JPH04507341A - Fusion protein with in vivo post-translational modification site and production and purification method - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Fusion protein with in vivo post-translational modification site and production and purification method This application is a continuation-in-part of U.S. Application No. 077354.266.

The invention described herein was applied to a health and human services department store in the United States. Grant No. 2 by National Institute of Health RO1, Ar15650, in the course of research established in part. rice The national government has rights to this invention.

field of invention The present invention relates to a protein of interest that binds to an amino acid sequence containing a post-translational modification site or Concerning a hybrid DNA sequence encoding a fusion protein comprising a polypeptide Ru. The invention further provides vectors comprising hybrid DNA sequences, and expression of the hybrid DNA in a suitable host. It also relates to fusion proteins produced by. Finally, the present invention provides post-translational modifications. By using a binding partner that binds to the fusion protein only after fusion proteins.

Background of the invention Recent advances in molecular biology have shown that in bacteria, yeast, mammals and other hosts, has made it possible to produce large amounts of heterologous proteins and polypeptides.

These methods involve the production of a desired protein or polypeptide operably linked to an expression control sequence. It relies on the construction of a vector containing the DNA sequence encoding the peptide. after that , transform suitable hosts with these vectors and culture them under suitable conditions. This makes it possible to produce a desired protein. Another refinement of this technology is the selected A DNA sequence encoding a protein or polypeptide and a secreted extracellular or forms a hybrid gene consisting of DNA sequences from periplasmic proteins. It is possible to obtain secretion of the selected protein or polypeptide by I made it into Noh.

To isolate a desired protein or polypeptide if it is not secreted by the host For this purpose, the host cells must be disrupted and the protein or polypeptide Intracellular and extracellular proteins must be isolated from cell debris and other contaminants. Must be. Convert secreted proteins or polypeptides into intracellular proteins and Media or periplasmic space despite separation from cell debris More must be collected from In any situation, the desired protein Recovery of proteins or polypeptides is usually time consuming and less simple than desired. Includes a lengthy purification process. Additionally, such purification steps often result in loss of product or activity lozenges. Invite someone.

In particular, such purification steps are usually empirical. For example, various column separation techniques For proteins or polypeptides, all fractions can be Must be analyzed. In addition, many purification operations are not specific and involve many steps. This results in a combination of methods having to be used. Included in such methods Many steps and time involved (resulting in loss of activity and product) .

One method used in the purification process uses recombinant DNA technology to Fusion proteins comprising a desired protein or polypeptide bound to a protein It manufactures. Analysis of reporter proteins involves purification of fusion proteins. or to provide a means for isolation of fusion proteins.

Although many reporter proteins may be used, an example of the method is β-galactosidase It is a fusion with Ze. β-galactosidase fusion protein has different charge, size, etc. Based on conventional separation techniques, the progress of the separation can be monitored by analysis of β-galactosidase activity. While monitoring the fusion protein, β-galactosidase or anti-β-galactosidase. Due to the presence of β-galactosidase antigenic determinants by reaction with galactosidase antibodies It can be purified further. 5ilhavy and Beckwith, Micr.

biol, Rev, 49, 398-418 (1985); Ullman an d Perrin, in The LactoseOperon(Beckw ith and Zipser, eds, 1970. Co1d Spring g Harbor La1) oratory, Co1d Spring Har bor, New York). β-galactosidase fusion proteins are also immobilized. column of anti-β-galactosidase antibody or if the active site is retained. can be purified on a column of immobilized substance analogs. Si Ihavy and Beckwi th, Mierobiol, Rev, 49.398 -418 (1985); Ullman, Gene, 29.27-31198 4>.

Fusions to reporter proteins other than β-galactosidase are Proteins are often selected so that specific antibodies are not required, so they often make purification easier. to promote. An example of such a fusion is when the protein of interest is attached to the Fc region of an IgG. This is a structure that is fused to protein A. Such a fusion can be performed on a column of IgG. can be separated above.

Nilsson et al, The EMBOJ, 4.1075-80 ( 1985).

β-galactosidase and protein assay using antibody, immunoglobulin or substrate columns A combination of purification methods for protein A fusion proteins involves - Requires harsh conditions to destroy protein or enzyme-substrate complexes . These conditions at least partially target the desired protein or protein of the fusion protein. It is expected that the polypeptide segment will be denatured. Ni1sson etc. al,, The EMBOJ, 4.1075-80 (1985); Ul I man, Gene, 29.27-31 (1984); UI Iman andP errin, in The Lactose Operon (Beckwit h ancl Zipser, eds...! 970゜Co1d Spring Harbor Laboratory, Co1d Spring Harbo r, New York).

Biotin is synthesized by plants, most bacteria and some fungi, and is initially It is a small coenzyme (vitamin H) that occurs intracellularly in a protein-bound state. bio Tinylated proteins undergo many necessary metabolic carboxylation and decarboxylation reactions. plays an enzymatic role in the reaction. Wood and Barden, Ann. Rec, Biochem, 46.385-413 (1977).

Biotin is a covalent bond between biotin's carboxyl group and a unique amino group. It binds to the acceptor protein through an amide bond. Id, Biot The in addition is biotin ligase (called biotin holoenzyme synthesis). It is a two-step reaction catalyzed by (see Figure 1). Biotin is first Converts to AMP, which binds specific lysine residues of the acceptor protein. reacts with the ε-amino group of , producing biocytin.

The carboxy-terminal sequences of biotin proteins from various biological sources are virtually biotin ligases are of various different biological origins (e.g. bacterial biotinylates acceptor proteins from R. eukaryotes and higher eukaryotes). Mur tif and Samols, J., Biol, CI+etn, , 262. 11813-16 (1987); Schwarz et at, J, B tol, Cham, 241.28T5 (19 66). Of particular note in these sequences are ■) highly maintained biocytin; Samols et al., J. Biol. chem. , 263°646J, -64 (1988); 2) Proline residue upstream of biocytin Presence of groups or short proline-rich regions Schwar Zet al, J, B iol, Chem, 263.9640-45 (1988); and 3) biotin The protein residue to which the protein binds is usually 34 or more away from the carboxy-terminal amino acid. is located at residue 35, although some biotinylated proteins Furthermore, a coenzyme is attached to a position away from the carboxy terminus. Samols e l, al, , J, Biol, Chern, , 263.6461-64 ( 1988); Bai et al, Eur, J., Biochem, 182.239 (1X89); Takai et al, J, Biol, Chem, 263. 265H1988).

Figure 2 shows some biotin proteins compiled from published reports. The amino acid sequence of the carboxy-terminal portion of the protein is shown.

The sequences are aligned at the position of the lysine residue (arrow) that is biotinylated. the array is the Escherichia coli biotin carboxyl carrier protein (Es cherichia coli biotin carboxyl carri erprotein) (ECBCCP, a subunit of acetyl-CoA carboxylase) Unit); Propionibacterium shamanii transcarboxylase ( Propionibacterium shermanii transcar boxylase) (PS 1.3s) 1.3 subunit; cerevisiaevirbate carboxylase (Saccharomyces cerevisiae) evisiae pyruvate carboxylase) (YPYC); Human pyruvate carboxylase (HPYC); and a derivative from tomato (TOM) Column.

The identification of proteins from tomato that have biotinylation sites is unknown. The array is , isolated by biotin acceptor activity, P, sh, erman i Homologous to the sequence o Hoffman et al, Nucleic Ac1d Re5arch, 1.5.3928 (1987).

In Figure 2, the residues in the boxes are residues that are conserved within proteins. Ru. Another example of a biotinylated protein sequence is Sam.

Is et al, j, Biol, chem, 263.6461-64 (19 88); and Schwarz et al.

J. Biochem, 263.9640-45 (1988).

The role of certain sequences in biotinylation and the carboquine terminus of biotin proteins Research has been carried out on the amino acids located in the minutes. Multif and Samo ls et al., J. Biol. Chem., 263.6461-64 (1 988); and Schwarz et at J. Biol. Chem. 263.6461-64 (1988). In particular, Propionibacteri um shermanii transcarboxylase 1. ．． 3S subunits has been studied. It is 123 amino acids long. Biotin is a It is bound to a lysine residue located 34 residues from the carboxy terminus. 19-12 A truncated 1,33 subunit polypeptide containing 3 residues was digested with biotin. become During this period, the deficiency of the penultimate amino acid (number 122) Prevents protein biotinylation. Murtif and Samols et a l, j, Biol, chem, 262.11813-16 (1987); S amolset al, , J, Biol, Chem, , 263.6 461-64 (1988). Also, methionine flanking the biotin moieties The residue is not required for biotinylation.

5henoy, et al, , FASEB J, , 2.2505-2 511. (1988).

In addition to the covalent bonds discussed above, biotin is highly non-covalently bonded to proteins. specifically binds to proteinaceous avidin and streptavidin (KD 10-” M). This non-covalent bond to biotin is used to purify the fusion protein. A streptavidin fusion protein has been developed. In particular, PCT application WO8710 5026 and Wo 86102077 contain D encoding streptavidin. The NA sequence was isolated, cloned, and the protein of interest bound to streptavidin. used in the production of recombinant DNA sequences encoding proteins or polypeptides. It has been disclosed that WO 86102077 and WOlo 5026 are Furthermore, the fusion protein may contain biotin or a biotin derivative or It teaches that it can be isolated by contacting with analogues. other proteins Contaminants that do not bind to biotin are removed by washing, and the fusion protein is It is eluted from Ochin.

However, the biotin or biotin inducer of the fusion protein described in the above application The conditions for elution from the conductor are very strict and require At least a partial reduction in activity and antigenicity of the peptide may occur. Also, strike Leptavidin fusion proteins contain intracellular biotin or metabolically essential biotin. It is highly lethal to host cells due to its binding to tinylated proteins.

5ano and Cantor, Proc, Nat’l Acad, S ci, USA, 87, 142-146 (1990).

Lipoylation is another post-translational modification. Lipoic acid has a carboxyl group and a tag. The acceptor is formed through a covalent amide bond with the ε-amino group of the protein residue. bound to proteins. 5tephenset al, Bur, J, Biochem, 133.481-89 (1983). This covalent bond is , catalyzed by the enzyme lipoate ligase.

(The amino acid sequences of boiled proteins are known, and these proteins are The amino acid sequences of the protein paste boiling sites are extremely similar (see Table 1 below). (see). Whey ligase from one bacterium is released from unrelated bacteria. acceptor protein both in vitro and in vivo. It has been shown that it can be spoiled.

Table 1 Comparison of amino acid sequences of various glue-boiled proteins Lipoylation enzyme Array Ref protein source ten E, coli E2p book! ipl LITVEGDKASM BVP a1ip 2 LITVEGDKASMEVP a1ip3 LITVEGDKASMEV P　aE2o＊t　LvEIETDKVVLIEVP　bB, stearoth ermo-E2p LC), vQNDKAVVEIP chilus A, vinelandii E2p 1ipl LVVLESAKASMEVP d1ip2 LIVLESDKASMEIP d1ip3 LIVLESDK ASMEIP dB2o LIVDLETDKVVMBvL e cow 82p VETDKATVGF f rat E2p IETDKATIGFE g human E2p 1ipl VETDKATvGFE h1ip2 IETDKATIG FE h=’7)’Jri’) Thin LESVKAASEL i cleavage + Indicates ribolysine residue.

tE2p = dihydrolipoamide acetylate from pyruvate dehydrogenase transferase Nemoto E2o = dihydrolipoamide from α-ketoglutarate dehydrogenase Dosuccinyltransferase a 5 tephens, Darlison, Lewis and Guest, Eur, J, Biochem, 133.1T5 b 5pence, Darlison, 5tephens, Duckenfi eldandGuest, Eur, J, Biochem, , 141.361 -374 (1984)c Packman, Borges and Perha Biochem, J, 252.79-86 (1988) d Hanema aijer, Janssen, Kok and Veeger, Eur, J, B iochem,, 174゜e Westphal and Kok, Eur , J. Biochem, 187, 235-239 (1990) f Brad Ford, Howell, Aitken, James and Yeaman, Bi ochem, J, 245.9g Gershwin, Mackay, Stur Gessand Coppel, J. Immunol, 138.3525-h Coppel, McNeilage, 5urth, Vandewater, 5p. ithill, Whittinghamand Gershwin, Proc. , Nat 1. Acad, Sci, USA, 85.7317-732 1 (1988).

i Fujiwara, Okamura-rkeda and Motokawa, J. Biol. Chem., 261.8836-8841. (1986) Dihydripoamide acetylate of pyruvate dehydrogenase complex of E. coli The transferase (E2p) component consists of three highly homogeneous tandem repeats. , comprising a sequence of approximately 100 amino acids forming the N-terminal half of the polypeptide chain. Before Posted by; Guest et al, J, Mo1. Bial, , 18 5°743-54 (1985). All three of these sequences are for repoiling It contains lysine, which is the site of , and forms each folded functional region. The above mentioned book. each The repeating sequence contains a lipoylation site in the following invariant 18-residue sequence: A 1a-Gl u-Gl n-3er-Leu-I 1e-Thr-Va i GI u-G ly-Asp-Lys(Lip)-Ala-3er-Met- Glu-Vat-Pro Q supra,; 5tephens et al, Eu rj, Biochem, 133.481-89 (1983). Three of E2p Furthermore, the repeat sequence of about 20 to 30 amino acids contains abnormally alanine and prolyte. This region contains a long C-terminal region rich in amino acids and charged amino acids, and this region has structural flexibility. imparting properties to polypeptides. Radford et al., J. Bi. ol, chem, 264.767-75 (1989); Guest et al, , J, Mo1. Biol, , 185.743-5S (19 85).

Summary of the invention The present invention includes novel fusion proteins. This fusion protein is a first DNA sequence encoding an amino acid sequence that enables quality post-translational modification; The selected tag is in the same reading frame as the second DNA sequence and is joined end-to-end. a second DNA sequence encoding a protein or polypeptide; encoded by a red DNA sequence. This hybrid DNA sequence further comprises: Proteins or polypeptides selected from amino acid sequences encoding post-translational modifications may include a third DNA sequence encoding a cleavage site that provides a means for cleaving the DNA. . A third DNA sequence is located between the first and second DNA sequences, and all three D The NA sequences are in the same reading frame.

Preferably, the first DNA sequence enables post-translational biotinylation of the fusion protein. amino acid sequence, such as Propionibacterium herma nii Amino acid sequence of 1.33 subunit of transcarboxylase, or is a hive encoding a fragment thereof that allows for post-translational biotinylation of the fusion protein. This is a lid DNA sequence. In particular, P, Shermanii transcarboxy encodes the final five amino acids at the carboxy terminus of the 1.33 subunit of The sequence encoding the final 61 amino acids is biotinylated, whereas the sequence encoding the final 61 amino acids is biotinylated. It turns out that it doesn't get treated like a dick.

More preferably, the first DNA sequence is capable of post-translational lipoylation of the fusion protein. an amino acid sequence that allows the E. coli pyruvate dehydrogenase complex to encoding fragments thereof that allow for fusion or post-translational lipoylation of the fusion protein. This is a hybrid DNA sequence.

The present invention further provides vectors containing these hybrid DNA sequences and vectors containing these hybrid DNA sequences. Provide host cells transformed with the vector. These vectors are even more preferred. or a signal or signal leader sequence that provides for secretion of the fusion protein; It contains the DNA sequence encoding the fragment.

The present invention further provides the method of culturing the transformed host under appropriate conditions to produce the fusion protein. The present invention includes methods for producing fusion proteins that obtain quality expression.

Preferably, the fusion protein is modified in vivo by post-translational modification. be done. Secretion of the fusion protein may also be achieved by using a signal or signal leader sequence. Obtained if it contains.

The modified fusion protein has a binding protein that binds to the fusion protein after it has been modified. Prepare a toner and bind the modified fusion protein under conditions that allow binding. contact with the bonding partner to remove the bonded repair from the unbonded material in the mixture to the bonding partner. Separate the decorated fusion proteins and elute the modified fusion proteins. obtained by culturing cell extracts or transformed hosts by methods including The vine is purified from a mixture of materials such as culture media. Fusion protein or cleavage site , while still bonded to the bonding partner or can be cleaved after elution.

The binding partner can be an antibody or an antibody that binds to the fusion protein only after it has been modified. It can be any compound. For example, if the fusion protein is a biotinylated protein , the binding partner can be an antibody against biotin, but preferably is selected from avidin, streptavidin and derivatives and analogs thereof.

Brief description of the drawing FIG. 1 illustrates the addition of biotin to proteins by biotin ligase.

Figure 2 shows the carboxy-terminal sequence of the biotinylated protein.

FIG. 3 illustrates the production of vector pCY46.

FIG. 4 illustrates the production of vector pCY49U.

FIG. 5 illustrates the production of vector pCY74.

FIG. 6 illustrates the production of vector pcY90.

Figure 7 illustrates the production of vector pCY84.

FIG. 8 illustrates the production of vector pCY72.

Figure 9 illustrates the production of vector pCY73.

FIG. 10 illustrates the production of Vectori CY119.

FIG. 11 illustrates the production of vector pCY56.

Figure 12 illustrates the production of vectors pCY66 and pCY68.

FIG. 13 illustrates the production of Vectori CY120.

Figure 14 is a typical fluorograph of biotinylated fusion protein and control. Ru.

Figure 15 illustrates the production of vector pCY94.

Figure 16 illustrates the production of vector pcys.

Figure 17 illustrates the production of vectors pcY105 and pcyxoe.

Figure 18 illustrates the production of vector pcYl18.

Figure 19 illustrates the production of vectors pcY116 and pcY117.

Figure 20 shows E. coli and Saccharomycas cerevisi. Sample of biotinylated HIS3-1.33 fusion protein produced by ae. It is a typical fluorograph.

FIG. 21 illustrates fusions A-M and E, transformed with these fusions. The results of culturing E. coli strains are shown.

Figures 22A-C show fractions of material eluted from a monomeric avidin column. A graph showing β-galactosidase activity and protein concentration against numbers. be.

Figure 23 shows biotinylated fusion proteins eluted from monomeric avidin and A stained polyacrylamide gel is shown.

Figure 24 illustrates fusion QR.

Figure 25 illustrates the production of vector pKR14.

Figure 26 illustrates the production of vector pKR10.

Figure 27 illustrates the production of vectors pKR22 and pKR23.

Figure 28 illustrates the production of vector pKR21.

Figure 29 illustrates the production of vectors pKR24 and pCY68.

Figure 30 shows typical examples of proteins produced using the 353-labeling method or boiled. It is a fluorograph.

Figure 31 shows the fluorofluorescence of proteins produced using the 353-labeling method or boiled. It is a log graph.

Figure 32 shows lipoylated protein electrophoresed and stained polyacrylamide. Showing gel.

Figure 33 illustrates the production of vector pCYT8D.

Figure 34 illustrates the production of vector 1) CY159.

DETAILED DESCRIPTION OF THE CURRENTLY PREFERRED EMBODIMENTS The hybrid DNA sequences of the present invention are , comprising a first DNA sequence encoding a site of post-translational modification. Post-translational modifications are usually A modification that occurs within a cell, whereby one or more chemicals become It covalently bonds to the amino acid within the post-translational modification site through several enzymatic reactions. Ru. The site itself is not only the amino acid that is modified, but also the site where the post-translational modification occurs. Contains the other necessary amino acids in the proper sequence.

Although the term “post-translational” is used, it is important to note that such modifications occur during protein synthesis. The exact point in time is not yet known. Current evidence suggests that proteins are completely assembled. and show that these modifications occur after leaving the liposome. example For example, Murtif and Samols have the penultimate amino acid shown to be required for tinylation (see Background section above). however , the possibility that modification occurs or begins while protein synthesis is still occurring. Sexuality cannot be completely denied. As indicated herein, the use of “post-translation” The term is intended to cover all of these possibilities.

Modification of the fusion protein is preferably carried out using reactions that normally occur within the host cell. It is done in vivo. Modifications are made in vivo by host cells.

If done in the fusion protein, the modification occurred, as described below. from cell extracts using a binding partner that only later binds to the fusion protein. can be purified directly from cell culture medium.

However, if the modification of the fusion protein does not occur sufficiently within the host, Portions of the fusion protein produced by the host and not modified in vivo It may be necessary to modify it in vitro. Post-translation modification is i n in vitro and in substantially the same manner as in vivo. After the same translation A modification site and an enzyme that recognizes this site are used. For example, proteins With common lysine residues, in vitro using biotin ligases from many sources. Vine biotinylated with o.

It is extremely rare to modify fusion proteins in vitro in this way. It is thought that almost all fusion proteins can be produced satisfactorily in vivo. It is considered to be modified.

The present invention is a marker for a fusion protein, which can be used directly or indirectly. to identify the fusion protein, or to culture cell extracts or host cells to generate the fusion protein. other materials such as those found in protein-containing media, e.g. mixtures of other proteins; Markers for fusion proteins such that fusion proteins can be isolated from including any type of post-translational modification that provides The present invention further provides for purification. To further simplify the process, two different post-translational modifications can be used in one fusion protein. including the use of positions.

Preferred are translations that are utilized by the host cell and modify only a small number of proteins. This is a post-translation modification. This is because it facilitates the identification and isolation of the fusion protein. Ru. Used by cells to covalently repair only a few proteins (1-5) Examples of decorative post-translational modifications include biotinylation, attachment of 4-phosphopantetin, lipoic acid and flavin binding.

For example, E. coli has only one biotinylated protein, an acetyl-CoA protein. Biotin carboxyl carrier protein (BCCP) component of ruboxylase , two lipolyzed proteins and one protein containing 4I-phosphopantetin It has been shown to include quality. Fal　l、　Met、h.

EnZymology, 62.390 (1979); Perham et a l, , Biochem, Soc, Symp, , T4.67 (1987); Rock and Cronan, Meth, Enzymol, , 71, 341 (1981) o Other bacteria have two or three biotinylated Contains protein. Fa,ll,Meth-Bnzymol,,62,390- 98 (1979)a Saccharomyces cerevisiae is Contains 3-5 biotinylated proteins, depending on growth conditions; mammals and plants , contains four such proteins. Ch, andler and Ba1. I ard, Biocham, J., 251.749 (1988); Lim et al, Arch, Biochem, Bio Tape A.

258, 219 (1987); N1kolau et al, Anal, Biochem, 149.448-53 (1985j; Robinson et al, J, Biol, Chem, 2 58.6660-64 (1983). Also, all microorganisms, mammals and plants At least two lipolyzed proteins (E2o and E2p) and possibly three Such a protein (the third protein is a lipolytic protein involved in the glycine cleavage system) It is thought to contain proteins.

Enzymology of the addition of biotin, 4-phosphopantetine and lipoic acid to proteins It is understood that all three of these modifications occur in virtually all cells. child The sequences of proteins modified by these three compounds are known, and therefore , a DNA sequence encoding a post-translational modification site is used as a hybridization probe. cDNA or gDNA libraries that are screened for accurate sequences using It can be obtained using conventional methods such as those for producing. In fact, such protein The genes encoding some have already been cloned. In addition, these repairs Decoration is that in metabolism, modified molecules exist on the surface of modified proteins, thereby It plays a role in helping to identify and purify proteins with modifications.

All these modifying groups are also effective haptens and are specific for this modifying group. It is possible to produce a modified antibody and use it to purify a fusion protein with a modification. Wear. In addition, biotinylated proteins can be used, for example, as antibodies against biotinylated proteins. On the contrary, avidin, streptavidin and Specificity of biotin and strong parent for derivatives and analogs of these two compounds By taking advantage of their compatibility, they can be easily identified and isolated.

Similarly, lipoic acid has specific properties in various metal compounds (e.g. arsenic and thallium compounds). It is a diothyl that can be strongly bonded, and the metal compound is a monothiol. It binds the dithiol more tightly than the lipoic acid-modified fusion protein. Provides a method for manufacturing. The method for purifying the fusion protein of the invention is described in more detail below. Explain.

The DNA sequence encoding the post-translational modification site usually undergoes the desired post-translational modification. It can be the sequence of a complete gene encoding a protein. Post-translational modification occurs. Any fragment encoding a suitable amino acid sequence to enable It may also be a fragment of a gene. Furthermore, the DNA sequence or fragment of such gene Fragments may be modified (or completely synthetic) as long as they encode functional post-translational modification sites. You may also use the following array.

The second DNA sequence of the hybrid DNA sequence of the invention is intended for the selected purpose. Encodes a protein or polypeptide. This protein or polypeptide is , which is normally produced by the host (a “homologous” protein or polypeptide) proteins that are not normally produced by the host (“foreign” proteins or (ripeptide). In this way, homologous proteins or polypeptides Even proteins can be added such that they can be identified or isolated by means of post-translational modification.

Among the NA sequences useful as the second DNA sequence, the following proteins or polypeptides Enzymes such as nibrothiase, preferably encoding peptide, and lipase ; human insulin, various interferons, human growth hormone, bovine growth hormone; Lumon, Porcine Growth Hormone, Thyroid Stimulating Hormone, Follicle Stimulating Hormone, Vasopre Animal and human hormones such as prolactin and prolactin: Factor VII , Factor VIII, erythroboietin and tissue plasminogen activation blood factors such as blood factors; lymphocytes; globulins such as immunoglobulins; albumin; endorphins such as β-endorphin and enkephalin; Viral or bacterial antigens, such as foot-and-mouth disease antigens, influenza antigens, protein and hepatitis core and surface antigen; rennin; Bacillus thurin endotoxin; as well as of prokaryotic, eukaryotic or viral origin. Other useful proteins and polypeptides.

Hybrid DNA sequences encoding fusion proteins are readily available to those skilled in the art. can be produced and introduced into vectors using conventional techniques known in the art. No. First, the post-translational modification site and the DNA encoding the protein or polypeptide of interest. The A sequence is isolated. This forms a cDNA or gDNA library and A proper hybridization process takes place. Of course, there are many useful in practicing the invention. genes and DNA sequences have been isolated, cloned, and made available. ing. Furthermore, when the DNA or amino acid sequence is known, many desired A desired DNA sequence is produced by chemical synthesis.

The hybrid DNA sequence of the present invention comprises a DNA sequence encoding a post-translational modification site. the end to the end of the DNA sequence encoding the protein or polypeptide of interest, produced by combining them so that they are in the same reading frame. Post-translation correction The DNA sequence encoding the decorative site encodes the protein or polypeptide of interest. It may be located upstream or downstream of the DNA sequence.

In a preferred embodiment, the hybrid DNA sequence further comprises post-translational modifications. chemical or polypeptides useful for separating selected proteins or polypeptides from contains a third DNA sequence encoding an enzymatic cleavage site. Such a cleavage site is , a hybrid DNA sequence is combined with a DNA sequence encoding a post-translational modification site and a desired located between the DNA sequences encoding the desired protein or polypeptide. one or more codons encoding a desired cleavage site, and all The fusion protein is constructed so that both DNA sequences are in the same reading frame. It can be constructed within the quality.

The cleavage site can be a site for proteolytic cleavage. Also, the selected purpose If the protein or polypeptide does not contain any methionine residues, , the cleavage site may be methionine (encoded by the ATG codon). stop The fusion protein was then cleaved at the methionine residue by treatment with cyanogen bromide. sell. Gross.

Methods in EnzymologY, 11, 238-55 (1967 ).

With respect to the proteolytic cleavage site, this cleavage site is in vivo, i.e. Select to avoid cleavage during purification by host-produced proteases There is a need. In addition, the cleavage site is present only in the fusion protein and is caused by post-translational modification. sufficient that is not present in other proteins produced by the modified host. Preferably, it is unique. In this respect, the third DNA sequence is highly specific. proteases, such as the following peptide bond i1e-glu-gly-arg (Nagai and Thorgersen, Methods in Enzy factor Xa, which cleaves By thrombin, which cleaves fibrin, and elastase, which cleaves elastin. can be designed to encode cleavage sites that are recognized by However, a The use of elastase is , if the fusion protein is isolated on an antibody column and on-column cleavage is desired. It should be noted that this is not desirable.

The invention also includes vectors capable of expressing the fusion protein in a suitable host. child The vector encodes a fusion protein operably linked to appropriate expression control sequences. It contains a hybrid DNA sequence. This functional linkage can be achieved by hybrid DNA sequences. This can be done before or after inserting the sequence into the vector. Columns include promoter, activator, enhancer, operator, and liposome. binding site, start signal, stop signal, cap signal, polyadenylation signals, as well as other signals related to the regulation of transcription or translation.

Both vectors have a promoter operably linked to the hybrid DNA sequence. and a transcription termination signal. The promoter is inside the host cell. Any DNA sequence that exhibits transcriptional activity (including homologous or heterologous proteins) proteins (preferably homologous), as well as extracellular or intracellular proteins, e.g. enzyme, glycoamylase, protease, lipase, cellulase and glycolytic enzyme. It may also be derived from a gene that encodes.

The promoter is preceded by upstream activator and enhancer sequences. Good too. An operator sequence may also be included downstream of the promoter sequence, if desired. .

A vector is a vector in which the hybrid DNA sequence is not itself initiated by an initiation signal. If there is a translation initiation signal immediately preceding the hybrid DNA sequence, No. There is a termination signal between the initiation signal and the end of the hybrid DNA sequence. There shouldn't be any.

Expression control sequences suitable for use in the present invention are well known.

These include: E. coli lac series, E. coli Either trp system, TAC system or TRC system; main bacteriophage lambda Essential operator and promoter regions, regulatory regions of filamentous single-stranded DNA phage Region; Expression control sequences of other bacteria; Saccharomyces cere Genes encoding TPI, ADH, PGK and α-factor Promoter derived from Aspergillus oryzae TAK A amylase and A, niger glycoamylase, neutral α-amylase and Promoter derived from the gene encoding acid-stable α-amylase; Rhi zomucor m1ehe i co-coat aspartin proteinase and lipase promoters derived from genes encoding; as well as prokaryotic cells, eukaryotic cells, and other known sequences that regulate the expression of genes of these viruses or combinations thereof. .

The vector further includes one or more replication systems that enable replication within the host cell. Must include stem. In particular, when the host is yeast, the vector Must contain the maternal 2u replication gene REPI-3 and the origin of replication. Must be.

At least one restriction enzyme site and the vector to be introduced into the host cell are present in the host cell. encodes a selectable or identifiable phenotypic characteristic that occurs when It must contain a DNA sequence (a "selectable marker").

Vectors suitable for use in the present invention are well known. They include pU C (e.g. pUC8 and pUC4K), pBR (e.g. pBR322 and pBR 328), 'pUR (e.g. pUR288), phages λ and YEp (e.g. YEp24) plasmids, other vectors described in the Examples below, and Derivatives of these vectors are included.

In a preferred embodiment, D encoding a signal or signal leader sequence The NA sequences or functional fragments thereof are placed within the recombinant DNA vector at the translation initiation site. and the hybrid DNA encoding the fusion protein.

A signal or signal leader sequence is a signal or signal leader sequence at the amino terminus of a polypeptide or protein. A sequence of amino acids at the end of a protein or polypeptide that is produced by provides secretion from cells that are Preferably, the signal or signal leader The amino acid sequence is cleaved from the fusion protein during its secretion from the cell. yes If not, preferably the fusion protein is isolated after isolation of the fusion protein. cleaved from the signal or signal leader amino acid sequence.

Signal or signal leader sequences suitable for use in the invention include: Contains: saccharomyces cerevisiae alpha (U, S, Patent No. 4.546.082 and 4.870.008) ), S, cerevisiae α factor fragment, S, cerevisiae e α factor (see U.S. Patent No. 4.588, 684), yeast BAR I secretion system (see U.S. Patent No. 4.613.572), synthetic signal reader sequence, Kluyveromyces Iactis signal leader sequence and Usually a precursor of a protein or polypeptide, such as a precursor of interferon. Part of the signal sequence (US Patent No.

4,775.622).

Known naturally occurring compounds modified with biotin, 4-phosphopantetine or lipoic acid The proteins that are present are not secreted. This is done by adding one of these three compounds. This is expected to be because proteins modified by . Therefore, post-translational modifications may result in the addition of these three compounds to one fusion protein. If so, only the modified protein to be secreted becomes the fusion protein. contain a signal or signal leader sequence as part of the fusion protein. is preferable.

A suitable host is transformed with the vector containing the obtained hybrid DNA sequence. used for. This transformation is performed using methods well known in the art. I can.

Any of the many available and well-known host cells may be used in the practice of the present invention.

The host must be capable of carrying out the selected post-translational modifications. Up As pointed out above, almost all cells contain biotin, 4-phosphopantethi and lipoic acid can be added to proteins.

The selection of a particular host may be influenced by a number of other art-recognized factors. Depends on the vector. These include, for example, compatibility with the chosen expression vector; Toxicity to that of the fusion protein encoded by the hybrid DNA sequence , transformation rate, ease of recovery of the fusion protein, expressed properties, and biological safety. Includes completeness and cost. All hosts contain a specific hybrid DNA sequence or may not be equally effective for modifying fusion proteins with certain post-translational modifications. It is necessary to balance these factors while understanding that there is no

Within these general guidelines, useful microbial hosts include bacteria (e.g. E. coii sp.), yeasts (e.g. Saccharomyces sp.), and cultured cells of other bacteria, insects, plants, mammals (including humans), or those in the art. Other known hosts are included.

The host preferably allows proteins other than the fusion protein to undergo post-translational modifications. It is manipulated so that it is not modified by For example, it is usually biotinylated by yeast. These proteins are not required for yeast growth on medium supplemented with seeds, and they are The encoding gene can biotinylate the fusion protein of the present invention, but any other to produce a yeast host that also does not produce biotinylated proteins. Or it can be made non-functional. Mishina et al, Eu r, J.

See Biochem, 111.79 (1980). Similarly, 8. coli Proteins that are normally lipolyzed by bacteria on an appropriately supplemented medium are The genes encoding these genes are not necessary for growth, and the genes encoding them are not necessary for growth. Generate a bacterial host that is capable of producing protein only as a lipolyzed protein. can be deleted to produce It also grows at high temperatures in the presence of fatty acids. , BCCP (E. coli, the only biotinylated protein normally produced) A temperature-sensitive mutant E. coli strain has been developed that produces almost no protein (e.g. There is. This mutant flavor was named fabE and was developed by Co11 Genetic. 5tock Center, Yale University, New H Available from aven, CT.

Engineering a suitable host will ensure that production of the fusion proteins of the present invention is within the necessary range of cellular metabolism. Potentially detrimental to cellular metabolism due to reduced post-translational modifications of raw proteins must be taken into account. For example, toxicity is the result of a decrease in intracellular biotin. or for titration of available biotin ligase activity, or both. It can happen.

A potential problem with biotin depletion is that biotin is supplied at high concentrations in the growth medium. more easily overcome. E, coii, Saccharomyces cer The biotin transport system of E. evisiae and mammalian tissue culture cells is Biotin can be transported at a rate high enough to eliminate depletion. Bark er & Campbell, J. Bacteriology, 143. 789 (1980); Ragers and Lichstein, J. Bac. teriology, 100,556 (1,969); tiet al, , Ann, N, Y, Acad, Sei, 4 47.38 (1985). High concentrations of biotin enter E. coli by diffusion. There is evidence that it can be done. Barker & Campbell, J.B. acteriology, 143.789 (1980).

Prolonged, high-level biotinylated fusion protein expression This results in a lack of protein biotinylation.

In E. coli, the only endogenous biotinylated protein is essential for fatty acid synthesis. BCCP catalyzes essential steps. High levels of some of the fusion proteins of the invention Expression of B.Bel reduces biotinylation of BCCP and shows that B.co. The gene encoding li biotin ligase (birA) was cloned and bi A multicopy plasmid containing the rA gene contains biotin ligase. Overproducing and biotinylated fusion protein yield increases and fusion protein production increases. can be used to overcome the possible growth-inhibiting effects of In particular, Buoncris trani and 0tsuka, J, Bio 1. Chem, 263. J013 (1988) showed that E. coli biotin ligase is reported that it could be produced in >600-fold excess without exhibiting deleterious effects on growth. ing. Using a similar plasmid, we obtained very high expression (approximately Quantitative biotinylation of the fusion protein (see Example 8) (3 x 10' molecules/cell) Obtained.

Although ligase-deficient mutants can be cloned by genetic supplementation, However, the S. cerevisiae ligase gene has not yet been cloned. Not yet. E. coli ligase can be expressed and expanded in yeast or other heterologous systems. Add or gauze level. However, as mentioned above, the biological Tinylated proteins are necessary for yeast growth (the gene encoding them is lacking). may be damaged or rendered inoperable.

To date, only a few questions about cellular metabolism have been associated with the production of boiled proteins. It wasn't getting any attention. No lipoic acid deficiency or titration of lipoate ligase occurs It looks like.

The transformed host is then grown under conventional culture conditions until the desired fusion protein is expressed. It is cultivated so that The fusion protein can also be modified in vivo by post-translational modification. Preferably, it is modified as follows.

The present invention also provides binding partners that bind to the fusion protein only after they have been modified. and bind the fusion protein modified with conditions that allow binding to the binding partner. The modified fusion protein is simply removed from the materials in the mixture by contacting the modified fusion protein with Provide a way to separate.

After binding the fusion protein to the binding partner, mix the bound fusion proteins. separated from other materials in the product (e.g., cell extract or culture medium) and then The protein is eluted from the binding partner.

Post-translational modification sites occur while the fusion protein is still bound to the binding partner. Alternatively, it may be removed from the selected protein or polypeptide after elution.

The post-translational modification site can be removed by various means, but preferably the cleavage site described above is removed. Remove by means of.

The binding partner may be an antibody. For example, biotin, 4-phosphopantetin or modified fusions by the addition of these compounds using antibodies against lipoic acid. Proteins can be purified. The antibody is preferably immobilized on a solid support. be done. Methods for producing antibodies and using them for protein purification are well known. There is.

The binding partner may be another compound that binds to the fusion protein after modification. stomach. As mentioned above, biotin is very strongly (KD 10-”M), avidin and specifically non-covalently bound by streptavidin and streptavidin. This specific binding is , although the binding affinity is reduced due to steric hindrance (K, approximately 10-”M ), extending to biotin covalently bound to the protein, as discussed above. follow Therefore, the biotinylated fusion protein can be used with avidin and stock as binding partners. Purification using leptavidin or analogues or derivatives of these two compounds good. Analogs and derivatives of avidin and streptavidin include: Includes: subunits and fragments of avidin and streptavidin; amino acids Avidin and streptavidin with deletions, additions, or substitutions (full size, full size) chemically modified avidin and streptavidin.

Any analog or derivative retains the ability to specifically bind biotin. Are suitable.

using a column of immobilized avidin or streptavidin or its analogs or derivatives. This is because the risk of denaturation sometimes encountered when using antibody columns is avoided. , is a preferred means of purifying the biotinylated fusion proteins of the invention. Like that Columns are also cheaper to use than antibody columns. In addition, avidin and Treptavidin is more resistant to proteolysis and denaturation than antibodies; The column life of vidin and streptavidin is longer than that of antibody columns.

Avidin and streptavidin columns are compatible with other affinity columns such as antibody columns. These methods are well known. example For example, avidin or streptavidin can be used as a cephalogram activated with cyanogen bromide. Vine covalently bonded to the base.

In a preferred embodiment of the method of the invention, a biotinylated fusion with a cleavage site Protein-containing cell extracts or media are transferred to fixed avidin and streptavidin. Pass through the gin column. Biotinylated fusion proteins and other biotinylated proteins in extracts or media Only otinylated proteins are retained on the column. Then open the fusion protein. Upon cleavage at the cleavage site, the protein or polypeptide of interest is eluted from the column. , the polypeptide containing the biotinylation site is retained on the column. Fusion of the cleavage site Selected to be absent from proteins or other biotinylated proteins , only the selected protein or polypeptide of interest elutes from the column. . Avidin and streptavidin are usually resistant to proteases, but Preferably, the cleavage site is one that is not found in avidin and Strep I avidin.

These operations are better tolerated when cleaving fusion proteins on columns. Because it is thought to have a strong affinity for avidin and streptavidin, Preferably, biotin with avidin and streptavidin is used. Very tight binding of moieties makes elution of the fully biotinylated fusion protein desirable It can be disadvantageous in some cases. Biotinylation with avidin and streptavidin Protein binding is virtually irreversible due to competition with free biotin; Elution from columns such as method must be used.

However, avidizin, which has a low affinity for biotin and biotinylated proteins, The column increases capacity by converting avidin from its normal tetrameric form to its monomeric form. It can be easily and reproducibly manufactured. Monomeric avidin columns such as is obtained by treating a fixed avidin column with a guanidine solution.

This treatment partially and irreversibly denatures the avidin, allowing high affinity biotin Most of the binding sites of change the position.

The remaining high affinity sites can be blocked with biotin, which Quantitative elution of bound biotinylated proteins using non-denaturing buffer containing tin A column that can be used is obtained.

Reference text regarding the manufacture and properties of low affinity monomer avidin columns used in columns The production of materials suitable for low-affinity monomeric avidin columns is the first step in the production of low-affinity monomeric avidin columns. Since this is a process, it is described indirectly.

If the cell extract or cell culture medium is passed through a low affinity monomeric avidin column, biotin Only biotinylated fusion proteins and other biotinylated proteins bind. Combined video Otinylated proteins are eluted using a biotin-containing buffer. in this way, The fusion protein is not denatured (eluted) and the column can be reused.

Fusion proteins can be prepared using conventional methods such as size, charge, or antigenicity-based separations. Depending on the separation method, biotin and other biotinylated proteins may be present in the elution buffer. It can also be separated from Alternatively, the fusion protein may have a cleavage site If present, it can be cleaved at the cleavage site and mix protein and biotin. The compound is passed through an avidin or streptavidin (usually high affinity) column and The biotinylated protein and biotin bind to the column. Furthermore, the cleavage site If specific to the junction between the segments of the fusion protein, the selected tag of interest Only proteins or polypeptides are eluted from this column.

It is also possible to produce a low affinity streptavidin strain.

As described in the background, the streptavidin gene was cloned and ing. In addition, the crystal structure has been recently analyzed, and the low-resolution avidin structure is Personal communication virtually superimposed on the leptavidin structure. these The structure of Avidin explains the reduced biotin binding affinity of monomeric avidin. tetramer In avidin, it forms a hydrophobic biotin-binding site for a given subunit. One of the four tryptophan residues that monomerization removes this residue from the biotin binding site. This results in low affinity. Therefore, site-directed mutagenesis guided by the crystal structure Appropriate expression of the streptavidin gene in combination with induction results in monomer a tetrameric stream that has an affinity (or exhibits any affinity given in principle) Two molecules of treg1 hairvisi are produced. Such a tetrameric molecule is a protease more stable than monomers and against denaturation, offering better column-binding ligands. It is thought that it will be provided.

r) Boil residues on ribolyzed proteins contain intramolecular disulfide bonds. ribo Upon reduction of the protein, the riboyl residue forms thiodiol dihydroipoic acid. However, ribonated fusion proteins bind diols much more tightly than monothiols. It can be purified using metal compounds that

Ribonylated fusion proteins reduce disulfide bonds to generate dithiols Reduced by reagent. Such reagents and methods of using them are well known. ing. Suitable reducing agents include borohydrides, monothiols such as mercaptoesters, tanols and thioglycolates, and 1,4-dithiols, such as dithiothre Contains itol. 1,4-dithiol is preferred.

Organic phase arsenates have thiol moieties located on adjacent carbon atoms or separated by methylene groups. on separated carbon atoms (e.g. 1,2-dithiol or 1,3-dithiol) binds more tightly to dithiols than to monothiols. Dihydroli Polyacid is a 6,8-dithiol, and its strong bond to organic arsenic compounds is Among physical systems, this compound is virtually unique and therefore the organic layer arsenate Salts are preferably selected for use in the purification of ribonated fusion proteins of the invention. stomach.

A suitable organic arsenic has the following formula: RAs.0, where As.0 is arsenite (arsine). R represents a substituted or unsubstituted linear, branched, or cyclic (including aromatic ring) ) Represents any organic group including hydrocarbon groups and heteroatom groups. Organic arsenic is low R is preferably a high molecular weight (>75) residue, as it is less volatile than molecular weight compounds. It is. The organic layer arsenate is prepared as described below. Webb, Enz)+me and Metabolic Inhibitor s, Vol, III, pp, 595-793 (Academic Pr ess, New Y shield nitrogen 1966) and R, M. Johnstone, “5ulfhydryl Ag ents:Ar5enicals,”inMetaboIic Inhibi tars, A Cornprehensive Treatjse, Vo l, II, pp, @99-9 9-118 (Acade Press, New York 1963).

The organic layer arsenate is bound to a polymeric material to form an organic arsenite column. the In such cases, R is a functional link for bonding RAs=O to the polymeric material. eg NH, , SH and COOH. That's it The method of manufacturing the column and polymeric materials suitable for use in the column is similar to that of other It is well known and is used to manufacture affinity columns.

A column of organic arsenite bound to agarose was developed by Hannestad et al. l, , Analytical Biochemistry, 126.20 0 (1982). Cell extract or cell culture medium ribonated fusion proteins and other ribonated proteins when reduced and then passed through the column. Only proteins bind. The bound ribolylated protein is dissolved in sodium hydroxide or to 1,2- or 1,3-dithiol, e.g. dithiopropylamine, dihydrol poic acid, 2,3-dimercapto-2-propatur or 2,3-dimercapto-2 - eluted from the column using propane sulfonic acid. In this way, fusion tan Proteins are eluted without being denatured and the column can be reused.

The fusion protein is isolated in an elution buffer using conventional separation methods, e.g.

separated from any other lipolyzed proteins by separation based on sterility, charge, or antigenicity. Separated vine. Alternatively, if a cleavage site exists, the fusion protein can be The protein mixture can be cleaved and passed through another organoarsenic column. and other ribonated proteins and polypeptides cleaved from the fusion protein. is combined there. The cleavage site is a fusion protein or other lipolyzed protein. the selected protein of interest or Only polypeptides are eluted from this column.

Alternatively, while the lipolyzed fusion protein is still bound to the organoarsenic column, , if a cleavage site exists, the fusion protein can be cleaved at the cleavage site. , the polypeptide containing the ribolation site is retained on the column, and the protein or polypeptide of interest is Peptides can be eluted from the column. Additionally, the cleavage site is a segment of the fusion protein. a selected protein or polypeptide of interest, if specific for binding between is eluted from this column.

The use of organic arsenite columns avoids variations that are often problematic when using antibody columns. It is preferable to purify the lipolyzed fusion protein of the present invention because it avoids the risk of This is a good method. Such columns are also cheaper than using antibody columns. (approximately 100 to 1000 times cheaper).

Furthermore, unlike antibodies, organic arsenic is insensitive to proteolysis and denaturation; The column life of mechanical arsenite columns is much longer than that of antibody columns.

Finally, certain proteins (e.g. insoluble proteins, e.g. membrane proteins) or under certain conditions (e.g. proteins produced by recombinant DNA technology). denaturing agents (e.g. dispersants or strong chiotropic substances), It is necessary to solubilize the fusion protein so that it can be isolated using be. Antibody columns often cannot be used in these situations.

However, avidin and streptavidin bind biotin in the presence of denaturing agents. Ordinary affinity avidin and streptavidin are may be used in such cases to isolate biotinylated fusion proteins. Swac k et al, Anal, Biochem, 匪114 (1978) reference. This document describes proteins solubilized with sodium dodecyl sulfate (SDS). The biotinylated protein present in the crude mixture of Quantitative binding to a column of gin, washing away contaminating proteins, and SDS The column matrix is eluted by boiling the column matrix. Main departure The authors described streptavidin bound to agarose by an 11-carbon arm. A modification of this technique was used to purify biotinylated proteins to homogeneity.

Similarly, organoarsenic columns and ribonated moieties remain unaltered by protein denaturants. stomach. This column can be used to analyze fusion proteins when denaturing conditions must be used. quality can be refined. In fact, organic arsenite columns contain organic arsenite. Since it is not a protein like gin and streptavidin, such Much more resistant to denaturing agents than avidin and streptavidin columns Highly sexual. In addition, organoarsenic columns include avidin and streptavidin columns. It is cheaper and more stable than . Therefore, using ribonated and organic arsenic columns This is important if denaturing conditions have to be used in the purification of the fusion protein. It is generally preferred in some cases, and is also preferred from an economic point of view for other applications.

However, it is difficult to decide whether to use a ribonylated or biotinylated system. There are other considerations when determining the First, organic arsenic is toxic and fusion If contaminated with protein products (organoarsenic is covalently bound to the column) Potassium and organic arsenic, which appear to be difficult to remove, can be removed by adding dialysis to other purification processes. must be removed. Second, biotin avidin and streptavidin The binding of dihydrolipoic acid to organic arsenic is more specific than that of dihydrolipoic acid. Ru. Third, the reagents used to reduce ribolylated proteins and the methods used to elute them. The dithiols used for disulfide bond) Activated vine. Many proteins do not contain disulfide bonds or Bonds are normally buried in the protein stomach where reducing agents cannot enter if present. This disadvantage is protein-specific, as it can be corrupted. For reducing disulfide bonds If more inactivation occurs, this is generally reversible but requires another step in the purification process. It would have to be added to the tocol.

Example Restriction enzymes and other enzymes used in the examples below were purchased from Bethesda Re5search Laboratories, New England B iolabs or Boehringer Mannheim Biochem Obtained from icals. Phage T4 DNA ligase performs all ligations and reactivations. used for cyclization. Buffers and reaction conditions when using these enzymes are as described above. Produce a hybrid DNA sequence recommended by the provider that includes: ■) Propio oriba containing the sequence encoding the biotin attachment site cterium shermanii) lancecarboxylase 1,3S DNA sequence encoding a fragment of Buunit; 2) β-galactosidase structural gene All or part of the child. The two DNA sequences are such that the fusion protein has a β-terminus at the amino terminus. It has a galactosidase or β-galactosidase fragment and a bicarbonate at the carboxyl terminus. fused to be encoded with an otin acceptor sequence. these The hybrid DNA can be placed on a suitable vector and used to transform a suitable host. was used. When cultured under conditions that allow expression, the biotinylated fusion protein produced.

1.3S subunit of P. shermanii transcarboxylase The amino acid sequence of is being tracked. Murtif, Bahler and Samols, P. roc, Nattl, Acad, Sci, [JSA, 82.5617-21 (1 985). The carboxy terminus is involved in the post-translational addition of biotin to the subunit Contains an array. Murtif and Samols, The Journal of Biological Chemistry, 262.11813-1 6 (1987).

1. The gene encoding the 3S subunit is located upstream of the biocytin lysine codon. A given DNA sequence contains a large number of naturally occurring restriction sites.

Murt if, Bahler and Samols, Proc, Na tl, Acad, Sci, USA, 82.5617|21 (1985). Using these parts, 1,3S subunit nodes of various lengths can be made. A series of β-galactosidase fusions with the carboxy terminus of

The starting material for the manufacture of these constructs encodes 1.38 subunits. The plasmid ptac1.3t contained the structural gene. This plasmid is V , Murtif, Samols, Department of Bio chemistry.

Ca5e Western Re5erve University, C1ev Obtained from eland, 0hio 44106.

Alternatively, plasmid ptac1.3t can be produced by the method described below. So Many of the processes described by Murtif, Bahler and Samols, P. roc, Nattl, Ac. What is disclosed in this reference is incorporated herein by reference. inserted into. First, anaerobically grown P, shermani, W5 By completely cleaving the genomic DNA extracted from the two strains with PstI, the genome A mini library was created. This strain is from the American Type Culture Collection. Obtained from ATCC, Rockville Meridian, deposit number 6207. Ru.

The purified PsLr fragment was obtained from pUC9 (obtained from ATCC, accession no. 3725). ), and the resulting plasmid was inserted into the Pst1 site of Escherichia Transforming coliHBlol (obtained from ATCC with accession number 33694) It was used to exchange. Positive colonies were transferred to a labeled hybridization plate. The 1.3s subunit was identified using the Pst1 site of pUC9. Plasmid pTc1.3 containing a 1.7 kb PstI fragment containing the gene to be coded was isolated.

Plasmid pTc1.3t was constructed from plasmid pTc1.3 as follows. Ta.

Plasmid pTc1.3 was cut with Pstl and 5faNf, and the 3S subunit was We obtained a shortened fragment that codes for nits. T4D the 5faNI end of this fragment. The fragment was made blunt with NA polymerase and inserted into the Pstl and Sma I sites of pUC9. inserted into. Plasmid pTc1.3t short (the resulting insert is 0.4 kilobases) with a length of 40 base pairs of 51-flanking sequence and 30 base pairs of 3'-furan sequence. In addition to the King sequence, from the sequence encoding 123 residues of 1.33 subunits Become.

In plasmid ptac1.3t, a 0.4 kilobase insertion of pTcl, 3t. The material used was the expression vector pKK223-3 (Pharmacia LKB Bio technology, Pistcataway, New Jersey) It is located next to the ac promoter. Plasmid ptac! , 3t, plastic Produced by cutting Sumido pTc1.3t with HindllI and EcoRI. Built. Fill the ends with T4 DNA polymerase and transform the fragment into plasmid pK Ligate into the SmaI site of K223-3 to form plasmid ptac1.3t. Ta.

A further description of the methods used, the various material properties and details of their origin can be found in the references cited above. Murtif and Samols, Murtif, Bahler a may be found in the article by Samols, nd.

At the end of Figure 21, the fragments of the 1 and 3S genes used in the hybrid DNA are shown. The amino acid sequence encoded by The four fragments used are: 1. The carboxyl-terminal 106 amino acids of the 33 subunits, the carboxyl-terminal 75 amino acids, 61 amino acids at the carboxyl terminus, and 61 amino acids at the carboxyl terminus; Encodes 38 amino acids. These fragments were derived from the plasmid ptac1.3t. 1. The 3S subunit structural gene was digested with the restriction enzymes 5all and N, respectively, as described below. It is induced by cutting with ar I, Nae I and Xho I.

The hybrid DNA sequence encodes part of these 1.33 subunits. In addition to the fragment, it contains one of the following: l) β- which upon expression produces an active enzyme; Complete sequence encoding galactosidase: 2) the last 16 amino acids (inactive enzyme ) DNA sequence encoding all of β-galactosidase except for 3) protein 4) a DNA sequence encoding the amino terminus of 65% of the protein (inactive enzyme); A DNA sequence that encodes only the four terminal amino acids of a protein (inactive enzyme).

1. Production of fusion product A Fusion A contains the carboxyl-terminal 106 of the 1.33 subunit in the correct reading frame. The entirety of the β-galactosidase gene linked to the DNA sequence encoding the amino acids of A hybrid DNA sequence that includes a coding sequence.

See Figure 21.

Plasmid pCY49J containing fusion A was produced as shown in Figures 3 and 4. did. Plasmid ptac1.3t was transformed with BamHI and 5aII as above. I cut it with. This fragment was added to the BamHI and 5aII regions of plasmid pBR328. The plasmid pCY46 was prepared by inserting the plasmid pCY46 into the plasmid pCY46. Plasmid pBR328 is Obtained from ATCC deposit number 37517. Next, plasmid pCY46 was added to 5a The fragments obtained were cut with Sa and I of plasmid pBR288. r and Pst1 sites to produce plasmid pCY49J containing fusion A. did.

Plasmid pUR288 contains Sa, 11. BamHI, XbaI and Hin Contains IacZ with a unique cloning site at the 3′ end, which is the dI11 site. nothing. The production of plasmid plJR288 and its properties are described by Ruther and Mul l, er-old 11. The EMBO Journal, 2.1791-94 ( (1983). This is Universitat zu Kol n, 5000 Koln 41. From Professor Muller-Hi II of FRG can get.

Creating a unique loning site at the 3' end of the 1acZ gene of pUR288 A portion of the linker is retained in the fusion A structure and is linked to the β-galactosidase of fusion A. and the sequence encoding the 1.33 subunit fragment (see Figure 21). (represented by SOHEV)).

2. Production of fusion product B Fusion B contains the carboxyl-terminal 75 of the 1.33 subunit in the correct reading frame. The complete sequence of the β-galactosidase gene linked to the DNA sequence encoding the amino acid. It is a hybrid DNA sequence containing a code sequence.

See Figure 21.

Plasmid pcY74 containing fusion B is shown in Figures 5, 11 and 12. Manufactured as follows. First, pCY49J containing fusion A was linearized with EcoRV. and HindII fragmentation from plasmid pUc4K containing the kanamycin resistance gene. The fragment was inserted into the EcoRV site of pCY49J to produce plasmid pCY56. (See Figure 11).

Plasmid pUC4 contains Pharmacia LKB Biotechnol Ogy, Pistacataway, New Jersey. Vi era and Messing, Gene, 19.219 (1982). Light.

Next, plasmid pCY56 was transferred to Nar! Cut with. Plasmid pTZ18R was linearized with AccI, and the NarI fragment obtained from pCY56 was transformed into pTZ 18R to the Acc1 site to produce plasmid pCY66 (see Figure 12). (see). Accl cleavage creates an overhang complementary to the end produced by Nar I Additional 5' ends can be produced.

Plasmid pTZI8R is available from Pharmacia LKB Biotechno Obtained from logy. Also, Mead et al, , Prot, En See Gineer, 1.67: (1986).

Finally, plasmid pCY66 was cut with XbaI and XmnK, and the resulting fragment was The fragment was ligated into the Xbal and Xmn1 sites of pUR288 to create a plaque containing fusion B. Sumido pCY74 was produced (see Figure 5).

3. Production of fusion product C Fusion C contains the carboxyl-terminal 61 of the 1.3S subunit in the correct reading frame. The complete sequence of the β-galactosidase gene linked to the DNA sequence encoding the amino acid. It is a hybrid DNA sequence containing a code sequence.

See Figure 21.

Plasmid pcY90 containing fusion C was produced as shown in Figures 6 and 12. did. Plasmid pUC8 was linearized with AccI, and plasmid pCY56 (first ．． (prepared as shown in Figure 1) was cut with Narr. pcysa's Nar I fragment was inserted into the A c c, 1 site of pUC8 to construct plasmid pcyas. Built.

(See Figure 12).

Thereafter, plasmid pcY68 was cut with NaeI. Plasmid pUR28 9 was cut with BamHI, and the ends were cut using DNA polymerase ■ and dNTP's. I filled it up. pUR289, a NaeI fragment of pcyea treated as above. to produce plasmid pcY90 containing fusion C.

Plasmid ptlR289 contains 5all, Bam old, Xbal and Hind The 1acZ gene has a unique loning site at the 3l end, which is the 111 site. including.

The portion of the linker that creates the loning site, which is unique to pUR289, is contained in fusion C. (denoted 'vVVvV in Figure 2i).

The production of plasmid pUR289 and its properties were described by Rutber and Muller. -Hitl, The EMBO Journal, 2.1791-94 (19 83). Plasmid pUR289 is Muller-Hi 11 Obtained from the professor.

Plasmid pUC8 is a well known vector. This is Boehring er Mannheim Biochemicals and Pharmacia LKB Biotechnology or fusion technology is a component of 1.3S subunit. Linked in the correct reading frame to the DNA sequence encoding the 38 amino acids at the loboxyl terminus A hybrid DNA sequence containing the entire coding sequence of the β-galactosidase gene It is.

See Figure 21.

Plasmid pCY84 containing the fusion material was produced as shown in FIG. plus Mid-pCY84 is generated by cleaving pCY49J with 5ail and XhoI and cyclizing it again. Manufactured by

5. Production of fusion product E Fusion E encodes the carboxyl-terminal 75 amino acids of the 1.33 subunit. 1006 pieces of β-galactosidase linked to the coded DNA sequence in the correct reading frame. is a hybrid DNA sequence containing a sequence encoding the amine-terminal amino acid of .

See Figure 21.

Plasmid pCY72 containing fusion E was produced as shown in FIG. Here As shown, this plasmid is pCY66 (produced as shown in Figure 12). ) was cut with Xmn1 and EcoRI, and the resulting fragment was inserted into pUR288's Xmn I and EcoRI sites to form plasmid pCY72. will be built.

6. Production of fusion product F Fusion F contains the carboxyl-terminal 75 of the 1.33 subunit in the correct reading frame. 650 β-galactosidase molecules linked to a DNA sequence encoding an amino acid. A hybrid DNA sequence that includes a sequence encoding an amino-terminal amino acid. No. See Figure 21.

Plasmid pCY73 containing fusion F was produced as shown in FIG. Here As shown, plasmid pCY73 was derived from pCY66 (manufactured as shown in Figure 12). ) was cut with Xmn1 and 5stI, and the resulting fragment was digested with Xmn1 and 5stI of pUR288. generated by ligating into the nI and 5stI sites to form plasmid pCY73. will be built.

7. Production of fusion product G Fusion G contains the carboxyl-terminal 106 of the 1.3S subunit in the correct reading frame. The first 4 of β-galactosidase linked to a DNA sequence encoding the amino acids of is a hybrid DNA sequence containing a sequence encoding amine-terminal amino acids. . See Figure 21.

Plasmid pcY119 containing fusion G was produced as shown in FIG. child As shown here, plasmid ptac1.3t was cut with HindHI and its After that, it is partially cut at 5all. The obtained fragment was inserted into HindII of pUc8. I and 5ail sites to form plasmid pcY119.

8. Production of fusion product H Fusion H contains the carboxyl-terminal 75 of the 1.33 subunit in the correct reading frame. The first four β-galactosidase molecules linked to a DNA sequence encoding an amino acid is a hybrid DNA sequence containing a sequence encoding the amino-terminal amino acid of.

See Figure 21.

Plasmid pCY68 containing fusion H was produced as shown in FIG. plastic To produce Sumid pCY68, plasmid pcY5B was cut with Narl. , plasmid pUC8 was cut with AccI. Combine these and recircularize Plasmid pCY68 containing fusion H was produced by.

9. Production of fusion I Fusion I contains the carboxyl-terminal 38 of the 1,3S subunit in the correct reading frame. The first four β-galactosidase molecules linked to a DNA sequence encoding an amino acid is a hybrid DNA sequence containing a sequence encoding the amine-terminal amino acid of .

See Figure 21.

Plasmid pcY120 containing the fusion compound was produced as shown in FIG. child As shown, plasmid pta, c1.3t contains HindlII and Xho It is cut at l. The obtained fragment was inserted into the HindIII and 5ail sites of pUC8. was inserted to form plasmid pcY120 containing fusion I. For Xho I digestion A fragment with an overhanging 5″ end complementary to the fragment produced by 5all. I got it.

Several E. coli strains were transformed with the vector containing fusion A-I produced above. Converted. Transformation was performed according to Maniatis et al., Molecular Cloning, pp, 403-433 (Cold Spring Harb or Press, Co1c! Spring Harbor, New York Hanahan, J., Mo1. B All buffers as recommended by IAS, 166°557 (1983) It was modified by including 20+nM MgC1□ in the solution.

The E. coli strains used were NM522 and its restriction positive parent BMH71-18, F　　11recA; DH5a　;F　　M15recA; and MC106 It is 1. Strains BMH71, -18 and F1]1recA is B, Mulle A gift from Professor r-Hill, Ruther and Muller-1 (itl, T He EMBO Journal, 2.1791-94 (1983) ing. The DH5a strain was obtained from Bethesda Re5earch Laborat. ories. NM522 strain, F'M15recA strain and MC106 One stock is 47000.33904. each from ATCC. and deposit number 53338 You can get it with the issue. The main characteristic of all five strains was high transformation frequency.

DH5a strain, F' M15recA strain, NM522 strain and BMH71-18 strain , the 1acZ gene (called Ml, 5), which produces inactive β-galactosidase ), and its activity is limited to vectors such as pUc8 and pTZ18R. The presence of a second inactive β-galactosidase fragment encoded by sell. Method for producing active β-galactosidase from these two inactive proteins is called α-complementation, pUC8, pTZ18R and similar Insertion of a DNA fragment within a polylinker sequence placed in the 1acZ sequence of the vector It is commonly used because it results in a loss of β-galactosidase activity. this Loss of activity is associated with 5-bromo-4-chloro-indolyl-β-galactosidase ( (available from Sigma Chemical Co.) was manufactured as follows. This is revealed by including it in a culture medium.

The F'11recA strain has a complete chromosomal lactose operon deletion. , IaclQ region that overproduces lactose operon repressor protein Contains the F° factor. BMH71-18 strain and NM522 strain are also F' Contains the 1aclQ factor. Lactose repressor is the lactose operon Regulating expression of the inducible fusion protein.

The medium used for the transformation method was 1% Batato tryptone (DifcoLa boratories), 0.1% Bact Yeast Extra Lac (purchased from Difco Laboratories), and 0.5% NaC It is a broth consisting of 1. The solid medium contains 1.5% agarose.

Antibiotics are optionally added to select transformants.

They are ampicillin sodium (100 μg/ml), kanamycin sulfate (50μg/ml) and chloramphenicol (50μg/ml) final concentration is added so as to obtain Antibiotics can be stored in liquid media or molten at 55°C. It is added to the celestial medium just before pouring into the Petri dish. All antibiotics are 3igma Purchased from Chemical Co.

2. Analysis of radiolabeled biotinylated proteins formed as above with fusion A-1. The transformed E. coli strain is cultured using tritiated biotin for fusion. Proteins were labeled. Bacteria were grown at 37°C in 0.4% glycerol, 0.5% 1% vitamin-free casein hydrolyzate, 41 nM dolithiated biotin (IμCi of 3H biotin/ml) (New Engla, nd Nuclea (purchased from Amersham) and plasmid maintenance. in minimal medium E containing antibiotics suitable for 1. -2　Xl0g cells/ml The cells were cultured until

- After overnight incubation, 0.1 ml of culture medium containing I-2XIO@ cells was added to 1 mM Isopropyl-thio-galactoside (IPTG) (Sig+na Chemical al Co.

into test tubes containing 1.0 ml of the same medium supplemented with (purchased from).

Cells were cultured for 2 hours to obtain expression of the fusion protein, after which cells were harvested and 8M urea and 1% sodium dodecyl sulfate (SO3) at pH 6.8. Dissolved in s-HCl 12.5mM solution. Cell extracts were collected in the presence of SO3. , separated on a 7.5% polyacrylamide gel operated in discontinuous mode.

Gel, purchased from Enhance (New England Nuclear) fluorographed by dipping into a pre-flushed film. exposed. The results are shown in FIG.

The production of biotinylated proteins involves replacing biotin with streptavidin or avidin. 184, in press.

3. Assay of biooperon derepression Biotin (bio) operon derepression was assayed for each of the fusions. bi The o operon contains the gene encoding the enzyme that synthesizes biotin. biotin raw The rate of synthesis of synthetic enzymes is regulated by repressors, and their activity is dependent on biotin. Depends on external supplies, E, c.

However, it is sensitive to cellular levels of biotin acceptor protein during li. The regulation of this operon differs from the normal enzyme repression system in two novel properties. Become. First, repressor protein and biotin ligase are the same protein It is. This is because the protein binds to the biotin operator-specific DNA binding region. It contains both enzyme active sites. The second novel property is that it activates DNA binding. The corepressor that converts is not biotin, but biotinoyl = AMP, and this is the product of the first half reaction of biotin ligase activity.

The above mentioned book. Biotinoyl-AMP is biotin of the acceptor biotin protein. Leaves the enzyme bound until consumed by oxidation.

The maximum rate of bio operon transcription (derepression) is severely limited by biotin supply. (e.g. biotin depletion of bioauxotrophs). Would you like to be synthesized? Biotinoyl AMP also plays a rapid role in the biotinylation of acceptor proteins. Since the repressor ligase biotinoyl-AMP complex is consumed, Bio-operators are very rarely supplied without being accumulated in detectable quantities. maximum transfer. Therefore, biotinylation consumes biotinoyl-AMP. and is attributed to the derepression of the bio operon.

Derepression of the bio operon can be observed on indicator plates. and was quantified by β-galactosidase activity as shown below. A means of assaying the synthesis of biotinylated protein fusions in E. coli is provided. child The system uses fusions that are biotinylated but not biotinylated to be degraded. (1988), including fusion A-1. This is carried out by transforming E. coli strain BM2661 using the vector. It was. Strain BM2661 is a promoter of the E. coli bio BCDF operon. Contains a truncated β-galactosidase gene fused to a protein. biotin biosynthesis When β-galactosidase is derepressed, β-galactosidase is produced, while exogenous biotin Very low expression is seen when present in the medium at high concentrations.

Strain BM2661 was obtained from Dr. Campbe 1. of Stafford University. From I Obtained.

The indicator medium used was supplemented with 41 nM or 5 μM biotin. MacConkey lactose (purchased from Difco Laboratories) ). On this medium, suppressed colonies are white, while unsuppressed colonies are unsuppressed. It is pink or red depending on the degree of removal. The results are shown in FIG.

The cells are destroyed and the β-galactosidase is converted to 0-nitrophenylgalactin. This was done by analyzing tosidase hydrolysis.

4. Results The results of the above two analyzes are shown in FIG. “ in the biotinylated protein column +” indicates that the expected size and amount of tritiated fusion protein was detected. and The “+” in the derepression column indicates that the transcription of the biotin operon is 41 nM. in the presence of biotin (the lowest concentration that gives maximum derepression in wild-type cells). “++” indicates at least a 10-fold increase in biotin at 5 μM. This also shows that a 10-fold reduction in inhibition was observed.

As shown in Figure 21, the 38 amino acid at the carboxyl terminal of the 1.33 subunit It is produced by a fusion protein that encodes only acid, and converts biocytin lysine residues into carboxylic acids. Proteins that were amino acid residues up to the xyl terminus were not biotinylated.

This means that the sequence upstream of biocytin lysine is protein-mediated by biotin ligase. This shows that it is necessary for recognition of quality.

The required array is 1. '3S subunit (presumed β-turn) pro-ala -pro sequence (residues 58-60). This is because this segment Proteins produced by fusions C and D, which lack the 21), while fusion A containing this segment.

This is because B and EH were bound to biotin (see Figure 21). However However, there are many more subtle structures in this region that are important for ligase recognition. sell.

Of particular interest is the last 75-carboxine terminal amino acid of the 1.3S subunit. Fusions B, E, F, and H have biotinylation sites consisting of amino acids. child This is the smallest amino acid sequence found so far that confers biotinylation.

Note that some biotin fusions are degraded by intracellular proteases. Should. Fusion E is expected to have a very weak biomass at the migration location. produced a tinylated protein bond. This result indicates that β-galactosidase and biotin It is believed that this is due to proteolytic clipping of the bonds between the linkage sequences. Ru. The joining of the DNA segments is carried out by Eco of the β-galactosidase 1acZ gene This is the R1 site. This site has been used in the λgtll system and , proteolytic clipping of the fusion region has been observed in many fusions. . Carroll and Laufhon, DNA Cloning, vol. 3. pp, 89-1ll (Glover ed, , IRE, Pre ss, Oxford, U, K, 1987) This proteolytic cleavage problem The problem can be solved by using a protease-deficient E. coli host or by using a fusion protein. The problem should be solved by changing the arrangement of the connections between the two segments of the texture.

However, degradation of the fusion is limited for fusions with non-functional acceptor sequences. instead, the derepression of the biotin operon provided by the degraded fusion can be distinguished from functional acceptor sequences. As shown in Figure 21, There was a high level of fusion E derepression indicating that the receptor sequence is functional. .

Figure 14 shows a typical example obtained using the tritiated labeling method described above. Showing a fluorograph. In FIG. 14, column 1 is produced by fusion A. column 2 contains no fusion protein, column 3 contains protein, column 3 contains fusion protein Column 4 contains proteins produced but not induced; column 4 contains proteins produced by fusion B. Column 5 contains proteins produced by fusion E. (A blurred band was observed upon overexposure), column 6 is due to fusion F. Contains manufactured proteins. In all columns, the lower bands represent endogenous E , which represents the E. coli biotin carboxyl carrier protein.

Fusion J is the amino acid of Tn9 chloramphenicol acetyltransferase. A hybrid DNA sequence that coats the terminal 209 amino acids; The sequence encodes the carboxyl-terminal 75 amino acids of the 1,3S subunit. . See Figure 21.

Plasmid pCY94 containing fusion J was produced as shown in FIG. here Plasmid pCY, 66 (produced as shown in Figure 12) was cut with SmaI and Sphr. The resulting fragment was stained with 5e at pH 3G397. inserted into the al and sph I sites to form plasmid pCY94 containing fusion J. did.

Plasmid pH5G397 was obtained from Japan Cancer Research Resource Bank, Tokyo. It was. Ta1eshita et al, Gene, 61.63 (1987) reference.

Plasmid pCY94 in the form of E, coli DH5a strain and 8M2661 strain Used for quality conversion. strain DH5α was treated with tritiated vinyl as described in Example 1. Strain BM2661 was incubated with lactose operon inducer. De-suppression was tested as described in Example 1, except that no surfactant was added. I tried it.

The results are shown in FIG. As shown here, the biotinylated fusion protein was H5α, and when pCY84 was introduced into strain BM2661, the repression was released. It was seen.

Production and expression of encoding DNA sequences The fusion includes the amino terminal 44 of Tn5 neomycin phosphotransferase. is a hybrid DNA sequence encoding an amino acid of 1.3 It encodes the carboxyl-terminal 75 amino acids of 3 subunits. See Figure 21 Light.

Plasmid pcY118 containing fusion K was isolated as shown in Figures 16 and 18. Manufactured. First, D from phage lambda b221 containing transposon Tn5 NA was isolated and cut with Bam old and HindlII. E at the end.

co　　　　　DNA polymerase I (Flenow fragment) and dNTP's. I did. Thereafter, the fragment was inserted into the Sma1 site of pUC8 to create a plasmid pC. Y5 was manufactured. Next, pCY5 was digested with NarT and Bgll, and the resulting fragment was The protein containing fusion K was inserted into the Narl and Bg11 sites of pta, cl, 3t. Lasmid pcY118 was produced.

Transposon Tn5 beam, Berg, Washington Universes ity, St. Louis.

Obtained from Missouri. The manufacturing method is described by Berg et al. c, Natl, Acad, Sci, USA, 72.3628-32 ( 1975). Tn5 neomycin phosphotransferase A similar DNA segment encoding the Pharmacia Biotech Obtained from ology.

Plasmid pCY118 was used to transform strain BMH71-18.

This transformation was performed as described in Example 1 above.

The transformed bacteria were incubated with trichelated biotin as described in Example I. Chin and assayed for derepression as described in Example 2. Second result Shown in Figure 1. As shown here, biotinylated fusion proteins are produced and inhibited. Release was seen.

Fusion M combines the amino terminus of T903 neomycin phosphotransferase. A hybrid DNA sequence encoding 41 amino acids; ．． It encodes the carboxyl-terminal 75 amino acids of 33 subunits. 21st See diagram.

Plasmid pcY11.7 containing fusion M was produced as shown in FIG.

First, plasmid pCY66 (produced as shown in Figure 12) was lined with PsU. and recircularize to form plasmid pcY11.5. Plasmid pUC4 K was cut with EcoRI and the resulting fragment was ligated to the EcoR1 site of pcY115. and formed plasmid pcYl16. Finally, plasmid pcY1.16 Cut with C1al and XmaI. E, coli DNA polymerase ■ (Flenow fragment) and dNTP’s, recircularize the plasmid and create a fusion A plasmid pCY117 containing M was formed.

Plasmid pcY117 was used to transform E. coli strain MC1061. Ta.

This transformation was performed as described in Example 1 above. transformed tapir The terriers were incubated with tritiated biotin as described in Example 1. and analyzed for derepression as described in Example 2. The results are shown in Figure 21. . As shown here, biotinylated fusion proteins were produced and derepression was observed. It was.

The gene encoding the yeast HIS3 protein was expressed in E. coli. (Due to the presence of a promoter and foreign sequences providing liposome binding functions).

Here it complements the E. coli hisB mutant. 5truhl and Davis, J., Mo1. Biol, , 136.309- 332 (1980). Complete HIS3 protein except for the last six amino acids The hybrid DNA sequence encoding the 1,3S subunit is E, co It was expressed in both S. li and S. cerevisiae and biotinylated. this The hybrid DNA sequence is fusion I7 shown in FIG.

Plasmid pcY106 containing the fusion material was produced as shown in FIG. Ma First, plasmid pWJ79 was cut with BamHI, and the resulting fragment was inserted into plasmid Y. It was ligated into the BamH1 site of Ep24 to form the plasmid pcytos.

Plasmid YEp24 is compatible with both E. coli and S. cerevisiae. It is a shuttle vector that can be replicated by This is Washington, Seattle Washington pR from ATCC. B5. Also available as deposit number 37051. Botstein et al.

, Gene, 8.17 (1979).

Plasmid pWJ79 was obtained from Yoko T, University of Washington, Seattle, Washington. Obtained from N. Davis. This is 5truhl and Davis (Struhl et al., J, M. o1. Biol, 136, 309-320 <1980)), pBR3 22 cloned into the BamHI site (T, N.

Davis, personal communication). Plasmid pBR322 is p harmacia LKB Biotechnology and New E obtained from ngland Biolabs and deposited no. 3134 from the ATCC. Obtained as 4. Old S3 DNA fragment pRB from ATCC], 4. Deposit number Obtained as 37063.

Next, plasmid pCY66 was cut with Kpnr and sphI, and the resulting fragment was Insert the fragment into the corresponding site of plasmid pcY105 to create a plasmid containing the fusion. pCY106 was produced.

Plasmid pcY106 is used to select for antibiotic resistance in E. coli strain DII5α. Depending on the selection, and in S. cerevisiae strain CTY186, uracil independent Maintained by choice. Strain CTY186 has chromosomal URA3 at the LYS locus. and I (contains the deletion of IS3 and the nonsense region. Strain CTY186 contains S, Emr, Cal 1fornia Institute of Technol Obtained from Ogy. Originally, Dr. B. Banka of the University of Illinois Manufactured by itts. 5HYI, which is essentially the same strain as CTY186, , available from the ATCC under deposit number 44769. Other substantially identical stocks are Y east Genetics 5tock Culture Center, U ntversity of California, Berkeley, Ca 1ifornia.

Transformation of yeast strains was performed by Ito et al., J. Bacteriolo. gy, 153.163-168 (1983). .

To label biotinylated proteins, yeast were treated with glucose (0.6%), Add 30 μg/ml lysine and 20 nM biotin (1 u Ci/ml). The cells were grown on minimal medium. Histidine-HCl 2.5μg/ml or 50μg /ml was added. At low histidine concentrations, derepression of HIS3 transcription occurs. Ta. 5truh1. Nature, 300.284-287 (1982).

Yeast cells were crushed in a French pressure cell, and insoluble impurities were removed by centrifugation. Removed. Proteins were recovered from the supernatant by trichloroacetic acid precipitation and acid washed. Remove and dissolve in SDS buffer (described in the examples) and add 12.5% polyacrylate. Electrophoresis was performed on a Lumid gel. The gel was fluorinated as described in Example 1. I put it on a loggraph.

E. coli strain DH5α containing pcY106 was labeled as described in Example 1. and subjected to electrophoresis.

Expected molecular weight (32 kDa) in both bacterial and yeast cells. A new biotinylated protein was discovered. See Figures 20 and 21. yeast cells Meanwhile, the synthesis of this 32 kDa biotinylated protein is similar to that of the normal old S3 protein. It was adjusted as follows. Under histidine-limiting conditions, synthesis is derepressed and derepressed. Under exclusion, the former S3 fusion protein becomes the major biotinylated protein in yeast cells. became. See Figure 20.

In Figure 20, column 1 is L coli strain DI containing fusion L (pCYl-06). Column 2 contains the complete HrS3 gene (p cY105) containing YEp24C derivatives by E. coli strain DH5a. Columns 3 and 4 contain S containing fusion L (pcYI06). , comprising a protein produced by S. cerevisiae strain CTY186; Column 5 is yeast strain CTYI86 containing the complete HIS3 plasmid (1) CYi05) Column 6 contains proteins produced by Bethesda Re5earc. h 14C-labeled molecular weight standards purchased from Laboratories (Oval Bumin-43kDa, carbonic anhydrase 29kDa, β-lactoglobulin bulin-18,4kDa). Columns 7 and 8 are long exposures of columns 1 and 2. It is a thing of time. In column 5, the labeled bands are sorted in order of increasing mobility. Chill-CoA carboxylase (205kDa), pyruvate carboxylase (130kDa) and Lim et al (Archives Biochem , and Biophys, 258, 259-64 (1987)) This is an unknown 44 kDa protein that was also observed. The bands in columns 2 and 8 are E. coli biotin carboxyl carrier protein (BCCP).

Bio operon derepression occurs because such a system is not known in yeast. Therefore, it was not tested in yeast. The bio operon inhibitor shown in Figure 21 The derepression results were analyzed for derepression as described in Example 2. This is about coli.

Example 7. Purification of biotinylated proteins “Monomer avidin” column with low affinity Sigma Chemical Co.

Purchased from. The guanidine treatment used to produce those materials partially and irreversibly denatures the biotin binding site, creating a larger biotin-binding site with higher affinity. change the moiety to a lower affinity site as described above. The remaining parts with high affinity are , blocked with biotin, and the bound biotinylated protein becomes 5henoy. et al., FAsEB J, 2.2505-11 (198g) A column is provided that is quantitatively eluted with a non-denaturing buffer containing biotin.

E. coli BMH71-18 was transformed with a vector containing fusion A or fusion B. The cells were transformed and cultured to express biotinylated proteins as in Example 1 above.

Destroy the cell extract with Fren (Hh pressure cell) Manufactured by. Intact cells and undissolved contaminants were removed by centrifugation. Up The clear solution was applied to a monomer avidin column, and the biotin was removed from the 5henoy column. Washed with buffer to remove unbound material. biotinylated protein was eluted from the column using a biotin-containing buffer from 5henoy et al. Ta.

The biotinylated fusion protein was transferred to the endogenous E. coli biotin carboxy carrier. -eluted together with protein (BCCP). BCCP is a biotinylated fusion protein. 5ephacryl S-100 (Pharmacia LKB B native molecules (purchased from Biotechnology) by gel filtration. Due to the large difference in the molecular weight of β-galactosidase (approximately 500,000 Daltons vs. BCCP44.000 daltons) were easily separated.

Example 8: Purification of biotinylated proteins pCY74 or β encoding fusion B -E, coli F containing vector pUR288 encoding galactosidase ’ll　recA 100ml culture solution was grown early exponentially in broth medium. phase and induced with ImM [PTG for 3 h, as described in Example 1. Recovered. F’11 recA also produces about 100-fold overproduction of biotin ligase. pBAll, a compatible plasmid that produces Barker and Ca. mpbell, 1. Mo1. Biol.

146, 469 (1981).

Harvest the cells and follow the instructions from Miller, Experiments in Molecule. ar Genetcs (ColdSpring Harbor Lab, N ew York, 1972) in Z buffer prepared as described in G. Destroyed. The obtained lysate was centrifuged at 48,000 x g for 1 hour, and the supernatant (containing approximately 2 mg of protein each) was transferred to Sepharose (Hendrickson n et al, , Anal, Biochem, , 94.366 (1 A column of monomeric avidin (prepared as described in 979) Therefore, 0 with an exchangeable biotin binding capacity of 35 nmol/ml Sepharose. , applied to a 5 ml column. Column contains Z buffer or 20mM biotin 2 buffer. Approximately 250 μl fractions were collected, and Miller, E. described in experiments in Molecular Genetics. were analyzed for β-galactosidase activity and for protein concentration as described above. (absorption at 280 nm of 20-fold dilution).

The results are shown in Figures 22A-C. Figure 22A shows a plasmid encoding fusion B. β- for the fraction number of the supernatant collected from cells containing pcY74 Figure 3 shows a graph of galactosidase activity and protein concentration. Figure 22C shows the skim Before applying the sample to the column, wash the column with Z buffer containing 20mM biotin. A graph similar to FIG. 22A is shown except that. Figure 22B shows β-gala. A cell containing pUR288 that produces tosidase but not the fusion protein. The elution profile of the supernatant collected from cells is shown. I want to understand more than this, fusion Proteins were retained on the column and subsequently eluted by the addition of 20mM biotin. It will be done.

The purified fusion protein eluted from the monomer avidin column was washed with 8% polyacrylate. Electrophoresis was performed on a Rylamide gel in the presence of SO3. The gel is Kumassi e Stained with Blue R.

E containing plasmid pcY100 and plasmid pCY74 or pUR288 , c.

1i F’ll recA was cultured and the protein was purified as in this example above. I got it. The resulting supernatant was applied to a monomer avidin column and the eluate was filtered as above. The sea urchins were subjected to electrophoresis on a polyacrylamide gel.

Plasmid pcY100 was transformed into BamHI-Sca! of pMBRlo. Man the fragment iatis et al.

Mo1ecular Cloning, A, Laboratory Manua l(Cold Spring Harbor Lab,.

pAcYc184 as described in New York (1982). BamHI-EcoRV fragment. Barker and Campbell.

J, Mo1. See Biol, 146.469 (1981). Plasmi Do pMBRIO was given to me by A, 0tsuka, and its manufacturing method is from Buoncri. strani and Otsuka, J. Biol, Chem.

263, 1013 (1988). Plasmid pAcYc184 is available from the ATCC under deposit number 37033.

The results of electrophoresis are shown in FIG. Columns 1-5 are on a 2.5 ml avidin column. , a total amount of approximately 20 mg extracted from cells containing pCY74 encoding fusion B. Contains material related to protein chromatography.

A sample of the original supernatant applied to the column was subjected to full electrophoresis.

A sample of unbound protein (flow-through) was electrophoresed in column 2 and 20 m A sample of the eluate obtained by eluting with biotin of M was electrophoresed in column 3. I put it on. In column 4, the sample was treated with monoclonal anti-β-galactosidase. (from Promega, Mad 1son, WE), then the Protein A - Same as in column 3 except absorbed with agarose and centrifuged. The same sample was subjected to electrophoresis. The obtained supernatant is the material placed on the gel. Met.

The blurred bands seen in the lower half of the column are unabsorbed immunoglobulin chains. be. Column 5 is Bethesda Research Laboratory Molecular weight standard (phosphorylase B-97 kDa, bovine serum Albumin-68kDa, Ovalbumin-43kDa, Carbonic Anhydra -29kDa, and β-lactoglobulin-18,4kDa).

Columns 6-10 code for fusion B on a 1.6 ml monomeric avidin column. Chromatography of approximately 5 mg of total protein extracted from cells containing pCY74 Contains material related to Original supernatant samples and unbound proteins were Each column 6 and 7 were subjected to electrophoresis.

A sample of the peak area of the 20mM biotin eluent was subjected to electrophoresis in column 8, and the Samples from the tilling region of the isolated peaks were subjected to electrophoresis in columns 9 and 10. Column 8 -10 minor bands are the most mobile, which is the protease-cleaved form of BCCP. All bands other than the large band were absorbed with anti-β-galactosidase (data not shown). It was removed by Fall, Meth, Enzymology, See 62.390 (1979).

As mentioned above, some host cells contain pCY74 and two birA (biotinylated) ligase overproduction) plasmid. Electrophoresed in columns 1-5 The strain used to produce the material overproduces the birA protein by more than 100 times. The material containing the producing plasmid pcY100 and subjected to electrophoresis in column 6-IO The strain used to produce pB overproduced gauze activity by approximately 10 times It contained All.

As shown in Figure 23, the eluate with biotin has a single band (column 3). This band was produced by monoclonal anti-β-galactosidase (column 4). After treatment, it disappears, indicating that the band contains the biotinylated fusion protein. Indicates that there was By comparing column 3 and columns 8-10, it is determined that the host cell is pcY. loo, the produced biotinylated fusion protein compared to pBAll. It can be seen that the quantity of quality increases substantially.

Tomato c DNA biotin protein sequence shown in Figure 2 Klebsiell a pneumoniae alpha subunit of oxalacetate decarboxylase β-galactosidase linked to the DNA encoding NIT in the correct reading frame A hybrid DNA sequence was produced containing DNA encoding a fragment of. these Each of the two former DNA sequences encodes a polypeptide containing a biotinylation site. do. Are the two DNA sequences the fusion protein? Assemble the tosidase fragment. It has a biotin acceptor sequence at the carboxy terminus and a biotin acceptor sequence at the carboxy terminus. fused so that it is coded.

Suitable vectors encoding these hybrid DNA sequences are described below. Manufactured. The vector was used for the transformation of various strains of E. coli. The strains and methods used are described in Example 1. ). As described in Example 1, When cultured under conditions that allow expression in the presence of thiated biotin, biotinylated A fusion protein was produced. Furthermore, the inhibition of the bio operon was released in Example 1. When tested in the same way, a release of inhibition was observed.

A, hive encoding β-galactosidase and biotinylated tomato protein Production of vector containing lid DNAc encoding biotin tomato protein Leave the DNA segment.

Ne1l Hoffman, Department of Biology, University of Penn5ylvania, Ph1ladel fhia, Pa, as an unnamed plasmid. The plasmid is Hof fman et al, Nucleic Ac1d Res, 15. 3 Original Lambda Sharon 16 Fage 5stl cutter described in 928 (1987) induced by cutting. The phage was described by Alexander et al. Isolated from the tomato c DNA bank described in , Dan, 79-89 (1984) did.

The plasmid obtained from Kano and Hoffman was cut with 5stI and 5alI. pUR278 (1acZ gene ) to produce plasmid pKR2 encoding fusion N. Melt Compound N is the N-terminus of β-galactosidase fused to the tomato sequence shown in Figure 2. Contains DNA encoding the terminal 651 amino acids. The fusion junction is between the 1acZ sequence and At IacZ residue 651 with PPPPPPPGTV between the tomato sequences in Figure 2. be. Plasmid pUR278 was obtained from Professor Muller-Hil l, Universitat Zu Kgln, 5000 k? jln 41. Obtained from FRG. Its manufacturing method and properties are described by Ruther and Muller- Hill, The EMBO Journal, 2.1791-94 (1983 )It is described in.

B. Production of β-galactosidase and oxalacetate decarboxylase Plasmid pSC3 was obtained from Dr. E. Schwarz, 1 Jax-Planck. In5titut fur Bi.

Obtained from CheIIIie, Martinsreid, West Germany Ta. Its manufacturing method is: Lausse de pSC3 is Klebsiella pne Some of the γ, α and β of S. umoniae oxalacetate decarboxylase Code subunits. Laussermair et al, and Schw arz et al. together disclose the DNA sequences of the α, γ and β genes.

Plasmid pSC3 was cut with 5alI, and the resulting α subunit encoding fragment was 3, 2, the fragment b was ligated to I) H3G398 cut at Sa, 11 to create p KR5 was formed. Then, the sequence encoding the α subunit was further added to pKR. Digestion of 5 with SalI and BamHI and the resulting 1.7 Kb fragment, pKR was subcloned by ligation into pMTL21 cut with the same enzyme. I got 1. Next, plasmid pKR11 was cut with Pstr and Bs5HII. The resulting fragment was ligated to pMTL20 cut with Pstl and MluI, pKR28 was obtained. Finally, plasmid pKR28 was cut with AatLr and Aa It was ligated to pUR278 cut with tlI to obtain pKR30 containing fusion 0.

Fusion O is Klebsjella pneumoniae oxalacetate DNA encoding 100 residues of the α subunit of decarboxylase and β- Contains DNA encoding the N-terminal 210 residues of galactosidase.

DVSQLTAAAP shows the amino acid sequence of 100 residues of α subunit as shown below. Ａ　PA　PAPAPA　SA　PAA　A　APAGAGTPVTA　PL　 AGF　I　WKVLAS　EGQTVAAGEVLL　hL　EAMKMET EIR, AAQAGTvRGIAVKAGDAVAVGDTLMTLA.

Plasmid pH3G398 was obtained from Japan Cancer Research Resource Bank, Tokyo. It was. Also, Takeshita et al, Gene 61.63 (19 See 87).

Plasmids pMTL20 and pMTL21 were prepared by Dr. S. P. Chambers. , PHLC Center for Appl ied Mi crobiolog Obtained from y, 5alisbury, Wi 1tshire, England Ta. Their manufacturing methods are Chambers, Pr1or, Barstow and Minton, Gene, 68139-149 (1988).

E. The DNA sequence encoding coliBccP was prepared by 5utton et al. , j, Biol, chem, , 252.3934-3940 (1977) Synthetic oligonucleotide corresponding to residues 17=82 of the reported amino acid sequence of BCCP Screening clone banks using probes containing leotide sequences Obtained by. The clone bank is Yanisch-Perron et al. , Gene, 33.103-119 (1985). E, co inserted between the old ndIII and Pst1 sites of M13mpil It consists of a 1.6 Kb old ndIIr-Psti fragment of the li chromosome. This clone The bank is Kano, John E, Cronan jr, University o Also obtained from f l1linois, Champaign, II linois It will be done. A HindIII site is located within the coding sequence of BCCP. isolation The DNA sequence of the clone was as reported in Sυtton et al. exactly 5 uttons, except that residue 39 is D instead of N. al, provided the decoded amino acid sequence aligned with the sequence.

The double-stranded, replicable version of BCCPCC-in was cleaved with HindIII and PstI. The BCCP-encoding fragment was then cut with the same enzyme. It was ligated to pTZ18U (containing the ampicillin resistance gene).

The obtained plasmid, pLS1, was digested with HindIII, and HindITI ligated to the fragment released from digested pCY82. This old ndllll fragment is Encodes ramphenicol acetyltransferase (CAT).

The resulting mixture was used for transformation of E. coli, and ampicillin and chlora Transformants resistant to both mufenicol were selected. BCCP, BCCP and One of these recombinant plasmids with the CAT gene fused in the same orientation was , Ncol and religated to form pLS2. The effect of this process is , a part of the C-terminus of the CAT gene and a part of the N-terminus of the BCCP gene were removed. The goal is to form a new fusion bond between them. Obtained recombinant plasmid pLS2 is the N-terminus of the CAT gene fused to the C-terminal 93 amino acids of BCCP. It encodes a fusion protein consisting of 1273 amino acids (Fusion P). B.C.C.P. The array is that given in Figure 2 and between the CAT array and the BCCP array of Figure 2. , an additional CCP sequence: EAPAAAGISG [(rVR, sPMVGT There is. Mata, the resulting letter sequence is replaced with N in BCCP residue 39 as above. , D.

Plasmid p'rz 18Ll is available from Pharmacia LKB Biotec Obtained from hnology. Also, Mead et al, , Prot, See Engineer, 1.67 (1986). CAT gene of pCY82 is that of transposon Tn9, and is commercially available, for example, from Pharma ia LKB Biotecbnology, Piscataway, Nevv Jersey, C1antech Laboratories, Pa1o A From Ito, CA, Stratagene, Ding nc LA Jolla, CA It is a common component of the resulting cloning vector. In addition, plasmid pCY8 2 is Dr. John E. Cronan, Jr., University o f　l1linois.

Champaign, l1linois.

Plasmid pLs2 was used for the transformation of various strains of B. coli. The strains and methods used are described in Example 1. ). As described in Example 1, I. When cultured under conditions that allow expression in the presence of lithiated biotin, biotin fusion protein was produced. Furthermore, in Example 1, the inhibition of the bio operon was released. When tested as follows, a release of inhibition was observed.

Example II: D encoding a fusion protein with a site for riboic acid addition Production and expression of NA sequences ■E, coli aceF gene encoding one or more glue boil addition sites fragment and all but the first 8 amino acids of the β-galactosidase structural gene. A hybrid DNA sequence containing DNA encoding amino acids was produced. two DNA sequence with a lipoyl acceptor sequence at the amino terminus and a lipoyl acceptor sequence at the carboxyl terminus. fused so that a fusion protein having a β-galactosidase sequence is encoded. Ta.

A. Production of a vector containing aceF gene and IacZ structural gene fragments E. ac encoding the E2p subunit of E.coli pyruvate dehydrogenase The eF gene was cloned and its sequence determined. 5tephens, Dar lison, Lewis and Guest, Eur, J, Bioc hem, 133.481-489 (1983) ■B As discussed in the background section, this amino acid sequence corresponds to the N-terminus of the E2p polypeptide chain. Three homogeneous segments consisting of approximately 100 amino acid residues that repeat vertically on one half of the edge. The points are shown and each repetition forms a region containing the boiling site. E2p port The repeat segments of the polypeptide chain and the a and ceF genes were each 1 ipl to 1 ip3, and 1it) I-1ip3.

aceF gene can be used to form fusions to β-galactosidase Contains several naturally occurring restriction sites. 1 or 2 domains (see Figure 24) ) can be used to generate in-frame deletions equivalent to There are three Bcl, one site in position.

The starting material for constructing such a fusion is Guest, I, ewis, Graham, Packman and Perham, J.M.O.L. Biol, 185.743-754 (1985). The plasmid pGs 101 containing the 3' end of the aceF gene is produced. . This plasmid was produced by Chefyield 5IOZTN, UK. I got it from Professor J. Guest of the University's Department of Microbiology.

Plasmid pGs101 contains the aceEF coding region in the tet promoter of the vector. is transcribed from a transcription factor, but has its own transcription initiation region.

The danL coding region of pGs101 was purified from 1,2K from pcs101. The bC region/5 phr fragment was ligated into the C1al and Sph r sites of pMTL23. By producing pKRl,2 (see Figure 25), a subclonal was added to pMTL23. It has been turned into a This step places the DanL coding region adjacent to the IacZ promoter. positioning and excluding all but 10 codons of the upstream aceE coding region. It is something to remove.

Plasmid pMTL23 is Kano, S, P, Chambers, PHLCCent refor Applied Microbiology, Sal 1sbu ry, iVi 1tshire, and England. Its manufacturing method is , Chambers, Pr1or, Barstow and Minton , Gene, 68139, No. 49 (1988).

Plasmid containing all three glue-boiled regions 1) KR12 contains three glue-boiled regions Provides starting material for additional constructs containing a subset of regions. first 8 ami All β-galactosidase-encoding DNA sequences except for the active enzyme Insert the containing cassette into the frame at the 3' end of each L-code segment of the various constructs. did. Methods for making these additional hybrid DNA sequences are shown below.

1. Production of fusion product Q Fusion Q contains all β-galactin amino acids in the correct reading frame except for the first 8 amine terminal amino acids. It encodes all three lip regions of E2p bound to the DNA encoding tosidase. This is a hybrid DNA sequence containing DNA that encodes. (Figure 24).

Plasmid pKRI4 containing fusion Q was produced as shown in FIG. plastic pMc1871 was digested with Pstl, and the resulting 3Kb fragment was used as pKR. 12 (prepared above) into the PsLr site. Plasmid pMC1871 1a does not contain the promoter regulatory region, operator, and translation initiation region. Contains cZ cartridge. Ca5adaban, Mart 1nez-Ari as, 5hapira and Chou, Methods Enz,, 1 00, 293-308 (1983). Plasmid pMc1871 is Pha rmacia LKB Biotechnology, Piscataway, Obtained from New Jersey.

2. Production of fusion product R Fusion R contains all β-terminal amino acids in the correct reading frame except for the first eight amino terminal amino acids. The first two glue boils of E2p bound to the DNA encoding galactosidase Code the regions (ltpl and l1p2) and the third glue boil region (lip3) It is a hybrid DNA sequence containing DNA that

(Figure 24).

The pKRIO containing fusion R was produced as shown in FIG. Danshot Plasmids pKR1 and 2 containing , Dan, and [ were cut in the Hind River and religated. did. This removes the 450 bp fragment from pKRl2 and KR7 (see Figures 24 and 26) was manufactured. Plasmid pMc1871, Cut with PstI and insert the resulting 3Kb fragment into the PstI site of pKR7. pKRlo was produced.

3. Production of fusion products S and T Fusions S and T contain all but the first 8 amino terminal amino acids in the correct reading frame. Hybrid 1 of B2p bound to DNA encoding β-galactosidase of Contains DNA encoding the ip region. Fusion S is a hybrid 1ipl-2 region It contains DNA encoding two 1ip regions consisting of and 1ip3. l　ip2 The DNA encoding the region is in the correct reading frame and contains the carboxyl-terminal region of 1ip2. Fuse the DNA encoding the amino-terminal region of 1ipl with the DNA encoding It was formed by this. See Figure 24.

Fusion T consists of two 1ips consisting of 1ipl and a hybrid 1ip2-3 region. Contains DNA encoding the region. The DNA encoding the 1ip2-3 region is In an open reading frame, the DNA encoding the amino-terminal region of lip2 was inserted into the calculus of ip3. It was formed by fusing to DNA encoding the boxyl terminal region. Figure 24 reference.

Plasmid pKR23 containing fusion S and plasmid pKR22 containing fusion T was manufactured as shown in FIG. First, plasmid pKR12 was transformed into Ba1l It was partially cut off. Belit (i.e., the Bcl1 site above) to Be11 -2 or from Bcll-2 to BclI-3 (Guest et al. a, 1. .

J, Mo1. Biol, 185.743-54 (1985) and 2nd The resulting 3,4 Kb fragment representing pK Rl6 and pKR17 were produced. The obtained product was cut with AccI. They were distinguished from each other. This suggests that there is an Accr site between Bcll-2 and Be11-3. However, this is because there is no difference between Be1l-1 and Bclr-2. Then plus Mid pMc1871 was cut with PstI, and the resulting 3 Kb fragment was used as pKRl6 and inserted into the Pst1 site of pKRI7 to create pKR22 and pKR23, respectively. Built.

4. Production of fusion product U Fusion U is in the correct reading frame except for the first 87 amino terminal amino acids (all β- Hybrid 1ipl of E2p fused to DNA encoding galactosidase Contains DNA encoding the -3 region. The DNA encoding the 1ipl-3 region is In the correct reading frame, insert the DNA encoding the amino-terminal region of 1ipl into the l1p3 library. It was formed by fusing to DNA encoding the loboxyl terminal region. 24th See diagram.

Plasmid pKR21 containing fusion U was produced as shown in FIG. first Plasmid pKR], 2 was cut completely with P'stI and then religated to create a plasmid. A lasmid pKR1,8 was formed. Thereafter, plasmid pMcI871 was transformed into Pst The resulting 3Kb fragment was inserted into the PstI site of pKRl8. to form pKR21.

5. Production of fusion product R' Fusion R' contains all β in the correct reading frame except the first 87 amino terminal amino acids. - The first two molecules of E2p bound to the DNA encoding galactosidase is a hybrid DNA sequence containing DNA encoding the first region and a third part. . See Figure 24. The coding sequence of fusion R' is identical to that of fusion R. The difference is , a translational control region adjacent to the coding sequence of fusion R' increases expression of fusion R. This is what is being changed in an attempt to improve the situation.

In the native aceEF operon, the translation termination site of aceE is ace Approximately 5 codons upstream of the F translation start site. Plasmid pKRIO, pK In Rl, 4, pKR21, pKR22 and pKR23, small hybrids peptides are large fusion proteins with sites for post-translational reboiling. is formed in addition to. This small peptide was added to the pMTL23 vector plasmid. The first 14 codons of the α-peptide of β-galactosidase encoded by It is formed as a result of translation of the first three codons from the cloned insert. this The peptide terminates 13 codons before the aceF translation start site.

Plasmid pKR24 containing fusion R' was produced as shown in FIG. Ma First, plasmid pKR10 was cut with χhol and Nrul. Complete sticky end Incubation with dNTPs and DNA polymerase T (Klenow fragment) tion and religated the plasmid. This method allows you to +2 frameshift within the α-peptide of β-galactosidase in the lasmid was formed. This frameshift shifts the first 14 codons of the α-peptide to placed in frame with the last 10 codons of aceE. This is the translation of the fusion R゛ The start site is located 5 codons downstream of the translation termination site of the small hybrid peptide. Attach. This is a translation seen in the binding between the natural operons aceE and aceF. It is the same as the translation regulatory region. By this operation, the β-gain of the fusion R' is compared to the fusion R. Lactosidase activity increased 5-fold.

B. Transformation of host and expression and detection of reboiled proteins 1. Transformation Several E. co II strains were incubated with a vector containing the fusion Q produced as described above. transformed with vector. The strains used were Dl (5α, CY487 and CY56 It is 5. Transformation was performed as described in Example 1.

The DH5α strain was described in Example 1. CY487 strain, Ju103 strain, GM2 Using PI vir grown with 199 strains, Marinus, Carrway , Frey, Brownand Arraj, Mo1. Gen, Genet ics, 192, 288-289 (1983). It was produced by making it chloramphenicol resistant. CY487 stock is a It has a dcm phenotype that allows the lasmid to be cleaved with Ba1l.

The CY565 strain is F' IaclQL8 proAB! Bisome's NK5830 Obtained by curing the stock.

JM103, GM2199 and NK5836 strains are Co11 Genetic 5tock Center, YaIe University, New H aven, obtained from CT.

2.35S Lipoic acid synthesis 353-Lipoic acid is described by Elliott, 5teele and Johnson, Tetrahedron LETTER 3, 2 ribs 3535-38 (1983) were synthesized as described for the non-radioactive compounds. Published synthesis vice The product (6S)-isopropyl-6,8-dihydroxyoctanoate Di(tert-butyldimethylsilyl) derivatives are described by W, S, Johnson, Dep. art of Chemistry.

5tanford Unjversjty, 5tanford, obtained from CA Ta. The tert-butyldimethylsilyl part was replaced with Dowex 50X-8 ion exchange resin. (H+ type), Corey, P.

der and Uhrich, Tetrahedron Letters 21.137-140 (1980). was removed to produce isopropyl-6,8-dihydroxyoctanoate. . The remainder of the synthesis involves replacing some of the non-radioactive sulfur with 31+3 elemental sulfur (Amersham Cop, ArliArlln Heights, IL) , Elliott et al., supra. final generation The experiment was carried out using E. coli JRG26 strain, Herbert and Gues t, Methods in Enzymology, 18.269-272 ( 0.8C when quantified by bioassay, as described in (1970). It has a specific activity of i/mmol. E, coli JRG26 (W14851ip -2) is Co11 Genetic 5tock Center, Obtained from Yale University, New Haven, CT.

3. Analysis of radiolabeled reboiled proteins plasmids pKR10, pKR14, E, col transformed with pKR21, pKR22, pKR23 and pKR24. DH5α, CY487 and CY565 strains of i were cultured with 3113 lipoic acid and fused. The combined protein was labeled. Bacteria were incubated with 0.4% glycerol at 37°C. lμg/ml thiamin, 1mM cysteine, 0.4% vitamin free case Select in hydrolyzate, 8Kg of 35S lipoic acid and plasmid maintenance Culture up to 1-2XIO' cells/vnl in minimal medium E containing appropriate antibiotics. did.

- After overnight incubation, the O,1K[+ culture solution containing 12XIO' cells was mixed with 1mM in a test tube containing 1.0 mM of the same medium supplemented with isopropylthiogalactoside. I put it in. Cells were cultured for 2-3 hours to obtain expression of the fusion protein. collect the cells , 0.1M Tris-HCI containing 8M urea and 1% SDS, pH The bacteria were lysed in a solution of 7.5. Cell extracts were collected in discontinuous mode in the presence of SDS. Separated on a 7.5% polyacrylamide gel. Bnlighteni gel ng (New England) Purchased from Nuclear, Boston, MA Fluorographed by immersion in pre-graphed film It was used for exposure.

Figure 30 is like the above! Typical fluorocarbons obtained using the 58-labeling method Show the graph. Column I contains no fusion protein, Column 2 contains cells containing fusion R. Column 3 contains extracts from cells containing fusion R′, Column 4 contains extracts from cells containing fusion R′; contains extracts from cells carrying fusion Q and column 5 contains extracts from cells carrying fusion S. Column 6 contains extracts from cells containing fusion T, column 7 contains extracts from cells containing fusion T, and column 7 contains extracts from cells containing fusion T. Contains extracts from cells containing compound U.

In all columns of Figure 30, the bands are 30kDa, 56kDa and 80kDa. It was discovered in Da. The 56 kDa and 80 kDa bands are pyruvate dehyde, respectively. Dihydrolipolyte of drogenase and α-ketoglutarate dehydrogenase It was positively identified as lance acetylase subunit (B2). 30kDa The band was identified as a ribolated protein involved in the glycine cleavage system. It was done.

The faint band appearing at approximately 150 kDa in all columns except column 1 is due to reboiled fusion. represents a synthetic protein. The fusion R' is darker than the fusion R, and compared to the fusion R, the fusion It shows that the expression of compound R" is increased (comparison of column 2 and column 3) A more effective labeling of fusion proteins is to include the fusion in a glycine cleavage system. Deletion of genes encoding aceF, 5ucB and reboiled proteins This is expected when placed in a microorganism. Bacteria containing such deletions are treated with acetate and By adding succinate and succinate, the presence or absence of the fusion product introduced into the bacterium is It is possible to make it so that only fluorinated proteins are present.

In FIG. 31, column 1 shows the lipoate auxotrophs (lipoate auxotrophs). Column 2 contains an extract of E. coli JRG26 strain, which is Contains an extract of TD3KOI with a deletion spanning cB; and column 3 contains an extract of ace Contains an extract of E. coli CY265 with a deletion spanning F. gene ac eF and 5ucB are pyruvate dehydrogenase and α-ketoglutarate, respectively. Encodes the B2 subunit of todehydrogenase.

CY265 strain is Co11 Genetic 5tock Center, Ya le University, New Haven, Connecticut? The TDaKO1 strain was obtained from Dr. JOHN GUEST, Dept., M. icrobiologLυn1versity of 5heffield, 5 Obtained from Heffield 5IOZTN, England. All bacteria are on top Cultured as described above, but with appropriate additions.

As shown in Figure 31, the CY265 strain does not produce E2P, and 01 is B at TD3. Does not produce 2°. Without the production of these proteins, such bacteria It would be possible to obtain larger quantities of conjugated proteins using cormorant.

Example 12: Purification of reboiled protein para-aminophenylarsine oxa ID (PA, PAO), Aldrich Chemical Co, Milw Purchased from aukee Wl. PAPAO-Sepharose, Hannest ad, Lundgvist and 5orbo, Anal, Bioch en+, 326.200-204 (198Q) Manufactured as described. PAPAO Sepharose is manufactured by Hannest ad etc., 1,2-dithiol (e.g. 2,3-dimercapto-■-propanol) tools (DMP)) and 1,3-dithiols (e.g. dihydrolipoic acid (DHLA) )), monothiols (e.g. cysteine) and 1,4-dithiols (e.g. For example, it has a higher affinity for dithiothreitol (DTT) than for dithiothreitol (DTT). It is shown.

The E. coli CY565 strain (described in Example 11) contains the pK Rlo was transformed with riboyl protein as described in Example 11. cultured to express it. Grind the cell extract using a French pressure cell. It was manufactured by Intact cells and cell contaminants were removed by centrifugation. .

The supernatant fraction was washed with 50 μM DTT in 1 m sodium phosphate.

It was reduced at pH 7.0. The reduced supernatant fraction was treated with PAPAO Sepha 0- The mixture was subjected to a strain ram and allowed to absorb for 1 hour at 4°C. After that, the column was adjusted to approximately 20 column volumes. 0.1 MIJ sodium phosphate containing O, OIM cysteine and 0.5 M NaCl. Washed with lium buffer, p)Is, 5. Cystine has all weak (combined) The monothiols or dithiols were removed from the column.

The reboiled protein was dissolved in O.IM sodium phosphate buffer, pH 8.0. 50 μM of DTT, DHLA, 2,3-dimercapto-2-propertool (DMP) or 2,3-dimercapto-2-propanesulfonic acid (DMPSOz ) was used to elute from the column. Lipoic acid using sodium borohydride, D) ILA by reduction as described in Hannestad et al. Manufactured.

DMP, lipoic acid and DMPSO, are from Aldrich Chemical Co. ,, purchased from Milwaukee JI. Sepharose 6B, cysteine and DTT is from Sigma Chemical Co., St. Louis, MO. Obtained from

7.5% polyacrylamide gel to remove boiled proteins eluted from the column. Top, subjected to electrophoresis in the presence of SO3. Figure 32 shows Fast 5tain ( Zoion (purchased from Re5earch Inc., Al5ton, MA). 5D of colored, eluted or boiled proteins from PAPAO-Sepharose S-polyacrylamide gel is shown. In Figure 32, column 1 shows the staining of IacZ. A sample eluted from a column loaded with an extract of a prototrophic strain containing chromosomal copies. Column 2-4 is an extract of the CY565 strain containing the fusion R (pKRlO). Contains the eluate from the column containing the output material. Column 2 is the protein eluted with DTT. Column 3 contains proteins eluted with DHLA, Column 4 contains DMPSO, Contains proteins eluted at In all columns, 56kDa and 82kDa The bands that appear are E2o and E2p, respectively. The 116kDa band in column l is , the native β-galactosidase. Appears at 155kDa in columns 3 and 4. The band shown is the fusion protein produced by fusion R.

Elution of the fusion protein from the column is monitored by β-galactosidase activity. (analysis described in Example 8). The results are shown in Table 11. Table 11 data As shown by the data, DMPSOs are the best eluents tested.

Table 11: Fusion B from PAPAO-Sepharose with various dithiols elution Dithiol Eluted fusion protein (%) DHLA 50 DMP 55 DMP30. 98 Example 13: Fragment of secreted β-lactamase of biotinylated fusion protein E. coli BCCP linked in the correct reading frame to the DNA encoding A hybrid DNA sequence containing DNA encoding the fragment was produced. BCCP The DNA sequence encodes a polypeptide with a biotinylation site and a pre-β-label. The lactamase DNA has a signal sequence that provides for secretion of β-lactamase. encodes a polypeptide. The two DNA sequences are such that the fusion protein has a camino-terminal with a pre-β-lactamase at the end and a BCCP fragment at the carboxyl terminus. was fused to be coded as

Plasmids pLs1 and pMTI, 21 were cut with PstI and NcoI and linked. As a result, pCYT8D was produced as shown in FIG. Plasmid pt, st The production of plasmid pMTL21 is described in Example 10, and the plasmid pMTL21 is described in Example 9. obtained from Dr. S. P. Chambers.

Plasmid pcY151 was converted into KpnI-PstI segment of plasmid pCYT8D. A synthetic protein encoding the C-terminal 23 amino acids of E. coli BCCP It was produced by substituting a segment of NA. This operation Due to the degeneracy of the code, there is an unknown 1.3 Kbp located downstream of the BCCP coding sequence. The sequence DNA was removed and two new 6-base restriction sites were added to the BCCP gene (Cfr lol and BcoRI), the translation stop codon and immediately downstream of the stop codon. was introduced with a Be11 site spanning the Sal1 site.

The synthetic NA fragment was injected into four synthetic oligonucleotides of 41, 33, 37, and 45 bases. From Otide (oligos A-D, respectively), Cronan, Naras imha n, and Rawl ings, Gene, 70.161-169 (19 The samples were near-assembled as described in 88). The four oligonucleotides are below. It has the following sequence.

(A) CGTTAAAGCTATCCTTGTTGTTGAATCTGGTC AGCCGGTTGAAT(B)TCGACGAACCGCTTGTTGTT ATCGAATGATCAG(C)CATGGCAATTTCGATAGGAA CAACTTAGACCAGTCGG(D) CCAACTTAAGCTGCT TGGCGAACAACAATAGCTTACTAGTCAGCTBCCP See Figure 2 for the amino acid sequence. The assembled synthetic NA is transferred to Kpnl. BCCP, giving a 3° overhanging single-stranded end and a 5ail 5' overhanging end. The Kpnl terminus was designed to be within the coding sequence.

As shown in Figure 34, the assembled synthetic NA is Kpn I and Sal, I. It was ligated to the cut plasmid pCY37. The obtained transformants were subjected to the expected regulation. We screened for plasmiods containing restriction sites. One of these is pC YS54, and was shown to contain the predicted sequence by DNA sequence analysis.

Plasmid pCY37 is the 34th Kanl gene of pCY5 in pTZ18R. Constructed by inserting as shown in the figure. Plasmid pCY5 is used in Example It was manufactured as described in 3. Plasmid pTZ178R was purchased from Pharmaci aLKB Biotechnology, Piscataway, N,, J, ka I got it from

Plasmid pcY151 was created by deleting pCYT8D with Hindll and KpnI. It was produced by digesting pcys54 with Kpnr and 5ail. child These digests were combined and diluted with pH5G395 digested with HindnI and 5alI. pcY151 was obtained as shown in FIG. Therefore, plasmid pc YI51 is derived from the Nco I-Kpn T segment of the natural BCCP gene and the synthetic BCCP gene fragment consisting of Kpn I-Sa l l segment from RiNA including. Plasmid pH3G395 was obtained from Japan Cancer Research Resource Bank, Tokyo. Obtained from.

To fuse the β-lactamase sequence to the BCCP sequence, pKT254Ω-mer The enzyme gene was cut with HindIrr and ligated to the old ndTII cut pcY151. , pcY158 was obtained (see Figure 34). Then, plasmid pcY158 was Cleavage with Pstl and recircularization by ligation yielded pcYI59. plasmid p cyt59 binds β-lactamase to the C-terminal 87 amino acids of BCCP. It encodes a fusion protein in which the N-terminal 182 amino acids are fused. pMTL2 The three amino acids (L, G, T) encoded by one polylinker sequence are: It is present at the junction of two polypeptides.

The β-lactamase gene used is obtained from ATCC, deposit number 31344. Note that it is the same as found in pBR322. plus MidopKT254Ω-Ap, Kano, J., Frey, In5titude of Veterinary Bacteriology, CH3012, Switzerland Obtained from

Plasmid pcY159, Dr. K. 5trauch and Professo rJ, Beckwith, Department of Microbi four obtained from Harvard Medical 5chool Different E. coli K-12 strains were transformed. Two of these strains (KS4 74 and KS476) abundant proteas normally present in the haberi plasmic space. ze (DegP). Two (KS303 and KS474) are the main external Lacks membrane lipoproteins. Such a 1pp- strain has an altered outer membrane. , which allows periplasmic proteins to escape to the extracellular environment (Suzuki, Nishimura, Yasuda, NishN15hi, Yama da, and Hirota.

Molecular and General Genetics, 167. 1-9.

The strains used and related genotypes are shown below: Strain Genotype pcY159 Names of derivatives containing KS272 Wild type CY742 KS303 1pp-5508CY743KS474 degP41 CY74 4KS476 1pp-5508, degP41 CY745 strain KS272.　 KS303 and KS474 are 5trauch, Johnson, Beck with, J, Bac from KS474 and KS303, K, 5tra Constructed by uch.

Strains CY742-745 were grown as described in Example 1 and treated with 3H-biotin. labeled with. Centrifuge the cells (2,000 x g, 10 minutes). Collect pellets from 1. Wash with omM Tris-HCl, pH 8.0, S Prepared for DS polyacrylamide electrophoresis. Culture top from centrifugation step To maintain clarity, all proteins present are precipitated with trichloroacetic acid. were collected and analyzed by gel electrophoresis.

Gel electrophoresis results show that cultures from degP+ strains (KS272 and KS303) The supernatant contains molecules ff expected for β-lactamase BCCP fusion protein. 1 (approximately 30,000) of biotinylated proteins.

Instead, about 1.4. , 000 Da biotin-labeled protein was observed. anti In contrast, depP- strains lacking DegP protease (KS4.74 and KS47 Both supernatants from 6) contained biotinylated proteins of the expected size of the fusion protein. It contained protein.

These data show that the β-lactamase BCCP fusion It is clear that it is a substrate for In cells containing DegP protease, The fusion protein is cleaved near the fusion junction and enters cells lacking DegP protease. No cleavage products were observed. DegP protease is present in the veriplasm. and in the absence of this protease, the fusion protein present in the cytoplasm Inability to stabilize protein quality (Strauch and Beckwi) th, Proc, Natl, Acad, Sci, USA, 85°1 576-1580 (1988)). Therefore, the β-lactamase BCCP fusion is , E, c.

1i is secreted through the inner membrane into the periplasm where DegP protease resides. I know what I have to do. In line with this interpretation, the 1pp-degP- strain The culture supernatant of 476 contained a significant amount of biotinylated fusion protein and lp The fusion protein was found in the culture supernatant of p+ strain (KS272. KS474). I couldn't. Therefore, as expected from the nature of the lpp mutation, the biotinylated fusion Synthetic proteins flowed into the culture medium from strain KS476. Total Bi of KS476 stock Approximately half of the otinylated fusion protein is found in the medium, with the remainder bound to cells. Ta. In addition, a biotinylated protein of 30.000 Da was added to the cell periphery of strain KS303. Some of this protein was found in the medium, although it was not found at all in the lettuce. (approximately 20% of the amount found in KS476 medium). Therefore, in the 1pp- strain , part of the fusion protein flows from the periplasm into the medium, resulting in DegP protein You can clearly escape Tease. degP protease was recently purified. The protein was found to be an endoprotease. FIG.9 FIG. 10 Q FIG. 17 F I G, 26 III+total-1to+t+dAes&1sepNaPCT/LISQO102F ISFlC1atmgL-1'>aru+Jrawnrr>ON:Sqncod lngfusi++nprn “@insigl(1+pnsr-rr;vn!1 1. ntnnal *+udifi+:ation ++1res, C1ap s[tu+I 1nC3ass J35. p) Yuclasp+ 6’1.7゜ rl+m +nvo11Fisnr'Jrt)+111I and ri rnup TT arra 1ndpppr++Ja+r |5nd rlirrllll! Ill　l＋f! eal1MI! ! 1.111' pr C1tL'1llfl　+lf　lJr'(lllp　HIF(lLlld　t he prepsredsynth-1ieally, =l+ix+=bwo uld　uuj　require　jhe　DNA of grup　X.

7) +ei ha ventj? +or+(++rr+upIHipindependent e+u(1E9r(ILlplJlsrulITIn rhlr itean bu 1131!11 11++ 1uir14% [North 1+qr prsr einn jban tl + nitrogen ■■ Pnrtzupd fc-r jjt group 1 or claimetl jn Buup 11゜

Claims (33)

[Claims] (1) A hybrid DNA sequence encoding a fusion protein; a first DNA sequence encoding an amino acid sequence that enables post-translational modification of the protein; as well as end or the end of the first DNA sequence, are in the same reading frame, and are selected the above hybrid comprising a second DNA sequence encoding a protein or polypeptide; DNA sequence. (2) further comprising a third DNA sequence encoding a cleavage site; Located between the first DNA sequence and the second DNA sequence, all three DNA sequences , in the same reading frame. (3) The first DNA sequence is an amino acid that enables post-translational biotinylation of the fusion protein. A hybrid DNA sequence according to claim 1 encoding a amino acid sequence. (4) The first DNA sequence is Propjonibacterium Sherm. 1.3S subunit of anii transcarboxylase, tomato biotinta protein, Klebsiella pneumoniae oxalacetate α-subunit of carboxylase Escherichia coli bioti Post-translational biotinylation of carboxyl carrier proteins or fusion proteins The protein according to claim 3 encoding fragments of these proteins that enable Hybrid DNA sequence. (5) The first DNA sequence is Propionibaoterium Sherm. The carboxy-terminal of the 1.3S subunit of Anii transcarboxylase The compound according to claim 1 which encodes the last 75 amino acids or analogs thereof. Brid DNA sequence. (6) The first DNA sequence is an amino acid that enables post-translational lipoylation of the fusion protein. A hybrid DNA sequence according to claim 1 encoding a amino acid sequence. (7) The first DNA sequence is E. coli pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase subunit or fusion of claims encoding those fragments that allow for post-translational lipoylation of synthetic proteins. Hybrid DNA sequence according to scope item 6. (8) Claim 1, 2, 3, 4, 5, 6 or 7, which is functionally linked to an expression control sequence. A vector containing a hybrid DNA sequence as described above. (9) Encodes a signal or signal leader sequence that causes the fusion protein to be secreted 9. The vector according to claim 8, comprising a DNA sequence or a fragment thereof. (10) A host transformed with the vector according to claim 8. (11) A host transformed with the vector according to claim 9. (12) The method according to claim 10 under conditions that allow expression of the fusion protein. A method for producing a fusion protein comprising culturing a transformed host. (13) Claim that the fusion protein is modified in vivo by post-translational modification The method according to item 14. (14) Claim 11 under conditions that allow expression and secretion of the fusion protein. A method for producing a fusion protein, comprising the step of culturing the transformed host described in Section 1. (15) Claims that the fusion protein is modified in vivo by post-translational modification The method according to item 14. (16) Selection coupled to the amino acid sequence that allows for post-translational modification of the fusion protein A fusion protein comprising a protein or polypeptide. (17) Post-translational modification of selected protein or polypeptide and fusion protein The fusion according to claim 16, comprising a cleavage site between the amino acid sequence and the amino acid sequence allowing Synthetic protein. (18) The fusion according to claim 16 or 17 modified by post-translational modification protein. (19) Claims that the amino acid sequence enables post-translational biotinylation of the fusion protein The fusion protein according to scope 16 or 17. (20) A claim that enables post-translational lipoylation of an amino acid sequence or fusion protein. The fusion protein according to scope 16 or 17. (21) A method for isolating the fusion protein according to claim 18 from a material mixture It is a law; provide a binding partner that binds to the fusion protein only after it has been modified; Contacting the modified fusion protein with the binding partner under conditions that allow binding let me, Modified fusion protein bound to binding partner from unbound material in mixture separate, and A method of isolating a fusion protein comprising eluting the modified fusion protein. . (22) the fusion protein has a cleavage site and binds to a binding partner; cleaved at the cleavage site, either during binding or after elution from the binding partner. The method according to item 21. (23) Claim 21, wherein the fusion protein is a biotinylated protein. How to put it on. (24) The binding partner is avidin, streptavidin and their derivatives and the like. (25) A fusion protein has a cleavage site and binds a binding partner. Claims that are cleaved at the cleavage site during or after elution from the binding partner The method according to item 23. (26) The binding partner is avidin, streptavidin and their derivatives and the like. (27) The binding partner is avidin or streptavidin, and biotin The fusion protein is likely to be cleaved at the cleavage site while bound to its binding partner. Scope of Claim 26. The method according to item 26. (28) the binding partner is immobilized low affinity monomeric avidin; The biotinylated fusion protein is cleaved at the cleavage site after it has been eluted from the binding partner. 27. The method of claim 26, wherein: (29) Additionally, selected proteins or polypeptides as well as other materials can be the selected protein or polypeptide. by separating the avidin- or streptavidin-bound material from the avidin- or streptavidin-bound material. , the selected protein or polypeptide from all material remaining after elution and cleavage. 29. A method as claimed in claim 28, including separating the cords. (30) The method according to claim 21, wherein the fusion protein is a lipoprotein. Law. (31) Gold whose binding partner binds more tightly to dithiols than to monothiols 31. The method according to claim 30, wherein the compound is a genus compound. (32) The method according to claim 31, wherein the metal compound is an organic arsenite. (33) The fusion protein has a cleavage site and is still bound to the binding partner. Claims that are cleaved at the cleavage site either internally or after elution from the binding partner The method according to paragraph 30, 31 or 32.