JPH04169193A - Non-a non-b hepatitis virus antigen polypeptide, polynucleotide coding the antigen polypeptide and diagnosis of non-a non-b hepatitis using the same - Google Patents

Abstract

NEW MATERIAL:The non-A non-B hepatitis virus antigen polypeptide having the amino acid sequence of formula. USE:A reagent for detecting non-A non-B hepatitis virus antibody. Vaccine for preventing and curing the infection with non-A non-B hepatitis virus. PREPARATION:The objective polypeptide of formula can be produced e.g. by using the serum of a non-A non-B hepatitis patient as a starting raw material, concentrating and recovering the virus particle as a precipitate by polyethylene glycol precipitation process, extracting RNA from the virus by guanidine- thiocyanate process, etc., synthesizing a cDNA using the RNA as a template, inserting the cDNA into a phage vector to prepare a cDNA library, culturing the library, screening by enzyme immunoassay to select a positive plaque, extracting DNA from the plaque, treating with restriction enzymes, bonding to a vector, inserting into E.coli, etc., to effect the transformation of the cell and culturing the obtained transformant.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of the Invention The present invention relates to non-A, non-B hepatitis virus antigens. More specifically, the present invention provides an antigenic peptide that specifically exhibits an antigen-antibody reaction with non-A, non-B hepatitis patient serum, a polynucleotide encoding the antigen polypeptide, and a method for diagnosing non-A, non-B hepatitis using the same. Regarding the law.

(Prior art) Non-A, non-B hepatitis refers to (E) hepatitis virus (HAV), which has been identified as a type of viral hepatitis thought to be caused by a transportable virus. Hepatitis virus (HBV), Hepatitis D virus (HDV)
), or hepatitis caused by cytomegalovirus (CI4V), Epstein-Barr virus (EBV), adenovirus, etc., which also infect hepatocytes and cause symptoms, are excluded virologically and serologically. be. Epidemiological evidence suggests that there are three types of non-A, non-B hepatitis: waterborne, which is prevalent in developing countries, post-transfusion (or needle accident), and developed countries. It is a sporadic (collectively acquired) type found in many countries. The waterborne type was thought to be caused by a different virus from the other two types, but in recent years genetic fragments of the main causative virus (hepatitis E virus) have been discovered by GenLab.
abs) (CEI, USA) and IEI CDC [WO 89/12462.8]
9/12641 twin fret (1990), Re
yes, G, R,, et al, 5science247
, 1335 (1990)], in this specification, unless otherwise specified, "non-Non-B hepatitis" does not include this water-borne type, but means the remaining post-transfusion type and sporadic type.

It is well known that post-transfusion hepatitis occurs in 10-20% of people who have received blood transfusions;
Alter [Alter, MJ, et a.
l、^nnals of Internal Medi
cine 77.691 (1972)], Prince [
1”rince, A, M,, et al, Lancet
2.241 (+974) 3, Fine Stone E F
e1nstone.

S, M,, et al, New England
d Journal of Medicine2
92, 767 (1975). Later, the involvement of hepatitis A virus was also denied, and
He was diagnosed with type hepatitis. The fact that this hepatitis is an infectious disease is that it can be caused by blood transfusions as well as blood products (coagulation factor preparations and immunoglobulin preparations). It was estimated from an epidemiological study that there is. Filtration experiments, postmortem experiments after treatment with chloroform and formalin, and fractionation using density gradient centrifugation have revealed that this infectious agent is a small, enveloped RNA virus, probably Togavirus.
) was thought to be about -.

By the way, according to estimates by the Ministry of Health and Welfare (1988), 90% of post-transfusion hepatitis and approximately 50% of sporadic acute hepatitis are estimated to be non-B hepatitis. Approximately half of these patients progress to chronic hepatitis, and 10-20% progress to cirrhosis. Furthermore, in the process of progressing to liver cancer, persistent infection with non-A, non-B hepatitis viruses and/or chronic inflammation are thought to be involved. Therefore, it is an urgent medical need to establish methods for preventing and treating non-A, non-B hepatitis viruses.
No real methods of fraud, prevention, or treatment have been established.)
No. 6 Recently, two groups have reported the isolation of genes for non-A, non-B hepatitis virus-specific antigens caused by blood transfusions. One is by Grufni of Chiron Corporation (USA [11] [Choo, Q-L, et alSci
ence 244.35') (1989>, Kuo,
G,,et al,5science244.362(
1989), Japanese Patent Publication No. 100880, European Patent Application Publication No. 318216 (1989) (
, and the other was by Arima et al.'s group at Okayama Oaza (currently Kagoshima University) [Arima, T., et al.
,) lepatology8, 1275 (1988)
, ^ri+oa, T,, et al, Gastro
entero-1ogia Japonica 24.
685 (1989), Arima, T., et alG.
astroenterolo3ia Japonica
25.218 (1990), European+Ij Patent Application Publication No. 363025 Specification M (1990) 3. Both antigens react specifically with serum from patients with chronic non-A, non-B hepatitis after blood transfusions and some patients with sporadic chronic non-A, non-B hepatitis. There was almost no reaction with patients suffering from chronic hepatitis B and chronic hepatitis B. Furthermore, the genes encoding these were not derived from host cells, and these antigens were thought to be derived from non-A, non-B hepatitis virus genes. The Chiron group named the virus containing this gene EC hepatitis virus (Hcv). Based on its genetic structure, HCV: a flavivirus 〒4
It is considered to belong to. However, neither e-neutral virus particles nor infectious virus genomes have been isolated, and the pathogenicity of this virus as a non-non-hepatitis B virus has not yet been proven.

Subsequently, multiple Japanese groups performed immunoscreening and reverse transcription-polymerase chain reaction (RT-PCF reaction) using serum from patients with non-A, non-B hepatitis.
A gene fragment with homology to CV was cloned. Compared to Chiron's HCv, these are about 5χ~30% at the base sequence level and 5χ~20% at the amino acid level.
% difference was observed, and it is thought to be derived from the Japanese variant of HCV [Maeno, M., et al.
al,, Nucleic Ac1ds Re5ear
ch18, 2685 (1990), Nobuo Takada et al., Liver 315upp1.217 (1990), Shuichi Kaneko et al., Liver [315upp1.213 (1990), Nobuyuki Kaya et al.
Liver H & 315upp1.214 (1990)].

In this way, knowledge about non-A, non-B hepatitis viruses is accumulating; however, there are also concerns about 1) subtypes and distribution patterns of HCV; 3) “Sporadic” non-A, non-B hepatitis seen in developed countries are all HCV as mentioned above.
There has not been sufficient research on whether or not hepatitis is caused by hepatitis.In other words, there has been no research on the identification of antigens necessary for developing detailed and useful diagnostic methods and therapeutic measures for non-A, non-B hepatitis. , is still not fully completed.

For example, for the diagnosis of non-A, non-B hepatitis, some virus antibody measurement kits are already on the market, but they only react with about 70% of non-A, non-IPB hepatitis and non-blood transfusions after blood transfusion. LXuo, G., et al.

5science 244.362 (199, O) Ko, the reaction rate with chronic non-A, non-B hepatitis patient serum is high, but acute phase non-A, non-B hepatitis patient serum and sporadic non-A, non-B hepatitis patients CMiyamuri that the reaction rate with serum is low;
T, , etal, Proc, Natl, Ac
ad, Sci, [J, S, ^ 87.983 (199
0).

Hisuya Nishioka et al., Internal Medicine 64.1027 <1989>]
, and it takes an average of 4 months for antibody seroconversion [^ti
er, f(,J,.

et al., N., Engl., J., Med., 30.14
94 (1989) i and the presence of antibodies to the virus does not necessarily correspond to viremia [Hiroaki Okamoto, Liver TR315upp1.40 (1990).

Koji Furusawa, Liver 315upp1.42 (1990) 1, etc. are known, and there are still many problems to be solved in diagnostic methods for non-A, non-B hepatitis virus antibodies.

(Problems to be Solved by the Invention) The present inventors have developed an antigen that is more useful than the conventional viral antigens, namely: 1) An antigen with a high reaction rate to serum from patients with non-A, non-B hepatitis after blood transfusion 52) Sporadic As a result of intensive research to discover antigens that have a high reaction rate to non-A, non-B hepatitis patient serum, and 3) antigens that can detect viral antibodies that have a strong correlation with viremia, we found that a new non-A, non-B hepatitis virus was detected from Japanese human plasma. The gene for non-B hepatitis virus antigen was obtained. When the nucleotide sequence of the gene was determined, it was found that there was homology with the previously reported nucleotide sequence (base sequence 6060th to 6314th as shown in Figure 47 of Japanese Patent Application Publication No. 112-500880), but different nucleotide sequences were found. The present invention was completed after learning that there is a novel non-A11-B hepatitis virus antigen.

<Means for Solving the Problems> In practicing the present invention, unless otherwise specified, molecular biology and microbiology recombinant DNA methods known in the art will be used.
A, and conventional techniques of immunology are employed. For such a method, please refer to the following experimental book.

Experiment book 1: Sa+obrook, J,, Fr1t
sch, E. F., and Maniatis, T.
Mo1ecular Cloning 2nd Ed,
; Cold Spring Harbor (1989
) Experiment book 2: DNA cloning Volume 1 (Gl
over, D, M edition) rRL Press, (1
985) Experiment Book 3: DNA Cloning Volume 3 (Glover, D, M, #4〉IRL Pre
ss, (1987) Experimental Book 4: [(andbo
OK of experimental immunity
-1ogy, 4th ed, volumes 1-IV (Heir
, D, M eds.), BIack-well (1986
) Ikensho 5° Current Protocols i
n Mo1ecular old logic (＾usube
1. F, M, et al,,X) John Wil
ey & 5ons (198g) Experimental book 6: Method in Enzymolo
gy Volume 185 (Goedd-el, Dl,!) Ac
ade+nic T'ress (1990) (1)
Preparation of virus RNA^) Preparation of RNA from patient blood F [Bs antigen negative, HBV-DNA jljH, high A
Human blood samples or non-A, non-B hepatitis patient sera showing LT (GPT > activity value (>351 tl/I)) are pooled and used as starting material for virus RNJI production. Virus particles are precipitated by polyethylene glycol precipitation method. RNA is extracted from the precipitate using a method such as the guanidine thiothioate method [Chomczynski,
P. and Sacchi, N1. ^analytic
al Bioche+aistry 162. 159
(+987)]. At this time, RNas
For example, heparin, polyvinyl yM, diethylpyrocarbonate vanadium complex, etc. can be added as an RNase inhibitor to prevent RNA degradation by E.

In addition, chimpanzee serum infected with non-A, non-B hepatitis virus can be used instead of human serum, but mutations may occur in the viral genes when the virus is passaged in different species of animals. When cloning antigens, human serum is preferably used as a starting material.

b) Preparation of 'lN^ from human liver Mi tissue [Experimental Report 1. Chapter 7] allows RNA to be prepared.

(2) Construction of cDNA library Using the obtained RNA as a template and random hexamer as a primer, the Gubler-Hoffman method [Ge.
double-stranded c by ne, 25, 263 (1983) 1
Synthesize DNA. The cDN^ is inserted into the λgtll phage vector.

The immunoscreening method using gtll is a well-known method developed to isolate the antigen gene corresponding to a specific antibody [Young, R.A., a.
ndDavis, R.W., Proc., Nat! , ^
cad, sci, UsA 80.1194 (1983)
, Experimental Book 2, p49-78], and λgtlN
λZAP, λZAPI1 outside J. pUc19. pU
The recombinant λgtll, which can also be inserted into vectors such as EXl, is infected with host E. coli (e.g. Y1090 strain), but under certain conditions it multiplies according to the bacteriophage multiplication mechanism, and along with this, , previously integrated cDNA is also amplified. Under certain conditions, the bacteriophage lyses the host E. coli and forms a visually recognizable plaque.

(3) Immunoscreening of cDNA DNA library using patient serum The cDNA inserted into the λgtll phage vector is expressed as a fusion polypeptide with β-galactosidase (β-gal), so it can be used to detect specific antigens. A large number of recombinant λgtl with specific antiserum! 3. By screening, cDNA encoding a specific antigen polypeptide can be identified by immunochemical methods. 9 In the present invention, the cDNA prepared in (2) above can be
It is desirable to screen the library using various non-A, non-B hepatitis patient sera or pooled sera. The above-mentioned patient serum was used as the primary antibody to react with the antibody, and peroxidase-labeled goat anti- (human IgG)
) React with IgG etc. as a secondary antibody and isolate plaques that show a positive color reaction.

(4) Determination of cDNA sequence The base sequence of the antigen gene of the present invention thus obtained is determined by Sanger method [Sang] on the recombinant λgtll DNA and on the plasmid vector DNA after subcloning.
er, F, , et al, , Proc, N
atl, ^cad, Sci, USA, , 74
゜5463 (1977), Experiment! 1. It can be determined using a commercially available sequence kit adapted from Chapter 3].

(5) Method for detecting the virus genome in patient serum using the base sequence of the antigen gene Based on the disclosed portion of the base sequence of the non-A, non-B hepatitis virus polynucleotide of the present invention, The polynucleotide encompassing the moiety was prepared using the phosphoramidite method Cf (Unkapiller, M. et al.
Nature 310.105-111 (1984)
It can be synthesized using a synthetic method such as No. 1, or a commercially available DNA synthesizer (for example, Apply Biosystems (ABI), 38S Type A DNA Synthesizer 7').

This polynucleotide hybridizes with one of the viral genomes of the invention.

It is useful as a probe (or primer) for identifying and detecting the virus. When using mA nucleotides for cutting (using conventional methods, radioactive 10-
They can be used as labeled probes such as biotin fluorescent probes, biotin fluorescent probes, and chemiluminescent probes.
The procedure can be carried out by referring to Probe II, CMC (1990).

Until now, non-A, non-B hepatitis viruses exist in extremely small amounts in patient serum (1/1 of the hepatitis B virus).
0') is known. In such cases, 1 reverse transcription-PCR method [Kaw
asaki, E, S, , et al, , P
roc, Natl.

^cad, sci, UsA 85.5698 (1988
), Hiroaki Okamoto, liver 1ti31, 5upp1.40 (1
It is also possible to detect the target virus genome after amplifying it using methods such as 990).

(6) 1IiI λ of non-A, non-B hepatitis virus antigen polypeptide and fusion antigen polypeptide) Expression of recombinant antigen polypeptide and recombinant fusion antigen glipeptide using genetic recombination technology: The antigen polypeptide is For example, expression in Escherichia coli can be expressed using known expression vectors in Chapter 17 of Experiment Book 1, Experiment Book 3,
p59-88, experimental book 6. For expression of pH-128 etc. in yeast, see Experiment Book 3, p141-161゜Experiment Book 6.
, p231-484. In addition, the expression method when using mammalian cells as a host is described in Chapter 16 of Experimental Ill, Experimental Book ・3, p163-212, Experimental Book 6. p4δ
The expressed recombinant antigen polypeptide can be purified by protein purification methods known in the art (ultrafiltration, ultrafiltration,
centrifugation, dialysis, ion exchange chromatography, gel filtration, electrophoresis, affinity chromatography,
HPLC etc.; e.g. Methods in Enzy
mo-1ogy volume 182 (Deutscher,
M, P, v4) Academic Press (
(1990) etc.). In addition, as a simple method for expressing a fusion antigen polypeptide, for example, E. coli Y1089 strain in which the recombinant λgtll clone Y1 of the present invention has been lysogenized is expressed using IPTG.
(1sopropyltio-β-galactos
1de) [Experimental Book 2, p.
7 row 77], the expressed fusion antigen polypeptide is
Gel filtration and/or mouse monoclonal antibody against β-gal (Boehringer Mannheim, 1083
M can be produced by immunoprecipitation method or affinity chromatography using 104). In addition, β-ga11
．． Expression of the 81-combined antigen polypeptide using ``Example'' can be carried out with reference to Experimental Book 6, p. 129-165.

b) Preparation of the antigen polypeptide by peptide synthesis: The antigen polypeptide can also be provided by chemical synthesis based on the amino acid sequence determined by the present invention. in this case,
The entire sequence can be synthesized into fragments of a length (10-50T) that is relatively easy to synthesize.
It is preferable to synthesize the peptide fragments by dividing them so that the adjacent fragments overlap by about 5 to 10 residues. For the detection of antiviral antibodies, all of these divided and synthesized peptide fragments are mixed together. However, once the antigenic region is identified by epitope manoping, only the fragments containing the antigenic region can be used alone or in combination.

Various polypeptides containing the amino acid sequence of the antigen polypeptide can be synthesized manually by a liquid phase method or solid phase method, or chemically synthesized by an automatic synthesizer (for example, ABI Model 430A peptide synthesizer). The polypeptide synthesized by the solid phase method according to the t, -Boc method or the Ftrroc method is excised from the resin using trifluoromethanesulfonic acid, hydrogen fluoride, trifluoroacetic acid, or the like. These synthetic peptides can also be purified by preparative reverse phase high performance liquid chromatography (HPLC) to further increase the degree of purification.

(7) Method for detecting virus antibodies in patient serum by immunoassay The non-A, non-B hepatitis virus antigen polypeptide obtained by the present invention, or the antigen polypeptide consisting of a partial epitope thereof, can be detected using an immunoassay, for example. , non-A, non-B in biological samples, including body fluid samples such as blood, blood, serum, and spinal fluid, and human immunoglobulin preparations.
It can be used to detect the presence of hepatitis virus antibodies. In this immunoassay, the antigen polypeptide is contacted with the sample under conditions that allow the formation of an immunological bond (antigen-antibody conjugate) between the antigen polypeptide and the non-A, non-B hepatitis virus antibody in the sample. ),
! If even a small amount of antigen-antibody conjugate is formed, this indicates the presence of non-A, non-B hepatitis virus antibodies in the sample, and can be detected and measured by appropriate means.

Such methods include immunoprecipitation method, agglutination method, radioimmunoassay (R1, 8), EIA, ELISA,
Examples include Western blot azosei and binding immunoassay. Additionally, assay protocols using the antigenic polypeptides can be performed using competitive or non-competitive binding methods.

The antigen polypeptide may be labeled with a label depending on the assay method. Known labels that bind to the polypeptide can be used, such as fluorescent molecules, luminescent dye molecules, radioactive molecules, enzymes, covalent molecules, etc. Factors, biotin/avidin, colloidal gold, magnetic particles, etc. Furthermore, if the antigen polypeptide of the present invention is chemically modified, it can be bound to a carrier protein, carrier polypeptide, or a known support by known means. Examples of such supports include microtiter plates and beads made of polystyrene or polyvinyl, glass tubes and beads,
Also chromatographic supports such as paper, cellulose, cellulose derivatives, and silica can be used.

Among these assay methods, ELT is particularly useful for large-scale screening of bad blood or blood products.
SA, ambient air method, Western blot assay, etc. are suitable.

The simplest method is to express the antigen obtained according to the present invention as a fusion protein with, for example, β-gal, plot it on a nitrocellulose membrane, fix the antigen on a solid phase, and perform non-diagnostic analysis using ELISA. A method for detecting non-B hepatitis virus antibodies (immunoplaque assay, Western Pro-I assay, etc.) (Example 4)
.

(Effects of the Invention) The antigen polypeptide of the present invention is useful for detecting non-A, non-B hepatitis virus antibodies that cannot be detected by conventional testing methods using antigens. Further, by using the non-A, non-B hepatitis virus polynucleotide sequence of the present invention, it is possible to detect virus particles (genomes) that cannot be measured with 5 detection times using conventional pressure detection methods. Also, using the antigen polypeptide.

Polyclonal antibodies and monoclonal antibodies that can be used to detect the viral antigen and treat non-Non-B hepatitis can be produced. In addition, the antigen polypeptide can be used for the production of vaccines for the prevention of viral 6-staining and for the treatment of wheat against 8-staining.

EXAMPLES The present invention will be explained in more detail with reference to Examples below, but these are not intended to limit the scope of the present invention.

Example 1: Extraction of plasma RNA for cDNA production HBs with abnormally high ALT activity value (>7010/I)
Antigen and! (After thawing 2000 ml of frozen plasma that was negative for IIIV-DNA at room temperature, it was centrifuged at 4°C for 20 minutes using a 5000 RP slip (Hitachi, RPR9-20-tar) to remove fibrin. Polyethylene glycol 4000 was added and dissolved. After cooling on ice for 30 minutes, centrifugation was performed under the same conditions to collect the precipitate. RNA from the precipitate was extracted by the AGPC method using guanidine thiocyanate [Chomczynski, P.
, and 5acchi, N^analytical B
iochemistry, li2.156 (1987)
]. In other words, double the amount of precipitate (1 g of precipitate
Solution 6D (6M guanidine thiocyanate, 25+I1M sodium citrate,
After dissolving in 0.1M 2-mercaptoethanol) (pH 7.0, 0.0, Sarcosyl, 0.1M 2-mercaptoethanol), 0.1 volume of 2M sodium vinegar (pH 4.0) was added, followed by equal volume of phenol, 0.2 volume of chloroform, and isoamyl alcohol rM? l'! Extraction was performed with (49:I).

After cooling with water for 15 minutes, centrifuge, separate the upper layer, add 2 equivalents of 2-propatool, and add RNAt! - precipitated. After centrifugation, the precipitate was dissolved in 05 mQ of 1 g1i 4D (4% guanidine thiocyanate, 25 m M sodium citrate).
pI (7,0+ 0.5% Sarcosyl, O,I@2
- mercaptoethanol), then 2 times the volume of ethanol was added to precipitate R11A again. After centrifugation, the material was washed with 75% ethanol, dried, and the precipitate was dissolved in 50μ9 sterile distilled water to make an RN4 solution.

Example 2: Creation of cDNA library cDNA synthesis was performed using a 10 μm RN^ solution as a starting material. R
To create two fi cDNAs from NA, use commercially available cD
NA synthesis system plus (Amajam, RPN-1
2567). One-tree cD from RNA
The conversion rate of NA is approximately 2%, from 1-strand cDNA to 2-strand cD.
The rate of change to NA was approximately 100χ.

The synthesized 2g cDNA was precipitated with ethanol and then mixed with 100μQ of TE i8 solution (10mM T
ris-CR.

Commercially available cDN^ synthesis kit Lumacia IJB, 27-
9260-01), the following reaction was performed. c.
Add the DNA solution to the 5ephacryl that comes with the kit.
By passing through an S-300 span column, IX
Next, buffer exchange was performed on the T4 ligase solution.
Follow the instructions for the EcoRI adapter f-addition reaction and T.
A 4-kinase reaction was performed.

The adapter that did not bind to the cDNA was 5ephac
It was removed using a rylS-300 span column. The cDNA in the eluate was subjected to ethanol precipitation with 5 μg of carrier tRNA. The precipitate was washed with 75% ethanol and then air-dried.

Next, commercially available cDNA cloning system λgtx
t-adapter method (Amajam, RPN 1280)
The following reaction was carried out using Add 5μ9 of sterile distilled water and 4μQ (2μg) of λg to the precipitate. , 11 Ec
After adding buffer to the oRI arm and 1 μΩ of L7 to dissolve it, 1 μQ (2.5 U) of T4 ligase was added, and the mixture was incubated at 1'5'C overnight. Next, GIGAP
An in vitro packaging reaction of the above reaction product (containing recombinant λgtll DNA) was performed using the ACKII Gold λD ShiA Packaging Kit (Stratagene, 200216), and c
A DNA library (Lot, B) was created.

Example 3: Cloning of non-A, non-B hepatitis virus antigen genes by immunoscreening The reaction between plaques in the cDNA library (Lot, B) and primary and secondary antibodies was performed using the commercially available SuperScreen immunoscreening system. (Amajam, RPN 1
It was carried out according to the method of 2817). The primary antibody used for screening was pooled serum from non-A, non-B hepatitis patients (
Solution A (10II+M Tris-Cg, pH 7) was prepared by absorbing (2 mg lysate/g serum) E. coli lysate (Biorat, 1.7-3205) from 5 patients with convalescent acute hepatitis and 5 with chronic hepatitis. ,51
2 with 50mM NaCR, 2% (W/V) BS^)
It was used after being diluted 0 times. The secondary antibody used was perokindase-labeled goat anti-human IgG (Kabbell, 3201-0081) diluted 500 times. The color reaction was performed using a commercially available Lambda Lift Detection Kit/GA.
It was performed using R-HRP (Bio-Rad, 17-3556).

Out of about 500,000 plaques, 10 positive plaques (colored blue-purple on a trocellulose filter) were isolated. One clone among them was named Yl, and the following analysis was continued.

Example 4: Antigen specificity test of clone Y1 a) A mixture of Immunoplaque Y1 clone and negative clone at a ratio of 2:8 was tested and tested using the immunoscreening method described above. , non-A, non-B chronic hepatitis patient (with history of blood transfusion) serum (5 people), non-A, non-B chronic hepatitis patient (with no history of blood transfusion)
Serum (5 people), normal control serum (5 people), chronic hepatitis B patient serum (5 people), acute hepatitis A patient serum (1 person)
The reactivity with (name) was investigated. As a result, clone Yl is
It was shown that it specifically reacted only with non-A, non-B hepatitis patient serum (Table 1).

Patients with non-A, non-B chronic hepatitis 5 3/' 5 Non-A, non-B chronic hepatitis without trunk blood 5 215 Type A 2
Chronic hepatitis 10/' Type IB Chronic hepatitis 50,/5τ Coordination 5, that is, clone Y] is non-A
It was confirmed that the virus contained an antigen (epitope) that is immunologically recognized by serum derived from non-B hepatitis patients.

b) Western blot assay λgt, l1 (parent strain) lysogen and recombinant λgtllY
1 lysis W, manufactured by JA, culture of the above lysogen and β-g, 1
The induction of expression of 1 and β-gal fusion antigen polypeptides is described in Experimental Book 3. 0 expression induction fL performed according to the method of p76
The culture solution was disrupted by ultrasonication, and the protein concentration was measured by the Bio-Rad method (Bio-Rad, 500-0001).

A protein amount equivalent to 5 μg from each disruption solution was subjected to 5DS-PAGE, and after electrophoresis, a semi-dry electroplotter (In
tegated 5eparati.

Western plot was performed using N Systems). The various sera listed in Table 1 were used as primary antibodies, and the reactivity of the various sera to β-gal and β-gal fusion antigens was examined using the immunoscreening method described in Example 3). Result 5: A color reaction was observed only in the combination of β-gal fusion antigen polypeptide (approximately 00 kd) and non-A, non-B hepatitis patient serum (positive rate was the same as the results in Table 1). The antigen specificity of the protein was confirmed.

Example 5: Determination of the base sequence of cDNA derived from clone Y1 and the antigen polypeptide sequence encoded within the sequence Clone Y1 was propagated by the plate lysis method described in 2118 of Experimental Book 1, and then phage DNA was extracted. Prepared. 5 μg of phage DNA t! - After digestion with EcoRI, it was purified by phenol extraction and ethanol precipitation.

After treating 3 μg of EcoR1 digest with alkaline phosphatase, 5' end labeling was performed using T4 kinase and γ32 p-^TP. After purifying the DNA fragments by phenol extraction and ethanol precipitation, they were subjected to 5.0% polyacrylamide gel electrophoresis and cD excised by EcoRI digestion using O1-radiography.
The length of NA was investigated. As a result, the size of the cDNA is approximately 2
It was found to be 80 base pairs.

Next, the above-mentioned EcoR] digested product and EcoF! 19 (Pharmacia IJ8.27
-4986-01) and J)! 109 (Takara Shuzo, 9052), and a plasmid containing an insert of about 280 bases was released (named pTZ19-Yl).

The base sequence of the cDNA incorporated into pTZ19-Yl was determined by DyeDeoxy Terminator Taq.
Sequencing Wit (ABI.

401070) was used to perform the sea-fence reaction, and Dh
It was determined by electrophoresis using an A-quencher (8Bl, 373A type).

M13 Brimer 1+14 (Takara Shuzo j832
), both strands were read and determined using M13 primer RV (Takara Shuzo, 3g30).

In addition, in order to confirm which chain of the determined sequence was involved in forming a fusion protein with β-gal protein on recombinant λgtll, we used λgtll EcoR1 site primers in the forward and reverse directions (New England Bio
+2]8, 1222) using Phage D
Base sequencing was performed using NA directly as a template. Based on these results, the nucleotide sequence encoding the antigen that specifically reacts with non-A, non-B hepatitis patient serum was determined as shown in FIG. 1, and the amino acid sequence of the antigen was determined as shown in FIG. 2.

[Brief explanation of drawings]

FIG. 1 shows the nucleotide sequence encoding the non-A, non-B hepatitis virus antigen polypeptide of the present invention. FIG. 2 shows the amino acid sequence of the non-AIPB hepatitis virus antigen polypeptide of the present invention. French 11￥1 5' AAAAAAGGTCA CCTTTGACA
G ACTGCAAGTC4050・60 CTGGACGACCACTACCGGGA CGT
GCTGAAGGAGATGAAGG CGAAGG
CGTCCACAGTTAAGlooo
110 120GCTAAAACTTCTA
TCCGTAGA AGAAGCCTGCAAGCT
GACGCCCCCACATTCGGCCAAATCC
,160170180

Claims (1)

[Claims] (1) A non-A, non-B hepatitis virus antigen polypeptide shown by the amino acid sequence below [there is a gene sequence]. (2) Chemically synthesized antigen polypeptide according to claim (1) or polypeptide fragment group containing the amino acid sequence thereof (3) Fusion antigen polypeptide having the amino acid sequence according to claim (1) (4) Antigen polypeptide The peptide is β-galactosidase (β-
(5) the fusion antigen polypeptide (5) according to claim (3), which is fused with the antigen polypeptide (6) claim (1), which expresses the antigen polypeptide according to claim (4); ,
A polynucleotide encoding the antigen polypeptide described in either (3) or (4) (7) A non-A, non-B hepatitis virus polynucleotide [with a gene sequence] shown by the base sequence below. (8) A polynucleotide probe for detecting a polynucleotide derived from a non-A, non-B hepatitis virus, the polynucleotide probe having a length of 8 consecutive bases or longer according to claim (7). (9) A host cell transformed with a recombinant expression vector to produce the antigen polypeptide according to any one of claims (1), (3), or (4) is used to express the polypeptide. (10) A method for producing an antigen polypeptide, which comprises culturing under conditions in which the antigen polypeptide according to claim (1), (2), (3), or (4) is present in a biological sample. non-A
Confirming the presence of non-A, non-B hepatitis virus antibodies in a biological sample by measuring the immunological conjugate formed upon reaction with non-A, non-B hepatitis virus antibodies. Detection method