RU2265668C1 - Set of primers for detection and/or identification of transgene dna sequences in vegetable material and product comprising thereof (variants), primer (variants), pair of primers (variants), method for detection and/or identification with their using (variants) and device for realization of method - Google Patents

Abstract

FIELD: biotechnology, genetic engineering.

SUBSTANCE: inventions represent sets of primers, pairs of primers and individual primers used in detection and/or identification of transgene DNA sequences in vegetable material and products comprising thereof, methods for detection and/or identification with their using and a device for realization of one of methods. Primers are complementary to 5 typical marker genes and regulatory DNA sequences - gus gene from microorganism E. coli, nptII gene from transposon Tn5, 35S-promoter site in cauliflower mosaic virus, terminator sites in nos gene and ocs gene from A. tumefaciens that comprises most often in genetic constructions of the most abundant in the world market of transgene plant strains and have nucleotide sequences given in SEQ ID Nos. 1-10. Methods involve DNA extraction from vegetable material and products comprising thereof, carrying out asymmetric or symmetric polymerase chain reaction (PCR), among them the multiplex reaction, with taking part of extracted DNA and set of primers, separation of amplified reaction products and their following detection and/or identification by their hybridization with oligonucleotides immobilized on biological microchip or by gel-electrophoresis method, or by using amplifying agent in real time regimen. Original selection of primers and addition of correcting nucleotide exchanges in their sequences provide similarity in their thermodynamic parameters and complete compatibility in sets that provides their effective working in the similar reaction conditions and enhance specificity, sensitivity and reliability of methods for detection and/or identification of transgene DNA sequences with their sharing significantly. Using in method in hybridization analysis of PCR results with specially developed biological microchips BM "Tressigen"-aminated glasses with oligonucleotides immobilized directly on their surface with nucleotide sequences given in SEQ ID Nos. 11-15, and apparatus-program complex "Degmigen" enhances specificity, economy and technological effectiveness of the process significantly. Inventions can be used in monitoring biological safety of nutrient, fodder foodstuffs and other goods of mass consumption.

EFFECT: improved method for analysis, valuable properties of primers.

54 cl, 5 dwg, 1 tbl, 5 ex

Description

FIELD OF THE INVENTION

The invention relates to biotechnology, in particular to genetic engineering, relates to ecology in terms of the biological safety of food, feed products and represents sets of primers, pairs of primers and individual primers for the detection and / or identification of transgenic DNA sequences in plant material and its products, methods detection and / or identification with their use and device for implementing one of the methods.

The invention can be used for monitoring the biosafety of food, feed and other consumer goods.

State of the art

Currently, two alternative methods are used to detect transgenic components of genetically modified plant organisms based on the detection and / or identification of modified biopolymers of these organisms - proteins or nucleic acids.

A known method for identifying plant transgenic proteins using appropriate antibodies (Stave JW, Food Control, 1999, vol. 10, pp. 367-374), as well as a method for detecting genetically modified plants containing NPT II protein using kanamycin and / or paromomycin (US 2003/0017599 A1).

The known methods have significant disadvantages. First, proteins are very labile biopolymers capable of changing both the conformation of the molecule and the secondary structure under various physical and chemical influences. As a result, the detection of foreign proteins by the indicated methods in products that have undergone a deep thermal, chemical or microbiological treatment becomes practically impossible.

Secondly, the sensitivity of the known methods is not always sufficient for reliable detection of small amounts of foreign proteins in transgenic products.

Thirdly, the implementation of these methods takes a lot of time and requires significant material costs due to the use of expensive reagents, in particular, specific antibodies and antibiotics.

An alternative method based on the detection and / or identification of transgenic nucleic acid sequences of genetically modified plant organisms is the analysis, in particular, their DNA using polymerase chain reaction (PCR). This method has several significant advantages.

Firstly, the analyzed biopolymer (DNA) is much more stable than the protein, therefore, it can also be studied in products that have undergone deep technological processing. In addition, even in case of destruction of the primary structure of the biopolymer, namely, degradation of DNA to fragments with a length of 150-200 base pairs, this method is suitable.

Secondly, the method has wider capabilities and allows us to identify not only expressed genome regions, but also auxiliary ones, such as promoters and transcription terminators.

Thirdly, the method is highly sensitive and allows reliable detection of transgenic sequences when the sample contains less than 10 ^-15 - 10 ^-14 g of the analyzed DNA.

Known methods for detecting genetically modified plants by detecting a single transgenic sequence of their DNA, namely the gus marker gene from the bacterium Escherichia coli (JP 2000197486), the terminator region of the nos gene from Agrobacterium tumefaciens (JP 2000210092) and the 35S promoter region of cauliflower mosaic virus (KR 1020030003785 A).

Moreover, in the first two cases, the amplified products obtained as a result of symmetric PCR with the participation of extracted DNA and a pair of primers are separated by gel electrophoresis and detected by staining them in a gel with a fluorescent dye; in the latter case, amplified products containing a fluorescent label are identified in real time by measuring the intensity of the fluorescent signal.

The primers used in the known methods for PCR amplification of transgenic DNA sequences have the following nucleotide sequences:

- primers for the gus marker gene from the bacterium Escherichia coli:

(5 ') d - GTAGAAACCC CAACCCGTG (3') ............... (1)

(5 ') d - CGTTGTTCAC ACAAACGGTG (3') ............... (2)

- primers for the terminator region of the nos gene from Agrobacterium tumefaciens

(5 ') d - TCATGATCAGATTGTCGTTT (3') ............ (1)

(5 ') d - CGGATAAACC TTTTCACGCC (3') ........................ (2)

- primers for 35S - promoter region of cauliflower mosaic virus

(5 ') d - TAGTGGAAAA GGAAGGTGGC (3') ............ (2)

(5 ') d-AGATATCACATCAATCCACT (3') .............................. (3)

(5 ') d - ATTGCCCCAG CTATCTGTCA C (3') ..................... (4)

(5 ') d - ATCACATCAA TCCACTTDC (3') ............... (5)

(5 ') d - TAGTGGAAAA GGAAGGTGGC (3') ............... (6)

(5 ') d - AGGATAGTGG GATTGTGC (3') .................. (7)

However, the value of the change in the free energy of the interaction of 3 'terminal nucleotides with template DNA (hereinafter, the change in free energy) of both primers (1 and 2) for the marker gene gus is very low (ΔG = -9.9 kcal / mol, ΔG and Tm for primers were calculated using the OLIGO program), which leads to an increased likelihood of their non-specific binding to the analyzed DNA. In addition, primer (2) forms an intra-primer hairpin with Tm = 55 ° C, which complicates its interaction with the analyzed DNA.

The value of the change in the free energy of the 3 '- terminal nucleotides of primer (1) for the terminator region of the nos gene is too low (ΔG = -11.1 kcal / mol) and leads to its nonspecific interaction with matrix DNA. As for primer (2), its melting temperature (Tm = 44.8 ° C), which determines the annealing temperature, is unacceptably low, which significantly increases the background of nonspecific reactions. In addition, the 3 '- terminal tetrameric portion of the nucleotide sequence of the primer (2) - GTTT is complementary to the homologous tetrameric portion of the nucleotide sequence of the primer (1) - AAAS, which causes inter-primer interactions.

Regarding 3 pairs of primers for the 35S promoter region of the cauliflower mosaic virus, it should first be noted that the template DNA sequence for their selection does not correspond to that used in the most common varieties of transgenic soy. In addition, the amplicons obtained by participating in the PCR of all 3 pairs of primers contain a refractory hairpin with Tm = 86.0 ° C, which prevents the amplification process.

Primer (2) includes a too refractory 3'-terminal tetrameric region with ΔG = -9.4 kcal / mol, which determines its non-specific interaction with the analyzed DNA. The fusibility of primers (3), (5) and (7) [Tm (3) = 40.0 ° C, Tm (5) = 44.7 ° C and Tm (7) = 43.8 ° C] significantly increases the background non-specific reactions.

A known method for the detection of genetically modified plants by detecting 2 transgenic sequences of their DNA, namely 35S - the promoter region of the cauliflower mosaic virus and the terminator region of the nos gene from Agrobacteriun tumefaciens, recommended by Regulation of the European Parliament and Council No. 1829/2003 of 09/22/2003 . "On Genetically Modified Food and Feed" (Lipp M., Brodmann P., Pietsch K., Pauwels J., Anklam E. Journal of AOAC International, 1999, vol. 82, No. 4, pp. 923-928) and included in the national standard of the Russian Federation (GOST R 52173-2003).

Obtained in the known method as a result of a symmetric PCR involving extracted DNA and 2 pairs of primers, the amplified products are separated by gel electrophoresis and detected and / or identified by staining them in a gel with a fluorescent dye.

The primers used in this method have the following nucleotide sequences:

- primers for 35S - promoter region of cauliflower mosaic virus

(5 ') d - GCTCCTACAA ATGCCATCA (3') ............... (1)

(5 ') d - GATAGTGGGA TTGTGCGTCA (3') ............... (2)

- primers for the terminator region of the nos gene from Agrobacterium

tumefaciens

(5 ') d - GAATCCTGTT GCCGGTCTTG (3') ............ (1)

(5 ') d - TTATCCTAGT TTGCGCGCTA (3') ........................... (2)

However, primer (1) for the 35S promoter region has a too low calculated annealing temperature (45.8 ° C) and includes a nucleotide substitution (T → C), which is characteristic of the 35S nucleotide sequence used to obtain transgenic plants, but is absent in the most common varieties of genetically modified organisms. In addition, for the same primer 3 ', the end is superimposed on a template hairpin with Tm = 79 ° C, and primer (2) is hybridized with a portion of template DNA containing a hairpin with Tm = 70 ° C. The amplicon obtained with the participation of this pair of primers contains a refractory hairpin with Tm = 86 ° C, and for the amplification process in this case it is necessary to use a low annealing temperature, at which the probability of occurrence of non-specific DNA fragments is very high.

As for the pair of primers for the terminator region of the nos gene, the optimal annealing temperature for them is too low (<50 ° C), and the primer (2) is self-complementary, since it contains a triplet complementary to its own 3 'terminal nucleotide sequence and, in addition, hybridizes with a portion of template DNA containing two refractory hairpin structures with Tm = 61 ° C and Tm = 86 ° C.

These disadvantages of the known primers and their sets significantly reduce the specificity, sensitivity and reliability of the known methods using them.

The closest analogue to the claimed invention in terms of a set of primers for the detection and / or identification of transgenic DNA sequences in plant material and its containing products, the detection method and / or identification using them and the device for implementing the method is the national standard of the Russian Federation (GOST R 52174-03) "Food products. Biological safety. Genetically modified organisms and sources. Method for the identification of genetically modified plants and products based on them", developed by Inst Itute molecular biology them. V.A. Engelhardt RAS and the Institute of Plant Physiology K.A. Timiryazev RAS, adopted and enforced by Decree of the State Standard of Russia №403-st dated December 29, 2003

The primers used in this standard have the following nucleotide sequences:

- primers for 35S - promoter region of cauliflower virus

(5 ') d - CCTCCTCGGA TTCCATTGCC CAG (3') ............ (1)

(5 ') d - GTCCATCTTT GGGACCACTG TCGG (3') .................. (2)

- primers for the gus marker gene from the bacterium Escherichia coli

(5 ') d - AAGCCGGGCAATTGCTGTGC CA (3') ........................... (1)

(5 ') d - GACCGCATCG AAACGCAGCA CG (3') .................. (2)

- primers for the terminator region of the nos gene from Agrobacterium tumefaciens

(5 ') d - CGATGACGCG GGACAAGCCG T (3') ............ (1)

(5 ') d - GACCTTAGGC GACTTTTGAA CGCGC (3') .................. (2)

- primers for marker gene npt II from transposon Tn5

(5 ') d - GTGTTCCGGC TGTCAGCGCA GG (3') .................. (1)

(5 ') d - CGCAAGGAAC GCCCGTCGTG G (3') ............... (2)

- primers for the terminator portion of the osc gene from Agrobacterium tumefaciens

(5 ') d - GAAACCGGCG GTAAGGATCT GAGC (3') ............... (1)

(5 ') d - GCGAGACGCC TATGATCGCA TGAT (3') ..................... (2)

A method for detecting genetically modified plants and products based on them with the participation of these primers includes:

- extraction of DNA from them;

- conducting multiplex asymmetric PCR with the participation of extracted DNA and a set of 10 (5 pairs) of known primers, in which one of the pair of primers contains a fluorescent label;

- obtaining amplified reaction products;

- separation of amplified products by hybridizing them with complementary immobilized deoxyribo-oligonucleotides;

- detection and / or identification of transgenic DNA sequences.

A device for implementing the known method is a biological microchip, the surface of which is formed from an array of microscopic cells of a polyacrylamide hydrogel. Five hydrogel cells located on the microchip in the specified order contain immobilized oligonucleotides complementary to the 35S nucleotide sequences of the promoter region of cauliflower mosaic virus, marker gene gus from Escherichia coli bacterium, terminator region of nos gene from Agrobacterium tumefaciens gene 5, mark , the terminating portion of the ocs gene from Agrobacterium tumefaciens and having the following nucleotide sequences:

(5 ') d-GCC ATC ATT GCG ATA AAG G (3')

(5 ') d-CTG GTA TCA GCG CGA A (3')

(5 ') d-GCT AAG CAC ATA CGT CAG AA (3')

(5 ') d-GGC AGC GCG GCT ATC (3')

(5 ') d-TTC TGT TGT GCA CGT TGT A (3'), respectively.

Gel cells are applied to a glass substrate using robots and are a hemisphere with a diameter of up to 250 microns and a period of about 300 microns.

Known primers have a number of significant disadvantages. Thus, primer (2) for the 35S promoter region contains a refractory hairpin at the 5 'end, the presence of which leads to the formation of hairpin by-products of polymerase synthesis not involved in PCR and in hybridization. In addition, the free energy changes of the 3 'terminal nucleotides of both primers for the 35S promoter region are too low [ΔG (1) = -9.7 kcal / mol; ΔG (2) = -9.6 kcal / mol], which leads to non-specific priming. The values of the free energy change of the 3'-terminal nucleotides of both primers for the marker gene gus are also unacceptably low [ΔG (1) = -10.0 kcal / mol; ΔG (2) = -9.9 kcal / mol]; in this case, both primers with a long length (22 nucleotides) have high melting points [Tm (1) = 67.0 ° C; Tm (2) = 66.2 ° C], which significantly reduces the specificity of amplification.

Changes in the free energy of the 3'-terminal nucleotides of primers (1) and (2) for the terminator region of the nos gene are extremely low [ΔG (1) = -11.1 kcal / mol; ΔG (2) = -13.4 kcal / mol], as a result of which the process of amplification of template DNA should be extremely non-specific. In addition, both primers contain internal hairpins with Tm (1) = 61 ° C and Tm (2) = 65 ° C, which prevents the primers from binding to template DNA. Moreover, the nucleotide sequence of the primer (1) partially overlaps with the refractory (Tm = 96 ° C) with the template DNA hairpin, as a result of which its hybridization with template DNA is significantly difficult; the primer (2) is self-complementary to the 3'-terminal refractory quartet - GCGC and must form primer dimers during amplification. Both primers (1) and (2) for the npt II marker gene hybridize with regions of template DNA containing refractory hairpin structures, which reduces the sensitivity of the amplification process. In addition, the same primers contain very refractory 3'-terminal nucleotides [ΔG (1) = -9.7 kcal / mol; ΔG (2) = -9.9 kcal / mol], and the amplicon obtained with their participation is extremely refractory, since it includes 64.6% of the GC “doublet”, which significantly reduces the efficiency of PCR.

Although changes in the free energy of the 3 'terminal nucleotides of both primers for the terminator portion of the ocs gene have quite acceptable values [ΔG (1) = -8.2 kcal / mol; ΔG (2) = -6.5 kcal / mol], primer (2) contains a refractory (Tm = 72.0 ° С) hairpin at the 5 'end, which is part of the matrix hairpin with Tm = 81.0 ° С , and 3 '- the end of the primer (1) overlaps with the refractory matrix hairpin with Tm = 71.0 ° С, the general consequence of which is a decrease in PCR sensitivity.

These disadvantages of the known primers indicate their unsatisfactory compatibility in the set, which does not allow them to work effectively under the same reaction conditions, which significantly reduces the specificity, sensitivity and reliability of the known method with their participation.

Thus, when using a set of known primers in the known method, it is possible to obtain no more than satisfactory results only under model experimental conditions (at high concentrations of purified matrix DNA), however, with the mass screening of various plant material and its containing products, the probability of false negative results is very high.

In addition, the use in a known method for implementing the procedure of hybridization of biochips from an array of hydrogel cells reduces the specificity, efficiency and manufacturability of the process due to

- increasing the likelihood of nonspecific binding of amplified products to immobilized oligonucleotides due to the insufficient length of the latter (from 15 to 19 nucleotides);

- slowing down the hybridization procedure (up to 18 hours) and increasing the analysis time;

- the need to use very expensive laser scanners to detect and / or identify the results of hybridization due to the micro sizes of hydrogel cells with immobilized probes (D <250 μm);

- increased likelihood of process disruption in terms of polymerization of the hydrogel array during the formation of biochips and defective products due to oxygen entering the atmosphere of the working chamber of the robot.

Disclosure of inventions

The objective of the claimed inventions is the development of highly effective new sets of primers, primer pairs and primers for the detection and / or identification of transgenic DNA sequences in plant material and its products, as well as high-tech, economical and environmentally friendly methods of mass screening of plant materials and products based on it with their use and devices for implementing one of the methods.

The objective of the invention in terms of the set of primers is solved by creating an original highly specific set of 10 (5 pairs) deoxyribo-oligonucleotides complementary to the nucleotide sequences most often contained in the genetic constructs of the most common varieties of transgenic plants on the world market (James C. Preview: Global status of commericalized transgenic crops: 2003. ISAAA Briefs. No 30. ISAAA: Ithaca, NY.), Namely, the nucleotide sequences of the 35S promoter region of cauliflower mosaic virus, the gus marker gene from Escherichia coli, term ornogo portion nos gene of Agrobacterium tumefaciens, the marker gene npt II of transposon Tn5 and the terminator portion of the ocs gene Agrobacterium tumefaciens and having the nucleotide sequence indicated in SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

An embodiment of a primer kit for detecting and / or identifying transgenic DNA sequences in a plant material and its containing products is a kit comprising at least 2 but not more than 10 deoxyribo oligonucleotides selected from the group consisting of primers with the nucleotide sequences indicated in SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

When using this option, a set of primers, if necessary, select in any way at least one missing primer to form a pair.

The technical results of the claimed invention in terms of sets of primers are:

- increasing the specificity of the amplification of the analyzed DNA;

- full compatibility in the sets of all 10 declared primers, allowing them to work effectively under the same reaction conditions;

- expanding the capabilities of detection and / or identification of amplified products through the use of various physicochemical methods.

The indicated technical results are achieved by the following:

- all of the claimed primers have fusible 3'-ends with ΔG> -9.0 kcal / mol, which significantly reduces the background of non-specific interactions;

- the claimed primers are characterized by an increased content of purine bases (A and G) at the 3 'ends, which increases the specificity of their interaction with the analyzed DNA;

- the probability of inter-primer and intra-primer interactions by introducing a series of primers with corrective substitutions to eliminate both these interactions and the unwanted formation of hairpin structures is virtually eliminated;

- the melting temperature (Tm) of all the claimed primers exceeds 65 ° C and for most primers is about 70 ° C, since 5'-terminal substitutions are added to the nucleotide sequences of a number of primers to increase their Tm;

- the claimed primers do not form hairpins with Tm> 30 ° C;

- areas of the analyzed DNA complementary to the claimed primers do not participate in the formation of refractory hairpin structures;

- inter-primer sections of amplicons obtained with the participation of the claimed primers do not contain refractory hairpin structures;

- pairs of the claimed primers are selected in such a way that differences in the sizes of amplicons obtained with their participation make it possible to differentiate them by various physicochemical methods, including electrophoretic separation.

For detection and / or identification of transgenic DNA sequences in plant material and its containing products, each of the 5 declared primer pairs can be used separately. A pair of primers includes 2 deoxyribo oligonucleotides complementary to the 35S nucleotide sequence of the promoter region of cauliflower mosaic virus or the gus marker gene from the Escherichia coli bacterium, or the nos terminator gene from the Agrobacterium tumefaciens or npt II marker gene from the Agrobacterium tumefactor transcripton, or the term tumefaciens having direct or reverse primer activity in PCR and having the nucleotide sequences indicated in SEQ ID NOs. 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and 10.

Each of the 10 declared primers complementary to the 35S nucleotide sequence of the promoter region of cauliflower mosaic virus or gus marker gene from Escherichia coli bacterium or terminator region can be used separately for detection and / or identification of transgenic DNA sequences in plant material and its products. the nos gene from Agrobacterium tumefaciens, or the npt II marker gene from the transposon Tn5, or the terminator portion of the ocs gene from Agrobacterium tumefaciens and representing the nucleotide sequence b indicated in SEQ ID NOs. 1 or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10.

When using any of the claimed primers, the primer lacking for pairing is selected in any way.

The above technical results are achieved using the claimed inventions (sets of primers, pairs of primers and primers) not only with the nucleotide sequences specified in SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, but also with sequences homologous to them by at least 75%, or with their variants, including deletions, insertions at 3 'and / or 5 '- end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequences.

The technical results of the claimed inventions regarding the detection and / or identification of transgenic DNA sequences in plant material and its products are:

- increasing the specificity of the process;

- increasing the sensitivity of the process;

- increasing the reliability and improving the reproducibility of the results obtained in the process, which allows you to freely use it for mass screening of plant material and its containing products;

- improving the efficiency and manufacturability of the process due to the use in it, in particular, of specially developed biological microchips BM "Trassigen" and hardware and software complex "Degmigen";

- expanding the capabilities of detection and / or identification of amplified products through the use of various physicochemical methods.

A method for detecting and / or identifying transgenic DNA sequences in plant material and its containing products, according to the invention, includes:

(a) extraction of DNA from them;

(c) performing asymmetric PCR, including multiplex, involving extracted DNA, a detectable label, and from 1 to 10 oligonucleotides-primers selected from the group consisting of primers with nucleotide sequences indicated in SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; or involving extracted DNA and the same primers in which at least one of the constituent primers contains a detectable label; or involving extracted DNA and the same primers; at the same time, if necessary, at least one primer missing for pairing is selected in the reaction mixture, selected in any way;

(c) obtaining amplified reaction products;

(d) separating the amplified products by hybridizing them with complementary immobilized deoxyribo-oligonucleotides or by gel electrophoresis;

(e) detection and / or identification of transgenic DNA sequences.

In this case, the defined label is both radioactive and non-radioactive; preferably, the label is a catalytic, ligand or fluorescent molecule.

The immobilized deoxyribo-oligonucleotides are complementary to the 35S nucleotide sequences of the promoter region of cauliflower mosaic virus or the gus marker gene from the Escherichia coli bacterium, or the nos terminator gene from the Agrobacterium tumefaciens or the npt II marker gene from the tense genome transfector, preferably tume 5, have the nucleotide sequences indicated in SEQ ID NOs. 11 or 12, or 13, or 14, or 15, respectively.

In this case, immobilized deoxyribo-oligonucleotides are localized on the solid phase, which is glass or polymers, or metals, or ceramics, or semiconductors, or mica. Preferably, the surface of the solid phase is formed as a device representing a biological microchip. As a biological microchip, the BM "Trasigen" device can be used.

It is advisable to detect and / or identify transgenic DNA sequences by comparative analysis of the level of luminescent or chromogenic or radioactive signals obtained as a result of hybridization with the immobilized deoxyribo oligonucleotides of the test sample and the positive and negative controls.

A comparative analysis of the results of hybridization of the test sample and controls is preferably carried out by converting the above signals into digital data, followed by their mathematical processing using a hardware-software complex and a computer program.

As a hardware-software complex, you can use the detector-identifier of biological microchips "Degmigen-001" or "Degmigen-002", or "Degmigen-003".

Detection and / or identification of transgenic DNA sequences by separation of amplified products containing a detectable label by gel electrophoresis is carried out under ultraviolet light or infrared light, or visible light.

The detection and / or identification of transgenic DNA sequences by separation of amplified products that do not contain a detectable label by gel electrophoresis is carried out under ultraviolet light in a gel containing a fluorescent dye, or after staining the amplified products in a gel with a fluorescent dye.

In this case, ethidium bromide or propidium iodide, or SYBR Green I can be used as a fluorescent dye.

In order to document the results of detection and / or identification of transgenic DNA sequences in either case, it is advisable to use a digital camera.

In addition, the detection and / or identification of transgenic DNA sequences can be carried out in the process of separation of amplified products by capillary gel electrophoresis.

A variant of the claimed method for the detection and / or identification of transgenic DNA sequences in plant material and its containing products is a method comprising:

(a) extraction of DNA from them;

(c) performing symmetric PCR, including multiplex, involving extracted DNA and from 1 to 10 primer oligonucleotides selected from the group consisting of primers with the nucleotide sequences indicated in SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, while, if necessary, at least one primer missing for pairing is selected in the reaction mixture, selected in any way;

(c) obtaining amplified reaction products;

(d) separation of amplified products by gel electrophoresis;

(e) detection and / or identification of transgenic DNA sequences.

The detection and / or identification of transgenic DNA sequences is carried out similarly to those described in the previous embodiment of the method for the case of separation of amplified products that do not contain a detectable label by gel electrophoresis.

Another variant of the claimed method for the detection and / or identification of transgenic DNA sequences in plant material and its containing products is a method comprising:

(a) extraction of DNA from them;

(c) PCR, including multiplex, involving extracted DNA and from 1 to 10 oligonucleotides-primers selected from the group comprising primers with the nucleotide sequences indicated in SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, as well as components that provide for the detection and / or identification of amplified products in real time, while, if necessary, at least one primer missing for pairing, selected in any way;

(c) real-time detection and / or identification of amplified products.

At the same time, both fluorescent dyes and fluorescent probes can be used as components for the detection and / or identification of amplified products.

It is advisable to use SYBR Green I as a fluorescent dye, and Tag Man or Molecular Beacons type probes are used as fluorescent probes.

Real-time detection and / or identification of amplified products is preferably done using a 6-channel LightCycler amplifier from Roche Applied Science.

The technical results of the claimed inventions in terms of a device for the detection and / or identification of transgenic DNA sequences in plant material and its containing products are:

- increasing the specificity of hybridization of amplified products with immobilized oligonucleotides due to the optimal length of the latter (up to 40 nucleotides);

- acceleration of the hybridization procedure (up to 1 hour) and reduction of analysis time;

- use for detection and / or identification of hybridization results of conventional optical (non-laser) scanners, in particular, the Degmigen hardware-software complex, due to macro-sizes of hybridization zones;

- reducing the cost of microchips due to simplification and increasing the reliability of the technological process of their manufacture, in particular, immobilization of oligonucleotides directly on the surface of the solid phase.

A device for detecting and / or identifying transgenic DNA sequences in a plant material and its products, according to the invention, is a solid phase surface with from 1 to 5 immobilized oligonucleotides selected from the group including oligonucleotides localized on it in a predetermined order complementary to the nucleotide sequences of the 35S promoter region of cauliflower mosaic virus or the gus marker gene from the bacterium Escherichia coli, or the terminator region of the nos gene from Agrobacteri um tumefaciens, or the nptII marker gene from the transposon Tn5, or the terminator portion of the ocs gene from Agrobacterium tumefaciens and have the nucleotide sequences indicated in SEQ ID Nos. 11 or 12, or 13, or 14, or 15, respectively.

In this case, the solid phase can be glass, polymers, metals, ceramics, semiconductors or mica. The surface of the solid phase can be formed in the form of a biological microchip. Preferably, the biological microchip is BM Trassigen.

The layout of the hybridization zones on the biological microchip is presented in figure 1.

The above technical results regarding the detection and / or identification method and device for its implementation are achieved using the claimed inventions - sets of primers, primer pairs and primers, as well as immobilized deoxyribo-oligonucleotides not only with the nucleotide sequences specified in SEQ ID NOs. 1-15, but also with sequences homologous to them by at least 75%, or with their variants, including deletions, insertions at the 3 'and / or 5' end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequences.

Brief Description of the Figures

Further, the claimed invention is illustrated by figures, while Figure 1 illustrates the location of hybridization zones on a biological microchip, where

K + indicate probes complementary to the nucleotide sequences of labeled primers (positive control);

K- denote probes complementary to the nucleotide sequences of the corn and soybean zein and lectin genes, respectively (negative control);

35S, nos, osc, npt, gus denote the corresponding probes intended for hybridization with amplified analyzed DNA (experiment).

Figure 2 illustrates the results of hybridization on a biological microchip of products of asymmetric PCR - amplification of transgenic DNA isolated from soy flour, where

A - hybridization results of PCR products - amplification involving a set of primers with nucleotide sequences indicated in SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10;

B is the same as A, but with the replacement of the primer with the nucleotide sequence indicated in SEQ ID NO: l by its truncated derivative with a deletion of five 5'-terminal nucleotides;

C is the same as A, but with the replacement of the primer with the nucleotide sequence indicated in SEQ ID NO: l by its extended derivative containing an insertion of five 5'-terminal nucleotides;

D is the same as A, but with the replacement of the biotinylated primer with the nucleotide sequence specified in SEQ ID NO: 2, which is 75% homologous to it with the nucleotide sequence;

E - the results of hybridization of PCR products - amplification with the participation of control DNA containing all five determinants of transgenicity, and a set of primers with nucleotide sequences indicated in SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 (positive control);

F - negative control.

Figure 3 illustrates the results of hybridization on a biological microchip of asymmetric PCR products - amplification of transgenic DNA isolated from Desiree potatoes, where

A - hybridization results of PCR amplification products using a set of primers with the nucleotide sequences shown in SEQ ID NOs. I, 2, 3, 4, 5, 6, 7, 8, 9, and 10;

B is the same as A, but with the replacement of the labeled primer with the nucleotide sequence indicated in SEQ ID NO: 6, its truncated derivative with a deletion of five 5'-terminal nucleotides;

C is the same as A, but with the replacement of the labeled primer with the nucleotide sequence specified in SEQ ID NO: 6, its elongated derivative containing the insertion of five 5'-terminal nucleotides;

D is the same as A, but with the replacement of the labeled primer with the nucleotide sequence specified in SEQ ID NO: 6, its derivative, including the nucleotide substitution of 5 nucleotides;

E is the same as A, but with the replacement of the labeled primer with the nucleotide sequence specified in SEQ ID NO: 6, which is 75% homologous to it with the nucleotide sequence;

F - positive control;

G is the negative control.

Figure 4 is an electrophoregram of the products of symmetric PCR amplification with the participation of transgenic DNA isolated from tobacco leaves, and various sets of primers, where

1 is an electrophoregram of PCR amplification products obtained using a set of primers with the nucleotide sequences shown in SEQ ID NOs. 1 and 2;

2 is the same as 1, but with the participation of a set of primers with the nucleotide sequences indicated in SEQ ID NOs. 3 and 4;

3 is the same as 1, but with the participation of a set of primers with the nucleotide sequences indicated in SEQ ID NOs. 9 and 10;

4 - same as 1, but with the participation of a set of primers with the nucleotide sequences indicated in SEQ ID NOs. 5 and 6;

5 is the same as 1, but with the participation of a set of primers with the nucleotide sequences indicated in SEQ ID NOs. 7 and 8;

6 is the same as 1, but with the participation of a set of primers with the nucleotide sequences indicated in SEQ ID NOs. 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and 10.

Figure 5 illustrates the change in fluorescence intensity of the SYBR Green I dye during PCR amplification of transgenic DNA isolated from Desiree potatoes with different sets of primers in real time, where

1 is a fluorescence intensity curve obtained using a set of primers with the nucleotide sequences shown in SEQ ID NOs. 1 and 2;

2 is the same as 1, but with the participation of a set of primers with the nucleotide sequences indicated in SEQ ID NOs. 3 and 4;

3 is the same as 1, but with the participation of a set of primers with the nucleotide sequences indicated in SEQ ID NOs. 5 and 6;

4 - same as 1, but with the participation of a set of primers with the nucleotide sequences indicated in SEQ ID NOs. 7 and 8;

5 is the same as 1, but with the participation of a set of primers with the nucleotide sequences indicated in SEQ ID NOs. 9 and 10.

The implementation of the invention

Example 1

To analyze the presence of transgenic sequences in soy flour DNA, the Regmigen reagent kit was used (TU 2643-003-71321417-2004).

100 mg of soy flour was placed in an 1.5 ml Eppendorf microtube, 400 μl of lyse solution, a portion of glass beads (0.3 g) were added and the material was homogenized on a vortex. The homogenate was centrifuged, the supernatant was taken and DNA was purified in accordance with the instructions attached to the reagent kit.

The purified DNA preparation was used for asymmetric PCR. In 6 microtubes with dry PNR reagents, 10 μl of solvent was added and in 4 test tubes 5 μl of purified DNA solution and 5 μl of solutions containing the following primers were added:

A. 1 pM unlabeled primers with the nucleotide sequences indicated in SEQ ID NOs. 1, 3, 5, 7, 9 and 4 pM primers labeled at the 5'-end with biotin with the sequences shown in SEQ ID NOs. 2, 4, 6, 8,10;

B. At 1 pM of the same primers, but with a substitution of the primer with the nucleotide sequence indicated in SEQ ID NO: 1 by its truncated derivative with a deletion of five 5'-terminal nucleotides ACTCCAAGAATATCAAAGATACAGTCTCAGAAGA;

C. At 1 pM of the same primers (according to item A), but with the replacement of the primer with the nucleotide sequence indicated in SEQ ID NO: 1 by its extended derivative containing an insertion of five 5'-terminal nucleotides - ACTCT CGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGA;

D. At 1 pM of the same primers (according to item A), but replacing the biotinylated primer with the nucleotide sequence indicated in SEQ ID NO: 2, 75% homologous to it with the nucleotide sequence TTGCTCCTT TTTTTTA C TGTCCTTTCGATGAAGTGACAGA;

E. A test tube served as a positive control, in which instead of the analyzed DNA 5 μl of a DNA solution containing all five determinants of transgenicity and primers listed in section A were added;

F. A negative control was a tube in which 5 μl bidistilled water and the primers listed in item A were added.

Biotin-labeled primers were synthesized by the phosphoramidite method (Chollet A., Kawashima EH Biotin-labeled synthetic oligodeoxyribonucleotides: chemical synthesis and uses as hybridization probes / Nucleic Acids Res.-1985.-Vol.13, No. 5.-P.1529-1541) .

Amplification of DNA was performed according to the program shown in the table.

Table
PCR program Program step Temperature ° C Incubation time, sec. The number of cycles 1 94 thirty 1 2 92 10 37 3 55 10 4 72 10

The amplified DNA was hybridized with probes immobilized on the Tressigen biological microchip (TU 4320-002-71321417-2004). The nucleotide sequences of the probes were as indicated in SEQ ID NOs. 11, 12, 13, 14 and 15.

For hybridization, 5 μl of SSCX20 buffer was added to each microtube and the reaction mixture was applied to the surface of the microchip containing zones of immobilized oligonucleotides. The microchip was kept for 1 hour in a humid chamber at 40 ° С, unbound DNA was washed three times with SSCX5 and SSCX1 buffer solutions, then it was washed in SSCX0.1 solution and drops of the buffer solution were shaken off.

Hybridized DNA containing biotin-labeled primers was developed using a conjugate of streptavidin with horseradish peroxidase. For this, the initial conjugate preparation with a protein concentration of 1 mg / ml was diluted 500 times with SSCX1 solution and 30 μl was applied to the working area of the microchip. The microchip was kept for 30 minutes in a humid chamber and the unbound conjugate was washed three times with SSCX5 and SSCX1 buffer solutions, after which it was washed in SSCX0.1 solution. Then, 30 μl of a substrate solution containing 0.02% diaminobenzidine and 0.015% hydrogen peroxide in SSCX0.1 was applied to it and left in a dark place at room temperature for 10 minutes. After staining, the microchip was washed with distilled water, drops of water were shaken off and dried.

The layout of the hybridization zones is shown in FIG.

The results of hybridization of the analyzed DNA were taken into account using the Degmigen-001 detector identifier (TU 4254-001-71321417-2004).

The resulting hybridization pattern is presented in Figure 2.

The amplified analyzed DNA was also hybridized with immobilized probes, the sequences of which differed from those indicated in SEQ ID NOs. 11 and 13, namely:

1. A probe with the nucleotide sequence indicated in SEQ ID NO: 11 was replaced with a truncated derivative with a deletion of five 5'-terminal nucleotides AAAGGGTAATATCGGGAAACCTCCTCGGA;

2. A probe with the nucleotide sequence indicated in SEQ ID NO: 11 was replaced with an extended derivative containing an insertion of five 3'-terminal nucleotides TCAACAAAGGGTAATATCGGGAGACCTCCTCGGATTCCA;

3. A probe with the nucleotide sequence indicated in SEQ ID NO: 11 was replaced by a 75% homologous nucleotide sequence

-TTGGTGGGGGGTAATATCGGGAAACCTTTTTGGG;

4. A probe with the nucleotide sequence indicated in SEQ ID NO: 13 was replaced by a truncated derivative with a deletion of five 5'-terminal nucleotides CGCAACGATTGAAGGAGCCACTCAGC;

5. The probe with the nucleotide sequence indicated in SEQ ID NO: 13 was replaced with an extended derivative containing the insert of five 3'-terminal nucleotides-AGAACCGCAACGATTGAAGGAGCCACTCAGCCGCGG;

6. A probe with the nucleotide sequence indicated in SEQ ID NO: 13 was replaced by a 75% nucleotide sequence homologous to it

-GGGGTTGCGGTGATTGAAGGAGAGACACTCAGC.

The hybridization pattern obtained with modified probes did not differ significantly from the results obtained with the original probes (see Figure 2).

Conclusion: the analyzed soybean DNA sample contains transgenic sequences of the 35S promoter region of the cauliflower mosaic virus and the terminator region of the nos gene from Agrobacterium tumefaciens.

Example 2

To analyze the presence of transgenic sequences in Desiree potato DNA, 100 mg of peeled root crop were taken and DNA was isolated for analysis in the same manner as described in Example 1.

In 6 microtubes with dry PCR reagents, 10 μl of solvent was added and 4 μl of purified DNA solution and 5 μl of solutions containing the following primers were added to 4 test tubes

A. 1 pM unlabeled primers with the nucleotide sequences indicated in SEQ ID NOs. I, 3, 5, 7, 9 and 4 pM labeled at the 5'-end of the primers with the sequences shown in SEQ ID NOs. 2, 4, 6, 8, 10. FAM, P32, digoxygenin, or flavin were used as the 5'-end label.

B. At 1 pM of the same primers, but with the replacement of the labeled primer with the nucleotide sequence specified in SEQ ID NO: 6, its shortened derivative with a deletion of five 5'-terminal nucleotides

-ACGTATGTGCTTAGCTCATTAAACTCCAGA;

C. At 1 pM of the same primers (p. A), but with the replacement of the labeled primer with the nucleotide sequence indicated in SEQ ID No: 6, its elongated derivative containing an insertion of five 5'-terminal nucleotides

-ATGG TGCCTGACGTATGTGCTTAGCTCATTAAACTCCAGA;

D. At 1 pM of the same primers (p. A), but with the replacement of the labeled primer with the nucleotide sequence specified in SEQ ID NO: 6, its derivative, characterized by the replacement of 5 nucleotides

CGT TG GT GTATGTGCTTAGCTCATTAAACTCCAGA;

E. 1 pM of the same primers (p. A), but with the replacement of the labeled primer with the nucleotide sequence indicated in SEQ ID N0: 6, its derivative, 75% homologous to it

-CGT TG GT GT GC G CC CTTAGCTCATTAAACTCCAGA:

F. A positive control was a test tube in which, instead of the analyzed DNA, 5 μl of a DNA solution containing all five determinants of transgenicity and a set of primers according to item A were added;

G. A negative control was a tube into which 5 μl bidistilled water and a set of primers according to item A were added. Fluorescently labeled primers were synthesized by the phosphoramidite method (Theisen P., McCollum C., Andrus A. Fluorescent dye phosphoramidite labelling of oligonucleotides / Nucleic Acids Symp. Ser.- 1992.-Vol.27.-P.99-100). Radioactive-labeled primers were synthesized using the Amersham bacteriophage T4 DNA kinase kit (EP 0214014A1).

Digoxigenin labeled primers were prepared according to the method described by A. Azzi et al. (Detection of B 19 parvovirus infections by a dot-blot hybridization assay using a digoxigenin-labelled probe / Azzi A, Zakrzewska K, Gentilomy G, Musiani M, Zerbini M . // J. Virol. Methods.- 1990.-Vol. 27, N2.-P.125-133).

Flavin-labeled primers were prepared using the method described by Schwogler A., Carell T. (Schwogler A., Carell T. Toward catalytically active oligonucleotides: synthesis of a flavin nucleotide and its incorporation into DNA / Org. Lett.-2000.- Vol.2, N10.- P.1415-1418).

Amplification and hybridization of DNA was carried out in accordance with the procedure described in Example 1. The results of hybridization of the analyzed DNA were taken into account using a biological microchip detector-identifier Degmigen-001 or Degmigen-002, or Degmigen-003 (TU4254-001- 71321417-2004). The resulting hybridization pattern is presented in Figure 3.

Conclusion: Desiree potato DNA analyzed contains transgenic sequences of 35S, the promoter region of cauliflower mosaic virus, the terminator region of the nos gene from Agrobacterium tumefaciens, the npt II marker gene from transposon TP5, and the gus marker gene from Escherichia coli bacteria.

Example 3

To conduct DNA analysis of transgenic tobacco, 100 mg of plant leaves were taken and DNA was isolated in the same manner as described in Example 1.

In 6 microtubes with dry PCR reagents, 10 μl of solvent was added and 5 μl of purified DNA solution and 5 μl of solutions containing the following amounts of primers were added:

1. 1 pM primer with the nucleotide sequence specified in SEQ ID NO: l, and 4 pM primer with the sequence specified in SEQ ID NO: 2;

2. 1 pM primer with the nucleotide sequence specified in SEQ ID NO: 3, and 4 pM primer with the sequence specified in SEQ ID NO: 4;

3. 1 pM primer with the nucleotide sequence specified in SEQ ID NO: 9, and 4 pM primer with the sequence specified in SEQ ID NO: 10;

4. 1 pM primer with the nucleotide sequence specified in SEQ ID NO: 5, and 4 pM primer with the sequence specified in SEQ ID NO: 6;

5. 1 pM primer with the nucleotide sequence specified in SEQ ID NO: 7, and 4 pM primer with the sequence specified in SEQ ID NO: 8;

6. A mixture of all of the above pairs of primers in the same concentrations.

Amplification was carried out in accordance with the procedure described in Example 1.

The reaction mixtures (10 μl each) were applied to a separating gel and electrophoresis was carried out in accordance with the generally accepted technique (Molecular cloning: a laboratory manual. 2 ^nd ed. / J. Sambrook, E. Fritsch, T. Maniatis // 1989, CSH.

At the end of electrophoresis, the gel was stained with a solution of ethidium bromide at a concentration of 0.5 μg / ml and photographed in ultraviolet light with a Kodak DC-120 digital camera.

For capillary electrophoresis, PACE-MDQ (Beckman Instruments, USA) was used in accordance with the procedure described by V. Garcia-Canas et al. (Sensitive and simultaneous analysis of five transgenic maizes using multiplex polymerase chain reaction, capillary gel electrophoresis, and laser-induced fluorescence / V. Garcia-Canas, R. Gonzalez, A. Cifuentes // Electrophoresis. -2004. - Vol. 25. - P.2219-2226).

The results of electrophoretic separation of amplified fragments of the analyzed DNA with the participation of various sets of primers in PCR are presented in Figure 4.

Similar results were obtained when replacing a primer with the nucleotide sequence indicated in SEQ ID N0: 2, a primer with the sequence GTCCATCTTTGGGACCACTGTCGG. Moreover, in PCR with the participation of one pair with a selected primer, and with the participation of a multi-primer mixture including this pair of primers, instead of an amplicon of 150 nucleotide pairs, an amplicon of 231 nucleotides in length was synthesized.

When replacing a primer with the nucleotide sequence specified in SEQ ID NO: 5, with a primer with the nucleotide sequence CGATGACGCGGGACAAGCCGT, both in the two-primer (with the participation of the pair with the selected primer), and in the multi-primer (with the participation of the multi-primer mixture, which includes this pair of primers, instead of PCR a length of 103 pairs of nucleotides, an amplicon of 113 pairs of nucleotides was synthesized.

Conclusion: the analyzed DNA of tobacco leaves contains the transgenic sequences of the 35S promoter region of cauliflower mosaic virus, marker gene gus from the bacterium Escherichia coli, terminator region of the nos gene from Agrobacterium tumefaciens, marker npt II gene from transposon Tn5, and terminator region of the ocs gene from Agrobaci tensume.

Example 4

To identify the analysis of the presence of transgenic sequences in Desiree potato DNA, 100 mg of peeled root crop were taken and DNA was isolated for analysis in the same manner as described in Example 1.

In 5 microtubes with dry PCR reagents, 10 μl of solvent, 4 μl of purified DNA solution, 1 μl of SYBR Green I solution (20 mg / ml) and 5 μl of solutions containing the following amounts of primers were added:

1. 10 rM primers with the nucleotide sequences indicated in SEQ ID NOs. 1 and 2;

2. 10 rM primers with the nucleotide sequences indicated in SEQ ID NOs. 3 and 4;

3. 10 rM primers with the nucleotide sequences indicated in SEQ ID NOs. 5 and 6;

4. At 10 pM primers with the nucleotide sequences indicated in SEQ ID NOs. 7 and 8;

5. For 10 rM primers with the nucleotide sequences indicated in SEQ ID NOs. 9 and 10.

Real-time DNA amplification was performed using the temperature conditions described in Example 1 using a LightCycler amplifier from Roche Applied Science. The change in the fluorescence intensity of SYBR Green I during DNA amplification is shown in Figure 5.

Conclusion: the DNA of the analyzed Desiree potato sample contains transgenic sequences of the 35S promoter region of the cauliflower mosaic virus, the gus marker gene from the bacterium Escherichia coli, the nos terminator portion of the Agrobacterium tumefaciens gene, and the npt II marker gene from the Тn5 transposon.

Example 5

Biological microchips "Trassigen" were made according to TU 4320-002-71321417-2004.

It should be especially noted that for the implementation of the claimed inventions, along with those indicated in Examples 1-5, other measuring instruments can be used, as well as equipment and sets of reagents with characteristics (metrological, technical and chemical), not worse than those indicated.

Sequence listing

<110> Applicant:

Name: 000 Innovation Corporation "Biosafety"

Location: 109147, Moscow, Marxist street, 5, bld. 1

<120> Name of inventions:

A set of primers for the detection and / or identification of transgenic DNA sequences in plant material and its containing products (options), a primer (options), a pair of primers (options) and a method for detection and / or identification using them (options).

<160> number of sequences: 15

<210> Sequence No.: SEQ ID NO: l

<211> Length: 39 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: synthetic sequence

<223> Purpose: primer for 35S - promoter region of the virus

cauliflower mosaics

<400> Description of the sequence of SEQ ID NO: l:

CGGCTACTCC AAGAATATCA AAGATACAGT TTCAGAAGA

<210> Sequence No.: SEQ ID NO: 2

<211> Length: 40 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: primer for 35S - promoter region of the virus

cauliflower mosaics

<400> Description of the sequence of SEQ ID NO: 2:

CCATTTTCCT TTTTTATTGT CCTTTCGATG AAGTGACAGA

<210> Sequence No.: SEQ ID NO: 3

<211> Length: 33 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: primer for the gus marker gene from bacteria

Escherichia coli

<400> Description of the sequence of SEQ ID NO: 3:

ACCGTACCTC GCATTACCCT TACGCTGAAG AGA

<210> Sequence No.: SEQ ID NO: 4

<211> Length: 30 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: primer for the gus marker gene from bacteria

Escherichia coli

<400> Sequence Description of SEQ ID NO: 4:

TGCCCGCTTC GAAACCAATG CCTAAAGAGA

<210> Sequence No.: SEQ ID NO: 5

<211> Length: 32 nucleotides

<212> Molecule type: single chain linear DNA

<213> Origin: artificial sequence

<223> Purpose: primer for the terminator portion of the nos gene from

Agrobacterium tumefaciens

<400> Sequence Description of SEQ ID NO: 5:

GGACAAGCCG TTTTACGTTT GGAACTGACA GA

<210> Sequence No.: SEQ ID NO: 6

<211> Length: 35 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: primer for the terminator portion of the nos gene from

Agrobacterium tumefaciens

<400> Description of the sequence of SEQ ID NO: 6:

GCCTGACGTA TGTGCTTAGC TCATTAAACT CCAGA

<210> Sequence No.: SEQ ID NO: 7

<211> Length: 25 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: primer for the marker gene npt II from transposon Tn5

<400> Sequence Description of SEQ ID NO: 7:

GTGACCCATG GCGATGCCTG CTTGC

<210> Sequence No.: SEQ ID NO: 8

<211> Length: 30 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: primer for the marker gene npt II from transposon Tn5

<400> Sequence Description of SEQ ID NO: 8:

ACCCAGCCGG CCACAGTCGA TGAATCCAGA

<210> Sequence No.: SEQ ID NO: 9

<211> Length: 32 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: primer for the ocs gene terminator region from

Agrobacterium tumefaciens

<400> Sequence Description of SEQ ID NO: 9:

AAAAAGTGGC AGAACCGGTC AAACCTAAAA GA

<210> Sequence No.: SEQ ID NO: 10

<211> Length: 32 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: primer for the ocs gene terminator region from

Agrobacterium tumefaciens

<400> Description of the sequence of SEQ ID NO: 10:

CGTTATTAGT TCGCCGCTCG GTGTGTCGTA GA

<210> Sequence No.: SEQ ID NO: 11

<211> Length: 34 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: hybridization probe for 35S - promoter

Cauliflower Mosaic Virus

<400> Sequence Description of SEQ ID NO: 11:

TCAACAAAGG GTAATATCGG GAAACCTCCT CGGA

<210> Sequence No.: SEQ ID NO: 12

<211> Length: 33 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: hybridization probe for the gus marker gene from

Escherichia coli bacteria

<400> Sequence Description of SEQ ID NO: 12:

TCGTGGTGAT TGATGAAACT GCTGCTGTCG GCT

<210> Sequence No.: SEQ ID NO: 13

<211> Length: 31 nucleotide

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: hybridization probe for the terminator site

nos gene from Agrobacterium tumefaciens

<400> Sequence Description of SEQ ID NO: 13:

AGAACCGCAA CGATTGAAGG AGCCACTCAG C

<210> Sequence No.: SEQ ID NO: 14

<211> Length: 29 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: hybridization probe for the npt II marker gene from

transposon Tn5

<400> Description of the sequence of SEQ ID NO: 14:

CCGAATATCA TGGTGGAAAA TGGCCGCTT

<210> Sequence No.: SEQ ID NO: 15

<211> Length: 40 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: artificial sequence

<223> Purpose: hybridization probe for the terminator site

ocs gene from Agrobacterium tumefaciens

<400> Sequence Description of SEQ ID NO: 15:

AAGACTGATT ACATAAATCT TATTCAAATT TCAAAAGTGC

Claims (54)

1. A set of primers for the detection and / or identification of transgenic DNA sequences in plant material and its containing products, including 10 deoxyribo-oligonucleotides complementary to the nucleotide sequences of the 35 S-promoter region of cauliflower mosaic virus, gus marker gene from Escherichia coli bacterium, terminator region of the nos gene from Agrobacterium tumefaciens, the npt II marker gene from transposon Tn5, the terminator portion of the ocs gene from Agrobacterium tumefaciens and representing the nucleotide sequences shown in SEQ ID NOs . 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, or nucleotide sequences homologous to them by at least 75%, or their variants, including deletions, insertions at 3'- and / or 5 ' -end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequences. 2. The set of primers according to claim 1, characterized in that the two deoxyribo oligonucleotides included in it are complementary to the nucleotide sequence of the 35 S-promoter region of the cauliflower mosaic virus and have direct or reverse primer activity in the polymerase chain reaction (PCR), with nucleotide sequences, specified in SEQ ID NO: 1 and SEQ ID NO: 2 or with nucleotide sequences homologous to them by at least 75%, or their variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions no more 5 nucleotides in these sequences make up a pair of primers. 3. The primer set according to claim 1, characterized in that the two deoxyribo oligonucleotides included in it are complementary to the nucleotide sequence of the gus marker gene from the bacterium Escherichia coli and have direct or reverse primer activity in PCR, with the nucleotide sequences indicated in SEQ ID NO: 3 and SEQ ID NO: 4 or with nucleotide sequences homologous to them by at least 75%, or their variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequence They comprise a pair of primers. 4. The primer set according to claim 1, characterized in that the two deoxyribo oligonucleotides included in it are complementary to the nucleotide sequence of the terminator region of the nos gene from Agrobacterium tumefaciens and have the activity of forward or reverse primers in PCR with the nucleotide sequences specified in SEQ ID NO: 5 and SEQ ID NO: 6 or with nucleotide sequences homologous to them by at least 75%, or their variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the following flaxes make up a pair of primers. 5. The set of primers according to claim 1, characterized in that the two deoxyribo oligonucleotides included in it are complementary to the nucleotide sequence of the npt II marker gene from the Tn5 transposon and have the activity of direct or reverse primers in PCR with the nucleotide sequences specified in SEQ ID NO: 7 and SEQ ID NO: 8 or with nucleotide sequences homologous to them by at least 75%, or with their variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequences, make up a pair of primers. 6. The primer set according to claim 1, characterized in that the two deoxyribo oligonucleotides included in it are complementary to the nucleotide sequence of the ocs gene terminator region from Agrobacterium tumefaciens and have direct or reverse primer activity in PCR with the nucleotide sequences indicated in SEQ ID NO: 9 and SEQ ID NO: 10 or with nucleotide sequences homologous to them by at least 75%, or their variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in specified follow lnostyah, make a pair of primers. 7. A primer for detecting and / or identifying a transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the 35S promoter region of cauliflower mosaic virus and representing the nucleotide sequence specified in SEQ ID NO: 1 or the nucleotide sequence homologous to it by at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequence. 8. A primer for the detection and / or identification of a transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the 35S promoter region of cauliflower mosaic virus and representing the nucleotide sequence specified in SEQ ID NO: 2 or the nucleotide sequence homologous to it by at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequence. 9. A primer for the detection and / or identification of the transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the gus marker gene from the bacterium Escherichia coli and representing the nucleotide sequence specified in SEQ ID NO: 3 or the nucleotide sequence homologous to it, at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the specified sequence. 10. A primer for the detection and / or identification of the transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the gus marker gene from the bacterium Escherichia coli and representing the nucleotide sequence specified in SEQ ID NO: 4 or the nucleotide sequence homologous to it, at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the specified sequence. 11. A primer for the detection and / or identification of the transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the terminator region of the nos gene from Agrobacterium tumefaciens and representing the nucleotide sequence specified in SEQ ID NO: 5 or the nucleotide sequence homologous to it, at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the specified sequence. 12. A primer for detecting and / or identifying a transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the terminator region of the nos gene from Agrobacterium tumefaciens and representing the nucleotide sequence specified in SEQ ID NO: 6 or the nucleotide sequence homologous to it, at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the specified sequence. 13. A primer for the detection and / or identification of the transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the marker gene npt II from transposon Tn5 and representing the nucleotide sequence specified in SEQ ID NO: 7 or the nucleotide sequence homologous to it, at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the specified sequence. 14. A primer for the detection and / or identification of the transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the marker gene npt II from transposon Tn5 and representing the nucleotide sequence specified in SEQ ID NO: 8 or the nucleotide sequence homologous to it, at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the specified sequence. 15. A primer for the detection and / or identification of the transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the terminator portion of the ocs gene from Agrobacterium tumefaciens and representing the nucleotide sequence specified in SEQ ID NO: 9 or the nucleotide sequence homologous to it, at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the specified sequence. 16. A primer for the detection and / or identification of the transgenic DNA sequence in plant material and its products, complementary to the nucleotide sequence of the terminator portion of the ocs gene from Agrobacterium tumefaciens and representing the nucleotide sequence specified in SEQ ID NO: 10 or the nucleotide sequence homologous to it, at least 75%, or its variants, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the specified sequence. 17. A set of primers for the detection and / or identification of transgenic DNA sequences in plant material and its containing products, comprising at least 2, but not more than 10 deoxyribo-oligonucleotides selected from the group comprising primers according to claims 7-16. 18. A pair of primers for detecting and / or identifying a transgenic DNA sequence in plant material and its containing products, including 2 deoxyribo-oligonucleotides complementary to the 35S nucleotide sequence of the promoter region of cauliflower mosaic virus, having direct or reverse primer activity in PCR and representing nucleotide sequences, indicated in SEQ ID NO: 1 and SEQ ID NO: 2 or nucleotide sequences homologous to them by at least 75%, or variants thereof, including deletions, insertions at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequences. 19. A pair of primers for detecting and / or identifying a transgenic DNA sequence in plant material and its containing products, including 2 deoxyribo oligonucleotides complementary to the nucleotide sequence of the gus marker gene from the bacterium Escherichia coli, having direct or reverse primer activity in PCR and representing nucleotide sequences, indicated in SEQ ID NO: 3 and SEQ ID NO: 4 or nucleotide sequences homologous to them by at least 75%, or variants thereof, including deletions, insertions at 3'- and / or the 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequences. 20. A pair of primers for detecting and / or identifying a transgenic DNA sequence in plant material and its containing products, including 2 deoxyribo oligonucleotides complementary to the nucleotide sequence of the terminator portion of the nos gene from Agrobacterium tumefaciens, having direct or reverse primer activity in PCR and representing nucleotide sequences those indicated in SEQ ID NO: 5 and SEQ ID NO: 6 or nucleotide sequences homologous to them by at least 75%, or variants thereof, including deletions, insertion and at the 3'- and / or 5'-end and / or nucleotide substitution not more than 5 nucleotides of said sequences. 21. A pair of primers for detecting and / or identifying a transgenic DNA sequence in plant material and its containing products, including 2 deoxyribo oligonucleotides complementary to the nucleotide sequence of the npt II marker gene from transposon Tn5, having direct or reverse primer activity in PCR and representing nucleotide sequences, indicated in SEQ ID NO: 7 and SEQ ID NO: 8 or nucleotide sequences homologous to them by at least 75%, or their variants, including deletions, insertions at 3'- and / and whether the 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequences. 22. A pair of primers for detecting and / or identifying a transgenic DNA sequence in plant material and its containing products, including 2 deoxyribo oligonucleotides complementary to the nucleotide sequence of the terminator portion of the ocs gene from Agrobacterium tumefaciens, having direct or reverse primer activity in PCR and representing nucleotide sequences those specified in SEQ ID NO: 9 and SEQ ID NO: 10 or nucleotide sequences homologous to them by at least 75%, or variants thereof, including deletions, insertion and at the 3'- and / or 5'-end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequences. 23. A method for detecting and / or identifying transgenic DNA sequences in plant material and its containing products, including (a) extraction of DNA from them; (c) performing asymmetric PCR, including multiplex, involving extracted DNA, a detectable label, and from 1 to 10 oligonucleotides-primers selected from the group consisting of primers according to claims 7-16; or involving extracted DNA and the same primers in which at least one of the constituent primers contains a detectable label; or involving extracted DNA and the same primers; at the same time, if necessary, at least one primer missing for pairing is selected in the reaction mixture, selected in any way; (c) obtaining amplified reaction products; (d) separating the amplified products by hybridizing them with complementary immobilized deoxyribo-oligonucleotides or by gel electrophoresis; (e) detection and / or identification of transgenic DNA sequences. 24. The method according to item 23, wherein the determined label is radioactive, selected from the group including ³² P, ³ H ¹⁴ , C or ¹²⁵ I. 25. The method according to item 23, wherein the defined label is non-radioactive, selected from the group comprising a catalytic molecule, a ligand molecule or a fluorescent molecule. 26. The method according A.25, characterized in that the catalytic molecule is selected from the group comprising hemin, cyanocobalamin or flavin. 27. The method according A.25, characterized in that the ligand molecule is selected from the group comprising biotin, digoxygenin or dinitrobenzene. 28. The method according A.25, characterized in that the fluorescent molecule is selected from the group comprising FAM, TAMRA, R6G, R110, ROX or JOE. 29. The method according to item 23, wherein the immobilized deoxyribo-oligonucleotides are complementary to the 35 S nucleotide sequences of the promoter region of cauliflower mosaic virus or the gus marker gene from Escherichia coli bacterium, or the nos terminator of the Agrobacterium tumefaciens gene or the marker gene nos. Tn5, or the termination region of the ocs gene from Agrobacterium tumefaciens, and have the nucleotide sequences indicated in SEQ ID Nos. 11 or 12, or 13, or 14, or 15, respectively, or nucleotide sequences homologous to them by at least 75%, or variants thereof, including deletions, insertions at the 3 ′ and / or 5 ′ end and / or nucleotide substitutions no more than 5 nucleotides in the indicated sequences. 30. The method according to item 23 or 29, characterized in that the immobilized deoxyribo-oligonucleotides are localized on the solid phase. 31. The method according to item 30, wherein the solid phase is selected from the group comprising glass, polymers, metals, ceramics, semiconductors or mica. 32. The method according to p. 30 or 31, characterized in that the surface of the solid phase localized on it in a predetermined order immobilized deoxyribo-oligonucleotides formed in the form of a device representing a biological microchip. 33. The method according to p, characterized in that the biological microchip is a device BM "Trasigen". 34. The method according to any of paragraphs.23-29, characterized in that the detection and / or identification of transgenic DNA sequences in the plant material and its products is carried out by comparative analysis of the level of signals - luminescent or chromogenic, or radioactive, obtained as a result of hybridization with immobilized deoxyribo-oligonucleotides of the test sample and positive and negative controls. 35. The method according to clause 34, wherein a comparative analysis of the results of hybridization of the test sample and controls is carried out by converting luminescent, or chromogenic, or radioactive signals into digital data, followed by their mathematical processing using a hardware-software complex and a computer program. 36. The method according to p. 35, characterized in that as a hardware-software complex use the detector-identifier of biological microchips "Degmigen-001", or "Degmigen-002", or "Degmigen-003". 37. The method according to item 23, wherein the detection and / or identification of transgenic DNA sequences after separation of amplified products containing a detectable label, the method of gel electrophoresis is carried out under ultraviolet light or infrared light, or illumination with visible light. 38. The method according to item 23, wherein the detection and / or identification of transgenic DNA sequences after separation of the non-detectable label-containing amplified products by gel electrophoresis is carried out under ultraviolet light in a gel containing a fluorescent dye, or after staining the amplified products in a gel fluorescent dye. 39. The method according to § 38, wherein the fluorescent dye is a dye for DNA selected from the group comprising ethidium bromide, propidium iodide or SYBR Green I. 40. The method according to clause 37 or 38, characterized in that a digital camera is used to document the results of detection and / or identification of transgenic DNA sequences. 41. The method according to item 23, wherein the detection and / or identification of transgenic DNA sequences is carried out in the process of separation of amplified products by capillary gel electrophoresis. 42. A method for detecting and / or identifying transgenic DNA sequences in plant material and its containing products, including  (a) extraction of DNA from them; (c) performing symmetric PCR, including multiplex, involving extracted DNA and from 1 to 10 oligonucleotides-primers selected from the group consisting of primers according to claims 7-16; at least, if necessary, add at least , one primer missing for pairing, selected in any way; (c) obtaining amplified reaction products; (d) separation of amplified products by gel electrophoresis; (e) detection and / or identification of transgenic DNA sequences. 43. The method according to § 42, wherein the detection and / or identification of transgenic DNA sequences is carried out under ultraviolet light in a gel containing a fluorescent dye, or after staining the amplified products in a gel with a fluorescent dye. 44. The method according to item 43, wherein the fluorescent dye is a dye for DNA selected from the group comprising ethidium bromide, propidium iodide or SYBR Green I. 45. The method according to item 43, wherein a digital camera is used to document the results of detection and / or identification of transgenic DNA sequences. 46. The method according to § 42, wherein the detection and / or identification of transgenic DNA sequences is carried out in the process of separation of amplified products by capillary gel electrophoresis. 47. A method for detecting and / or identifying transgenic DNA sequences in plant material and its containing products, comprising (a) extracting DNA from them; c) PCR, including multiplex, with the participation of extracted DNA and from 1 to 10 oligonucleotides-primers selected from the group comprising primers according to claims 7-16, as well as components for the detection and / or identification of amplified products in the mode real time, and if necessary, at least one primer that is missing for pairing, selected in any way, is added to the reaction mixture; (c) real-time detection and / or identification of amplified products. 48. The method according to clause 47, wherein the components that provide for the detection and / or identification of amplified products in real time, use fluorescent dyes or fluorescent probes. 49. The method of claim 48, wherein SYBR Green I is used as the fluorescent dye, and Tag Man or Molecular Beacons type probes are used as the fluorescent probes. 50. The method according to clause 47, wherein the detection and / or identification of amplified products in real time is carried out using a 6-channel LightCycler amplifier company Roche Applied Science. 51. A device for the detection and / or identification of transgenic DNA sequences in plant material and its containing products, which is a solid phase surface with 1 to 5 immobilized oligonucleotides selected from the group comprising oligonucleotides complementary to 35S nucleotide sequences localized on it in a predetermined order of the promoter region of the cauliflower mosaic virus or the gus marker gene from the bacterium Escherichia coli, or the terminator region of the nos gene from Agrobacterium tumefaciens, or marker the npt II gene from the Tn5 transposon, or the ocs terminator region from Agrobacterium tumefaciens and having the nucleotide sequences indicated in SEQ ID Nos 11 or 12, or 13, 14, or 15, respectively, or nucleotide sequences homologous to them by at least 75 %, or their variants, including deletions, insertions at the 3'- and / or 5 'end and / or nucleotide substitutions of not more than 5 nucleotides in the indicated sequences. 52. The device according to paragraph 51, wherein the solid phase is selected from the group comprising glass, polymers, metals, ceramics, semiconductors or mica. 53. The device according to p. 51 or 52, characterized in that the surface of the solid phase is formed in the form of a biological microchip. 54. The device according to item 53, wherein the biological microchip is BM "Trassigen".

Images