JPH0456594B2 - - Google Patents

Description

[Detailed description of the invention]

(Industrial Application Field) The present invention relates to a DNA containing a base sequence encoding a polypeptide having a diuretic effect or a precursor thereof, and a plasmid containing the DNA. (Prior Art and Technical Background) It is known that granules morphologically similar to granules found in peptide hormone-producing cells exist in the human atrium (JDJamieson & G.
E.Palade, J.Cell Biol., 23 , 151, 1964). recent years,
Rat atrial homogenate and its granules were
It is known to cause natriuresis in rats (AJDeBold et al., Life Sci., 28 , 89, 1981,
R. Keeler, Can. J. Physiol. Pharmacol., 60 ,
1078, 1982, etc.), and the existence of peptide-like substances with molecular weights of 20,000 to 30,000 and 10,000 or less that have natriuretic effects in the atrium of humans, rabbits, pigs, and rats (G. .Mark,
S. Currie et al., Science, 221 , 71-73, 1983). More recently, Flynn, TG et al. isolated a 28-amino acid peptide with diuretic activity from rat atrium (Biochem.Biophys.Res.
Commun., 118 , 130-139, 1984). Also,
Kangawa, K. and Matsuo, H. discovered a peptide consisting of 28 amino acids with similar activity from human atrium and named it α-hANP. And α-hANP is H-1 Ser -Leu-Arg-Arg
−Ser−Ser−Cys−Phy−Gly−10 Gly −Arg−
Met−Asp−Arg−Ile−Gly−Ala−Glu−Ser−20 Gly −Leu−Gly−Cys−Asn−Ser−Phe−Arg−
We demonstrated the structure of 28 Tyr -OH (Cys at position 7 and Cys at position 23 are bonded by a disulfide bond) and clarified that it has a remarkable diuretic effect as a pharmacological activity, especially natriuretic effect and antihypertensive effect (Biochem .Biophys.Res.Commun., 118 , 131~
139, 1984, and patent application No. 58-243675). On the other hand, it is known that various physiologically active peptides are not directly produced in vivo, but that their respective precursors are produced through the action of endeptidase, exopeptidase, and the like. For example, it has been reported that β-endorphin and γ-LPH are produced using β-LPH as a precursor, and β-MSH is produced using γ-LPH as a precursor (Takahashi, H. et al., FEBS Lett. 135 , 97〜102,
1981). The present inventors paid attention to this, and α-
Thinking that hANP may also be produced from a certain precursor, we conducted intensive research on the gene encoding α-hANP and its production mechanism. the result,
Peptide that is the precursor of α-hANP (hereinafter referred to as γ-
We succeeded in isolating and identifying the gene (DNA) encoding hANP (abbreviated as hANP), and created a recombinant DNA containing this DNA.We also used this recombinant DNA to produce diuretic effects, especially natriuretic effects, and The present inventors have discovered that it is possible to produce a peptide that has a blood pressure lowering effect, and have completed the present invention. (Problems to be Solved by the Invention) That is, the present invention provides α-hANP and its precursors (for example, γ -hANP; This amino acid sequence is
Furthermore, the present invention provides a method for mass-producing various polypeptides that have the same biological activity as these polypeptides (shown in the figure). The structure and pharmacological activity of γ-hANP, a precursor of α-hANP isolated from human atrial granules, can be found in the specification of the patent application “Novel Peptides and Pharmaceuticals Containing the Same as Active Ingredients” filed on the same day as this application. It is described in detail in the book. (Means for solving the problems) The present invention will be described below. (1) Identification of the γ-hANP gene, which is the precursor of α-hANP (see Figure 5) A gene having the base sequence encoding α-hANP was prepared as follows. First, from polyARNA (mRNA) obtained using an oligo-dT column from human atrial granules, Okayama
-Berg method (Mol.Cell.Biol., 2, 161-170,
(1982) was used to create a cDNA library, and then chemically synthesized 14-mer oligonucleotides corresponding to positions 12 (met) to 16 (Gly) of the amino acid sequence (described above) of α-hANP were used as a mixed probe. ) as the above
A clone that hybridized with the target probe, ie, ^{the 32} P-labeled probe, was selected from the cDNA library. This results in approximately 40000
23 target clones were obtained from 2 transformants (the above-mentioned cDNA ligature). For plasmids from 8 clones, use the above 14mer mixed probe as a primer.
When the nucleotide sequences were examined by the dideoxy method, all plasmids had a nucleotide sequence encoding α-hANP. Of these, long insertion
Two plasmids with DNA fragments i.e.
phANP1 and phANP82 (approximately 950 bp and approximately
The entire base sequence was determined for 850bp). The base sequence was Maxam-Gilbert (Meth.
Enzym., 65, 499-560, 1980) and Sanger et al. (Proc. Nath. Aced. Sci. USA, 74 , 5463-
5467, 1977). both
Both DNAs have a long open reading frame (translatable region) that starts with the translation start codon ATG and ends with the translation stop codon TGA, and they have exactly the same sequence except that one is about 100 bp shorter on the 5′ side than the other. Was. This translatable region contains α-hANP, which consists of 28 amino acids and whose amino acid sequence has already been revealed.
(Kangawa, K. & Matsuo, H., Biochem.
Biophys.Res.Commun., 118 , 131-139,
1984) was present (see Figure 5). On the other hand, a diuretic polypeptide (γ-hANP) purified from human atrial granules has an N-terminus of H-Asn-Pro-Met-Tyr-Asn-
...and the C-terminus is -Asn-Ser-Phe-Arg-Tyr-
It was found to consist of 126 amino acids that are OH (see FIG. 1 and the aforementioned patent application filed on the same date as this application). From a comparison of this result and the nucleotide sequences on phANP1 and phANP82 mentioned above, the gene and amino acid sequence encoding γ-hANP (Figure 1) are shown in Figure 5 (showing the sequence cloned into phAN82). It is concluded that this is true. In the figure, amino acid sequences 1 to 25 are considered to be signal peptides involved in protein secretion, and the polypeptide consisting of 126 amino acids starting from Asn at position 26 and ending at Tyr at position 151 is γ-hANP ( The amino acid sequence consisting of the signal peptide and γ-hANP is shown in Figure 2). What I'm interested in is
Amino acid sequence of α-hANP (from position 124 in the figure)
(up to position 151) are present on the C-terminal side of the amino acid sequence of γ-hANP. This means that
This is a consistent explanation of the results described in the specification of the aforementioned patent application filed on the same date as the present application. Thus, as originally expected, α−
We confirmed the existence of the precursor of hANP, ie, γ-hANP, and were able to isolate its gene. The DNA shown in FIG. 5 and its fragments shown in FIGS. 3 and 4 contain α-hANP and γ-
It is clear that hANP is industrially useful as a material for mass producing various polypeptides that have the same biological activities (especially diuretic and antihypertensive effects) as hANP. Also,
It has been suggested that the diuretic peptide (β-hANP), which was also discovered in human atrium, is a dimer of α-hANP (Japanese Patent Application No. 1983-
338817), which also indicates the usefulness of the precursor and its gene. In order for α-hANP to be produced using γ-hANP as a precursor, it is necessary to cleave the C-terminus of pro-arg (amino acid sequence 123-124 in Figure 5). In the intestinal tract and spinal cord, gastrin-releasing hormone (GRP) is produced by cleavage at the C-terminus of the pro-arg sequence present in its precursor (Reave, JR
et al., J. Biol. Chem., 258 , 5582-1983 and
Minamino, N. et al., Biochem.Biophys.Res.
Commun., 119 , 14-20, 1984), α-hANP
It is thought that γ-hANP undergoes similar processing (probably enzymatic action) in vivo and is produced from γ-hANP. (2) Creation of recombinant DNA γ- containing the base sequence encoding α-hANP
The recombinant DNA of the hANP gene is created by using the DNA fragment containing the γ-hANP gene obtained as described above, as described in detail below.
After cloning into M13DNA, in vitro
Mutation method (Zoller, M.J. & Smith, M.,
γ using Nucl.Acid.Res. 10 , 6487, 1982).
-A restriction enzyme EcoRI cleavage site and translation site codon (ATG) are added immediately upstream of the hANP gene, and an appropriate expression control nucleotide sequence region (including promoter and SD sequence) is added upstream of the cleavage site.
This was done by inserting . First, a DNA fragment (approximately 700 bp) containing the γ-hANP gene obtained by cutting phANP1 obtained in (1) above with PstI was inserted into the PstI cleavage point of M13mp8RFDNA (manufactured by PL), and ) was transformed. Next, phage DNA (single-stranded DNA) into which the desired DNA fragment (approximately 700 bp) has been inserted is isolated from the culture solution of the transformed strain,
In vitro mutation
Using the γ-hANP gene mutation (also called site directed mutation) method, we created an EcoRI cleavage recognition site (GAATTC) and ATG immediately upstream of the γ-hANP gene.
(a triplet codon encoding Met) was inserted. The in vitro mutagenesis method uses a chemically synthesized 36mer single strand with an ATG sequence immediately 3' to the EcoRI cleavage recognition site.
Hetero with the above-mentioned single-stranded phage DNA DNA
After forming the duplex, the conventional method (Zoller, JM &
Smith, M., Nucl.Acid.Res. 10 , 6487,
This was carried out by transforming Escherichia coli (JM103) with DNA made double-stranded with the DNA polymerase IKlenow fragment according to (1982). Target base sequence (In Figure 5, the base sequence ACC AGA GCT shown by the broken line from 67th to 75th is GAA
A plasmid having the base sequence converted to TTC ATG can be obtained from the above transformed strain.
DNA (RFDNA) is selected by analysis using restriction enzyme (EcoRI) cleavage, and dideoxy chain termination is performed around the base sequence.
(Sanger, F. et al., Proc. Natl. Acad. Sci.
USA, 74 , 5463-5467, 1977). This plasmid is
It was named M13mp8-hANP525 and used in the next experiment. Cloning of the γ-hANP gene into the expression vector was carried out using the above plasmid M13mp8-
hANP525 was extracted with EcoRI and SalI (SalI cleavage site is
(derived from M13mp8DNA)
A 510 bp DNA fragment was added to the plasmid ps20 (see Figure 6), which had already been constructed by the present inventors.
This was done by replacing the EcoRI-SalI fragment (approximately 450 bp) of . Plasmid ps20 λP _L
Promoter and lambda phage C protein gene
It is a plasmid that contains the SD sequence (Sheain-Dalgarno sequence) as a 5' untranslated region, and is constructed so that a foreign gene inserted downstream of this region (EcoRI break) can be expressed under the control of the λP _L promoter, The E. coli transformed strain N4830/pS20 containing this plasmid was named SBM271 and has been deposited with the Institute of Fine Technology under the Budapest Treaty (FERM BP-535). Plasmid pS220 (see FIG. 6) constructed according to the present invention was transformed into E. coli strain N4830 according to a conventional method, and the production of γ-hANP in the transformed strain (N4830/pS220) was examined. For production of γ-hANP, the culture temperature of the transformed strain was changed from 32°C to 42°C in the middle of the culture.
After shifting to ³⁵ , the produced protein was pulse-labeled (2 minutes) by adding 35 S-methionine, and the labeled produced protein was checked by detecting it by SDS-PAGE (SDS polyacrylamide gel electrophoresis). Ta. As a result, a clear protein band that was not seen in the strain not containing pS220 (N4830) was observed only in the culture of the transformed strain (see Figure 7). Furthermore, the region between the λP _L promoter region of plasmid pS220 and the translation start codon (ATG) of γ-hANP was converted into a region containing the SD sequence of the E. coli outer membrane protein (lpp) gene and the SD sequence of the MS2 phage A protein gene. Similar protein production was observed in the plasmids (pS223-3 and pS224-3, respectively; see FIG. 8) (see FIG. 7). The protein band corresponds to the theoretical molecular weight of γ-hANP.
Although found at a position larger than 13679 (approximately 20 Kd), γ-hANP purified from human atrium was also
Since the protein band migrated at the same position on -PAGE, it was determined that the protein band was γ-hANP produced by the transformed strain N4830/pS220. SDS−
In PAGE, it is a common phenomenon that proteins are migrated at positions with a larger molecular weight than their theoretical molecular weight. Furthermore, this suggests that a chemically synthesized linker with a translation stop codon designed in three different reading frames at the end of the γ-hANP structural gene (

This was also supported by the fact that a similar plasmid with the addition of [Formula] (underlined is a stop codon) also showed a protein band at the same 20Kd position that was not seen in the control. This result precludes the possibility that the translation stop codon TGA (the codon immediately downstream of the 151st amino acid Tyr in Figure 5) may have been incorrectly translated in vivo to produce a large protein. be. Thus, it was confirmed that γ-hANP, which is a precursor of α-hANP, can be produced in microorganisms using the gene obtained in the present invention. Here, we have described recombinant DNA with a base sequence encoding the amino acid sequence (26 to 151) excluding the signal peptide portion of γ-hANP (amino acid sequence 1 to 25 in Figure 5). (Fig. 4), or α-hANP (124 to 151 in Fig. 5).
It is clear that recombinant DNA can also be produced in a similar manner for nucleotide sequences encoding polypeptides starting from 151) or, where appropriate, a polypeptide. In addition, here, we used γ-hAND mRNA cDNA obtained from human atrial granules.
However, a gene encoding the amino acid sequence may be chemically synthesized. Furthermore, in the construction of recombinant DNA, γ-
Although an example is shown in which the _λPL promoter is used to express the hANP gene, the promoter region is not limited to this. For example, when expressed in E. coli, promoter regions such as tryptophan (trp), lactose (lac), lipoprotein (lpp), alkaline phostase (PHOA PHOS, etc.) and outer membrane protein (omp) genes,
Furthermore, a hybrid promoter between tryptophan and lactose promoter (tac promoter)
may also be used. In addition, in the case of expression in yeast, alcohol dehydrogenase (ACH),
Promoter regions of genes such as glyceraldehyde dehydrogenase (GAP-DH), phosphoglycerokinase (RGK) and inhibitory acid phosphatase (PHO5),
Furthermore, in the case of animal cells, the early or late promoter region of SV40 can also be used. The present invention will be further explained below with reference to Examples, but the present invention is not limited thereto. Example 1 Construction of α-hANP cDNA library and gene isolation/identification 1-1 Construction of cDNA library Two human atria isolated from an 82-year-old woman and a 61-year-old man were used using the method of Chirgwin et al. Chirgwin, JM et al., Biochemistry 18 , 5924
5299, 1879), 1 mg of RNA was extracted using 4M guanidinium thiocyanate.
Then 0.5MLiCl ₂ , 10mM EDTA and 0.5%
10mM Tris-HCl buffer (PH) containing SDS
7.2) as a binding buffer
poly(A) ⁺ RNA bound to dT cellulose
(mRNA) 75 μg was isolated (Nakazato,
H. & Edmonds, DS, Meth.Enzym., 29 ,
431-443, 1974). Next, Okayama-
Berg's method (Mol.Cell.Biol., 2 , 161~
170, 1982), 15 μg poly(A) ⁺ RNA
A cDNA library (plasmid) was prepared using 4.2 μg of vector primer DNA and transformed into E. coli strain WA802. Transformants were screened on LB-agar medium containing 40γ/ml ampicillin,
About 40,000 transformants showing ampicillin resistance per 1 μg of poly(A) ⁺ RNA were obtained. 1-2 Isolation of α-hANP clones Approximately 40,000 colonies obtained above were replicated on a nitrocellulose filter,
After culturing on an LB agar plate containing 40 γ/ml ampicillin at 37°C for 6 hours, the cells were further transferred to an LB agar plate containing 180 γ/ml chloramphenicol and cultured at 37°C overnight. Next, the colonies that formed on the filter were sterilized with 0.5N NaOH, neutralized to pH 7.0, and the filter was sterilized with 0.5N NaOH.
0.5M Tris-HCl buffer containing NaCl (PH
7.0) and 3×SCC (0.15M NaCl, 0.015M
Sodium citrate) for 5 minutes each. Finally, remove bacterial debris with a paper towel and air dry.
Baking was performed at 80°C for 2 hours. Then, at the end of 5′
Two types of chemically synthesized oligonucleotides labeled with ³² P (Figure 9) were used as a mixed probe and hybridization was performed with the DNA molecules immobilized on the above filter (Grunstein, M. & Hogness, DS). , Pyoc.
Natl.Acad.Sei.USA, 72 , 3961-3965,
(see 1975). The above probe is based on the amino acid sequence Met-Asp-Arg-Ile-Gly of α-hANP.
(amino acid sequence from position 135 to position 139 in Figure 5)
It is a mixed probe of oligonucleotide consisting of 14mer, whose 5′ end is [γ. ³² P] ATP.
Labeled with T4 kinase and has a specific activity of 1~
It is 2×10 ⁶ cpm/pmol. Hybridization was performed using 1× Denhardts. [0.2%
BSA (Almore), 0.2% Ficol (Sigma)
and 0.2% polyvinylpyrrolidone (Wako Pure Chemical Industries, Ltd.)], 0.1% SDS and per ml.
3x containing 50 μg of salmon testis DNA (PL)
It was carried out for 16 hours at 38°C in SCC. The filter was then washed at 38°C with 3x SCC containing 0.1% SDS.
After washing with water and air drying, it was exposed to X-ray film. This operation yielded 85 positive clones. Next, two types of probes (probe and probe: Figure 9) were used separately, and each was heated to 40℃.
Colony hybridization was performed on the positive clones at 38°C in the same manner as above. As a result, 23 clones that did not hybridize with the probe but only with the probe were obtained.
Next, plasmid DNA was isolated from 8 out of 23 clones using a conventional method, and plasmid DNA was isolated using a dideoxy probe as a primer.
chain termination method (Sanger, F. et al.
Pyoc.Natl.Acad.Sci.USA, 74 , 5463~
5467, 1977). As a result, both plasmids contained α
Since a nucleotide sequence corresponding to the amino acid of -hAND was present, the above eight clones were recognized as transformants having a plasmid containing the cDNA of α-hANP. Among these plasmids, the long γ-hANP
Select two plasmids (phANP1 and phANP82) into which cDNA has been inserted.
The base sequence of the cDNA was determined. phANP1 and
cDNAs of approximately 950 bp and 850 bp were inserted into phANP82, respectively. FIG. 10 shows the restriction enzyme cleavage site of the inserted DNA region and the strategy for determining the base sequence.
In the figure, the direction of base sequence determination is indicated by an arrow; the solid line indicates the upper strand of double-stranded DNA, and the dotted line indicates the lower strand.
strand). Base sequences were determined using the Maxam-Gilbert method (Meth.Enzym., 65 , 499-560,
1980) and the method of Sanger et al. (Proc. Natl.
Acad.Sci.USA, 74 , 5463-5467, 1977). In Figure 10, A is determined by the Maxam-Gilbert method, and B is determined by the Maxam-Gilbert method.
5′− labeled with ^32P at 5′ and 3′
GATCGATCTGCCCTC−3′ and 3′−
CTAGCTAGACGGGAG5′ chemically synthesized oligomers were used as primers by the method of Sanger et al., and C.
The three DNA fragments obtained by cutting with plasmid pUC8 (Vieira, J. & Messing, J.
Gene 19 , 259-268, 1982) and were determined by the method of Sanger et al. As a result of nucleotide sequencing of the above, both nucleotide sequences of the inserted DNA were completely identical except for the difference in length at the 5' end. Among them, the base sequence of the DNA inserted into phANP1 and the amino acid sequence corresponding to the base sequence are shown in FIG. The inserted DNA sequence includes a long translatable sequence (open reading frame) starting from ATG and ending with the stop codon TGA.
α- at the 3′ end (C-terminus in the amino acid sequence)
A DNA sequence encoding hANP was found.
The N-terminus of γ-hANP purified and identified from human atrium is H-Asn-Pro-Met-Tyr-Asn.
-... and the C-terminus is -Asn-Ser-Phe-Arg
-Tyr-OH (see said patent application filed on the same date as this application), γ-
The amino acid sequence of hANP starts from Asn at position 26 and ends at Tyr at position 151 in Figure 5.
It is determined that it consists of 126 amino acids. This result indicates that γ-purified from human atrium
It matches the amino acid composition and amino acid sequence of hANP. In Figure 5, the amino acid sequence 1-25 starting from Met and ending with Ala is considered to correspond to a signal peptide involved in secretion based on its structure. Also, in the base sequence shown in Figure 5,
AATAAA (underlined part) commonly found upstream of the polyA sequence of eukaryotic mRNA near the 3' end
existed. 2 Construction of γ-hANP gene expression vector 2-1 Insertion of hANP gene into M13 DNA 0.44 μg of M13mp 8RF DNA (PL),
20μl Medium-salt Buffer (50mM
Pst in 10mM Tris·HCl buffer (PH7.5) containing NaCl, 10mM _MgCl2 , 1mM DTT.
(16 units) was heated at 37°C for 1 hour to cut. Next, the enzyme reaction was stopped by heating at 65°C for 10 minutes. on the other hand,
Plasmids obtained from cDNA libraries
Add 20 μg of phANP1 DNA to 100 μl in the same way.
Pst (160units) in Medium salt buffer
After cleavage by heating at 37°C for 1 hour using
A gel corresponding to a 700 bp DAN fragment was cut out, and the DNA fragment was extracted and purified by electrophoresis. Next, the above two types of DNA fragments (Pst digested
M13mp8 RFDNA 66 ng and about 700bp DNA
1μg of fragment) was added to 20μ of ligation solution (10mM MgCl ₂ , 1mM ATP, 5mM
20mM Tris/HCl buffer containing DTT PH
7.6), reacted with 5.6 units of T4 DNA ligase (Muro Shuzo) at 14°C for 16 hours. This reaction solution
20μ of Escherichia coli treated with CaCl ₂ as usual
It was added to a JM103 50mM CaCl ₂ suspension and transformed. Selection of transformed clones was performed as follows. YT containing X-Gal and IPTG kept at 45℃
Soft agar medium (0.6% agar, 0.8%
Bactotryptone, 0.5% Yeast Extract, 0.5%
10μ of 100mM IPTG in 3ml of NaCl solution,
2% X-gal 50μ and JM103 in log phase
Add 0.3 ml of the appropriately diluted CaCl ₂ suspension to YT agar medium (1.5% agar, 0.8% bactotryptone, 0.5
37% yeast extract, 0.5% NaCl) spread on top
Cultured at ℃ for 16 hours. Select 10 clones from the resulting white plaques and add them to 2x YT liquid medium (1.6% Bactotryptone, 1% yeast extract,
After inoculation in 1.0% NaCl), the cells were cultured at 37°C for 8 hours.
Next, 1 ml of the culture solution was centrifuged at 10,000 rpm for 10 minutes, and the supernatant was collected as a phage solution.
The phage DNA [single-stranded DNA (ssDNA)] was isolated and purified as described below. 20% polyethylene glycol (PEG6000) containing 2.5M NaCl in 800μ of the above Phage solution
After adding 200μ of
Phages were precipitated by centrifugation at 10,000 rpm for 5 minutes. This phage precipitate was dissolved in TE buffer (1mM EDTA, 10mM Tris HCl).
Dissolve in 100μ of buffer (PH8.0), add 50μ of water-saturated phenol, and mix vigorously for 5 minutes.
Centrifugation was performed at 10,000 rpm for 5 minutes. 80μ was taken from the aqueous phase, 3μ of 3M sodium acetate (PH8.0) and 200μ of ethanol were added thereto, and after cooling at -70°C for 10 minutes,
DNA was precipitated by centrifugation at 10,000 rpm for 10 minutes. After cleaning the precipitated DNA once with ethanol, it was dissolved in 50μ of the above TE buffer. Of the 10 clones of Phage DNA
dideoxy chaintermi nation methods
in Enzymology 65 , 560–580, 1980
The lower strand (DNA with a complementary base sequence to mRNA) is
Two clones containing the inserted fragment were selected. This phage DNA was subjected to in vitro mutagenesis (described below).
mutation) was used as a template DNA. 2-2 By in vitro meditation
Insertion of EcoRI cleavage site and translation initiation codon Chemical synthesis of 36mer with phosphorylated 5′ end
DNA fragment (5′-
CTCCTAGGTCAGGAATTCATGAATC
2 μ containing 10 pmol of CCATGTACAAT-3′)
Into the solution, 5μ of the single-stranded phage DNA solution obtained in (2-1) above and 0.1M MgCl ₂ ,
Add 1μ of 0.2M Tris・HCl buffer (PH7.5) containing 0.5M NaCl and 2μ of water to make a total of 10μ
The solution was heated at 65°C for 5 minutes and left at room temperature for 10 minutes. Next, this mixture contains 0.1M MgCl ₂
1μ of 0.2M Tris.HCl buffer (PH7.5),
2μ of 0.1M DTT, 1μ of 10mM ATP,
dATP, dGTP, dCTP, 10mM each;
and 2μ of dTTP, 2μ of water, and DNA
Polymerase Klenow Fragment (Klenow
fragment) (Behring-Mannheim) 5
2.8 units of _T4 DNA ligase (Takara Shuzo) were added, and the mixture was allowed to react at 15°C for 16 hours. Using 20μ of this reaction solution, E. coli was cultured as described above.
JM103 was transformed. Next, as described above, 48 clones were selected from the plaques generated on the YT soft agar medium, and 2
After inoculation into ×YT liquid medium, the cells were cultured at 37°C for 8 hours. Centrifuge 1 ml of culture solution at 10,000 rpm for 10 minutes.
The supernatant was collected as phage fluid. On the other hand, alkaline extraction method (Birnboim, HC & Doly, J. Nucl, Acid,
RF by Res 7 , 1513-1523, 1979)
DNA was extracted and separated. Then the RF DNA
EcoRI buffer (50mM NaCl, 5mM
100mM Tris・HCl buffer containing _MgCl2
It was decomposed by heating at 37°C for 1 hour using EcoRI (Takara Shuzo) 4.2 unit in 20μ (PH7.5). The reaction solution was subjected to 2% agarose gel electrophoresis, and clones that produced a DNA fragment of about 530 bp were selected. (1 clone out of 48 clones) This clone is M13mp8−
It was named hANP 525. Next, 0.4ml of JM103x nutrient solution infected with the phage clone was added to 400ml of 2xYT liquid medium.
Add 4 ml of non-infected JM103 culture solution and incubate at 37℃ for 12 hours.
After culturing, RF DNA was obtained from the infected bacteria by cesium chloride density gradient centrifugation containing ethidium bromide according to a conventional method, and phage DNA was obtained from the supernatant phage solution by the method described above, followed by dideoxy chain termination method (described above). The base sequence was determined using As a result, we found the expected base sequence, namely γ-hANP.
Immediately before the N-terminus of the translation start codon ATG and
Sequence with ECORI cleavage recognition site GAATTC
It was confirmed that GAATTC ATG was inserted. 2-3 Construction of γ-hANP gene expression vector (see Figures 6 and 8) The plasmid pS20, which is the material for constructing the γ-hANP gene expression vector, has already been constructed by the present inventors, and the plasmid pS20 containing the plasmid E. coli transformed strain N4380/pS20 is SBM271
It was named FERH BP-535 and was internationally deposited with the Institute of Fine Technology under the Budapest Treaty. pS20 is a plasmid that allows foreign genes to be expressed under the control of the P _L promoter of λ phage, and was constructed as follows. First, bacteriophage λCI857
λP _L obtained by cutting with BamH and Hind
A 2.4Kb DNA fragment containing the promoter
A plasmid inserted between Hind and RamH of pBR322 was obtained (this plasmid was
Plasmids described in Nature 292, 128, 1981
(equivalent to pKO30). Next, the Hae DNA fragment (containing part of NutR, tR ₁ C and O) of bacteriophage λcy3048 (obtained from Dr. Hiroyuki Shimatake, Faculty of Medicine, Toho University) was inserted into the Hpa cleavage site of this plasmid.
A plasmid (pS9) was obtained in which a 1.3 Kb fragment was inserted such that C was positioned in the same direction as the transcription direction of _λPL . This plasmid (pS9) is then cut with Bgl and Rsa to obtain
0.65Kb DNA fragment (P _L promoter, DNA sequence of protein N' lacking the C-terminus of N protein, and shear indulganoid (SD) of C gene
EcoR at the Rsa break (including the sequence region)
After adding a linker -CGGAATTCCG- -GCCTTAAGGC- (obtained from New England Biolabs), the sticky end of the Bg break was made blunt with T4 DNA polymerase, and this DNA fragment was cut with EcoR and then blunted with T4 polymerase. A plasmid (pS13) in which the terminated DNA fragments were ligated was obtained. This plasmid (pS13) is oriented in the same direction as the transcription direction of the tetracycline resistance gene (Tc〓) in pBR322.
The P _L promoter is located. moreover,
This plasmid (pS13) was combined with EcoR and Sal
The long fragment obtained by digestion with
E. coli containing the plasmid is disclosed in
FERM BP was named SBMG105 and sent to the Microtech Institute.
Plasmid pS20 (see FIG. 6) is obtained by digesting the plasmid pS20 (deposited under the number -282) with EcoR and ligating the obtained DNA fragment containing the foreign gene (human γ-type interferon gene G1F). One of the γ-hANP gene expression vectors
pS220 is the plasmid M13mp8-hANP525 obtained in Example 2-2 with EcoR as shown below.
Fragment obtained by digestion with Sal (approximately 510bp)
was obtained by replacing pS20 with a G1F-containing fragment obtained by digesting pS20 with EcoR and Sal (see Figure 6). That is, M13mp8−
After EcoR reaction containing 8 μg of hANP525 DNA (containing 50 mM NaCl and 5 mM MgCl ₎
100mM Sulis hydrochloric acid solution, PH7.3) in 70μ
Add 15 units each of EcoR and Sal at 37℃
After reacting for 1 hour, 1.0% agar gel electrophoresis separation was performed. Next, γ-
Approximately 510bp EcoR-Sal containing hANP gene
DNA fragments were extracted and purified. Meanwhile, 2 μg of the pS20 plasmid mentioned above was added to the EcoR reaction solution.
Add 10 units each of EcoR and Sal in 50μ, react for 1 hour at 37°C, and after electrophoresis separation on 1.0% agar gel, use the method described above (electrselute method) to generate EcR containing the λP _L promoter and the SD sequence of the C gene. −Sal
A DNA fragment (approximately 4.3 Kb) was obtained. continue,
EcoR-Sal containing the above-mentioned γ-hANP gene
Add 3μ of a 10x concentration ligation solution (described in Example 2-1) to a solution of an aqueous solution of DNA fragment (3μ) and 10μ of an aqueous solution of EcoR-Sal DNA fragment of pS20 plasmid,
mM DTT (dithiothreitol) 3μ, 1
mM ATP aqueous solution 3μ, distilled water 6μ and
One of the γ-hANP gene expression vectors, pS220, was constructed by adding 2 units of T4 DNA ligase and performing a reaction at 16°C overnight.
Transformation of E. coli strain N4830 (purchased from Pharmacia Japan) with pS220 was performed using 300 μ of E. coli containing 50 mM CaCl ₂ treated with 10 μ of the above reaction solution with CaCl ₂ according to a conventional method.
The suspension was added to the N4830 strain suspension and allowed to stand on ice for 1 hour, then 2.5 ml of L-broth was added and cultured at 32°C for 1.5 hours. Transformants were selected by isolating colonies growing on nutrient agar containing 50 μg/ml ampicillin (ampicillin-resistant strains). Plasmid DNA was isolated from the obtained transformant according to a conventional method, and analysis using restriction enzymes revealed that λP _L
It was confirmed that the γ-hANP gene was inserted downstream of the promoter. This transformed strain was named N4380/pS220, and the following γ-hANP
It was used for experiments related to production. In addition to the above pS220, other γ-hANP gene expression vectors were constructed as described below. That is, after cutting plasmid pS20 with EcoR, Xba linker [purchased from New England Biolabs: d (CTCTAGAG)] was added to DNA fragments of various sizes obtained by hydrolyzing using exonuclease Bal31.
ligated to create plasmid pS20X, and then
After disassembling pS20X with Xba and Sal,
pIN4G1F54 (disclosed in Japanese Patent Application No. 58-132524) was cut with Xba and Sal, and the shorter DNA fragment (containing the human γ-type interferon gene) was used as the Xba-Sal of pS20X.
inserted in place of the DNA fragment. Among the plasmids constructed in this way, the expression level of the γ-type interferon gene was high in the culture of E. coli transformed with the plasmid.
132524) plasmid
It was named pS83-3. Next, as shown in Figure 8, in place of the EcoR-Sal fragment of pS83-3, the already obtained plasmid M13mp8
Plasmid pS223-3 was obtained by inserting the EcoR-Sal fragment of -hANP525.
pS223-3 is a plasmid having the SD sequence of the E. coli outer membrane protein (lpp) gene (see Figure 1 of Japanese Patent Application No. 132524/1982) downstream of the _λPL promoter region. E. coli by this plasmid.
Transformed strain N4380/
pS223-3 was used together with the aforementioned N4380/pS220 in an experiment to produce γ-hANP. It was subjected to yet another γ-hANP production experiment. Yet another γ-hANP gene expression vector pS224-3 is the previously described plasmid pS83.
Obtained by cutting −3 with Xba and EcoR
A plasmid in which a chemically synthesized DNA fragment (AGGAGGT) containing the SD sequence of the bacteriophage MS2A protein gene, which has Xba and EcoR cleavage recognition sequences as sticky ends at both ends, was inserted instead of the DNA fragment containing the SD sequence of the lpp gene. pS84-3 was obtained, and then M13mp8-hANP525 DNA was extracted as shown in Figure 8.
The EcoR-Sal fragment was converted into EcoR of pS84-3DNA.
-obtained by inserting the Sal fragment. E. coli N4380/pS224-3 transformed with pS224-3 in the same manner as above was also transformed with
Together with N4380/pS220 and N4380/pS223-3, it was used in an experiment to express the γ-hANP gene. 3 Production of γ-hANP by transformed strains The three transformed strains obtained in Example 2-3, namely N4830/pS220, N4830/pS223-3, and N4830/pS224-3, and the host strain containing no plasmid N4830 was cultured at 32°C in M9 minimal medium supplemented with 50 μg/ml ampicillin and 19 natural amino acids except methionine.
When OD660 reached 0.4, a portion of the culture was cultured at 42°C. 15 and 30 minutes after transferring to 42℃, add 2μCi of ^35S -methionine (manufactured by New England Nuclear Co., Ltd., purchased from Japan Isotope Association) with a specific activity of 800Ci/mmol to 0.3mL of the culture solution, and heat at the same temperature. After incubation for 2 minutes, the final concentration was 10%.
TCA (trichloroacetic acid) was added to the mixture so as to give the same temperature as before, and the mixture was immediately cooled to 0°C. After 10 minutes, the precipitate was collected by centrifugation, washed once with ethanol, and subjected to 15% SDS polyacrylamide gel electrophoresis according to a conventional method. Similar treatments were performed on samples that had been cultured at 32°C. After drying the above gel, we observed a protein band labeled with ³⁵ S-methionine using a radioautograph. As shown in Figure 7, it was determined that the plasmid was transformed with the plasmid into which the γ-hANP gene had been inserted. Three transformed strains (N4830/; pS220,
S4830/pS223-3 and N4830/pS224-
In 3) culture at 42°C, a protein band corresponding to approximately 20 Kb was observed that was not seen in the control strain (N4830) or the transformed strain cultured in 32. γ- purified from human atrium
Since hANP migrated at the same position in SDS polyacrylamide electrophoresis under the same conditions,
This protein band is the γ-
It was determined to be hANP. Also, this protein
What was observed only in culture at 42°C was that γ
- This indicates that the hANP gene is expressed under the control of the λPL promoter. The standard protein kit for molecular weight measurement in the above electrophoresis was manufactured by PL Biochemical.

[Brief explanation of the drawing]

Figure 1 shows the amino acid sequence of γ-hANP, Figure 2 shows the amino acid sequence consisting of the signal sequence and the amino acid sequence of γ-hANP, and Figure 3 shows the amino acid sequence of γ-hANP.
Figure 4 shows the base sequence encoding hANP, Figure 4 shows the signal sequence and the base sequence encoding γ-hANP, Figure 5 shows the sequence of the cDNA fragment cloned into phANP82, and Figure 6 shows the nucleotide sequence encoding γ-hANP. −
DNA fragment encoding hANP and plasmid pS20
Fig. 7 is an electropherogram showing the expression of γ-hANP and is a photograph in place of a drawing, and Fig. 8 shows the process of constructing plasmid pS220 from γ-hANP.
DNA fragment encoding hANP and plasmid
Figure 9 shows the process of constructing plasmids pS223-3 and pS224-3 from pS83-3 and pS84-3, respectively.
The nucleotide sequences of the probes used for fragment selection are shown, and FIG. 10 shows the strategy used to determine the nucleotide sequences in phANP1 and phANP82.

Claims (1)

[Scope of Claims] 1. A DNA fragment comprising a base sequence encoding a polypeptide having a diuretic effect, characterized in that said polypeptide has the following amino acid sequence: [Table] [Table] DNA fragment. 2. The DNA fragment according to claim 1, which comprises a base sequence encoding a polypeptide having the following amino acid sequence: 3. The DNA fragment according to claim 1, which contains the following base sequence: 4. The DNA fragment according to claim 2, which contains the following base sequence: [Table] [Table] 5. The DNA according to any one of claims 1 to 4, which is composed of cDNA produced using mRNA obtained from human atrial cells as a template.
piece. 6. The compound according to any one of claims 1 to 5, which constitutes a part of the recombinant DNA molecule.
DNA fragment. 7. A plasmid comprising a base sequence encoding a polypeptide with diuretic action produced in the human atrium, characterized in that the polypeptide has the following amino acid sequence: [Table]. 8. The plasmid according to claim 7, which contains the following base sequence: [Table] 9. The plasmid according to claim 7 or 8, which contains a DNA fragment composed of cDNA produced using mRNA obtained from human atrial cells as a template. 10. The plasmid according to any one of claims 7 to 9, which contains a base sequence involved in the expression of a foreign gene. 11. The plasmid according to claim 10, which contains a promoter region. 12. The plasmid according to claim 11, wherein the promoter is the _λPL promoter. 13. The plasmid according to claim 7, which is pS220, pS223-3, or pS224-3.