WO1996021156A1

WO1996021156A1 - Method for preparing scintillation proximity assay targets

Info

Publication number: WO1996021156A1
Application number: PCT/US1995/016736
Authority: WO
Inventors: Claude G. Lerner
Original assignee: Abbott Laboratories
Priority date: 1995-01-04
Filing date: 1995-12-19
Publication date: 1996-07-11

Abstract

A method for immobilizing an assay target on a fluorescent support for use in a scintillation proximity assay, comprising the steps of (a) expressing a fusion protein comprising a linking domain and a functional domain, and (b) attaching said fusion protein to said fluorescent support via said linking domain, wherein the functional domain comprises the assay target or a polypeptide capable of attachment to the assay target.

Description

METHOD FOR PREPARING

SCINTILLATION PROXUVΠTΎ ASSAY TARGETS

Technical Field The present invention relates to fluorescence-based assays for the detection and measurement of biochemical compounds such as enzymes and their substrates, receptor ligands, antigens, immunoglobulins and other proteins. More particularly, the invention relates to scintillation proximity assays, in which a radiolabelled compound is brought into the immediate proximity of a fluorescent support via its specific affinity for or binding to a specific target moiety attached to the support.

Background of the Invention

In various academic, commercial and other settings, as for example in research, product development, quality assurance and clinical laboratory testing, biochemical assays are routinely used to detect and quantify minute amounts of selected compounds. Many of these assays possess one or more disadvantages such as long assay time, lack of sensitivity, complexity of the assay, disposal of used radioactive or other reagents, and high cost of operation.

Fluorescence assays are now regularly used in biochemical laboratories. In one type of fluorescence assay, scintillation proximity assays, fluorescent materials (fluors) are used in combination with radiolabeled compounds, such as [³H]- or [¹²⁵I]-labeled compounds that emit β-particle radiation or Auger electrons, respectively. Such compounds, when bound or retained in close proximity to the fluor, excite the fluor and cause it to emit light in the visible portion of the spectrum. Measurement of this emitted light in an appropriate monitoring device serves as the basis of the analysis. One example of a scintillation proximity assay is disclosed in United States Patent No.

4,568,649, issued February 4, 1986, which describes an immediate ligand assay wherein a ligand capable of binding a specific reactant is attached directly to support particles, such as beads. The beads themselves incorporate or are coated with a fluor. When the ligand-bearing beads are exposed to a mixture containing the radiolabeled reactant, the reactant is "captured" by the ligand and bound to the fluorescent bead. Energy from decay of the radiolabel then activates the fluor, the fluor emits light, and the emitted light is measured. In the above patent, the use of various ligand-reagent pairs is disclosed, including antigen-antibody, protein A- immunoglobulin, lectin-glycoprotein, hormone receptor-hormone, enzyme-substrate, enzyme- cofactor, RNA-DNA, DNA-DNA, and streptavidin-biotin. An improved version of the above immediate ligand assay is one in which the target ligand is attached to the fluorescent particle or support by an intervening linkage. Streptavidin (or avidin) and biotin, because of the ready availability of each component and their high affinity for one another, are particularly useful in forming such a linkage. Accordingly, there have been disclosed a number of scintillation proximity assays in which the target moiety consists of a biotinylated or biotin-containing ligand attached to a streptavidin-coated flourescent support Commercially available streptavidin-biotin scintillation proximity assays now include ones in which the target moiety consists of (i) biotin attached to DNA- or RNA- oligomers annealed to larger, radiolabeled RNA sequences, for assay of RNaseH or reverse transcriptase activity; (ii) a radiolabeled and biotinylated peptide, susceptible to cleavage by HTV proteinase; (iϋ) biotinylated oligonucleotides, susceptible to cleavage by HIV-1 ligase; (iv) biotinylated-low density lipoprotein, for assay of transfer of [³H]-cholesteryl ester from high density lipoprotein; or (v) a biotinylated peptide substrate, susceptible to transfer of [³H]- farnesyl pyrophosphate (see the 1994 product catalog of Amersham Life Science Co., Arlington Heights, Illinois). Other linked-ligand scintillation proximity assays have been developed in which wells (such as those of a microtitre-type plate) are formed from a fluor- containing material and coated with streptavidin, to which is attached a biotinylated or biotin- containing target moiety. Such assays are commercially available from DuPont NEN® (Boston, Massachusetts) under the tradename FlashPlate™.

Although extremely useful, such linked-ligand scintillation proximity assays are circumscribed by the limited availability of biotinylated compounds or complexes which can serve as the target moiety. Naturally biotinylated proteins, for example, are rare; consequently, methods for chemical and enzymatic biotinylation of proteins have been developed (see Savage et al., eds., Avidin-Biotin Chemistry: a Handbook (Pierce Chemical Co., Rockford, 1992), and Wilchek et al., eds., "Avidin-Biotin Technology", Methods in Enzymol., vol. 184

(Academic Press, San Diego, 1990)). Chemically biotinylated synthetic peptides have been used in scintillation proximity assays to study enzymatic activity and binding affinity (see Brown et al., Anal. Biochem. 217: 139- 147 (1994) and Pernelle et al., Biochemistry ,

32: 11682-11687 (1993)). Even so, there is a lack of readily-available biotinylated proteins suitable for use in linked-ligand scintillation proximity assays, as in screening for possible therapeutic agents. Potential target proteins which would be useful in scintillation proximity assay screens include enzymes, such as topoisomerases (enzymes that modify the topological state of DNA), as well as proteins which lack catalytic activity but which interact with therapeutically important ligand molecules. Examples of the latter include DNA binding proteins, such as transcription factors, RNA binding proteins, soluble receptor domains and the like.

While only chemical biotinylation has been used to prepare assay targets for use in scintillation proximity assays, other means for biotinylating proteins have been developed in connection with the preparation and purification of recombinant expression products. For example, several investigators have disclosed methods for obtaining pure fusion proteins, in which a biotin carrier protein is attached to a fusion protein and biόtin-streptavidin interactions are used to separate impurites from the desired product. (See Cronan Jr., J. Biol. Chem. 265:10327-10333 (1990); Reed and Cronan, J. Biol. Chem. 266:11425-11428 (1991); European Patent Application No. 511 747, published November 4, 1992; Ackerman et al., J. Biol. Chem. 267:7386-7394 (1992); Consler et al, Proc. Natl. Acad. Sci. U.SΛ. 90:6934- 6938 (1993); and Pos et al., FEBS Lett. 347:37-41(1994)). Various uses of such biotinylated fusion protein products have also been reported, including Germino et al. (in Proc. Natl. Acad. Sci. U.SΛ. 90:933-937 (1993)), who disclose the use of a biotinylated fusion protein to isolate recombinant organisms which produce protein ligands for the fusion protein (leucine zipper regions); Berliner et al. (in J. Biol. Chem. 269:8610-8615 (1994)), who disclose a biotinyl-kinesin fusion protein immobilized onto a streptavidin-coated surface and its use to study microtubule movement in an in vitro motility assay for kinesin motor activity; and Weiss et al. (in Protein Expr. Purif. 5:509-517 (1994)), who disclose a biotinyl-fusion protein incorporating the heavy chain coding region of a monoclonal antibody (Fab) to human tumor necrosis factor and its use in purification of antigens by immunoaffinity chromatography.

However, the use of such biotinylated fusion protein products in scintillation proximity assays has not been suggested.

It is therefore an object of the present invention to provide an improved scintillation proximity assay, and in particular to provide an improved means of preparing target moieties for use in such assays, such that a wide variety of assay targets can be readily obtained.

Summary of the Invention

It has now been found that fusion proteins, and especially biotinylated fusion proteins, provide an ideal and unexpectedly useful means of linking target moieties to the fluorescent support of a scintillation proximity assay. Accordingly, in one aspect of the invention is disclosed a method for immobilizing an assay target on a fluorescent support for use in a such an assay, comprising the steps of

(a) expressing a fusion protein comprising a linking domain and a functional domain, and (b) attaching the fusion protein to the fluorescent support via the linking domain.

In one embodiment of such a method, the linking domain of the fusion protein comprises a biotin-accepting domain which is biotinylated either during or after expression of the fusion protein. The fusion protein may then be attached to the fluorescent support by means of binding between a biotinyl group on the biotin-accepting domain and a streptavidin or avidin group on the surface of the support. One such biotin-accepting domain is that which originates from the 1.3 S biotin-containing subunit of Propionibacterium shermanii transcarboxylase, known as the biotin carboxylate carrier protein or BCCP. Also, as described below, other linking domains may be utilized as the means by which the fusion protein is attached to the fluorescent support.

The type of assay target to be imobilized, however, may vary widely regardless of the choice of linking domains. Among the methods of the present invention are those in which the functional domain of the fusion protein comprises a polypeptide capable of specific binding to a radiolabled reactant in a manner which is detectable by the scintillation proximity assay. These fusion proteins, in which the functional domain itself comprises the assay target, may be exposed to the radiolabeled reactant before the fusion protein is attached to the fluorescent support (i.e., the assay may be run in so-called "capture" mode); alternatively, the targets may be exposed to the radiolabeled reactant after the fusion protein is attached to the fluorescent support (i.e., the assay may be run in so-called "real-time" mode).

The functional domain polypeptides which may serve directly as assay targets include enzymes, transcription factors, DNA binding proteins, RNA binding proteins, receptors and cell adhesion molecules, as well as operational fragments and active sites thereof. A preferred polypeptide-reactant combination is a topoisomerase enzyme and [³H]-labeled supercoiled deoxyribonucleic acid, and in particular human topoisomerase I or a topoisomerase of bacterial origin such as Escherichia coli topoisomerase I.

As an alternative to the above method in which the assay target is the functional domain of the fusion protein itself, the present invention also includes those methods in which the assay target is an active component (such as a receptor complex or an efflux pump) of a whole cell, or of a membrane vesicle having a normal or an everted orientation. Such targets may be immobilized on the fluorescent support by fixing the entire cell or vesicle to the support. This is accomplished by means of a fusion protein of the present invention which has in its functional domain a polypeptide capable of attachment to the cell, as for example by affinity for factors on the cell surface, or of insertion (where the polypeptide comprises a transmembrane protein) into the membrane of the cell. With the functional domain of the fusion protein bound to the surface of, or inserted into, the cell or vesicle membrane, and the linking domain attached to the fluorescent support, the entire cell or vesicle is positioned in such proximity to the support as to allow a scintillation proximity assay to be performed. In another aspect of the present invention, novel fusion proteins are disclosed comprising a linking domain as described above and a functional domain comprising a topoisomerase I enzyme or an operational fragment or active site thereof. Particular examples of such fusion proteins include those in which the topoisomerase enzyme is human topoisomerase I or a topoisomerase of bacterial origin such as Escherichia coli topoisomerase I. In yet another aspect of the invention are disclosed recombinant plasmids or genetic constructs encoding such fusion proteins and comprising such regulators of expression as may be desired, as well as host cells incorporating such plasmids or constructs and capable of expressing the fusion proteins. Suitable host cells may include bacterial cells transformed by the incorporation of a plasmid of the present invention, or where necessary may include eukaryotic cells into which the above constructs are co-transfected using a vector of viral or other origin.

Brief Description of the Drawings

The present invention will be better understood in connection with the accompanying drawings, in which

FIGURE 1 represents a restriction site and functional map of plasmid pUC18-topA, having a size of approximately 5.9 kilobases (kb);

FIGURE 2 represents a restriction site and functional map of plasmid pPPXal-NtopA, having a size of approximately 3.6 kb;

FIGURE 3 represents a restriction site and functional map of plasmid pPPXal-EcotopA, having a size of approximately 6.3 kb; FIGURE 4 represents a restriction site and functional map of plasmid pPPXa3-hTOP 1 , having a size of approximately 5.8 kb;

FIGURE 5 represents a restriction site and functional map of plasmid pET23-BiohTOPl, having a size of approximately 6.6 kb; and

FIGURE 6 represents a restriction site and functional map of plasmid pVL1392-BiohTOPl, having a size of approximately 12.6 kb.

Detailed Description of the Invention

According to the method of the present invention and as demonstrated below, it is now possible to prepare as the target of a scintillation proximity assay a complex molecule such as topoisomerase I and, moreover, to do so without the need for chemical modification of the enzyme. Additional target proteins likely to be suitable and readily configured for a scintillation proximity assay include the biotinyl-Jun fusion protein disclosed by Germino et al. (above) to assay binding of [³H] -labeled Fos synthetic peptide, and the biotinyl-Fab antibody fragments disclosed by Weiss et al. (above) for [³H]-labeled antigens in a scintillation immunoassay. Other potential target proteins include those which have been shown to be active when incorporated into fusion hybrids with the glutathione S-transferase (GST) domain (e.g., etsl transcription factor protein (Chen and Wright, Oncogene 8:3375-3383 (1993)), human estrogen receptor (Beekman et al., Gene 146:285-289 (1994)), human androgen receptor (Roehrborn et al., Mol. Cell. Endocrinol. 84:1-14 (1992)), and atrial natriuretic factor receptor (Pandey and Kanungo, Biochem. Biophys. Res. Commun. 190:724-731 (1993)). When necessary, target polypeptides requiring free amino- and carboxy-termini for activity may be assayed by inserting the biotin-accepting domain within the functional domain rather than at either end, as in the case of Consler et al. (above) who report the construction of a hybrid polypeptide with the biotin-accepting domain inserted internally within a cytoplasmic loop of the lactose permease of E. coli. It is also expected that target polypeptides consisting of multiple subunits may be adaptable to scintillation proximity assays; for example, Ackerman et al. (above) disclose that subunits of the Fl-ATPase are co-purified with an ATPl 1 biotinyl fusion protein, suggesting that an entire such multi-subunit protein may be expressed and attached to a scintillant support.

Where the gene sequence for a target polypeptide is unknown, or where it is preferable to study a target moiety (such as a receptor molecule) in situ, the present invention may be used to attach entire cells or vesicles to a fluorescent support. For example, biotinylated whole cells may be prepared by expressing a hybrid fusion protein consisting of a biotin-accepting domain connected to a membrane localization protein sequence such that the functional domain (the localization protein sequence) becomes anchored to the membrane. Membrane preparations incorporating particular targets (such as efflux pumps), in the form of normal or everted vesicles, can be prepared from whole cells by conventional procedures.

In the specification and claims hereof, certain terms are intended to have the following meanings:

The terms "active site" and "operational fragment" refers to a polypeptide which has been truncated or abbreviated but which retains enough of its biological function to serve as an assay target

The term "assay target" as used herein refers to that component of a scintillation proximity assay which is fixed to the fluorescent support, whether before or after reaction with a radiolabeled reactant. The terms "attaching" or "immobilizing" as used herein in connection with a scintillation proximity assay target refers to the anchoring or localization of such a target in sufficiently close proximity to the fluorescent support that a detectable fluorescent signal is emitted when the target captures or binds a suitable radiolabelled reactant

The term "biotin-accepting domain" as used herein refers to that portion of a polypeptide sequence which contains posttranslational signals resulting in its biotinylation either during or after expression, as for example the biotin carboxyl carrier protein (BCCP) of E. coli or the 1.3S biotin-containing subunit of Propionibacterium shermanii transcarboxylase.

The term "fluorescent support" as used herein refers to a support structure having incorporated therein or attached thereto a fluor, and comprising either a single surface or the surfaces of a plurality of particles. The term "functional domain" as used herein in connection with a fusion protein refers to that portion of the fusion protein which either (i) comprises the assay target in the form of a polypeptide or (ii) recognizes, binds to or has a specific affinity for the assay target.

The term "fusion protein" as used herein refers to a hybrid of two or more peptide sequences not normally found together, joined by a covalent bond and expressed together as a single protein.

The term "linking domain" as used herein in connection with a fusion protein refers to that portion of the fusion protein which recognizes, binds to or has a specific affinity for a factor on the surface of the fluorescent support. The term "radiolabeled reactant" as used herein refers to a compound which binds to or is a ligand of the assay target and incorporates a radioisotope such as tritium [³H] or radioactive iodine [125r

The term "transmembrane protein" as used herein refers to a protein having a membrane-spanning domain which serves to anchor the protein to a cellular or vesicular membrane.

The methods, fusion proteins and genetic constructs of the present invention will be better understood in connection with the following examples, which are intended as an illustration of and not a limitation upon the scope of the invention. In the examples, all percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted. The present invention may be carried out using the methods demonstrated as well as other techniques well-known in the art, including selection of the conditions required to grow and transform cells, DNA isolation and purification, restriction enzyme digestions, electrophoresis of DNA fragments and peptides, annealing of plasmids and DNA insertion, DNA sequencing and the like. (See, for example, Molecular Cloning: A Laboratory Manual. Sambrook et al., eds., Second Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989); and "Guide to Protein Purification," M.P. Deutscher, ed., in Methods in Enzymol., volumel82 (Academic Press, Inc., San Diego, California, 1990)). Both here and throughout the specification, it is intended that such citations are expressly incorporated by reference.

The work described herein was performed in conformity with physical and biological containment requirements specified under the current regulations described in National Institute of Health CNIH . Guidelines for Recombinant DNA Research, published by the U. S. Department of Health, Education and Welfare. Example 1 General Methods

Media. Reagents. Chemicals, and Enzymes Media components for the growth of bacteria were purchased from Difco Laboratories

(Detroit, Michigan). MLB media contained 5 g 1 NaCl, 1 g/1 glucose, 5 g/1 yeast extract 10 g/1 tryptone, and 0.01 M Tris-HCl, pH 7.5; when ampicillin was used, it was added to a final concentration of 100 μg ml. MLB agar medium contained 15 g/1 agar in addition to the above components; ampicillin, when used, was added to a final concentration of 160 μg/ml. M63 thymidine labeling medium consisted of 1 x M63 salts (3 g/1 KH2PO4, 7 g/1 K2HPO4, 2 g/1 (NH4)2SO4, 0.5 mg 1 FeSO4) containing 2 μg/ml thymidine, 0.3% glucose, 1 mM MgSO4, 10 μg/ml Bl, 50 μg/ml L-tryptophan, 0.5% Casamino Acids, and 100 μg/ml ampicillin. M63 agar medium contained 15 g/1 agar in addition to the above components. Isopropyl-^β-D- thiogalactopyranoside (IPTG) was from Sigma Chemical Co. (St. Louis, Missouri). TMN-FH insect medium for the growth of Spodoptera frugiperda (Sf9) cells were purchased from PharMingen (San Diego, California). TE buffer contained 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA. lOx DNA gel loading dye contained 0.25% bromophenol blue, 0.25% xylene cyanol, 30% glycerol, 5 mM EDTA, and 10 mM Tris-HCl, pH 8.0.

Restriction enzymes, T4 DNA ligase and nuclease-free bovine serum albumin (BS A) were purchased from New England Biolabs (Beverly, Massachusetts); or Boehringer

Mannheim (Indianapolis, Indiana). Agarose, the GlassMAX™ DNA isolation Spin Cartridge System, and phosphate-buffered saline (PBS) were obtained from Life Technologies (Gaithersburg, Maryland). Ampicillin and lOx concentrate Tris-acetate-EDTA (TAE) buffer were purchased from Sigma Chemical Co. (St Louis, Missouri). The QIAGEN™ plasmid Midi Kit and the QIAEX™ gel extraction kit were obtained from QIAGEN (Chatsworth, California). Polymerase Chain Reaction (PCR) reagents and Taq DNA polymerase were purchased from Perkin Elmer (Norwalk, Connecticut). The Magic™ PCR preps purification system was purchased from Promega (Madison, Wisconsin). Tris-glycine polyacrylamide pre¬ cast gels and the Dry-Ease™ drying system were purchased from Novex (San Diego, California). Molecular weight standards and ISS Pro-Blue Stain for protein gels were from Integrated Separation Systems (Natick, Massachusetts).

Membranes, reagents used in Western blotting procedures, avidin-alkaline phosphatase conjugate, and protein assay kit were obtained from Bio-Rad (Hercules, California). Slide- A-Lyzer™ 10 kDa molecular weight cut-off dialysis cassettes and UltraLink™ immobilized monomeric avidin affinity resin were from Pierce Chemical Co. (Rockford, Illinois). Radioisotopically-labeled [methyl-^Hl-thymidine (70-85 Ci/mmol, 1 mCi/ml aqueous solution) and streptavidin-coated Scintillation Proximity Assay (Farnesyl Transferase kit) beads were obtained from Amersham (Arlington Heights, Illinois). Streptavidin FlashPlate™ Plus microplates were obtained from DuPont NEN^® (Boston, Massachusetts). AU other chemicals were obtained from Sigma Chemical Co., Boehringer Mannheim, Bio-Rad or Life Technologies, supra.

Host Cell Cultures. DNA Sources, and Vectors

Transformation-competent E. coli DH5α and DH5α F'lQ cells (described by Jessee and Blodgett, Focus 10:69 (1988)) were obtained from Life Technologies, supra. The PinPoint™ Xa protein purification system, which includes the PinPoint Xal and Xa3 expression vectors, was purchased from Promega, supra. The expression vector pET-23(+) of Studier et al. (Methods Enzymol. 185:60-89 (1990)) was obtained from Novagen (Madison, Wisconsin). The baculovirus transfer vector pVL1392, BaculoGold™ DNA, baculovirus strain Autographa californica nuclear polyhedrosis virus (AcNPV) and Spodopterafrugiperda (Sf9; ATCC CRL 1711) insect cells were purchased from PharMingen (San Diego, California). Plasmids pBR322 (GenBank accession number VB0001 ; ATCC 31344 and ATCC 37017) and pUC18 (GenBank accession number VB0025; ATCC 37253), and bacteriophage PM2 DNA were purchased from Boehringer Mannheim, supra. The plasmid YEpGALl-hTOPl containing the human TOPI gene encoding DNA topoisomerase I (Bjornsti et al., Cancer Research 49:6318-6323 (1989); GenBank accession number J03250) and the plasmid pJW80 containing the Escherichia coli topA gene encoding DNA topoisomerase I

(Wang et al., Nucl. Acids. Res. 11:1773-1790 (1983); GenBank accession number X04475) were obtained from Dr. James C. Wang, Harvard University.

Oligonucleotides used for PCR and DNA sequencing were synthesized using an oligonucleotide synthesizer from Applied Biosystems, Inc. (Foster City, California, Model No.394).

Bacterial Strains and Hosts Containing Plasmids

The bacterial strains utilized herein were E. coli K-12 strains. E. coli strain KLC124 (genotypes F", Rha", Thy, and trpA33 ), described in Chase et al., J. Bacteriol. 137:234-242 (1979), was used for the preparation of uniformly labeled [³H]-pBR322 DNA by metabolic labeling with [³H]-thymidine as described below in the method for preparation of [³H -labeled plasmid DNA. [Other Thy- E. coti strains, such as strains ATCC 31244 or ATCC 39061 (available from the American Type Culture Collection, Rockville, Maryland) may also be utilized.] The strains DH5α (genotypes F-, gyrA96, recAl), and DH5α F'lQ (genotypes gyrA96, recAl I F lacrø) were obtained from Life Technologies, supra.

The plasmid-containing bacterial hosts prepared herein (strains KLC124/pBR322, DH5α F'IQ/pVL1392-BiohTOPl, and DH5α F'lQ/pPPXal-EcotopA) were deposited under the Budapest agreement on December 29, 1994, with the Agricultural Research Service (NRRL), U.S. Department of Agriculture (Peoria, Illinois), and were accorded the accession numbers NRRL B-21371, NRRL B-21372, and NRRL B-21373, respectively.

Plasmid DNA Preparation

Plasmid DNA was isolated by means of a QIAGEN™ plasmid Midi Kit in accordance with the supplier's instructions. The procedure used to isolate plasmid DNA for cloning experiments was essentially as follows: A 100 ml culture was grown overnight at 37°C. Cells were pelleted at 3000 x g for 5 min, resuspended in 25 ml of 20 mM Tris-HCl, pH 7.5, and repelleted. The pellet was stored frozen at -20°C until ready for use. The pellet was thawed at room temperature and dissolved in 4 ml of solution PI (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, and 0.05 mg/ml RNase A). Following addition of 4 ml of solution P2 (0.2 N NaOH and 1% SDS), the mixture was swirled gently and kept at room temperature for 5 min, after which 4 ml of solution P3 (3 M potassium acetate, pH 5.5) was added and the mixture was swirled gently and kept on ice for 15 min. Debris was pelleted at 23,500 x g for 30 min and the supernatant filtered through 3 layers of sterile gauze or a 0.45 μ nylon filter. The filtrate was applied to a QIAGEN™ TIP- 100 column pre-equilibrated with buffer QBT (0.75 M NaCl, 50 mM 3-morpholino-propanesulfonic acid (MOPS), pH 7.0, 15% ethanol, and 0.15% Triton X-100). The column was washed with 2 x 10 ml of buffer QC (1.0 M NaCl, 50 mM MOPS, pH 7.0, and 15% ethanol), and DNA was eluted with 5 ml of buffer QF (1.25 M NaCl, 50 mM Tris-HCl, pH 8.5, and 15% ethanol). The plasmid DNA was precipitated by addition of 3.5 ml of isopropanol and stored at -20°C for 30 min, followed by centrifugation at 14,500 x g for 15 min. The DNA pellet was resuspended in 200 μl TE buffer and reprecipitated with 0.3 M sodium acetate and 2 volumes of cold 100% ethanol.

Polymerase Chain Reaction (PCR. Amplification of DNA

For the PCR reactions, 200 ng of target plasmid DNA, 10 μl of 10X PCR Buffer II, 6 μl of 25 mM MgC_2, 10 μl of dNTP mixture (2 mM of each dNTP), 100 pmol of each primer, and 2.5 U of Taq DNA polymerase were combined in total volume of 100 i\. After an incubation at 94°C for 6 minutes, the following conditions were repeated for 40 cycles: 94°C for 40 sec, 55°C for 40 sec, then 72°C for 45 sec. When cycling was completed, the reaction product was allowed to soak at 4°C. The PCR products were analyzed on an agarose gel and were then purified using Magic™ PCR Preps (Promega, supra) according to the supplier's protocol. Restriction Enzvme Digestion

Restriction enzymes were used according to suppliers' instructions. At least 2 units of enzyme were used for each microgram of DNA to be digested, and sufficient incubation time was allowed to complete digestion of the DNA.

Isolation of DNA Restriction Fragments

Approximately 2 μg of plasmid DNA wore digested with restriction enzymes under standard conditions. The resulting fragments were separated by agarose gel electrophoresis and visualized under ultraviolet light after staining with ethidium bromide. Bands of DNA of the desired size were excised from the gel. The protocol for use of the QIAEX™ gel extraction kit or GlassMAX™ DNA isolation Spin Cartridge System was followed to isolate the desired DNA fragments from the agarose gel slices. The yield of recovered fragment was assayed by direct comparison of ethidium bromide fluorescence with pure DNA standards. Typically, recoveries of 50% were obtained.

DNA Ligations

T4 DNA ligase was used for standard vector/insert ligations and was present in excess (50 U/μg DNA); inserts were present at equimolar or 2-fold molar excess to 40 to 50 pmoles of vector. The DNA fragments, reaction buffer containing enzyme, and T4 DNA ligase were combined in a total reaction volume of 50 μl. The mixture was incubated at room temperature for 3 hours.

Transformation

Plasmid DNA samples were transformed into transformation-competent E. coli DH5α and DH5α F'lQ cells by mixing 20-50 μl of cell suspensions with 1-5 μl (5- 100 ng) of DNA plasmid solution or ligation mixture followed by incubation at 0°C for 30 min. The cells were then heated to 37°C for 2 min, after which 0.5 ml of MLB media was added and the mixture was incubated at 37°C for 30 min. Samples (0.1 ml) of the cells were plated onto MLB plates containing 1.5% agar and 160 μg/ml ampicillin. The plates were incubated overnight at 37°C.

Isolation of Recombinant Plasmid DNA from Transformed Host

Recombinant plasmid DNA was isolated from its prokaryotic host using well-known alkaline lysis procedures or similar methods.

DNA Topoisomerase I Assays

Conversion of supercoiled PM2 DNA to the relaxed form was measured by agarose gel electrophoresis. The unit definition was the activity that converted one-half of the 125 ng of supercoiled PM2 DNA substrate into relaxed form at 37°C, in 15 min or 30 min for the human or bacterial DNA topoisomerase I biotinyl-fusion protein, respectively. Cell extracts containing human DNA topoisomerase I biotinyl-fusion protein were diluted in buffered diluent consisting of 10% glycerol, 15 mM potassium phosphate, pH 7.2, 0.1 mM EDTA and 1 mg/ml BSA, and assayed in reaction buffer consisting of 100 mM KCl, 10 mM MgC_2, 20 mM Tris, pH 7.5, 0.1 mM EDTA and 40 μg/ml BSA. Cell extracts containing bacterial DNA topoisomerase I biotinyl-fusion protein were diluted and assayed in reaction buffer consisting 10 mM Tris-HCl, pH 7.4, 120 mM NaCl, 30 μg/ml BSA, 0.1 mM EDTA and 5 mM MgCl2.

The assay procedure was as follows: Assay tubes containing 5 μl of protein sample were pre-equilibrated at 37°C for 3 min. The reactions were started by addition of 15 μl reaction buffer containing 125 ng of supercoiled PM2 DNA, the tube contents were quickly mixed, and the tubes were incubated at 37°C in a water bath. Reactions were stopped by the addition of 5 μl stop solution containing 5% SDS, 0.125% bromophenol blue, 0.125% xylene cyanol, 15% glycerol, 2.5 mM EDTA and 5 mM Tris-HCl, pH 8.0. The amount of conversion of supercoiled substrate to relaxed product was determined by agarose gel electrophoresis relative to a control reaction, which contained all components except enzyme, incubated for the same period at 37°C. Dilutions of the enzyme samples were performed in order to obtain accurate activity data.

Agarose Gel Electrophoresis

Plasmid DNA topoisomers and linear DNA fragments were resolved by electrophoresis in 0.7% agarose gels in buffer consisting of TBE (89 mM Tris, 89 mM boric acid and 2 mM EDTA, pH 8.4) or TAE (40 mM Tris-acetate, pH 8.3 and 1 mM EDTA), respectively. Analytical and preparative gels were submerged in electrophoresis buffer and run in a horizontal gel box at 60-100 volts. Following electrophoresis, the gels were stained with 0.5 μg/ml ethidium bromide (EtBr) and the DNA ws visualized by UV transillumination. The gel was photographed with Polaroid (Cambridge, Massachusetts) type 55 positive/negative black and white print film and processed according to the supplier's instructions. The negative of the gel was scanned using a Molecular Dynamics Personal Densitometer™ model SI equipped with a Dell model XPS/466V personal computer. The apparent amount of DNA in individual bands was quantitated using ImageQuaNT™ image analysis software from Molecular Dynamics (Sunnyvale, California).

Polvacrylamide Gel Electrophoresis Protein samples were diluted into Laemmli sample buffer for analysis by SDS -PAGE

(Laemmli, Nature 227:680-685 (1970)). All SDS gels were run using either 10% homogeneous or 4-20% gradient Tris-glycine polyacrylamide pre-cast 1.0 mm x 15 well gels in an electrophoretic apparatus obtained from Integrated Separation Systems (Natick, Massachusetts). The gels were run at 30 mA constant current until the bromophenol blue tracking dye reached the bottom of the gel. Gels were stained with Coomassie blue using the ISS Pro-Blue staining kit according to the supplier's instructions. Gels were dried onto cellophane using the DryEase™ Drying System. The dried gel was scanned and individual protein bands quantitated using a Molecular Dynamics Personal Densitometer™ as detailed above in the agarose gel electrophoresis method.

Western Blotting Western blotting was perf armed as described in Antibodies: a Laborator^y Manual.

Harlow and Lane, eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1988). Tris-glycine polyacrylamide gels were used to separate proteins for Western blotting. Proteins were transferred from the gels to nitrocellulose membranes using a Biotrans Model A semi-dry electrophoretic transfer unit apparatus obtained from Gelman Sciences (Ann Arbor, Michigan). Transfer buffer consisted of 48 mM Tris base, 39 mM glycine, 0.037% SDS, and 20% methanol. The proteins were transferred at constant current using 0.8 mA/cm² membrane for 1.5 hr. After blotting the membrane was treated with blocking buffer consisting of TBST (20 mM Tris, pH 7.5, 0.5 M NaCl, and 0.05% Tween 20) containing 3% BSA (fraction V). Biotinylated proteins were detected by incubating the blot with 30 ml TBST containing 6 μl avidin-alkaline phosphatase conjugate at room temperature for 30 min. The membrane was washed twice with 50 ml TBST. The immobilized avidin-alkaline phosphatase was detected with a bromochloroindoyl phosphate/nitro blue tetrazolium chromogenic substrate kit used according to the supplier's instructions.

Preparation of . H1-labeled Plasmid DNA

Plasmid pBR322 was transformed by electroporation into E. coli strain KLC124 using a Bio-Rad Gene Pulser™ with Pulse Controller electroporation unit according to the supplier's instructions (0.2 cm cuvettes, 25 mF, 200 ohms, 2.50 kV). A portion of a frozen culture stock of E. coli strain KLC124/pBR322 stored at -70°C in 20% glycerol was swabbed onto M63 agar medium and incubated at 37 °C overnight Three colonies from the plate were inoculated into 2 ml of liquid M63 labeling medium, and the starter culture was incubated overnight at 37°C. The next morning, the entire 2 ml starter culture was transferred into 100 ml of M63 thymidine labeling medium and incubated at 37 °C with shaking until the culture turbidity reached ODβoonπ, = 0.65-0.70, at which time 1.5 ml of 20 mg/ml chloramphenicol in ethanol was added. After 2 hours, [³H]-thymidine (70-85 Ci mmol) was added to a final concentration of 25 μCi/ml, and the culture continued incubation at 37°C overnight [³H]-labeled supercoiled pBR322 DNA were isolated from the cells using a QIAGEN™ Plasmid Midi DNA isolation kit as described above. Using this method, at least 100 μg of [³H]-pBR322 plasmid DNA with specific activity of 5,000 to 7,000 dpm/ng were routinely obtained.

Example 2 Construction of Strain E. r.nli DH5α F'lO/pPPXal-EcotopA

Step 2a. Construction of pUC18-topA plasmid

Approximately 50 ng of plasmid pJW80 were used to transform competent E. coli DH5α cells, employing selection for ampicillin resistance on MLB-agar plates as detailed above. Surviving colonies were picked and examined for the expected plasmid of ~9.7 kb, which constituted the desired E. coli DH5ot pJW80 transformant. A single colony of E. coli DH5α pJW80 was used to inoculate 2 ml of MLB medium, containing 100 μg/ml ampicillin, and incubated at 37°C with shaking at 250 rpm for a period of 4 to 6 hours. This culture was then used as inoculum for 100 ml of MLB medium, containing 100 μg/ml ampicillin, and incubation at 37°C with shaking was continued overnight (16 to 20 hours). The cells were harvested by centrifugation and washed once with 20 mM Tris-HCl, pH 7.5. The isolation and purification of plasmid pJW80 was performed using the QIAGEN™ Plasmid Midi- Kit as described in the Methods section above. Approximately 2 μg of plasmid pJW80 DNA was digested with the restriction enzymes Sphl and Smal, and approximately 2 μg of plasmid pUC18 was digested with the restriction enzymes Sphl and HincU under standard conditions. The resulting fragments were separated by agarose gel electrophoresis and visualized under ultraviolet light after staining with ethidium bromide. Bands corresponding to DNA of sizes -2.7 kb, which contained the plasmid pUC18 vector backbone, and ~3.2 kb, containing the topA gene encoding the E. coli topoisomerase I gene, were excised from the gel. The protocol for use of the QIAEX™ Gel Extraction Kit was followed to isolate the desired DNA fragments from the agarose gel slices as described above. Approximately 100 ng of ~2.7 kb plasmid pUC18 Sphl - Hinc fragment were mixed with approximately 120 ng of -3.2 kb plasmid pJW80 Sphl - Smal fragment and ligated as detailed above in the method for DNA ligations. The reaction mixture contained the desired plasmid pUC18-topA (-5.9 kb).

Step 2b. Preparation of E. coli DH5α F'lQ cells Containing pUC18-topA Plasmid

Approximately 10 ng of plasmid pUC18-topA, prepared in Step 2a above, were used to transform competent E. coli DH5α F'lQ cells, employing selection for ampicillin resistance on MLB-agar plates, as detailed above in the method for transformation. The surviving colonies were identified as E. coli DH5α F'IQ/pUC18-topA transformants by restriction enzyme and gel electrophoresis analysis of the constituent plasmids. Large-scale isolation and purification of the plasmid pUC18-topA from E. coli DH5α F'IQ/pUC18-topA cells were performed according to the procedure detailed above. A restriction site and functional map of plasmid pUC18-topA is presented in Figure 1 of the accompanying drawings.

Step 2c. Construction of pPPXal-NtopA Plasmid The polymerase chain reaction was used to amplify from plasmid pUC 18-top A, prepared in Step 2b, a DNA fragment corresponding to the first 330 bp of the topA coding region. The oligonucleotide primers employed were

5'GCTG(_X}AAG^ITCTACCATGC<3TAAC CTCTTGTCATCG^3, [SEQ ID NO:l] and 5'CGCGIi _CCCITCAGCCAGTTGTTTCAGTTCAG^3' [SEQ ID NO:2]. TheHindπi and BamHl restriction sites (underlined) were incorporated into the primers to allow the amplified fragment to be subcloned in-frame into the PinPoint Xal (pPPXal) vector. The PCR reaction using plasmid pUC18-topA as DNA template was performed as described in the Methods section above. Approximately 2 μg of plasmid pPPXal and the 330 bp PCR product generated by the procedure described above were cut with the restriction enzymes Hindm and BamHl under standard conditions. The reactions were incubated at 65 °C for 30 min to inactivate the restriction enzymes. Approximately 100 ng of HindU -BamHl digested plasmid pPPXal DNA (-3.3 kb) were mixed with approximately 35 ng of similarly digested PCR product (315 bp). The DNA fragments were ligated as described in the Methods section above. The reaction mixture contained the plasmid pPPXal -Ntop A (-3.6 kb).

Step 2d. Preparation of E. coli DΗ5α F'lQ Cells Containing pPPXal -Ntop A Plasmid

Approximately 10 ng of plasmid pPPXal -NtopA, prepared in Step 2c above, were used to transform competent E. coli DH5α F'lQ cells, employing selection for ampicillin resistance on MLB-agar plates, as described above. The surviving colonies were identified as E. coli DH5α F'lQ/pPPXal-NtopA transformants by restriction enzyme and gel electrophoresis analysis of the constituent plasmids. The reading frame of the gene fusion was confirmed by DNA sequencing. Large-scale isolation and purification of the plasmid pPPXal -NtopA from E. coli DH5α F'lQ/pPPXal-NtopA cells were performed according to the procedure detailed above. The plasmid pPPXal -NtopA was used as an intermediate in the construction of the biotinylated E. coli topoisomerase I expression vector, pPPXal-EcotopA. A restriction site and functional map of plasmid pPPXal -NtopA is presented in Figure 2 of the accompanying drawings. Step 2e. Construction of pPPXal-EcotopA Plasmid

Approximately 2 μg of plasmid pPPXal-NtopA DNA, prepared in Step 2d above, and approximately 2 μg of plasmid pUC18-topA DNA, prepared in Step 2b above, were digested with the restriction enzymes Pvull and Kpnl under standard conditions. The resulting fragments were separated by agarose gel electrophoresis and visualized under ultraviolet light after staining with ethidium bromide. Bands corresponding to DNA of sizes -3.5 kb, which contained the plasmid pPPXal-NtopA vector backbone, and -2.8 kb, containing the remainder of the E. coli topA gene, were excised from the gel. The protocol for the QIAEX™ Gel Extraction Kit was followed to isolate the desired DNA fragments from the agarose gel slices, as described above. Approximately 100 ng of -3.5 kb plasmid pPPXal -NtopA PvuU-Kpnl fragment were mixed with approximately 80 ng of -2.8 kb plasmid pUC18-topA Pvull-Kpn fragment and ligated as described above. The reaction mixture contained the plasmid pPPXal-EcotopA (-6.2 kb).

Step 2f. Construction of Strain E. coli DH5α F'lO/pPPXal-EcotopA

Approximately 10 ng of plasmid pPPXal-EcotopA, prepared in Step 2e above, were used to transform competent E. coli DH5α F'lQ cells, employing selection for ampicillin resistance on MLB-agar plates as described above. The surviving colonies were identified as E. coli DH5α F'lQ/pPPXal-EcotopA transformants by restriction enzyme and gel electrophoresis analysis of the constituent plasmids. The reading frame of the gene fusion was confirmed by DNA sequencing. Large-scale isolation and purification of the plasmid pPPXal -EcotopA from E. coli DH5α F'lQ/pPPXal-EcotopA cells were performed according to the procedure described above. A restriction site and functional map of plasmid pPPXal -EcotopA is shown in Figure 3. The plasmid expression vector pPPXal -EcotopA was used for production of biotinylated E. coli topoisomerase I in E. coli DH5α F'lQ host cells.

Example 3 Construction of Strain E. coli DH5α F'IO/pVL1392-BiohTOPl

Step 3a. Construction of pPPXa3-hTOPl Plasmid

Approximately 50 ng of the plasmid YEpGALl-hTOPl were transformed into competent E. coli DH5α cells, and ampicillin-resistant colonies were selected on MLB-agar plates, as detailed above. Surviving colonies were picked and examined for the expected plasmid of -12.3 kb, which constituted the desired E. coli DH5α/YEpGALl-hTOPl transformant Large-scale isolation and purification of the plasmid YEpGALl-hTOPl from E. coli DH5α /YEpGALl-hTOPl cells were performed according to the procedure detailed above. Step 3b. Preparation of E. coli DH5α Containing pPPXa3-hTOPl Plasmid

Approximately 2 μg of plasmid PinPoint Xa3 (pPPXa3) DNA and 1.5 μg of plasmid YΕpGALl-hTOPl DNA, prepared as described above, were cut with the restriction enzymes EcoRW and BamHl under standard conditions. The bands corresponding to DNA of sizes -3.3 kb, which contained the plasmid pPPXa3 vector backbone, and -2.5 kb, containing the human TOPI gene, were electrophoresed, excised from the gel and isolated. Approximately 100 ng of ~3.3 kb plasmid pPPXa3 EcoRM -BamHl fragment were mixed with approximately 75 ng of -2.5 kb plasmid YΕpGALl-hTOPl EcoRV-BamHl fragment and ligated. The mixture contained the desired plasmid pPPXa3-hTOPl, which was used as an intermediate in the construction of the transfer vector, pVL1392-BiohTOPl . Approximately 10 ng of plasmid pPPXa3-hTOPl, prepared as described above, were used to transform competent E. coli DH5α F'lQ cells, employing selection for ampicillin resistance on MLB-agar plates. The surviving colonies were identified as E. coli DH5α F'IQ/pPPXa3-hTOPl transformants by restriction enzyme and gel electrophoresis analysis of the constituent plasmids. The reading frame of the gene fusion was confirmed by DNA sequencing. Large-scale isolation and purification of the plasmid pPPXa3-hTOPl from E. coli DH5α F'IQ/pPPXa3-hTOPl cells were performed as detailed above. A map detailing the restriction sites and loci of plasmid pPPXa3-hTOPl (-5.8 kb) is presented in Figure 4.

Step 3c. Construction of pΕT23-BiohTOPl

The plasmid pET23-BiohTOPl was employed as a second intermediate in order to utilize its unique restriction sites in the construction of the transfer vector, pVL1392- BiohTOPl. Approximately 1.5 μg of plasmid pET-23(+) DNA and approximately 2 μg of plasmid pPPXa3-hTOPl DNA, prepared in Step 3b above, were cut with the restriction enzymes EcoRl and NotI under standard conditions. The bands corresponding to DΝA of sizes -3.5 kb, which contained the plasmid pET-23(+) vector, and -3.0 kb, containing the human TOPI gene fused to the biotinylation peptide, were electrophoresed, excised from the gel and isolated. Approximately 100 ng of -3.5 kb plasmid pET-23(+) EcoRl-Notl fragment were mixed with approximately 85 ng of -3.0 kb plasmid pPPXa3-hTOPl EcoRl-Notl fragment and ligated as described above. The mixture contained the desired plasmid pET23- BiohTOPl.

Step 3d. Preparation of E. coli DH5α F'lQ Cells Containing pET23-BiohTOPl Plasmid

Approximately 10 ng of plasmid pET23-BiohTOPl, prepared in Step 3c above, were transformed into competent E. coli DH5oc F'lQ cells, employing selection for ampicillin resistance on MLB-agar plates. The surviving colonies were identified as E. coli DH5α F'IQ/pET23-BiohTOPl transformants by restriction enzyme and gel electrophoresis analysis of the constituent plasmids. The reading frame of the gene fusion was confirmed by DNA sequencing. Large-scale isolation and purification of the plasmid pET23-BiohTOPl from E. coli DH5α F'IQ/pET23-BiohTOPl cells were performed as described above. A map detailing the restriction sites and loci of plasmid pET23-BiohTOPl (-5.8 kb) is presented in Figure 5.

Step 3e. Construction of pVL1392-BiohTOPl

Approximately 10 μg of plasmid pVL1392 DNA were digested with the restriction enzymes Pstl and BamHl under standard conditions. Approximately 3 μg of plasmid pET23- BiohTOPl DNA, prepared in Step 3d above, were cut with the restriction enzymes Pstl and

Bgl l under standard conditions. The bands corresponding to DNA of sizes -9.6 kb, which contained the plasmid pVL1392 transfer vector, and -2.9 kb, containing the human TOPI gene fused to the biotinylation peptide, were electrophoresed, excised from the gel and isolated.

Approximately 100 ng of -9.6 kb plasmid pVL1392 Pstl-BamH fragment were mixed with approximately 30 ng of -2.9 kb plasmid pET23 -BiohTOPl Pstl-BglU fragment and ligated.

The mixture contained the desired plasmid pVL1392-BiohTOPl.

Step 3f. Construction of Strain E. coli DH5α FTO/pVL1392-BiohTOPl

Approximately 10 ng of plasmid pVL1392-BiohTOPl, prepared in Step 3e above, were transformed into competent E. coli DH5α F'lQ cells, employing selection for ampicillin resistance on MLB-agar plates. The surviving colonies were identified as E. coli DH5α F'IQ/pVL1392-BiohTOPl transformants by restriction enzyme and gel electrophoresis analysis of the constituent plasmids. Large-scale isolation and purification of the plasmid pVL1392- BiohTOPl from E. coli DH5α F'IQ/pVL1392-BiohTOPl cells were performed using cesium chloride-ethidium bromide density gradients. A restriction site and functional map of plasmid pVL1392-BiohTOPl is presented in Figure 6.

Example 4 Preparation of Biotinyl-E. coli DNA Topoisomerase I Fusion Protein

Step 4a. Growth of E. coli DH5α F'lO/pPPXal -EcotopA Cells

A portion of a frozen culture stock of E. coli strain DH5α F'lQ/pPPXal stored at -70°C in 20% glycerol was swabbed onto MLB agar medium containing 160 μg/ml ampicillin and incubated at 37 °C overnight Three colonies from the plate were inoculated into 2 ml of liquid MLB medium containing 100 μg/ml ampicillin and the starter culture was incubated for 5 hr at 37°C. The entire 2 ml starter culture was then transferred into 170 ml of MLB medium containing 0.5 mM IPTG, 2 μM biotin and 100 μg/ml ampicillin and was incubated overnight at 37°C.

Step 4b. Preparation of E. cnli DH n F'lO pPPXal -EcotopA Whole Cell Extract Cells were pelleted at 3000 x g for 5 min, resuspended in 25 ml 20 mM Tris-HCl (pH

7.5) and repelleted. The pellet (-1.4 g wet weight) was stored frozen at -20°C until ready for use. The pellet was thawed at room temperature 10 min and cells were resuspended in 3 ml buffer A (10 mM Tris-HCl pH 7.4, 0.2 M NaCl, 1 mM EDTA, 1 mM DTT, 10% glycerol). The cell suspension was frozen at -70°C for 10 min, thawed at room temperature for 10 min, and then transferred to ice. The cells were lysed by two passages though a French Pressure Cell press (3/8" piston diameter; American Instrument Co., Silver Spring, MD) at 18 kpsi (selector on medium, gauge set at 912). Insoluble debris was pelleted by centrifugation at 14,000 rpm for 10 min in a microcentrifuge at 4°C. The supernatant was further clarified by ultracentrifugation at 60,000 x g for 15 min at 4°C. The extract was dialyzed overnight at 4°C against Buffer A (2 x 500 ml changes) in a Slide- A-Lyzer™ 10 kDa molecular weight cut off dialysis cassette.

Step 4c. Affinity Purification of Biotinyl-E. coli DNA Topoisomerase I Fusion Protein

A 3.22 ml immobilized UltraLink™ monomeric avidin affinity column was prepared according to the suppUer's protocol. The resin was washed with 32 ml of phosphate-buffered sahne (PBS; 10 mM phosphate-buffered satine, pH 7.4, 138 mM NaCl, 2.7 mM KCl) using a peristaltic pump at 1 ml min at 4°C. High-affinity biotin binding sites were preadsorbed by washing the column with 32 ml of PBS with 2 mM biotin. The resin was regenerated by washing with 25 ml of 0.1 M glycine, pH 2.8. The resin was neutralized by washing with 32 ml of PBS until the eluate was pH 7.0, and then equilibrated with 32 ml of buffer A. The E. coli DH5α F'lQ/pPPXal -EcotopA clear lysate was filtered through a 0.45 μm nylon filter. The filtered sample was appUed to the column and the extract recirculated over the resin for 13 min at 0.1 ml/min. The column was attached to a Gradi-Frac™ Uquid chromatography system (Pharmacia, Piscataway, New Jersey) set to collect 1 ml fractions. The column was washed with 30 ml of buffer A. Buffer A containing 4 mM biotin was used to elute the biotinyl-E. coli DNA topoisomerase I fusion protein. Peak fractions, as determined spectrophotometrically by absorbance at 280 nm, were collected, pooled and dialyzed overnight at 4°C against buffer A (3 x 1 L changes) as described above in Step 4b to remove free biotin from the protein preparation. At appropriate points during the fractionation, samples of the fractions were removed and diluted into LaemmU sample buffer for analysis by SDS-PAGΕ as detailed above in the method for polyacrylamide gel electrophoresis. The presence of biotinyl-E. coli DNA topoisomerase I fusion protein in the nuclear fraction was confirmed by Western blotting and probing with an avidin-alkaline phosphatase conjugate. Topoisomerase I activity was determined as detailed above in the general methodology section. Using this method, the enzyme was purified to greater than 95% apparent homogeneity based on densitometric analysis of a Coomassie blue stained SDS-PAGE gel, as detaUed in the polyacrylamide gel electrophoresis method described above. The final purified protein preparation was mixed with 0.4 vol of 100% glycerol and stored at -20°C. A typical preparation yielded -0.6 mg/ml protein, -96,000 U/ml relaxation activity with a total yield of -6.8 mg pure biotinyl-E. coli DNA topoisomerase I fusion protein per 170 ml culture.

Example 5 Scintillation Proximity Assays with Biotinyl-E. coli DNA Topoisomerase I Fusion Protein

Step 5a. Direct Scintillation Proximity Assay with Biotinyl-E. coli DNA Topoisomerase I Fusion Protein

Serial dUutions of biotinyl-E. coli DNA topoisomerase I fusion protein, prepared as described in Example 4 above, were prepared and mixed 10 μl of 4x EBFP buffer (0.2 M Tris- HCl, pH 7.4, 0.2 M NaCl, 0.8 mM EDTA and 0.2 mg/ml BSA) and deionized H₂O in a total volume of 40 μl in several weUs of a 96-weU microplate. A control reaction with lx EBFP buffer in place of protein was also prepared. The reaction was started by addition of 1 μl of [³H]-pBR322 (-35 ng, -162,000 cpm) and incubated at 37°C for 20 min. Complexes formed between the biotinyl-E. coli DNA topoisomerase I fusion protein and [³H]-pBR322 were captured with 100 μl of diluted streptavidin-coated SPA beads (stock SPA beads were prepared according to the suppUer's instructions and further diluted 1:15 with lx ΕBFP buffer). The suspension was incubated at room temperature for 10 min with gentle shaking to aUow binding of the biotinyl-protein/[³H]-DNA complexes to the streptavidin-coated scintillant beads. The dish was transferred to a WaUac 1450 Microbeta Uquid scintillation counter (WaUac Inc., Gaithersburg, MD). Data were collected over a single 60-second sampling period. Representative data from such a "capture-mode" scintillation proximity assay experiment with biotinyl-E. coli DNA topoisomerase I fusion protein are shown in Table 1 below, and demonstrate that extent of assay signal generated is dependant upon the amount of assay target (fusion protein of the present invention) used in the assay. Table 1

Assav with Biotinvl-E. coli DNA Topoisomerase I Fusion Protein

Rintinyl-/.. coli DNA Topo- isomerase I Fusion Protein (ng) cβm

0 63

1 78

10 584

100 5,688

1000 14,441

Step 5b. Effect of Guanidine Hvdrochloride as an Inhibitor of the Biotinyl-E. coli DNA Topoisomerase I Fusion Protein ScintiUation Proximity Assav

The effect of the strong protein denaturant guanidine hydrochloride (Gu-HCl) as an inhibitor of the scintiUation proximity assay with biotinyl-E. coli DNA topoisomerase I fusion protein was tested. The assay was set up as described above in Step 5a with a fixed amount of purified biotinyl-E. coli DNA topoisomerase I fusion protein and [³H]-pBR322 DNA in each reaction. An equal volume of lx ΕBFP buffer was used where indicated to replace the omitted component Results of the assay are show in Table 2, below.

Table 2

Inhibition with Guanidine Hvdrochloride

Sample A Sample B Sample C Sam le D Sample Ε

Fusion Protein + + + - -

Gu-HCl pretreatment - + - - -

Gu-HCl added - - + - - post-SPA reaction

[³Hl-pBR322 + + + + -

SPA beads + + + + +

% maximal cpm 100 4.7 35 6.0 3.6

As seen from Table 2, pretreatment of the enzyme with 3 M Gu-HCl (Sample B) resulted in a decrease of the assay signal of greater than 95%. This reduction of the signal to near-background levels suggests that the assay signal obtained with targets prepared according to the present invention results from conformation-dependent interaction between the fusion protein and the radiolabeled reactant (The effect of pretreatment with Gu-HCl on DNA relaxation (that is, on enzyme activity) was also measured; pretreatment as in Sample B with 3 M Gu-HCl produced complete inhibition of relaxation activity.)

Table 2 also reveals that addition of 3 M Gu-HCl to already-formed biotinyl- protein/[³H]-DNA complexes (Sample C) results in a decrease of the assay signal to 35% of its original value. Without wishing to be limited by theory, it is beUeved that this residual signal is due to that portion of the protein/DNA complexes which are denatured while in a state of covalent association. Consequently, these results support the expectation that scintiUation proximity assay targets prepared according to the present invention can be used to distinguish between different types of enzyme/substrate (or, more generally, target/ligand) interactions.

Step 5c. Effect of Phospholipids as Inhibitors of Biotinyl-E. coli DNA Topoisomerase I Fusion Protein Scintillation Proximity Assav

The effect of phosphoUpids on the scintillation proximity assay with biotinyl-E. coli DNA topoisomerase I fusion protein was examined. SPA reactions with biotinyl-E. coli DNA topoisomerase I fusion protein and [³H]-pBR322 were run as detaUed above in Step 5b with the addition of various dilutions of phosphoUpids to give the final concentrations indicated. The dish was transferred to a WaUac 1450 Microbeta tiquid scintillation counter, and the data were coUected as in Step 5a. Less than 80 cpm were detected in control samples lacking DNA or protein. The SPA signal in the absence of inhibitors was 14,141 ± 1,586 cpm. The results, shown below in Table 3, demonstrate that a scintiUation proximity assay performed with the biotinyl-DNA topoisomerase I fusion proteins of the present invention can be used to identify agents such as phospholipids that block substrate binding.

Table 3

Inhibition with Phospholipids (Activity in cpm)

Phosphotipid < ;onc. Phosphatidyl Phosphatidyl

(ug/ml) Glvcerol CardioUpin ethanolamine

0.34 14,724 15,333 16,732

1.00 14,815 16,475 16,649

3.34 14,394 16,633 17,089

10.00 14,400 16,593 18,066

33.35 6,064 10,990 19,420

100.00 1,028 6,273 17,762 Step 5d. Direct ScintiUation Proximity Assav with Biotinyl-E. coli DNA Topoisomerase I Fusion Protein usinp Streptavidin FlashPlate™ Plus Microplates

The applicabUity of FlashPlate™ Plus (DuPont NΕN®) microplates with streptavidin coated wells (cf. DuPont NΕN® Research Tips pamphlet, 10/12/94, reorder No.: H51804) to scintillation proximity assays using biotinyl-E. coli DNA topoisomerase I fusion protein was investigated as follows:

Biotinyl-E. coli DNA topoisomerase I fusion protein (1 μg), prepared as described in Example 4 above, was mixed 30 μl of 4x EBFP buffer and deionized H2O in a total volume of 120 μl in 6 weUs of a 96-weU Streptavidin FlashPlate™ Plus microplate. Control wells, with lx EBFP buffer in place of protein, were also prepared. The plate was incubated at room temperature for 10 min to allow binding of the biotinyl-E. coli DNA topoisomerase I fusion protein to the walls of the streptavidin coated weUs. The reaction was started by addition of 20 μl of the enzyme substrate [³H]-pBR322 (-100 ng, -500,000 cpm) in lx ΕBFP buffer. The plate was incubated at 37°C for 60 min with gentle shaking to aUow formation of the biotinyl- protein [³H]-DNA complexes. The plate was transferred to a Packard TopCount 96-weU microplate scintiUation counter (Packard Instrument Co., Meriden, Connecticut), and data were collected over a single 1 -minute sampling period. The signal in the presence of substrate was 7,404 ± 1,867 cpm, and the control signal was 432 ± 324 cpm. These results demonstrate that scintillation proximity assays utilizing fusion proteins of the present invention can be performed with multi-weU microtitre-type scintiUant plates as weU as with more conventional scintiUation proximity assay technology (such as scintiUant beads in individual tubes).

Example 6 Preparation of Human Biotinyl-DNA Topoisomerase I Fusion Protein Nuclear Extracts

Step 6a. Expression of Biotinyl-Human Topoisomerase I Fusion Protein in Recombinant Baculovirus-Infected Insect CeUs

Expression of biotinylated human topoisomerase I fusion protein in Sf9 insect ceUs was accomplished utilizing the baculovirus expression system from PharMingen, supra. The procedures detailed in the manual from PharMingen were foUowed (Gruenwald and Heitz, Baculovirus Expression Vector System: Procedures and Methods Manual (PharMingen, San Diego, California, 1993). Recombinant virus, which contained the human TOP] gene fused to the biotinylation domain from the construct pVL1392-BiohTOPl described above in Example 3, was used to infect Sf9 cells for production of the desired fusion protein. Controls included uninfected Sf9 ceUs and wild-type baculovirus-infected ceUs. Step 6b. Fractionation of Recombinant Baculovirus-Infected Insect Cells

Approximately 72 hours post-infection, the Sf9 ceUs of Step 6a were harvested and washed with phosphate-buffered saUne (PBS). In order to determine the localization of the biotinyl-human topoisomerase I fusion protein, the cells (including those of the controls) were fractionated according to a protocol adapted from Miyamoto et al. (Molec. Cell. Biol. 5:2860- 2865 (1985)). The cells were incubated in hypotonic buffer (10 mM Tris-HCl, pH 7.5, 10 mM NaCl and 1.5 mM MgCl_>) at 4°C for 30 min and were centrifuged to separate the nuclei from the cytoplasmic fraction. After removal of the supernatant (cytoplasmic fraction), the nuclear peUet was incubated in hypotonic buffer containing 1% Nonidet™ P-40 nonionic detergent and 0.5% deoxycholate at 4°C for 30 min to strip the nuclei. The stripped nuclei were then peUeted by centrifugation, and the supernatant containing the membrane-associated fraction was removed. In order to dissociate the biotinyl-human topoisomerase I from the chromatin and to swell the nuclear pores, the nuclei were then incubated in hypotonic buffer containing 0.5 M NaCl at 4°C for 30 min. After centrifugation, the supernatant containing the biotinyl-human topoisomerase I was removed, and hypotonic buffer was added to the insoluble pellet. The nuclear fractions from the recombinant baculovirus and the controls were diluted in 2x storage buffer (99% glycerol, 100 mM NaCl, 100 mM KPO₄, pH 7.0, 0.1 mM PMSF, and 1 mM DTT), aUquoted, and stored at -20°C for future use. At appropriate points during the fractionation, samples of the fractions were removed and dUuted into LaemmU sample buffer for analysis by SDS-PAGE as detailed above. The presence of biotinyl-human topoisomerase I fusion protein in the nuclear fraction was confirmed by Western blotting and probing with an avidin-alkaUne phosphatase conjugate.

Example 7 Scintillation Proximity Assav with

Human Biotinyl-DNA Topoisomerase I Fusion Protein

Step 7a. Preparation of Human Biotinyl-DNA Topoisomerase I Fusion Protein Coated Streptavidin-fluoromicrosphere ScintiUation Proximity Assav Beads Experiments with the human biotinyl-DNA topoisomerase I fusion protein were performed in "real-time" mode since the protein was not purified to homogeneity. The human biotinyl-DNA topoisomerase I fusion protein, prepared in Example 6 above, was bound to streptavidin-coated SPA beads by incubating 20 μl of nuclear extract and 30 μl of lx dUuent (10% glycerol, 15 mM potassium phosphate, pH 7.2, 0.1 mM EDTA, and 1 mg/ml BSA) with 50 μl of SPA beads pre-equiUbrated in lx HBFP buffer (100 mM KCl, 10 mM MgCl₂, 20 mM Tris, pH 7.5, 0.1 mM EDTA, and 40 μg/ml BSA). The suspension was mixed gently at 4°C for 20 min. The endogenous non-biotinylated insect cell DNA topoisomerase I was washed away from the human biotinyl-DNA topoisomerase I fusion protein-coated SPA beads by dUution with 100 μl of 2x HBFP buffer followed by peUeting of the beads at 14,000 rpm in a microcentrifuge for 15 min at 4°C. The supernatant was removed, and the peUet was resuspended in 200 μl of lx HBFP buffer. The wash procedure was repeated and the final peUet resuspended in 750 μl of lx HBFP buffer. Control experiments were performed with non-biotinylated human DNA topoisomerase I, and indicated that the above washing procedure removes greater than 99% of the residual non-biotinylated endogenous insect cell DNA topoisomerase I. The human biotinyl-DNA topoisomerase I fusion protein-coated SPA beads contained 12.5 U/μl relaxing activity when assayed as detaUed above in the DNA topoisomerase assay method of Example 1.

Step 7 b. Real-Time ScintiUation Proximity Assav with Human Biotinyl-DNA Topoisomerase I Fusion Protein

Human biotinyl-DNA topoisomerase I fusion protein coated SPA beads, prepared as described in Section 7a, were mixed with lx HBFP buffer in a total volume of 100 μl. The reaction was started by addition of 50 μl of [³H]-pBR322 (-50 ng, -15,000 cpm, -40,000 dpm), gently mixed and transferred to a WaUac 1410 liquid scintiUation counter (WaUac Inc., Gaithersburg, Maryland). Data were coUected repeatedly over 60-second sampUng periods with the instrument in ³²P-cpm mode. Representative data from such a real-time mode SPA experiment with human biotinyl-DNA topoisomerase I fusion protein are shown in Table 4 below, and demonstrate not only a high signal-to-background ratio but also the potential for kinetic analysis using the fusion proteins of the present invention in scintiUation proximity assays.

Table 4

Scintillation Proximity Assav with Human Biotinyl-DNA Topoisomerase I Fusion Protein

Volume of Coated Beads Controls

Time 50 μl 100 μl - Protein + Protein (min) (cpm) (cpm) + DNA - DNA

6 5,741 9,929 97 29

15 8,210 14,851 107 22

24 9,464 16,594 125 27

30 10,184 17,561 114 27

60 10,776 18,007 102 19

90 11,084 18,268 115 26

120 10,940 17,871 120 39 Step 7c. Effect of Camptothecin as an Inhibitor of Scintillation Proximity Assav with Human Biotinyl-DNA Topoisomerase I Fusion Protein Camptothecin (CFT) previously has been shown to specifically interfere with the breakage-reunion reaction of topoisomerase I by trapping the enzyme in a putative covalent reaction intermediate termed the "cleavable complex" (Hsiang et al., J. Biol. Chem. 260:14873-14878 (1985)). The drug-stabiUzed cleavable complex can be converted to protein- tinked DNA breaks by treatment with strong protein denaturants. The effect of CPT on the scintiUation proximity assay with human biotinyl-DNA topoisomerase I fusion protein was examined. SPA reactions with human biotinyl-DNA topoisomerase I fusion protein and [³H]-pBR322 were run as detaUed above in Section 7b with the addition of various dUutions of CPT to give the final concentrations indicated. The data shown in Table 5 below are average steady-state values, which varied by less than 5% over time.

Table 5

Effect of Camptothecin as an Inhibitor of ScintUlation Proximity Assav

Camptothecin cpm after Resistance (ug/ml) cpm 3 M Gu-HCl to Treatment (%)

0 10,429 6,615 63.4

0.001 10,425 6,958 66.8

0.003 10,448 7,103 68.0

0.01 10,358 6,981 67.4

0.03 10,557 7,397 70.1

0.1 10,359 7,285 70.3

0.3 10,482 7,438 71.0

1 10,061 7,286 72.4

3 9,702 7,089 73.1

10 10,255 7,868 76.7

30 9,737 7,330 75.3

As the concentration of CPT increases, the fraction of SPA signal resistant to Gu-HCl treatment (and presumably due to a stabUized covalent protei /DNA complex) is observed to increase. These results demonstrate yet another use of the fusion proteins of the present invention, namely, the preparation of scintillation proximity assays for the identification of agents which induce stabilization of covalent enzyme-substrate complexes.

It wiU be apparent to those slilled in the art that other sources of genes and vectors or described above may be used, alternate bacterial hosts may be employed, and enzymatic procedures may be altered without changing the scope or intent of the invention. Moreover, various technical obstacles, such as insoluble and inactive protein fusion products, may be overcome by procedural modifications and design choices weU-known in the art, such as incubating the cultures expressing the hybrid fusion proteins at lower temperatures, co- expressing chaperonin proteins to facilitate proper folding, or altering the level of expression by changing expression vector constructs or host strains.

It is further expected that the fusion proteins of the present invention may be employed in different types of scintiUation proximity assays, such as for direct measurement of radioactive Ugands, for indirect assays of inhibitory molecules, or for kinetic studies of a wide variety of target molecules, and that the present invention may be practiced in forms other than those specifically described above without departing from the spirit thereof. The above examples therefore should not be regarded as limiting of the scope of the invention, which is defined exclusively by the appended claims and their equivalents.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Lerner, Claude G.

(ii) TITLE OF INVENTION: improved Method For Preparing

Scintillation Proximity Assay Targets (iii) NUMBER OF SEQUENCES: 2 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Abbott Laboratories

(B) STREET: D377/AP6D, 100 Abbott Park Road

(C) CITY: Abbott Park

(D) STATE: Illinois

(E) COUNTRY: United States of America

(F) ZIP: 60064-3500

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Diskette, 3.50 inch, 800 Kb storage

(B) COMPUTER: Apple Macintosh • (C) OPERATING SYSTEM: System 7.0.1

(D) SOFTWARE: MS Word v.5.1a (saved as "Text Only") (vi) CURRENT APPLICATION DATA: Not available (vii) PRIOR APPLICATION DATA: Not applicable (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Danckers, Andreas M.

(B) REGISTRATION NUMBER: 32,652

(C) REFERENCE/DOCKET NUMBER: 5640.US.Ol (ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (708) 937-9396

(B) TELEFAX: (708) 938-2623

(2) INFORMATION FOR SEQ ID NO: 1 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 39 bases pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1

GCTGCGAAGC TTCTACCATG GGTAAGGCTC TTGTCATCG 39 (3) INFORMATION FOR SEQ ID NO:2 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2

CGCGGATCCC TTCAGCCAGT TGTTTCAGTT CAG 32

Claims

What is claimed is:

1. A method for immobUizing an assay target on a fluorescent support for use in a scintillation proximity assay, comprising the steps of:

(a) expressing a fusion protein comprising a linking domain and a functional domain, wherein said linking domain comprises a biotin-accepting domain;

(b) biotinylating said biotin-accepting domain during or after expression of said fusion protein; and

(c) attaching said fusion protein to said fluorescent support via said biotinylated linking domain.

2. A method according to Claim 1 wherein said fusion protein is attached to said fluorescent support by means of binding between a biotinyl group on said biotin-accepting domain and a streptavidin or avidin group on the surface of said support.

3. A method according to Claim 2 wherein said biotin-accepting domain originates from the 1.3S biotin-containing subunit of Propionibacterium shermanii transcarboxylase.

4. A method according to Claims 1 or 2 wherein said assay target comprises a polypeptide capable of specific binding to a radiolabled reactant in a manner detectable by said scintiUation proximity assay, said functional domain comprising said polypeptide.

5. A method according to Claim 4 comprising an additional step of exposing said polypeptide to said radiolabeled reactant, said additional step being carried out before said attaching step (b).

6. A method according to Claim 4 comprising an additional step of exposing said polypeptide to said radiolabeled reactant, said additional step being carried out after said attaching step (b).

7. A method according to Claim 4 wherein said polypeptide is selected from the group consisting of enzymes, transcription factors, DNA binding proteins, RNA binding proteins, receptors, ceU adhesion molecules, and operational fragments and active sites thereof.

8. A method according to Claim 7 wherein said polypeptide is a topoisomerase enzyme and said radiolabled reactant is [³H]-labeled supercoiled deoxyribo nucleic acid.

9. A method according to Claim 8 wherein said topoisomerase enzyme is human topoisomerase I.

10. A method according to Claim 8 wherein said topoisomerase enzyme is of bacterial origin.

11. A method according to Claim 10 wherein said topoisomerase enzyme is Escherichia coli topoisomerase I.

12. A method according to Claims 1 or 2 wherein said assay target is a component of a whole cell and said functional domain comprises a polypeptide capable of attachment to said cell.

13. A method according to Claim 12 wherein said polypeptide comprises a transmembrane protein capable of insertion into the membrane of said cell.

14. A method according to Claims 1 or 2 wherein said assay target is a component of a membrane vesicle and said functional domain comprises a polypeptide capable of attachment to said vesicle.

15. A method according to Claim 14 wherein said polypeptide comprises a transmembrane protein capable of insertion into the membrane of said vesicle.