lost. The number of at least one NGF-constituting amino acid before substitution in a mutein in which at least one NGF-constituting amino acid of NGF is substituted with another amino acid may be any number as long as the characteristics of NGF are not lost.

Examples of constituent amino acids before substitution include cysteine and other than cysteine.
Cysteine is particularly preferred. Examples of constituent amino acids other than cysteine as the constituent amino acids before substitution include aspartic acid, arginine, glycine, valine and the like. When the constituent amino acid before substitution is cysteine, the substituted amino acid is preferably, for example, a neutral amino acid. Specific examples of the neutral amino acid include glycine, valine, alanine, leucine, isoleucine, tyrosine, phenylalanine, histidine, tryptophan, serine, threonine and methionine. Particularly, serine and threonine are preferable. When the constituent amino acid before substitution is other than cysteine, another amino acid that is substituted is, for example, the amino acid before substitution in terms of hydrophilicity, hydrophobicity or charge of the amino acid. Choose ones with different properties. As a specific example, when the amino acid before substitution is aspartic acid, examples of the amino acid after substitution include asparagine, threonine, valine, phenylalanine, and arginine, with asparagine and arginine being particularly preferable. When the amino acid before substitution is arginine, the amino acids after substitution are glutamine, threonine,
Examples thereof include leucine, phenylalanine, and aspartic acid, with glutamine being particularly preferred. When the constituent amino acid before substitution is glycine, examples of the amino acid after substitution include threonine, leucine, phenylalanine, serine, glutamic acid, and arginine, with threonine being particularly preferred. When the constituent amino acid before substitution is serine, examples of the amino acid after substitution include methionine, alanine, leucine, cysteine, glutamine, arginine, and aspartic acid, with methionine being particularly preferred. When the constituent amino acid before substitution is valine, examples of the amino acid after substitution include serine, leucine, proline, glycine, lysine and aspartic acid, with serine being particularly preferred. As the original constituent amino acids before substitution, aspartic acid, arginine, glycine, serine and valine are preferable. As the amino acid after substitution, asparagine, glutamine, arginine, threonine, methionine, serine and leucine are preferable.

In the above substitution, two or more substitutions may be carried out simultaneously. In particular, it is preferable that 2 or 3 constituent amino acids be substituted. The above mutein may be a combination of two or three of the above addition, deletion and substitution. In order to produce the mutein, a site-directed mutagenesis technique is adopted. The technique is well known and is known as L.F. Racer (Lather, RF) and Jay P. Lecoq (Lecoq,
JP), Genetic Engineering (Genetic E
ngineering), Academic Press, Inc. (1983) 3rd
See pages 1-50. Oligonucleotide-directed mutagenesis is described by Smith, M. and Gillam, S., Genetic Engineering: Principles and Methods, Plenum Press, Inc. (1981) 3
Volumes 1-32.

In order to produce a structural gene encoding the mutein, for example, (a) 1 of the structural genes of NGF is used.
A single-stranded DNA consisting of single-stranded DNA is hybridized with a mutant oligonucleotide primer (a codon for cysteine that should be replaced by this single-stranded DNA, or a region containing an antisense triplet that may form a pair with this codon). However, the above-mentioned primer is complementary, provided that the mismatch between the codon for the other amino acid encoding the codon or, in some cases, the antisense triplet, is not limited to this), and (b) the primer using DNA polymerase. Mutated heterozygous (heteroduplex)
And (c) replicate this mutant heterodimer. The phage DNA carrying the mutated gene is then isolated and integrated into a plasmid.

A mutein can be produced by transforming an appropriate host with the plasmid thus obtained and culturing the obtained transformant in a medium. The mutein lacking the constituent amino acids of NGF as an antigen in the present invention is preferably a mutein having 100 or more amino acids in the amino acid sequence of NGF, more preferably 110 or more muteins. .

To produce the monoclonal antibody of the present invention, a mammal is immunized with the human NGF protein, and the resulting spleen cells are fused with mammalian lymphoid cells,
It is then produced by cloning. The NGF
When immunizing a protein, the NGF protein may be used as a complex with a carrier protein and then used as a complex. Examples of the carrier protein include bovine serum albumin, bovine thyroglobulin, hemocyanin and the like. When the carrier protein complex is used, the coupling ratio between the carrier protein and NGF protein is about 0.1 to 30 times (carrier / NGF protein: weight ratio). Desirably, about 0.5 to 5 times is used.
Further, various condensing agents can be used for coupling the hapten and the carrier, and glutaraldehyde, carbodiimide and the like are conveniently used.

When immunizing with the NGF protein or protein complex, experimental animals such as sheep, goats, rabbits, guinea pigs, rats and mice are used as the mammals to be immunized.
To obtain a monoclonal antibody, rat and mouse are preferable. The immunization method is, for example, when immunizing a mouse,
Although it is possible to use any route such as subcutaneous, intraperitoneal, intravenous, intramuscular, subcutaneous, etc., it is preferable to inject mainly subcutaneously, intraperitoneally or intravenously (particularly subcutaneously). In addition, the immunity interval, immunity, etc. are highly variable, and various methods are possible. A method using spleen cells extracted after 4 days is often used. It is desirable to use an immunization amount of about 0.1 μg or more, preferably about 10 μg to 300 μg, per mouse, as the amount of peptide at one time. or,
Before extracting the spleen, it is desirable to carry out a partial blood sampling, confirm an increase in the antibody titer in the blood, and then carry out a fusion experiment using spleen cells.

The cell fusion of the above-mentioned spleen cells and lymphoid cells is carried out, for example, by removing the extracted mouse spleen cells with hypoxanthine-guanine-phosphoribosyl transferase deficiency.
A suitable homologous or heterologous (preferably homologous) myeloma having a marker such as (HGPRT ⁻ ) or thymidine kinase deficiency (TK ⁻ ) [eg, P3-X63-Ag.8U1 (Ichimori et al. Journal of. Immunological Method 8
0 55 (1985)], such as, fused with the lymphoid cell line. For example, it is produced by fusing according to the method of Keller and Milstein [Nature 256 : 495 (1975)]. For example, a medium in which myeloma cells and splenocytes are mixed at a ratio of about 1: 5, for example, Iscove's medium and Ham's F-12 medium are mixed 1: 1.
(Hereinafter, referred to as IH medium) and suspended, and a fusion agent such as Sendai virus and polyethylene glycol (PEG) is used. Of course, dimethyl sulfoxide (DMSO) and other fusion promoters can be added. The degree of polymerization of PEG is usually about 1000 to 6000, and the time is about 0.5.
~ 30 minutes, concentration is about 10% -80%, etc.
As an example of preferred conditions, PEG 6000 is about 35
It can be efficiently fused by treating at about 55% for about 4 to 10 minutes. The fused cells can be selectively grown using a hypoxanthine-aminopterin-thymidine medium [HAT medium; Nature, 256 , 495 (1975)] and the like.

The culture supernatant of the grown cells can be screened for the production of the desired antibody, and the antibody titer can be screened as follows. That is, in this case, first, as a first step, the presence or absence of antibody production against the immunized peptide can be examined by a method such as a radioimmunoassay (RIA) method or an enzyme immunoassay (EIA) method. Various variants are possible. As one example of a preferable measuring method, one method using EIA will be described. For example, a rabbit anti-mouse immunoglobulin antibody is coupled to a carrier such as cellulose beads according to a conventional method, and a culture supernatant to be measured and mouse serum are added to the carrier and the mixture is kept at a constant temperature (about 4 to 40 ° C) for a certain period of time. .
The same applies below. ) To react. After that, the reaction product is thoroughly washed, and then an enzyme-labeled peptide (purification after coupling the enzyme and the peptide by a conventional method) is added, and the reaction is allowed to proceed at a constant temperature for a certain period of time. After thoroughly washing the reaction product, an enzyme substrate is added and the reaction is carried out at a constant temperature for a certain period of time, and then the produced color product can be measured by absorbance or fluorescence.

The cells in the wells showing growth in the selective medium and having antibody activity against the peptide used for immunization are
It is desirable to carry out cloning by the limiting dilution method or the like. By similarly screening the supernatant of the cloned cells and increasing the number of cells in wells having high antibody titers, monoclonal antibody-producing hybridoma clones showing reactivity with the immunized peptide can be obtained.

The hybridoma thus cloned is grown in a liquid medium. Specifically, for example, a liquid medium such as RPMI-1640 [Moore, G.
E., et.al. Journal of the American Medical Association (J. Am.Med. Assoc.) 199 , 5
49 (1967)], the monoclonal antibody can be obtained from the culture medium by culturing in a medium containing about 0.1 to 40% bovine serum for about 2 to 10 days, preferably about 3 to 5 days. it can. Further, the antibody can be obtained by inoculating the mammal intraperitoneally, growing the cells, and collecting ascites. For this purpose, for example, in the case of a mouse, about 1 × 10 ⁴ to 1 × 10 ⁷ cells, preferably about 5 × 1 in a BALB / c mouse previously inoculated with mineral oil or the like is used.
The 0 ⁵ ~2 × 10 ⁶ hybridoma were inoculated intraperitoneally
Ascites fluid is collected after about 7 to 20 days, preferably about 10 to 14 days. The antibody produced and accumulated in ascites can be easily isolated as a pure immunoglobulin from the monoclonal antibody by, for example, ammonium sulfate fractionation, DEAE-cellulose column chromatography and the like.

In this way, a monoclonal antibody against the NGF protein is obtained. The monoclonal antibody of the present invention specifically binds to the NGF protein of the immunogenic peptide. The monoclonal antibody of the present invention is an NGF different from the peptide of the immunogen used in the production.
It may also bind to proteins. The monoclonal antibody of the present invention reacts with human NGF and does not recognize the N-terminal portion of human NGF. For example, human NGF
It does not recognize the antigenic determination existing in the first to fifteenth amino acid sequences from the N-terminus of. Since the monoclonal antibody of the present invention binds to the NGF protein,
It is extremely useful as a reagent for measuring NGF protein. Furthermore, facilitating the measurement of NGF protein in living organs and tissues is extremely useful in obtaining basic knowledge (eg, biodistribution) regarding NGF protein. Enzyme-linked immunosorbent assay (EI) is usually used to detect NGF protein in living organs and tissues.
A method) or the like, or a fluorescent antibody method or a radioimmunoassay method (RIA method) is used. In particular, EIA
Method is preferred. N existing in these organs and tissues
Western blotting of proteins is effective for determining the size of GF protein. In this method, a crude extract derived from an organ or tissue or a partially purified sample thereof is subjected to acrylamide electrophoresis, transferred to a membrane filter, and then detected with an HRP-conjugated anti-NGF protein antibody.

Further, by utilizing the binding ability between the antibody and NGF protein, an antibody affinity column can be prepared and used as a reagent for purifying NGF protein. NG
The antibody molecule used to detect and quantify the F protein may be IgG or a fraction thereof (eg, F
It may be (ab ') ₂ , Fab' or Fab}. Among them, the antibody molecule to which the labeling agent is directly bound is preferably Fab '. The monoclonal antibody of the present invention is NGF
It can be used as a reagent in an immunochemical assay for proteins. The amount of NGF protein in living tissues and body fluids can be measured by the immunochemical assay method for NGF protein, and thus the central nervous system can be measured by measuring NGF protein in various tissues and body fluids. It is thought to be useful for diagnosis of diseases.

In carrying out the above-mentioned immunological assay method using two types of antibodies, the monoclonal antibody of the present invention is used as one antibody and the monoclonal antibody or polyclonal antibody of the present invention is used as the other antibody. Can be used. Examples of the carrier in the antibody retained on the carrier used in the method for measuring NGF protein include gel particles (eg, agarose gel [eg,
Sepharose 4B, Sepharose 6B (Pharmacia
Fine Chemical Co. (Sweden)], Dextran gel [eg, Sephadex G-75, Sephadex G-
100, Sephadex G-200 (Pharmacia Fine Chemical Co. (Sweden)), polyacrylamide gel [eg, Biogel P-30, Biogel P-6]
0, Biogel P-100 (manufactured by Bio-Rad Laboratories (USA))], cellulose particles [eg, Avicel (manufactured by Asahi Kasei), ion exchange cellulose (eg, diethylaminoethyl cellulose, carboxymethyl cellulose)], physical adsorbent [eg. , Glass (eg, glass sphere, glass rod, aminoalkyl glass sphere, aminoalkyl glass rod),
Silicon pieces, styrene resin (eg polystyrene spheres, polystyrene particles), immunoassay plate (eg Nunc (Denmark)), ion exchange resin {eg weak acid cation exchange resin [eg Amberlite IRC-50] (Rohm and Haas Company (USA)), Zeocurve 226
(Manufactured by Palm Chit (West Germany)), weakly basic anion exchange resin [eg, Amberlite IR-4B, Dowex 3 (manufactured by Dow Chemical Co. (USA)]} and the like.

In order to retain the antibody on the carrier, known conventional means can be applied. For example, "Metabolism", Vol. 8 (19)
71), the bromocyan method and the glutaraldehyde method described on page 696. Also,
As a simpler method, it may be physically adsorbed on the surface of the carrier. Examples of the labeling agent in the antibody to which the labeling agent is bound include a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, etc., and it is preferable to use an enzyme. As the enzyme, those which are stable and have large inactivity are preferable, and peroxidase, alkaline phosphatase, β-D-galactosidase, glucose oxidase and the like can be used, but peroxidase is preferable. As the peroxidase, those of various origins can be used,
Examples thereof include peroxidase obtained from horseradish, pineapple, fig, sweet potato, broad bean, corn, etc., and horseradish peroxidase (horseradish peroxidase extracted from horseradish)
Radish peroxidase (HRP) is preferred. Fab as an antibody molecule for binding peroxidase and antibody
In order to utilize the thiol group of ', it is convenient to use peroxidase into which a maleimide group has been introduced in advance. As a method for introducing a maleimide group into peroxidase, a maleimide group can be introduced via an amino group of peroxidase. To do that, N
A -succinimidyl-maleimide-carboxylate derivative can be used, and N- (γ-maleimidobutyloxy) succinimide (sometimes abbreviated as GMBS) is preferable. Therefore, a certain group may be included between the maleimide group and peroxidase. The reaction of GMBS with peroxidase is carried out by reacting both in a buffer solution having a pH of about 6 to 8 at a temperature of about 10 to 50 ° C. for about 10 minutes to 24 hours. Examples of the buffer include p
Examples include H7.0 0.1M phosphate buffer. The maleimidated peroxidase thus obtained is
For example, it can be purified by gel chromatography. Examples of the carrier used when performing the gel chromatography include Sephadex G-25.
[Made by Pharmacia Fine Chemicals (Sweden)],
Biogel P-2 [manufactured by Bio-Rad Laboratories (USA)] and the like can be mentioned.

The reaction between the maleimidated peroxidase and the antibody molecule can be carried out by reacting both in a buffer solution at a temperature of about 0 ° C. to 40 ° C. for about 1 to 48 hours. The buffer solution may be, for example, 0.1 mM containing 5 mM ethylenediaminetetraacetic acid sodium salt having a pH of 6.0.
M phosphate buffer etc. are mentioned. The peroxidase-labeled antibody thus obtained can be purified by, for example, gel chromatography. Examples of the carrier used when performing the gel chromatography include Sephadex G-25 [Pharmacia.
Fine Chemical Company (Sweden)], Biogel P-
2 [made by Bio-Rad Laboratories (USA)] and the like.

Further, a thiol group may be introduced into peroxidase and reacted with a maleimidated antibody molecule. Direct binding of an enzyme other than peroxidase to the antibody can be performed according to the case of peroxidase, and the glutaraldehyde method, periodate method, water-soluble carbodiimide method and the like known per se can be used. Examples of test samples in the assay system of the present invention include body fluids such as urine, serum, blood cells, and cerebrospinal fluid, or extracts of animal cells or fungi or culture supernatants thereof. As an example of the measuring method of the present invention, the case where the labeling agent is peroxidase will be specifically described below, but the present invention is not limited to peroxidase. First :: NGF to be measured on the antibody retained on the carrier
After the antigen-antibody reaction was carried out by adding a protein-containing analyte, the peroxidase and anti-NG obtained above were added to this.
A binding product with the F protein antibody is added and reacted.

As the test sample in this measurement system,
Examples thereof include body fluids such as urine, serum, blood cells, and cerebrospinal fluid, or extracts of animal cells or bacterial cells or culture supernatants thereof. A substrate of peroxidase is added to the reaction product obtained in step (1), and the absorbance or fluorescence intensity of the resulting substance is measured to determine the enzyme activity of the reaction product. : The above steps (1) to (3) are performed in advance for a standard solution of a known amount of NGF protein, and the relationship between the NGF protein and the absorbance or fluorescence intensity is prepared as a standard curve. : Analyte containing unknown amount of NGF protein (test sample)
The absorbance or fluorescence intensity obtained in the above is applied to a standard curve, and the amount of NGF protein in the analyte is measured.

The NGF protein can be purified using an antibody obtained by using a complex of a monoclonal antibody against the NGF protein and a carrier protein as an immunogen. This can be performed by performing affinity column chromatography using the antibody. The affinity column chromatography is, for example,
This can be carried out by coupling the antibody to a suitable carrier, packing it in a column, passing a solution containing NGF protein through the column for adsorption, and then eluting it.

Examples of the carrier include the same carriers as those described above. In particular, gel particles and various synthetic resins are conveniently used. For example CNBr
-Activated Sepharose 4B (manufactured by Pharmacia Fine Chemicals Co., Ltd.), Affigel-10, Affigel 15 (manufactured by Bio-Rad Laboratories) and the like can be mentioned.

For coupling the antibody to the carrier, known conventional methods can be applied. For example, "metabolism", 8th step.
Volume (1971), p.696, bromocyan method and glutaraldehyde method. Also,
A method using a water-soluble carbodiimide, an active ester method and the like can be used, but as a simpler method, they may be physically adsorbed on the surface of the carrier.

To perform purification using the antibody column thus obtained, the NGF protein in a buffer solution near neutral is adsorbed to the antibody column filled with the carrier to which the antibody is bound. Next, the column is washed with the same buffer, and the NGF protein specifically adsorbed is eluted. To elute the specifically adsorbed NGF protein, for example,
It is carried out using a pH or high pH buffer solution, or a buffer solution containing a high concentration of salt.

The low pH buffer solution is, for example, pH.
Examples thereof include 0.17 M glycine-hydrochloric acid buffer solution of 2.3, 0.1 M sodium citrate-hydrochloric acid buffer solution of pH 1.8, and the like. Examples of the high pH buffer solution include pH 11
Ammonia water, pH 11.7, 0.2M sodium borate buffer, etc. may be mentioned. Examples of the buffer solution containing the high-concentration salt include 6M guanidine hydrochloric acid solution and 7M urea solution. The elution may be performed by a batch method or a column method. The eluate of the antigen is dialyzed and purified. For example, when eluted with a low pH buffer solution, for example, 0.1M sodium carbonate buffer solution (pH 10.5), when eluted with a high pH buffer solution, for example, 0.1M glycine-hydrochloric acid buffer solution (pH 3.0). ), And then neutralized with, for example, 0.02 M containing 0.1% NaN _3.
Dialyze against phosphate buffer (pH 8.0). Alternatively, the antigen solution eluted with a buffer solution containing a high concentration of salt can be directly dialyzed against the above-mentioned phosphate buffer solution and stored. Further, it can also be stored as a freeze-dried preparation obtained by freeze-drying the above-mentioned eluate or dialysate. The NGF protein thus purified has a very high unit, and has, for example, a nerve cell growth action,
It can be effectively used for the treatment of various neurological disorders. The human NGF protein obtained as described above is useful as a reagent used in the study of the brain and nervous system, and is also expected as a therapeutic drug for senile dementia.

To use the human NGF protein for these studies, for example, the human NGF protein is used in an amount of about 0.1 to 1,000 ng / ml, more preferably about 1 to 100 ng per ml of animal cell culture medium. Is preferably added. In the specification and drawings of the present invention, when an abbreviation is used for a base or amino acid, IUPAC-IUB
Based on the abbreviations by Commision on Biochemical Nomenclature or abbreviations commonly used in this field,
An example is given below. When amino acids may have optical isomers, they are L-forms unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxy Cytidine triphosphate ATP: Adenosine triphosphate Tdr: Thymidine EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate G, Gly: Glycine A, Ala: Alanine V, Val: Valine L, Leu: Leucine I, Ile: Isoleucine S, Ser: Serine T, Thr: Threonine C, Cys: Cysteine M, Met: Methionine E, Glu: Glutamic acid D, Asp: Aspartic acid K, Lys: Lysine R, Arg: Arginine H, His: Histidine F, Phe: Phenylalanine Y, Tyr: Tyrosine W, Trp: Tryptophan P, Pro: Proline N, Asn: Asparagine Q, Gln: Glutamine Clz: 2-Chlorobenzyloxycarbonyl BrZ: 2-Bromobenzyloxycarbonyl Bzl: Benzyl Boc: t-Butoxycarbonyl Obtained in Reference Example 6 described later. Transformant CHO-D31-
10 is the Fermentation Research Institute since November 15, 1991
(IFO) has been deposited under accession number IFO 50217. Further, the microorganism was deposited on December 7, 1991, at the Research Institute for Microbial Technology (FRI), Ministry of International Trade and Industry, under the deposit number FERM BP-2674. The following hybridoma obtained in Example 1 described below has been deposited in the IFO as a deposit number indicated by the following IFO number from April 5, 1990, and FR from August 24, 1990.
It has been deposited at I as a deposit number indicated by the following FERM BP number. NGFA-133 IFO 50239 FERM BP-3078 NGFB-260 IFO 50240 FERM BP-3079

[0034]

The present invention will be described in more detail below with reference to Reference Examples and Examples, but the present invention is not limited to these. Reference Example 1 Construction of human NGF expression vector (1) A λEMBL3 genomic library prepared from human leukocyte DNA [Clontech] was used as an E. coli NM
After infecting 538, about 3 x 1 on a soft agar plate
0 ⁴ clones were spread each. After transferring the plug to a nylon membrane (Amersham, Hibond-N),
After immersing in 5N NaOH-1.5M NaCl solution for 6 minutes to denature the phage DNA, 0.5M Tris-HCl was added.
It was immersed in a (pH 8.0) -1.5 M NaCl solution for 6 minutes. Soak this membrane in 2 × SSC solution, air dry, and then 2 ℃.
The DNA was fixed to the membrane by treating for a period of time. On the other hand, human NGF of known [Ullrich, A. et al., Nature 303 , 821 (1983)].
DNA encoding human βNGF with reference to gene
(0.38 kb) was chemically synthesized, and this was labeled with ³² P using a DNA labeling kit (Nippon Gene Co.) as a probe. The DNA-immobilized filter was labeled with 6 × SSC (1 × SSC = 0.15M) containing a labeled probe.
NaCl, 0.015M sodium citrate), 5 × Den-ha
rdt's, 0.5% SDS, 20 μg / ml denatured salmon sperm DN
Incubated in 10 ml of solution A at 65 ° C. for 16 hours. After the reaction, the filter was washed 3 times for 5 minutes each in a 2 × SSC, 0.1% SDS solution at room temperature in a 1 × SSC, 0.1% SDS solution at 60 ° C. for 60 minutes. After the washed filter was dried, a radio-autogram was taken to search for a clone that reacts with the probe. From the clone λβLN2113 obtained by this method, the method of Davis et al. (Davis et al., [Advanced Bacterial Genetics]], Cold Spri
ng Harbor Laboratory 1980)
Was extracted.

Next, λβLN2113 was cleaved with SmaI and ApaI, the DNA containing the human NGF gene (about 1 kb) was cut out, the SmaI and ApaI sites of the plasmid pBluescriptIIK (purchased from Toyo Bo) were inserted, and the plasmid pNG was inserted.
FP107G was obtained. The nucleotide sequence of the inserted portion was determined using Sequenase (Toyo Bo) (sequence listing: SEQ ID NO: 1) (consecutive sequence of [FIG. 1] and [FIG. 2]). The determined nucleotide sequence is Nature, 30
The sequence described in 3 , 821 (1983) was completely identical in the protein coding region. The above phage λβLN
2113 DNA was cleaved with restriction enzyme BglII to give human NG
A DNA fragment containing F (1.8 kb) was isolated. On the other hand, the expression vector pKSV-10 (Pharmacia) for animal cells was cleaved with the restriction enzyme BglII, and the above human NGF was ligated with a DNA fragment (1.8 kb) containing a gene using T4 DNA ligase. Using this reaction solution, Escherichia coli DH1 was transformed, and one of the transformants resistant to ampicillin [Escherichia coli (E
The plasmid isolated from scherichia coli) DH1 / pMNGF101 was named pMNGF101 [FIG. 3].

Reference Example 2 Construction of Human NGF Expression Vector
(2) The plasmid pNGF107G obtained in Reference Example 1 was digested with restriction enzymes BclI and ApaI to isolate a DNA fragment (0.8 kb) containing the human NGF gene. This 0.8kb
The BclI-ApaI fragment was mixed with the chemically synthesized adapters SN1 (SEQ ID NO: 2), SN2 (SEQ ID NO: 3) and SN3 (SEQ ID NO: 4) (see FIG. 4) to prepare T4 DNA ligase. After ligation with 0.8 g of HindIII-BglII DN by cutting with BglII.
A fragment was obtained. The plasmid pSV2-gpt [Science, 209 , 1422 (1980)] was digested with the restriction enzymes EcoRI and HindIII to isolate a 2.6 kb EcoRI-HindIII DNA fragment containing the SV40 promoter. Next, plasmid pMTVdhfr [Natur (Natur
e), 294 , 228 (1981)], a 1.6 kb BglII-EcoRI fragment containing the polyA addition region was isolated. 2.6 kb EcoRI-HindI containing the above SV40 promoter
II DNA fragment, 0.8 kb Hind containing human NGF gene
The III-BglII DNA fragment and the 1.6 kb BglII-EcoRI fragment containing the polyA addition region were ligated with T4 ligase. Escherichia coli (Escherichia coli)
richia coli) DH1 was transformed into an ampicillin-resistant transformant [Escherichia c
oli) DH1 / pMNGF201] was named pMNGF201 [FIG. 4].

Reference Example 3 Construction of Human NGF Expression Vector
(3 ) Hind the plasmid pMNGF201 obtained in Reference Example 2
Cleavage with III and blunting with the DNA polymerase Klenow fragment reaction, followed by cleavage with BglII to about 0.8
The kb DNA fragment was isolated. On the other hand, plasmid pTB399
(Described in JP-A-63-13282) was cleaved with EcoRI and then blunted by Klenow fragment reaction.
Cleavage with BglII gave an approximately 3.9 kb DNA fragment. These two DNA fragments were circularized by T4 DNA ligase reaction to obtain plasmid pTB1054. Then the plasmid pTB34 containing the hamster DHFR cDNA
8 (described in JP-A-61-63282) was digested with ClaI and then treated with alkaline phosphatase, and the 2.4 kb DNA fragment (MnLVLTR, human NGF (hNGF) gene, and SV40 DNA derived from the ClaI digested pTB1054 was isolated and purified. (Including splice region and poly [A] addition region) for T4 DNA ligase reaction
Then, a human NGF expression vector pTB1058 was constructed [Fig. 5].

Reference Example 4 Transformation of CHO Cells Ham 12 medium containing 5% fetal calf serum was placed in a Falcon dish (diameter 6 cm), and hamster DHFR ^- CHO cells were cultured overnight at 37 ° C. After culturing, the cells (7 × 10 ⁵
Cells / dish) using the human NGF expression vector pTB1058 (10 μg) obtained in Reference Example 3 by the method of Graham et al. [Virology 52 : 456-467].
(1973)]. After culturing at 37 ° C. for 4 hours, the culture was continued by replacing with a new medium. 2 days later 5
If the liquid was changed with Dulbecco's modified MEM culture containing% dialyzed fetal bovine serum and 35 μg / ml proline, and then continued to be cultured in this selective medium, DMF was recovered for about 2-3 weeks.
The cells that became R ⁺ and proliferated formed colonies.

Reference Example 5 Cloning of transformants and
And expression of human NGF gene Cloning of the transformed cells obtained in Reference Example 4 was carried out according to a known method (for example, limited dilution method) to obtain transformants (cloned) CHO-D.
5, CHO-D42 and CHO-M36 were obtained. After the completion of cloning, each clone cell was treated with 5% fetal bovine serum, 35 μg / ml proline, 50 IU / ml penicillin,
The cells were cultured in Dulbecco's modified MEM medium containing 50 μg / ml streptomycin. The cells of each isolated clone were spread on Lymbrodishes, and when the cells were about 80% confluent, the medium was replaced with a new medium, and after culturing for 72 hours, NGF in the culture supernatant was replaced with EIA [Boehringer; Chemical Biophysical Research Communication (Biochem. Biophys. Res. Commun., 1
55 , 482 (1988)].

[Table 1] shows the clones producing a high amount of human NGF. NGF was not detected in the culture supernatant of untransformed CHO cells.

[Table 1] From the above results, it became clear that CHO cells that permanently express the human NGF gene can produce a larger amount of human NGF than COS cells that transiently express the gene.

Reference Example 6 Human NGF Highly Producing CHO Cell Line Transformant CHO-D obtained by the same method as in Reference Example 5
31 was cultured in Dulbecco's modified MEM containing 10 nM methotrexate (MTX) (containing 5% fetal calf serum 35 μg / ml proline). This clone showed normal growth at this concentration of MTX, so an MTX concentration of 1 was used.
The culture was continued by subculturing at 100 nM. Furthermore, when the MTX concentration was set to 1 μM, most of the cells died, but when the liquid change was performed on 3 to 4 days and the culture was continued, several cells started growing in colony form per 10 ⁵ cells. After these cells proliferated sufficiently, when subcultured in a culture medium of 10 μM MTX, most of the cells died again, and a few cells began to grow in a colony. The cells thus obtained showed stable and normal growth in the presence of 10 μM MTX, and were returned to a culture medium containing no MTX for growth and passaged for several generations, and then cultured in the presence of 10 μM MTX. Also grew normally. CHO-D resistant to 10 μM MTX
31-10 cells (IFO 50217, FERM BP-
2674) was cultivated under the same conditions as in Reference Example 5,
It was confirmed that g / l human NGF was produced in the medium.
I found it in IA.

Reference Example 7 Isolation of human NGF (1) 5% of the cell line CHO-D31-10 obtained in Reference Example 6 was used.
When a large amount was cultured in Dulbecco's modified medium containing 5% carbon dioxide at 37 ° C. for 7 days in fetal bovine serum, 35 μg / ml proline, 50 IU / penicillin, 50 μg / ml streptomycin, 10 μM methotrexate, 2.4 mg was added to the medium. E / l of human NGF produced
I found it in IA. The culture broth was centrifuged, APMSF was added to 2.2 liters of the culture supernatant so that the final concentration was 0.1 mM, the pH was adjusted to pH 6.0 with 0.2 N acetic acid, and then centrifuged. The obtained supernatant was added to 0.1M phosphate buffer pH 6.0.
-1 mM S-Sepharose column equilibrated with EDTA
Adsorbed to (2.6 cm x 14 cm), 0.1M phosphate buffer p
H6.0-0.15M NaCl-1mM EDTA-10%
After washing with glycerol, 50 mM Tris-HCl p
H7.5-0.7M NaCl-1mM EDTA-10%
Elute with glycerol. Fractions containing human NGF were collected and concentrated about 30 times with a diaflow cell (type YM10, Amicon). 20 mM of the obtained concentrated solution
Tris-HCl pH 7.4-0.5M NaCl-1mM E
Sephacryl equilibrated with DTA-10% glycerol
Gel filtration was performed with S-100HR (200 ml, 1.6 cm × 100 cm). Fractions containing human NGF were collected and concentrated about 10 times with Centriprep 10 (Amicon).
The obtained concentrated solution was subjected to reverse phase HPLC to purify human NGF. That is, the concentrated solution was treated with Asahipak ODP-50 (1
It was applied to a column (0.0 mm ID × 250 mm L) and subjected to a concentration gradient of 0-90% acetonitrile containing 0.1% trifluoroacetic acid to obtain 1.2 mg (from amino acid analysis) of a purified sample of human NGF. As a result of SDS-polyacrylamide gel electrophoresis and reverse phase HPLC, the purity of the obtained recombinant human NGF was 94%. The purified sample thus obtained was subjected to 16% polyacrylamide gel electrophoresis containing 0.1% SDS and silver staining. As a result, a single band of 13 kilodalton (kDa) was observed. Also,
Western blotting using a rabbit anti-mouse NGF antibody (Collabarative Research) and affinity-purified HRP-conjugated goat anti-rabbit IgG (Bio-Rad, USA) revealed a band at the same position as above. The obtained purified human NGF was placed in a glass hydrolysis test tube, dried under reduced pressure, added with 5.7 N hydrochloric acid containing 4% thioglycolic acid, sealed under reduced pressure, and hydrolyzed at 110 ° C. for 24 hours. .. After hydrolysis, hydrochloric acid was removed and the residue was reduced to 0.
Amino acid analysis was carried out by dissolving in 02N hydrochloric acid. The results are shown in [Table 2].

[0043]

[Table 2] Amino acid composition 1) Asp + Asn was calculated as 13. 2) Calculated from the amino acid sequence deduced from the nucleotide sequence of human NGF gene. The N-terminal amino acid sequence of purified human NGF was converted into a gas phase protein sequencer (Applied Biosystems model 47).
0A). The results are shown in [Table 3].

[0044]

[Table 3] N-terminal amino acid sequence ───────────────────────────── PTH-amino acid Sequence deduced from DNA Residue pmole amino acid sequence ───────────────────────────── 1 Ser 605 Ser 2 Ser 495 Ser 3 Ser 384 Ser 4 His 785 His 5 Pro 705 Pro 6 Ile 767 Ile 7 Phe 829 Phe 8 His 341 His 9 Arg 700 Arg 10 Gly 425 Gly 11 Glu 478 Glu 12 Phe 517 Phe 13 Ser 97 Ser 97 Ser 2 19 Ser 73 Ser 20 Val 476 Val 21 Trp 95 Trp 22-Val 23 Gly 166 Gly 24 Asp 179 Asp 25 Lys 245 Lys 26 Thr 74 Thr 27 Thr 102 Thr 28 Ala 179 Ala ──────────────────────────────

Purified human NGF 2.9 nmole was used for the analysis. Hydrazine decomposition [Natita et al., Journal of Biochemistry (J. Biochem.), 59 , 170 (196).
6)], the C-terminal amino acid of purified human NGF was alanine. As a result of examination by PAG isoelectric focusing method (new edition electrophoretic experiment method, edited by Electrophoretic Society, Spectroscopy, 1989), the isoelectric point of human NGF obtained was pH 9-10, and mouse NGF (Collaborative). Rese-arch Incorpo
It was almost the same as that of (rated). Brain Research, 133 , 350 (1977), Ex
perimental Cell Research, 145 , 179 (198
3) and Journal of Neu-roscience Research, 17 ,
25 (1987) according to the method described in PC12.
The activity of the purified human NGF was measured by using the neurite outgrowth of the cells as an index, and the purified human NGF showed the same activity as that of the standard mouse 2.5S NGF (Wako Pure Chemical Industries). .

Reference Example 8 Analysis of Intramolecular Disulfide Bond Using the purified human NGF obtained in Reference Example 7, the position of the intramolecular disulfide bond was determined. Lyophilized purified human NGF (530 μg) was added with 0.2 ml of 0.9% NaCl.
The solution and 0.8 ml of 0.01 M HCl were added and dissolved. The pH of this solution was 2.2. 1 by weight ratio
1mg / ml pepsin (Sigma)
10.6 μl of the solution was added, and the mixture was reacted at 37 ° C. for 22 hours. After the reaction, take 950 μl and collect 50 μl of 250 mM.
The pepsin digest was obtained by adding phosphate buffer (pH 6.0) to stop the reaction. The pepsin digest was subjected to HPLC for peptide mapping. TSK-Gel ODS
A -120T column (Tosoh Corp., 0.46 x 25 cm) was used to run a mixture of 0.05% TFA (A) and 99.95% acetonitrile 0.05% TFA (B) according to the following elution program. Flow rate is 1 ml / min, detection wavelength is 2
20 nm and 280 nm. On the other hand, 10 μl of 100 mM DTT solution was added to 50 μl of pepsin digest and left for 3 hours at room temperature to disulfide bond-reduced sample, which was similarly subjected to HPLC,
Peptide mapping was performed. After immobilizing the peptide having a disulfide bond by comparing these two peptide mappings, this peptide was isolated and the amino acid sequence of the gas phase protein sequencer end (ABI) was analyzed. As a result, this peptide was found to be a large peptide containing the following three peptides and having three disulfide bonds.

13 15 20 S-V-C-D-S-V-S-V (Sequence Listing: SEQ ID NO: 5)

54 58 60 65 70 F-E-T-K-C-R-D-P-N-P-V-D-S-G-C-R-G 73 -I-D-S- ( Sequence listing: SEQ ID NO: 6) 102 105 110 115 I-R-I-D-D-T-A-C-V-C-V-L-S-R-K-A-V-R 120-R-A ( Sequence listing: SEQ ID NO: 7)

Next, this peptide (2060 pmol) was concentrated to dryness under reduced pressure and then dissolved in 0.3 ml of 50 mM sodium acetate (pH 6.0). 0.48 μg in this solution
(14 pmol) thermolysin (Wako Pure Chemical Industries, Ltd.) was added and reacted at 37 ° C. for 20 hours, and then subjected to HPLC under the same conditions as above to perform peptide mapping. However, the following elution program was used.

Further, in order to determine the position of the disulfide bond, a sample obtained by subjecting the above peptide to DTT reduction treatment was similarly subjected to HPLC for peptide mapping. From the peptide mapping comparison, three fragments containing disulfide bond (fragment-1, fragment-2, fragment-3) were immobilized and obtained respectively. The amino terminal amino acid sequences of Fragment-1, Fragment-2, and Fragment-3 were analyzed. The results are shown in [Table 4]. On the other hand, these fragments were oxidized with performic acid to convert cysteine residues to cysteic acid, and amino acid analysis was performed. As a result, two cysteic acids were detected in each fragment.

[0050]

[Table 4] From these results, the position of the disulfide bonds of purified human NGF ^{is, Cys 15 -Cys 80, Cys 58} -Cys 108 and Cy
It was concluded that this was s ⁶⁸ -Cys ¹¹⁰ . Reference Example 9 Human NGF N-terminal ( 1-15) peptide H-
Ser Ser Ser HisPro Ile Phe His Arg Gly G
lu Phe Ser Val Cys OH (Sequence listing: SEQ ID NO: 8)
The synthesis of the N-terminal peptide of human NGF was carried out by the solid phase synthesis method using an automatic peptide synthesizer 430A (manufactured by Applied Biosystems). The program used “standard”. Is like the basic synthesis process, Merrifield Arubi (Merri field, RB) (1969 ) Advance of Enzymology (Adv. Enzymol.) 32, 2
21-296. Boc-C for resin
Using ys (MeBzl) .PAM-P (0.5 mmol / g), the compounds were sequentially synthesized from the carboxyl end. As Boc-amino acid, Boc-Val, Boc-Ser (Bzl), Boc-Phe, Boc-Glu
(OBzl), Boc-Gly, Boc-Arg (Tos), Boc-His
(Tos), Boc-Ile and Boc-Pro were used. Amino terminal S
After synthesizing up to er, the peptide resin was taken out from the synthesizer and dried. 1.5 g of p- for 1 g of peptide resin
Cresol and 0.5 ml of 1,2-ethanediotil were added, followed by about 8 ml of liquid hydrogen fluoride to give 0.
The reaction was carried out at 0 ° C for 2 hours. After completion of the reaction, hydrogen fluoride was removed under reduced pressure in a desiccator, and washed with diethyl ether containing 0.1% 2-mercaptoethanol and then with diethyl ether to remove most of the mixed reagents. The peptide was extracted with 10 ml of 3% acetic acid, and the resin mixed in the extract was removed by filtration. The filtrate was purified by gel filtration using Sephadex G-25. The gel filtration conditions were: column size 2.8 × 60 cm; detection wavelength 230 nm; solvent 3% acetic acid; flow rate 40 ml / hr.

Fractions containing the peptide were pooled, lyophilized and the resulting powder preparation was further purified by reverse phase high performance liquid chromatography. Column YMC pack, A-324 ODS 10 × 250 nm; column temperature 2
5 ° C; Elution solvent A 0.1% -trifluoroacetic acid water-9
9.9% distilled water; elution solvent B 0.1% -trifluoroacetic acid water-99.9% acetonitrile; elution program 0 minutes
(90% A + 10% B), 30 minutes (60% A + 40% B);
Elution rate 1.6 ml / min, detection wavelength 230 nm. Under this condition, the main peak fractions eluted at a retention time of 29.14 minutes were collected to collect Biorad AG 1 × 8 (AcOH type, 1.8 × 5c
After passing through the column of m), the washings were collected, the acetonitrile was distilled off, and then the residue was freeze-dried. A white powder number of 76 mg was obtained. Thin layer chromatography: Rf = 0.71 (Avicel gel plate; developing solvent; n-butanol: AcOH: pyridine: water = 30: 20: 6: 4). Elman, Elman,
GL) (1959) Architectural Biochemistry and Biophysics (Arch. Biochem. Biop
hys.) 82 , 70-77 method for determination of free SH group: 9
8%. Amino acid analysis value Ser 3.99 (4); Glu 1.00 (1); Pro
0.98 (1); Gly 1.19 (1); 1 / 2Cys 0.84 (1H); Val 1.03
(1); Ile 1.01 (1); Phe 2.12 (2H); His 1.84 (2); Ar
g 0.94 (1). Recovery rate 71.1%. [1/2] Cys was quantified by the performate oxidation method. The theoretical value is shown in parentheses.

Reference Example 10 Human NGF N-terminal peptide
0 work made of bovine serum albumin of a complex with bovine serum albumin (BSA) (132mg) of 3ml.
It was dissolved in 1M phosphate buffer (pH 7.5). 1 in this solution
Dimethylamide solution (20 mg) containing 1.2 mg of N- (γ-maleimidobutyloxy) succinimide (GMBS).
0 μl) was added dropwise with stirring with a stirrer, and the reaction was carried out at 30 ° C. for 30 minutes. The reaction solution was eluted with 0.1 M phosphate buffer (pH 6.5) -0.1 M NaCl as Sephade.
Purification with x G-25 (1.5 × 30 cm) gave a maleimide group-introduced BSA (maleimidated BSA). The above maleimidated BSA (20 mg) was dissolved in 0.1M phosphate buffer (pH 6.5) -0.1M NaCl. on the other hand,
Human NGF N-terminal peptide (5 mg) obtained in Reference Example 9 above
Was dissolved in 0.1 M phosphate buffer (pH 6.0) -5 mM EDTA. Mix both solutions (total volume 5ml or less), 30 ℃
Reaction for 60 minutes, add PBS and add human NGF N
12 ml of a solution containing a complex of powdered peptide and BSA was obtained. This solution was dispensed in 1.5 ml aliquots and used for immunization of rabbits.

Reference Example 11 Anti-human NGF N-terminal peptide
Preparation of Antibody The complex of human NGF N-terminal peptide and BSA obtained in Reference Example 10 above was mixed well with Freund's complete adjuvant, and the mixture was subcutaneously injected into a rabbit. After that,
Incomplete adjuvan of the above complex and Freund every two weeks
The mixture with t was injected into the same rabbit. Blood obtained by collecting the rabbits immunized as described above was centrifuged to obtain antiserum. ELISA using antibody titer of the obtained antiserum as human NGF N-terminal peptide antigen
A high antibody titer was observed as a result of the measurement. The above antiserum was purified by ammonium sulfate salting-out and DEAE cellulose column chromatography to obtain an anti-human NGF N-terminal peptide polyclonal antibody.

Example 1 (1) Immunization: 50 μg of antigen human N dissolved in 0.15 ml of physiological saline against BALB / c mice (8 weeks old)
The same amount of GF (obtained in Reference Example 7) and Freund's complete adjuvant (Difco) were mixed and injected subcutaneously. Two
After a week, a mixture of the same amount of the antigen and 0.15 ml of Freund's incomplete adjuvant was re-administered subcutaneously. Furthermore, 2 weeks later, 4 weeks later, and 6 weeks later, the same booster immunization is performed, and 5
Two weeks after the next immunization, 75 μg of human N dissolved in physiological saline
GF was inoculated intravenously.

(2) Cell fusion: From the immunized mouse obtained in (1) above, 3 days after the final administration of the antigen, the spleen was excised to obtain cells used for cell fusion. The cells were prepared by mixing Iscove's medium and Ham's F-12 medium at a ratio of 1: 1 (hereinafter,
It was suspended in IH medium). Mouse myeloma cell P
3-X63-Ag.8UI was subcultured in RPMI 1640 medium containing 10% fetal bovine serum under the conditions of 5% carbon dioxide and 95% air. Cell fusion is the method established by Köhler and Milstein et al. [Kohler, G. and Milstein, C .; Nature 256 , 495 (197).
5)]. Myeloma cell 2.4 × 10 ⁷
And immunized lymphocytes 1.2 obtained by the method described above
× 10 ⁸ were mixed, spun down, and dissolved in 0.3 ml of IH medium to prepare 45% polyethylene glycol 6000 (hereinafter referred to as P
It is called EG6000. ) Was added dropwise. The solution of PEG6000 was previously warmed to 37 ° C. and slowly added dropwise. After 8 minutes, 0.5 ml each of IH medium preheated to 37 ° C. was added to make 10 ml, and the mixture was centrifuged at room temperature for 600 rpm for 15 minutes to remove the supernatant. This cell precipitate was suspended in 200 ml of IH medium containing 20% fetal bovine serum, and 100 μl of each 768 well was seeded in a 96-well microplate (Nunc). One day later, HAT (hypoxanthine 1 × 10
^-4 M, aminopterin 4 x 10 ^-7 M, thymidine 1.6 x
100 μl of IH medium containing 10 ⁻⁵ M) (containing 20% fetal calf serum) (hereinafter referred to as HAT medium) was added to each well, and half of the medium was added to HAT medium every 3 days. Exchanged. The cells thus grown are hybrid cells.

(3) Search for antibody-producing cells: 10 μg of recombinant human NGF purified by the method described in Reference Example 7
Diluted with 0.01 M carbonate buffer (pH 8.5) to 100 μl / ml, 100 μl of the diluted solution was put into each well of 96-well immunoplate (Nunc) and left overnight at 4 ° C. NGF was bound. After washing with 0.01M phosphate buffer (pH 7.0) containing 0.15M NaCl,
1% bovine serum albumin to block excess binding sites
200 μl of 0.01M phosphate buffer containing (BSA)
Each well was poured into a well and stored in a cool place until use.
100 µl of the hybrid cell culture supernatant was added to the human NGF-bound 96-well immunoplate obtained as described above.
Each one was added and incubated at room temperature for 2 hours. After removing and washing the culture supernatant, horseradish peroxidase (HRP) -labeled anti-mouse IgG goat antibody (Kappel) was used as a secondary antibody.
Was added and incubated at room temperature for 2 hours. After removing the secondary antibody and thoroughly washing the wells, a peroxidase substrate solution (pH 5.5 sodium citrate buffer containing 0.02% H ₂ O ₂ and 0.15% o-phenylenediamine) was added to 1 well.
Add 00 μl, react at 25 ° C for 10 minutes, and 2N-sulfuric acid 1
After stopping the enzymatic reaction by adding 00 μl, the absorbance at 492 nm was measured using an automatic colorimeter for microplates (MTP-32, manufactured by Corona) (ELI.
SA method). The presence of bound antibody was observed in 2 wells by this method.

(4) Cloning of hybrid cells: The cells in these wells were seeded beforehand as 5 × 10 ⁴ cells / well of mouse thymocytes and vegetative cells so that the number of cells per well was 0.5. A 96-well microplate was used for cloning. As a result, 1 representative clone cell was obtained from each well, and a total of 2 clone cells, namely NGFA-133 (IFO 50) were obtained.
239, FERM BP-3078), NGFB-260
(IFO 50240, FERM BP-3079) was obtained.

(5) Production of antibody: Intraperitoneally of BALB / c mice to which 0.5 ml of mineral oil had been intraperitoneally administered in advance to each of the two hybridoma clones obtained by cloning in (4) above. To 1
Ascites was performed by inoculating 1 × 10 ⁶ animals per animal. Ascites was collected 10 days after the hybridoma was intraperitoneally administered. From about 10 ml of each obtained ascites,
The monoclonal antibody was purified according to the method of Stalin et al. [Journal of Biological Chemistry, 256 , 9750-9754 (1981)]. First, 10,000 rpm to remove fibrin-like substances from ascites 1
After centrifugation for 5 minutes, phosphate buffer-saline (PBS: 8.
1 mM-Na ₂ HPO ₄ , 1.5 mM KH ₂ PO ₄ , 27 mM K
It was diluted with Cl, 137 mM NaCl, pH 7.2) to a concentration showing an ultraviolet absorption (A ₂₈₀ ) at 280 nm of 12-14.
After dilution, a saturated ammonium sulfate solution was added to the sample to a concentration of 47%, salting was performed for 60 minutes at 4 ° C with stirring, and then centrifugation (10,000 rpm, 15 minutes) was performed to obtain a precipitate. It was The precipitate was dissolved in 20 mM Tris buffer solution (pH 7.9) containing 50 mM NaCl, and the solution 2 was added.
Dialysis was performed on l. After 2 hours, 2 liters of the same dialyzing solution was replaced, and dialysis was performed for another 15 hours. After dialysis,
Centrifugation was performed at 10,000 rpm for 15 minutes to remove the precipitate, and the supernatant was prepared so that the A ₂₈₀ value was 20 to 30. This sample was applied to a 20 ml DEAE cellulose column (Whatman DE ₅₂ ) equilibrated with a sufficient amount of Tris buffer containing 50 mM NaCl to obtain 50 mM Na.
After washing well with Cl-containing Tris buffer solution, 50 mM-5
Fractionation was performed at a flow rate of 1.5 ml / min using a gradient salt solution of the same buffer containing 0.00 mM NaCl, and the flow-through fraction was concentrated to obtain purified monoclonal antibody NGF.
A-133 and NGFB-260 were obtained. The method of Laemli et al. [Nature, 227 , 68] was used to confirm the purity of the antibody.
0-685 (1970)] and SDS-polyacrylamide gel electrophoresis was used. That is, salting out with ammonium sulfate,
The fraction passed through the DEAE cellulose column was reduced with 2-mercaptoethanol to obtain an acrylamide concentration of 10
Electrophoresis was carried out for 2.5 hours at 180 V using a% gel. As a result, all of the monoclonal antibodies had a molecular weight of 5
Two bands, an H chain around 2K and an L chain around 28K, were observed.

(6) Measurement of antibody subclass: The antibody subclass was measured by the following method. That is, 100 μl of each cloned hybridoma culture supernatant was added to the 96-well immunoplate coated with recombinant human NGF obtained in Reference Example 7 and incubated at room temperature for 2 hours. After removing the culture supernatant and washing, rabbit anti-mouse IgG
Antibodies against 1, IgG2a, IgG2b, IgG3, K chain and λ chain
100 μl of each (Kappel) was added and incubated at room temperature for 2 hours. HR after removing each antibody and washing
P-labeled goat anti-rabbit IgG antibody (Kappel) was added and incubated at room temperature for 2 hours. After removing the labeled antibody and washing well, the enzyme reaction was carried out by the method described in (3) above, and the absorbance was measured. As a result, the monoclonal antibody NGF
It was found that both A-133 and NGFB-260 are subclasses of IgG1K type.

Example 2 (1) Enzyme labeling of antibody: Purified NGFB-260 antibody (10.
8 mg / ml) 1.5 ml containing 0.1M NaCl 0.1M
Dialyze against acetate buffer (pH 4.2) at 4 ° C for 4 hours,
Add pepsin (Sigma, USA) (0.5 mg) and add 37 ° C.
Digested for 20 hours. The pH was adjusted to 7 with 1 M Tris to stop the reaction, and 0.02 M borate buffer solution (pH 8.0) containing 0.15 M NaCl was separated as an eluent on a column of Ultrogel AcA 44 (IBF, France). F (ab ') ₂ was obtained. After concentrating this to 1.1 ml, 0.1M phosphate buffer (pH)
It was dialyzed against 6.0) for 4 hours at 4 ° C., 0.2 ml of mercaptoethylamine, 5 mM EDTA and 0.1 ml of 0.1 M phosphate buffer (pH 6.0) was added, and the mixture was reduced at 37 ° C. for 90 minutes. . The reaction solution is Sephadex G-25fine (Pharmacia Fine Chemical Co., Sweden) (φ1 × 60 cm)
Were separated with 5 mM EDTA and 0.1 M phosphate buffer (pH 6.0) as eluents to obtain Fab 'fractions. On the other hand, horseradish peroxidase (HRP) (Boehringer Mannheim, West Germany) 10 mg was dissolved in 1.4 ml of 0.1 M phosphate buffer (pH 7.0) to prepare N- (γ-maleimidobutyloxy) succinimide (GMBS). 2.1 mg of N, N-
It was dissolved in 100 μl of dimethylformamide (DMF), added, and stirred at 30 ° C. for 60 minutes, and then Sephadex G-25fine.
(φ1.2 × 60cm) 0.1M phosphate buffer (pH 7.0)
Is separated as an eluent, and the maleimide group-introduced HR is separated.
P was obtained (maleimidized HRP). Fab ′ and maleimidated HRP were mixed at a molar ratio of 1: 1 at 20 ° C. at 4 ° C.
Reacted for hours. After the reaction, a 0.1 M phosphate buffer solution (pH 7.0) was used as an eluent for separation on an Ultrogel AcA 44 column to obtain an enzyme-labeled antibody (NGFB-260 Fab'-HRP).

(2) Preparation of antibody-bound solid phase: purified NGFA-
The 133 antibody was diluted with 0.01 M carbonate buffer (pH 8.5) to 10 μg / ml, and 100 μl thereof was placed in each well of a 96-well immunoplate and left overnight at 4 ° C. to bind the antibody to the solid phase. .. 0.1M containing 0.15M NaCl.
After washing with 01M phosphate buffer (pH 7.0), 1% BS
200 μl of 0.01 M phosphate buffer containing A was injected into each well and stored in a cool place until use.

(3) Sandwich EIA method: 100 μl of NGF solutions prepared at various concentrations were placed in antibody-coupled wells and incubated at 4 ° C. overnight. After removing the NGF solution, the enzyme-labeled antibody (NGFB
-260 Fab'-HRP) was added at 100 μl per well and incubated at room temperature for 2 hours. After removing the labeled antibody, the HRP substrate solution was added, and the following enzymatic reaction was carried out in the same manner as in Example 1 to measure the absorbance at 492 nm. As a result, the detection limit of NGF in this measurement system was 0.4.
ng / well [Fig. 6].

(4) Neutralizing activity of monoclonal antibody: Whether or not to neutralize the biological activity of the obtained monoclonal antibody-NGF was determined by using PC-12 cells derived from rat adrenal medulla pheochromocytoma and chicken dorsal root ganglion. I examined it. (a) Examination using PC-12 cells: human NGF 10 ng /
10 ⁴ PC-12 cells primed with ml were seeded in a 24-well microplate and 2 ng / ml of human NG
In the presence of F, various concentrations of the culture supernatant of the hybridoma clone cells described in Example 1 were added, and the effect on the projection formation of PC-12 cells was examined. As a result, NGFA-1
When 33 antibody was added, protrusion formation was completely suppressed [Table 5], and this antibody was found to neutralize the biological activity of NGF.

[Table 5]

(B) Examination using ganglia: The method of Davies et al. [J. Neuros (J. Neuros
Ci.) 6.1 1897 (1986)], nerve cells obtained from the embryonic spinal cord ganglion on the 8th day of fertilization were seeded in a 48-well microplate at a rate of 4 × 10 ³ cells / well. 2n
g / ml human NGF and various concentrations (0.3, 1, 3,
A mixture of purified monoclonal antibody (10, 30, 100 ng / ml) was added to the wells, and neurite-outgrowth
The effect on As a result, NGFA-133
Antibodies exert a suppression phenomenon at 3 ng / ml or more, 30 ng
It was found that the compound completely suppressed the addition of 1 / ml and had a strong neutralizing activity. (5) Antigen tissue site of monoclonal antibody: antibody is human N
Whether or not to recognize the N-terminal part of GF was examined by the following method. The N-terminal peptide of human NGF obtained in Reference Example 9 was diluted with 0.01 M carbonate buffer (pH 8.5) to 10 μg / ml, and 100 μl thereof was placed in each well of a 96-well immunoplate at 4 ° C. It was left overnight to bind the peptide to the solid phase. After washing with 0.01 M phosphate buffer (pH 7.0) containing 0.15 M NaCl, 0.0% containing 1% BSA was added to block excess binding sites.
Inject 200 μl of 1M phosphate buffer into each well,
Stored in a cool place until use. To the plate prepared as described above, 100 μl of the culture supernatants of the two types of cloned cells obtained in Example 1 were dispensed, and EIA was performed in the same manner as in Example 1- (3). , Monoclonal antibody N
Neither GFA-133 nor NGFB-260 showed peptide binding. Furthermore, Example 1- (3)
A 96-well microplate coated with NGF was prepared in the same manner as described, and the antibody and various concentrations (0.4 to 50 μm) were added.
(g / ml) with the prepared N-terminal peptide to give antibody NGF
It was examined whether or not the binding to the peptide was inhibited by the peptides, but no inhibitory effect was observed at any concentration of the peptides. From the above results, the obtained two kinds of monoclonal antibodies NGFA-133 and NGFB-260 were
It was considered to recognize an antigenic determinant present in the NGF N-terminal portion of human NGF other than 1-15 amino acids.

(6) Sandwich EIA method using anti-NGF N-terminal peptide antibody and monoclonal antibody: Reference Example 1
1. Purified rabbit polyclonal antibody and monoclonal antibody NGFA-1 against human NGF N-terminal peptide according to 1.
Whether or not human NGF can be quantified by 33 or NGFB-260 was examined by the following method. Purified human NGF N-terminal peptide antibody was bound to each well of a 96-well immunoplate bound to a concentration of 1 μg / well by the same method as described in (2) above, and 100 μl of NGF solution prepared at various concentrations was added. Incubated for 2 hours at room temperature. After removing the NGF solution, 100 μl of a solution containing the monoclonal antibody NGFA-133 or NGFB-260 adjusted to a concentration of 1 μg / ml was added, and the mixture was allowed to stand at room temperature for 2
Incubated for hours. After removing and washing the antibody solution, 1
HRP-labeled rabbit anti-mouse IgG diluted 10,000 times
100 μl of antibody (Jackson Immunoresearch Laboratories) was added, reacted for 2 hours at room temperature, washed well, and enzymatically reacted in the same manner as described in (3) above to obtain 492n.
The absorbance at m was measured. As a result, the detection limit of NGF in this EIA method was 15 pg / well, and detection was possible at a very low concentration [Fig. 7].

Example 3 (1) Enzyme labeling of antibody: Purified NGFA-133 antibody (7 m
g / ml) and the purified rabbit anti-human NGF N-terminal peptide antibody described in Reference Example 11 (2.5 mg / ml).
Fab) fractions were obtained in the same manner as described in Example 2 (1), and then reacted with maleimidated HRP to obtain the enzyme-labeled antibody NGFA-133Fab′-H.
RP and anti-human NGF (1-15) Fab'-HRP were obtained. (2) Sandwich EIA 100 μl of NGF solutions adjusted to various concentrations were placed in the wells to which the NGFA-133 antibody described in Example 2 (2) was bound and incubated at 4 ° C. overnight. After removing the NGF solution, 100 μl of NGFA-133-HRP or anti-human NGF (1-15) Fab′-HRP diluted 100-fold was added per well, and the mixture was incubated at room temperature for 2 hours. After removing the labeled antibody, the HRP substrate solution was added, and the following enzymatic reaction was carried out in the same manner as in Example 1 to measure the absorbance at 492 nm. As a result, N was used as the enzyme label.
When GFA-133Fab′-HRP was used, NGF
Detection limit of 0.94 pg / well (Fig. 8), anti-human N
When GF (1-15) Fab'-HRP was used, the detection limit was 8.4 pg / well. From the above results, sandwich E using NGFA-133 as the solid-phase bound antibody and NGFA-133 antibody as the enzyme-labeled antibody
It was found that the IA system detected NGF with the highest sensitivity. Further, the human nerve growth factor 2 (polypeptide (I)) whose EIA system shows high homology with human NGF
[Human NGF-2, revised et al .: European Patent Application Publication No. 386,752, FEBS Letters, 2
66 , 189-191 (1990)], it was examined whether hNGF-2 was 1 μg / ml.
It was found that the cross-reactivity was 0.01% or less without showing any reactivity even at a high concentration. In addition, in FIG. 8, the graph of − ◯ − shows the result of human NGF detection sensitivity, and the graph of − ◯ − in black shows the result of reactivity with human NGF-2.

[0067]

INDUSTRIAL APPLICABILITY The monoclonal antibody of the present invention is
Since it specifically binds to the GF protein and has a high binding ability, it can be advantageously used as a reagent for measuring human NGF. Further, a part of the monoclonal antibody of the present invention has a neutralizing activity and may be used as a reagent for knowing the in vivo activity of NGF.

[0068]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 972 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin Biological name: Human Strain name: Tissue sequence: CCCGGGTTAC GCCTGTTGTC CCGGTATAAC CATTGCTAGC ACACCCTTTC CCTCTCAGAA 60 GTGCCCCGGT TTGAATGAAA CCTCTTCGTG ATCCCCTTGG GAGGTCAACT CTGAGGGACC 120 CAGAAACTGC CTTTTGACTG CATTTAGTAC TCCATGAAGT CACCCTCATT TCTTTTTCAT 180 TCCAGGTGCA TAGCGTA ATG TCC ATG TTG Au ATC ATG Tla Au Tle Athlet GAA CCA CAC TCA GAG AGC AAT GTC CCT 278 Phe Leu Ile Gly Ile Gln Ala Glu Pro His Ser Glu Ser Asn Val Pro 15 20 25 GCA GGA CAC ACC ATC CCC CAA GTC CAC TGG ACT AAA CTT CAG CAT TCC 326 Ala Gly His Thr Ile Pro Gln Val His Trp Thr Lys Leu Gln His Ser 30 35 40 CTT GAC ACT GCC CTT CGC AGA GCC CGC AGC GCC CCG GCA GCG GCG ATA 374 Leu Asp Thr Ala Leu Arg Arg Ala Arg Ser Ala Pro Ala Ala Ala Ile 45 50 55 GCT GCA CGC GTG GCG GGG CAG ACC CGC AAC ATT ACT GTG GAC CCC AGG 422 Ala Ala Arg Val Ala Gly Gln Thr Arg Asn Ile Thr Val Asp Pro Arg 60 65 66 70 CTG TTT AAA AAG CGG CGA CTC CGT TCA CCC CGT GTG CTG TTT AGC ACC 470 Leu Phe Lys Lys Arg Arg Leu Arg Ser Pro Arg Val Leu Phe Ser Thr 75 80 85 CAG CCT CCC CGT GAA GCT GCA GAC ACT CAG GAT CTG GAC TTC GAG GTC 518 Gln Pro Pro Arg Glu Ala Ala Asp Thr Gln Asp Leu Asp Phe Glu Val 90 95 100 GGT GGT GCT GCC CCC TTC AAC AGG ACT CAC AGG AGC AAG CGG TCA TCA 566 Gly Gly Ala Ala Pro Phe Asn Arg Thr His Arg Ser Lys Arg Ser Ser 105 110 115 TCC CAT CCC ATC TTC CAC AGG GGC GAA TTC TCG GTG TGT GAC AGT GTC 614 Ser His Pro Ile Phe His Arg Gly Glu Phe Ser Val Cys Asp Ser Val 120 125 130 AGC GTG TGG GTT GGG GAT AAG ACC ACC GCC ACA GAC ATC AAG GGC AAG 662 Ser Val Trp Val Gly Asp Lys Thr Thr Ala Thr Asp Ile Lys Gly Lys 135 140 145 150 GAG GTG ATG GTG TTG GGA GAG GTG AAC ATT AAC AAC AGT GTA TTC AAA 710 Glu Val Met Val Leu Gly Glu Val Asn Ile Asn Asn Ser Val Phe Lys 155 160 165 CAG TAG TTT TTT GAG ACC AAG TGC CGG GAC CCA AAT CCC GTT GAC AGC 758 Gln Tyr Phe Phe Glu Thr Lys Cys Arg Asp Pro Asn Pro Val Asp Ser 170 175 180 GGG TGC CGG GGC ATT GAC TCA AAG CAC TGG AAC TCA TAT TGT ACC ACG 806 Gly Cys Arg Gly Ile Asp Ser Lys His Trp Asn Ser Tyr Cys Thr Thr 185 190 195 ACT CAC ACC TTT GTC AAG GCG CTG ACC ATG GAT GGC AAG CAG GCT GCC 854 Thr His Thr Phe Val Lys Ala Leu Thr Met Asp Gly Lys Gln Ala Ala 200 205 210 TGG CGG TTT ATC CGG ATA GAT ACG GCC TGT GTG TGT GTG CTC AGC AGG 902 Trp Arg Phe Ile Arg Ile Asp Thr Ala Cys Val Cys Val Leu Ser Arg 215 220 225 230 AAG GCT GTG AGA AGA GCC TGACCTGCCG ACACGCTCCC TCCCCCTGval CC 950 Ar Arg Ala 235 CCTTCTACAC TCTCCTGGGC CC 972

SEQ ID NO: 2 Sequence Length: 37 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Synthetic DNA Sequence Characteristics: Adapter Sequence: AGCTTGCCGC CACCATGTCC ATGTTGTTCT ACACTCT 37

SEQ ID NO: 3 Sequence length: 37 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA Sequence characteristics: Adapter sequence: GATCAGAGTG TAGAACAACA TGGACATGGT GGCGGCA 37

SEQ ID NO: 4 Sequence length: 12 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA Sequence characteristics: Adapter sequence: CAGATCTGGG CC 12

SEQ ID NO: 5 Sequence length: 8 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Sequence:

SEQ ID NO: 6 Sequence length: 20 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Sequence: Phe Glu Thr Lys Cys Arg Asp Pro Asn Pro Val Asp Ser Gly Cys 5 10 15 Arg Gly Ile Asp Ser 20

SEQ ID NO: 7 Sequence length: 19 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Sequence: Ile Arg Ile Asp Thr Ala Cys Val Cys Val Leu Ser Arg Lys Arg 5 10 15 Val Arg Arg Ala

SEQ ID NO: 8 Sequence length: 15 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Sequence: Ser Ser Ser His Pro Ile Phe His Arg Gly Glu Phe Ser Val Cys 5 10 15

[Brief description of drawings]

FIG. 1 shows the cloned human N obtained in Reference Example 1.
The nucleotide sequence of the GF gene and the amino acid sequence translated therefrom are shown.

FIG. 2 shows the cloned human N obtained in Reference Example 1.
The nucleotide sequence of the GF gene and the amino acid sequence translated therefrom are shown.

FIG. 3 shows a construction diagram of the human NGF expression vector pMNGF101 obtained in Reference Example 1.

FIG. 4 shows a construction diagram of the human NGF expression vector pMNGF201 obtained in Reference Example 2.

FIG. 5 shows a construction diagram of the human NGF expression vector pTB1058 obtained in Reference Example 3.

FIG. 6 shows the results of detection sensitivity of human NGF by sandwich EIA using a monoclonal antibody obtained in Example 2.

FIG. 7 shows the results of detection sensitivity of human NGF by sandwich EIA using the monoclonal antibody and rabbit anti-human NGF N-terminal peptide polyclonal antibody obtained in Example 2.

FIG. 8 shows anti-NGFA-133 set in Example 3.
The results of detection sensitivity of human NGF by sandwich EIA using Fab ′ of the antibody as a solid phase and a labeled antibody and the results of reactivity with human NGF-2 are shown.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] November 15, 1991

[Procedure Amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0068

[Correction method] Change

[Correction content]

[0068]

[Sequence listing] SEQ ID NO: 1 Sequence length: 972 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: Genomic DNA Origin organism name: Human strain name: Tissue Sequence: CCCGGGTTAC GCCTGTTGTC CCGGTATAAC CATTGCTAGC ACACCCTTTC CCTCTCAGAA 60 GTGCCCCGGT TTGAATGAAA CCTCTTCGTG ATCCCCTTGG GAGGTCAACT CTGAGGGACC 120 CAGAAACTGC CTTTTGACTG CATTTAGTAC TCCATGAAGT CACCCTCCATTCATCATCATCATCATCATCATCATTCT TCTTTTTCATCAT
r Leu Ile Thr Ala 1
5 10 TTT CTG ATC GGC ATA CAG GCG GAA CCA
CAC TCA GAG AGC AAT GTC CCT 278 Phe Leu Ile Gly Ile Gln Ala Glu Pro
His Ser Glu Ser Asn Val Pro 15 20
25 GCA GGA CAC ACC ATC CCC CAA GTC CAC
TGG ACT AAA CTT CAG CAT TCC 326 Ala Gly His Thr Ile Pro Gln Val His
Trp Thr Lys Leu Gln His Ser 30 35
40 CTT GAC ACT GCC CTT CGC AGA GCC CGC
AGC GCC CCG GCA GCG GCG ATA 374 Leu Asp Thr Ala Leu Arg Arg Ala Arg
Ser Ala Pro Ala Ala Ala Ile 45 50
55 GCT GCA CGC GTG GCG GGG CAG ACC CGC
AAC ATT ACT GTG GAC CCC AGG 422 Ala Ala Arg Val Ala Gly Gln Thr Arg
Asn Ile Thr Val Asp Pro Arg 60 65
70 75 CTG TTT AAA AAG CGG CGA CTC CGT TCA
CCC CGT GTG CTG TTT AGC ACC 470 Leu Phe Lys Lys Arg Arg Leu Arg Ser
Pro Arg Val Leu Phe Ser Thr 80
85 90 CAG CCT CCC CGT GAA GCT GCA GAC ACT
CAG GAT CTG GAC TTC GAG GTC 518 Gln Pro Pro Arg Glu Ala Ala Asp Thr
Gln Asp Leu Asp Phe Glu Val 95 100
105 GGT GGT GCT GCC CCC TTC AAC AGG ACT
CAC AGG AGC AAG CGG TCA TCA 566 Gly Gly Ala Ala Pro Phe Asn Arg Thr
His Arg Ser Lys Arg Ser Ser 110 11 5
120 TCC CAT CCC ATC TTC CAC AGG GGC GAA
TTC TCG GTG TGT GAC AGT GTC 614 Ser His His Pro Ile Phe His Arg Gly Glu
Phe Ser Val Cys Asp Ser Val 125 130
135 AGC GTG TGG GTT GGG GAT AAG ACC ACC
GCC ACA GAC ATC AAG GGC AAG 662 Ser Val Trp Val Gly Asp Lys Thr Thr
Ala Thr Asp Ile Lys Gly Lys 140 145
150 155 GAG GTG ATG GTG TTG GGA GAG GTG AAC
ATT AAC AAC AGT GTA TTC AAA 710 Glu Val Met Val Leu Gly Glu Val Asn
Ile Asn Asn Ser Val Phe Lys 160
165 170 CAG TAG TTT TTT GAG ACC AAG TGC CGG
GAC CCA AAT CCC GTT GAC AGC 758 Gln Tyr Phe Phe Glu Thr Lys Cys Arg
Asp Pro Asn Pro Val Asp Ser 175 180
185 GGG TGC CGG GGC ATT GAC TCA AAG CAC
TGG AAC TCA TAT TGT ACC ACG 806 Gly Cys Arg Gly Ile Asp Ser Lys His
Trp Asn Ser Tyr Cys Thr Thr 190 19 5
200 ACT CAC ACC TTT GTC AAG GCG CTG ACC
ATG GAT GGC AAG CAG GCT GCC 854 Thr His Thr Phe Val Lys Ala Leu Thr
Met Asp Gly Lys Gln Ala Ala 205 210
215 TGG CGG TTT ATC CGG ATA GAT ACG GCC
TGT GTG TGT GTG CTC AGC AGG 902 Trp Arg Phe Ile Arg Ile Asp Thr Ala
Cys Val Cys Val Leu Ser Arg 220 225
230 235 AAG GCT GTG AGA AGA GCC TGACCTGCCG A
CACGCTCCC TCCCCCTGCC 950 Lys Ala Val Arg Arg Ala 240 CCTCTACTACACTCTCTCGGGGC CC
972

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display location G01N 33/53 D 8310-2J 33/577 B 9015-2J // C12N 15/06 15/18 C12P 21/02 H 8214-4B (C12P 21/08 C12R 1:91) (C12P 21/02 C12R 1:91) 8931-4B C12N 15/00 A

Claims (9)

[Claims] 1. A monoclonal antibody against NGF protein which reacts with human nerve growth factor (NGF) and does not recognize the N-terminal portion of human NGF. 2. The monoclonal antibody according to claim 1, which is the monoclonal antibody NGFA-133. 3. The monoclonal antibody according to claim 1, which is the monoclonal antibody NGFB-260. 4. A hybridoma producing the monoclonal antibody according to claim 1. 5. The hybridoma according to claim 4, which is the hybridoma NGFA-133. 6. The hybridoma according to claim 4, which is the hybridoma NGFB-260. 7. The method for producing a monoclonal antibody according to claim 1, wherein the hybridoma according to claim 4 is grown in a liquid medium or intraperitoneally of a mammal. 8. A method for detecting and / or quantifying NGF protein, which comprises performing an immunological assay using the monoclonal antibody according to claim 1. 9. The detection and / or quantification method according to claim 8, wherein an enzyme immunoassay method is performed.