JPH04299985A - Oligonucleotide for detecting plant transformant and detection process - Google Patents

Abstract

PURPOSE:To provide the subject compound comprising a gene coded to a DNA of a microorganism belonging to genus Pseudomonas, targeting a gene participating in the synthesis of ice nucleation protein and useful as a probe for efficiently detecting a transformant in the development of new variety of a plant. CONSTITUTION:An oligonucleotide expressed by formula I and formula II and complementary to the nucleotide sequence of a gene inaZ participating in the synthesis of an ice nucleation protein of DNA of Pseudomonas syringae is chemically synthesized from the base sequence of the gene inaZ. The produced oligonucleotide is used as a primer for detecting the gene existing near the plant cell of a developed tobacco leaf, etc. In order to perform the detection, the primer is hybridized to the subject nucleotide sequence of single-stranded state in a specimen, the chain is extended by the polymerization reaction of four kinds of nucleotides, the obtained double-stranded nucleotide is separated into single-stranded state and the product is amplified by the chain-extension reaction using the complementary chain as a template for the other chain. The amplified product is detected e.g. by electrophoresis to determine the objective oligonucleotide in the specimen.

Description

[Detailed description of the invention]

0001

[Industrial Application Field] The present invention provides a probe for efficiently detecting or confirming transformants when developing new varieties with new traits by introducing genes into plants using genetic engineering techniques. The present invention relates to an oligonucleotide as an oligonucleotide and a method for detecting the same. More specifically, when inducing transformed tissue from plant tissues using recombinant microorganisms, probes are extremely effective in determining whether the tissue obtained is that of the parent plant or the transformed tissue. The present invention relates to an oligonucleotide as an oligonucleotide and a method for detecting the same.

0002

[Prior art] In recent years, in plant breeding technology, genetic engineering techniques have been used to introduce certain foreign genes into plants and express traits specific to that gene, thereby creating new traits that were not present in existing species. Many attempts have been made to add . The microorganism used as the recombinant microorganism is suitably a microorganism that originally has the ability to actively infect plants, and this is what is called a plant pathogenic microorganism. In order to use these microorganisms for plant transformation, it is desirable to at least maintain the ability to infect plants, eliminate the inherent pathogenicity, and express the target useful gene.

[0003] To confirm whether a newly obtained plant tissue is truly a transformant, analysis at the gene level is required for both introduction confirmation and expression confirmation.

0004

[Problems to be Solved by the Invention] However, at the present stage, efforts are being made to acquire useful genetic resources for use in recombinant DNA, and the current situation is that practical use has not yet been reached.

[0005] Therefore, the purpose of the present invention is to detect whether a plant tissue is truly a transformant at the genetic level.

[0006]

[Means for Solving the Problems] In order to achieve the above object, the present inventor has conducted extensive research and has discovered that a specific gene present near plant cells can be detected by a gene amplification method using oligonucleotides as primers. They discovered that it can be detected efficiently, and after further research, they completed the present invention. Here, the gene amplification method is
Polymerase Chain Re developed by
action method (hereinafter abbreviated as PCR method; Scie
nce. 230, 1350 (1985)).

[0007] In this method, when detecting a specific nucleotide sequence region, one end of the region recognizes the + strand and the other end recognizes the - strand and hybridizes with the oligonucleotides using one primer and the other primer. They are prepared as primers for a template-dependent nucleotide polymerization reaction against a sample nucleic acid that has been made into a single-stranded state by thermal denaturation, and the resulting double-stranded nucleic acid is separated into single strands, and the same reaction is repeated. cause to happen. By repeating this series of operations, the copy number of the region sandwiched between the two primers increases to the point where it can be reliably detected.

Materials include all tissues and organs of plants, such as dedifferentiated cells, tumor tissues, roots, stems, leaves, etc.
It can also be flower petals. In order to use these materials as samples for PCR reactions, pretreatment is required to release nucleic acid components from the plant materials. However, if the number of nucleic acids to which the primer can hybridize exists is several to tens of molecules or more, P
Since the CR reaction progresses, a sample solution with a sufficient amount of nucleic acid to allow the PCR reaction to proceed can be prepared by simply treating the material with oxygen, surfactant, alkali, or mechanical crushing for a short time. .

[0009] The oligonucleotide used as a primer in the present invention is Pseudomonas syringe.
The gene inaZ (ic
e-nucleation protein gene
) (Nature 317, 645-648 ('85
)) and has the following (a) or (b) sequence complementary to the nucleotide sequence of the gene (5') d-CTGCACTGAAGGTTTCACT
G (3')...(a)(5')d-GAATAGCA
TCATGACGCCAG (3') ... (b) or the gene iceE (ice nucleus active protein synthesis), which is encoded in the DNA of Ervinia herbicolaA.
tion protein gene) (Warren
,G. J. & Corotto, Corotto. L.
V. Unpublished ('89)),
An oligonucleotide (5') having the following (c) or (d) sequence complementary to the nucleotide sequence of the gene:
-GAACCAGAGGGAGTAAGACTG (3'
)...(c)(5')d-GTTAGTCCGTTCT
CAAAGCC (3')...(d) is used.

[0010] In consideration of specificity, detection sensitivity, and reproducibility, the oligonucleotide used as a primer in the present invention may be a nucleotide fragment of at least 15 bases to about 30 bases, and may be either chemically synthesized or natural. But that's fine.

[0011] Furthermore, the two primers in the present invention are, for example, one primer being an oligonucleotide containing the a sequence, and the other primer being an oligonucleotide containing the b sequence.

[0012] Further, the primer does not need to be specifically labeled for detection. D defined by the primer
The amplified region in NA should be from 50 bases to 2000 bases, preferably about 200 bases to 300 bases.

[0013] The template-dependent nucleotide polymerization reaction includes:
A thermostable DNA polymerase is used, but this enzyme has a
It may be derived from any biological species as long as its activity is maintained at a temperature of 0 to 95°C. This enzyme is a known substance, and for example, one manufactured by Perkin Elmer Cetus may be used. Thermal denaturation temperature is usually 90 to 95°C, the temperature for annealing operation for hybridizing primers is usually 37 to 65°C, and the temperature for nucleotide polymerization reaction is usually 50 to 7°C.
The number of copies of the target nucleotide fragment is amplified by carrying out a PCR reaction at 5° C. for one cycle, usually for 20 or more cycles, preferably 30 to 45 cycles, depending on the DNA weight of the sample. For detection, the presence and length of the amplified nucleotide fragment can be confirmed by directly subjecting the enzyme reaction solution to agarose gel electrophoresis.

[0014] From the results, it can be determined whether or not a nucleic acid having a sequence to be recognized by the primer is present in the material. This determination directly determines the presence or absence of DNA.

[0015] Various types of electrophoresis and chromatography, such as acrylamide electrophoresis, are also effective for detecting amplified nucleotide fragments. Furthermore, in electrophoresis, detection can be performed without labeling primers etc. by adding a marker to determine the molecular weight and/or using a nucleic acid staining method using ethidium bromide or the like.

[0016]

[Operation] According to the present invention, a specific gene is amplified by PCR method and the gene is detected, so that it is possible to confirm whether or not the plant is a transformant at the genetic level.

[0017]

[Example] (Experimental example 1: Pseudomonas sy
ice nucleation pro by ringae
Detection of tein gene) Sample preparation Tobacco (Nicotiana tabacum cv.
Pseudomonas syringa cultured overnight in LB medium with shaking on the surface of the expanded leaves (Samsun)
2 μl of e-strain Ni23 culture suspension was applied.

Radius 2.2 mm from the center point where the bacterial cell suspension was applied.
Punch out the leaf into a 5 mm disc, place it in a 1.5 ml Eppendorf tube, and add 40 μl of buffer (0.1
M Potassium Phosphate pH7.
0) and pulverized in a 0.5 ml Eppendorf tube.

[0019] Lysozyme (10mg/m
1) was added and incubated at 25°C for 15 minutes. Subsequently, Alk-SDS solution (0.2N N
50 μl of aOH, 1% SDS) was added, and the mixture was allowed to stand at 25° C. for 10 minutes. Next, 3M Potassium a
37.5 μl of cetate was added and left standing at 25° C. for 10 minutes.

[0020] Collect the supernatant by centrifugation at 15,000 rpm at 4°C for 20 minutes, and add 0.5 volumes of 2-pro
Panol was added and centrifuged at 20°C and 15,000 rpm for 2 minutes. The obtained precipitate was diluted with 75% ether.
After washing with -nol and drying, 1 ml of distilled water was added to prepare a sample solution.

Synthesis of primers Gene i related to the synthesis of ice nucleating protein of DNA possessed by Pseudomonas syringae
From the base sequence of naZ, (5')d-CTGCAC
TGAAGGTTTCACTG (3')... (a sequence; SEQ ID NO: 1) and (5') d-GAATAGCATCATGACGC
Select CAG (3')... (b sequence; SEQ ID NO: 2),
Oligonucleotides having the same sequence were chemically synthesized and used as primer (a) and primer (b), respectively. MILLIPORE's Cycl is used for chemical synthesis.
This was carried out by the phosphonate method using on plus DNA synthesizer. A C18 reverse phase column was used to purify the synthesized oligonucleotide.

PCR Using 3 μl of the above sample solution, add 1 ml of sterile distilled water to it.
4.55 μl, 10x reaction buffer 3 μl, dN
TP solution 4.8 μl, NP40 solution 3 μl, primer (a) 0.75 μl, primer (b) 0.
75 μl, and 0.1 thermostable DNA polymerase
5 μl was added to prepare a 30 μl reaction solution. Add mineral oil (SIGMA) to the container containing this reaction solution.
50 μl of the above was layered.

[0023] Details of the additive liquid are as follows. 10x reaction buffer; 500mM KCl, 100m
M Tris-HCI (pH 8.3), 15mM M
gC12, 0.1% (w/v) gelatin NP40 solution; mixture of NONIDET P-40, Tween 20 (final concentration of both 0.05%) dNTP solution; dATP, dCTP, dGTP,
dTTP mixture (both final concentrations 1.25mM) Primers (a) and (b); Each aqueous solution of the chemically synthesized purified product mentioned above (5 ODU/ml) Thermostable DNA polymerase; Taq DNA polymerase (5 units/ml) ; Perkin Elm
er Cetus).

The reaction conditions are as follows. Heat denaturation: 94℃ for 1 minute Annealing: 55℃ 1 minute Polymerization reaction: 72°C for 1 minute.

The process from thermal denaturation to annealing to polymerization reaction was defined as one cycle (required time: 5.7 minutes), and this process was repeated for 42 cycles (total time required: approximately 4 hours). These operations are performed by Perkin Elmer Cetus
The above reaction conditions were programmed into a DNA Thermal Cycler manufactured by Co., Ltd.

Detection In order to detect the amplified nucleotide fragments from the reaction solution, agarose gel electrophoresis was performed under the following conditions.

[0027] The agarose gel has a gel concentration of 2% (w/v
) containing ethidium bromide (0.5 μg/ml). The electrophoresis was performed at a constant voltage of 150 V for 35 minutes. Please note that the operating method and other conditions are
Molecular Cloning (19
This was done using the technique described in 82). In addition to the reaction solution, molecular weight markers were also run at the same time, and the lengths of nucleotide fragments detected in the gel and under ultraviolet light were calculated by comparing relative mobilities.

Results As mentioned above, Pseudomonas syrin
The nucleotide sequence of the inaZ gene in the DNA of G. g. According to this, when primer (a) and primer (b) were used, an estimated 155 base pairs of nucleotides should have been amplified. This estimate agreed well with the results of agarose gel electrophoresis.

FIG. 1 shows the results of agarose gel electrophoresis of the amplified nucleotide fragments. In the figure, (a) indicates the marker (φ× 174/HinC II), and (b) indicates Pseudomonas syrin-gae str.
ain Ni23, (c) tobacco leaves (control),
(d) shows a tobacco infected leaf.

(Experimental example 2: Ervinia herbi
cola's ice nucleation prot
(Detection of ein gene) As a sample, Ervini
Using a herbicola strain M42 culture suspension, (5') d-GAACCAGAGGA was used as a primer.
GTAAGACTG (3')... (c sequence, SEQ ID NO: 3) (5') d-GTTAGTCCG
TTCTCAAAGCC (3')...(d sequence, SEQ ID NO: 4) except that the nucleotide sequence was synthesized as in Experimental Example 1.
Sample preparation, primer synthesis, PC
R, detection was performed.

[0031] As mentioned above, Ervinia her
The iceE gene in the DNA of Bicola is
The base sequence has already been determined, and the size of the oligonucleotide of the present invention, that is, the nucleotide amplified by the primer by PCR, can be estimated. According to this, when primer (c) and primer (d) were used, an estimated 189 base pairs of nucleotides should have been amplified. This estimate agreed well with the results of agarose gel electrophoresis.

FIG. 2 shows the results of agarose gel electrophoresis of the amplified nucleotide fragments. In the figure, (a) indicates the marker (φ× 174/HinC II), and (b) indicates Pseudomonas syrin-gae str.
ain Ni23, (c) tobacco leaves (control),
(d) shows a tobacco infected leaf.

[0033]

Effects of the Invention In the present invention, the primers amplify the copy number of a target nucleotide in a plant by employing PCR. Moreover, since the nucleotide sequence to be amplified can be defined by the reaction of two or more primers, according to the present invention, a specific foreign gene can be easily detected from transformants with high sensitivity, and high selectivity can be obtained during detection. It will be done.

In the present invention, although high detection sensitivity is obtained, a large amount of material is not required for detection, and pretreatment of the material is simple. Moreover, the reaction time is short, detection requires simple equipment, and operation is easy, so the time it takes to obtain results can be significantly shortened. In addition, in the present invention, by using agarose gel electrophoresis and nucleic acid staining with ethidium bromide for detection, detection can be performed without labeling primers, etc., and the length of the nucleotide fragment can be confirmed, making the results reliable. becomes more sexual.

Furthermore, with regard to the detection of microorganisms that have target nucleotides, they have high selectivity for target nucleotides, so if a target nucleotide is incorporated into a microorganism in, for example, a plant transformation experiment using a recombinant microorganism, it will be possible to detect the target nucleotide in the plant body. It can be used as an indicator of the presence of microorganisms.

[0036]

[Sequence list] Sequence number (SEQ ID NO): 1
Sequence length 20 base sequence type
Number of nucleic acid strands
Single-stranded topology Types of linear sequences Genomic DN
A Hypothetical Sequence NO Antisense NO Origin Pseudom
onas syringae sequence characteristics
How the characteristics were determined S array
CTGCACTGAAGGTTTCA
CTG

SEQ ID NO.
): Length of 2 sequences Type of 20 base sequence Number of nucleic acid strands
single strand topology
Types of linear sequences Genomi
c DNA hypothetical sequence NO antisense NO Origin Pseudom
onas syringae sequence characteristics
How the characteristics were determined S array
GAATAGCATCATGACGC
CAG

[0038] SEQ ID NO.
): Length of 3 sequences Type of 20 base sequence Number of nucleic acid strands
single strand topology
Types of linear sequences Genomi
c DNA hypothetical sequence NO antisense NO Origin Ervinia
Characteristics of herbicola sequences
How the characteristics were determined S array
GAACCAGAGGGAGTAAGACTG

[0039] Sequence number (SEQ ID NO):
4 length of sequence 20 base sequence type
Number of nucleic acid strands
Single-stranded topology Linear sequence type Genomic D
NA hypothetical sequence NO antisense NO Origin Ervinia
Characteristics of herbicola sequences
How the characteristics were determined S array
GTTAGTCCGTTCTCAAAGCC

[Brief explanation of drawings]

FIG. 1 is an agarose gel electropherogram of the amplified nucleotide fragment of Experimental Example 1.

FIG. 2 is an agarose gel electropherogram of the amplified nucleotide fragment of Experimental Example 2.

Claims (1)

[Claims] [Claim 1] Pseudomonas syrin
A gene encoded by the DNA of gae,
The gene inaZ (i
ce nucleation protein gene
) An oligonucleotide having the following sequence (a) or (b) that is complementary to the nucleotide sequence of the gene. (5') d-CTGCACTGAAGGTTTCACT
G (3')...(a)(5')d-GAATAGCA
TCATGACGCCAG (3')...(b) [Claim 2] D of Ervinia herbicola A
The gene iceE (ice nu
creation protein gene), and the following (
c) or (d) an oligonucleotide having the sequence. (5')d-GAACCAGAGGAGTAAGACT
G (3')...(c)(5')d-GTTAGTCC
GTTCTCAAAGCC (3')...(d) [Claim 3] A method for detecting the gene according to claim 1 or 2, which is present in the vicinity of a plant cell, comprising: (i) a single-stranded gene in a sample; In the target nucleotide sequence, claims 1 and 2
Any oligonucleotide (primer) described in
hybridize, perform a chain length reaction by polymerizing four types of nucleotides, separate the resulting double-stranded nucleotide sequence into single strands, and use the complementary strand as a template for the chain length reaction using the other primer. By repeating the simultaneous chain length reaction using these two primers and the separation of the chain length reaction product from the template, the number of copies of a specific nucleotide fragment is amplified, and ■ the amplified nucleotide fragment is Detecting by electrophoresis or chromatography, and (1) determining whether or not the nucleotide sequence to be recognized is present in the sample by determining the molecular weight of the fragment and/or nucleic acid staining. A method for detecting a transformant, comprising: