JPH04148686A - Production of plasmid, transformant strain and peptide precursor protein - Google Patents

Abstract

NEW MATERIAL:A plasmid where vector DNA is bound to a gene fragment with a plurality of genes coding peptide bound to a gene coding protein secreted out of microbes by host microorganisms. USE:A vector for producing peptide as peptide precursor using recombinant DNA technique. PREPARATION:For example, protein A of Staphylococcus aureus is used as a protein secreted out of microbes by host microorganisms such as Bacillus subtilis SPL-14 (FERM P-11742), and a gene coding the wo protein A is selected by cloning from Staphylococcus aureus, and then, a gene fragment with a plurality of genes coding peptide bound to the above gene coding the protein A is bound to vector DNA using DNA ligase, thus obtaining the objective plasmid containing DNA coding protein secreted out of microbes by host microorganisms.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention provides plasmids useful for obtaining peptide precursors containing a plurality of peptides using recombinant DNA technology.
The present invention relates to a transformed strain and a method for producing a peptide precursor protein.

[Prior Art and Problems to be Solved by the Invention] Currently, a large number of physiologically active peptide hormones are known, and there is an increasing need for them as pharmaceuticals or reagents.

In recent years, it has become possible to produce peptides by microorganisms using recombinant DNA technology. In this recombinant DNA technology, a peptide precursor gene, in which a peptide-encoding gene and another protein-encoding gene are linked, is usually expressed in the host E. coli.
By allowing enzymes or drugs to act on the generated peptide precursor,
The target peptide is excised.

However, when producing a peptide precursor using E. coli as a host, there are the following problems.

(1) When E. coli is used as a host, it produces endotoxin, so endotoxin must be removed from the product.

(2) The peptide precursor produced within E. coli is usually
In many cases, the peptide precursor becomes an insoluble mass called an inclusion body, and in order to recover the peptide precursor from this inclusion body, a step of solubilizing it with a solubilizing agent such as urea is required. When a peptide is excised from a peptide precursor by enzymatic action, the above-mentioned solubilization is particularly important. However, this process is quite complicated;
Moreover, the solubilization efficiency is low. For example, it has been reported that when bovine growth hormone is produced by Escherichia coli and the generated inclusion bodies are solubilized using urea, the solubilization rate is 10%, and the rest remains as inclusion bodies. [5choner, R,G
,, at al,.

1'310/TlECllN0I, OGY, 3.15
1-154 (1985)].

(3) When peptide precursors are produced within bacterial cells, it is necessary to purify the desired peptide precursors from the crushed bacterial cells. In this case, many purification steps are required to separate the target peptide precursor from the many types of host-derived proteins present in E. coli cells.

On the other hand, when the peptide precursor is secreted and produced outside the microbial cell, there are fewer host-derived contaminant proteins than when the peptide precursor is produced inside the microbial cell, so it is advantageous for producing the desired peptide precursor. Therefore, we used Bacillus bacteria as a host, which has the property of secreting large amounts of secreted proteins, is nonpathogenic, and has been widely used for industrial production of enzymes, amino acids, etc., to secrete peptide precursors outside the bacterial body. Production is being considered. In particular, Bacillus subtilis among the Bacillus genus bacteria has a lot of genetic and biochemical knowledge.

It has also been reported that many heterologous gene products can be secreted and produced using Bacillus subtilis as a host by utilizing its secretory ability. For example, Bacillus subtilis α
- Secretion of mouse β-interferon using amylase gene [Yamanc, K, cl al, +
In J, A, l1och and P, Sa
low (cd,), Molecular biol
ogy or m1crobalaldlrrer
cnLiation, American 5ocie
ty for Mlcrobiology, Wash
Inton, D.C., 117-123 (1985)
[5Lephen R, Fahn
esLock, cl at, ^ppHcd and
'EnvlronmcnLal Mlcroblolo
gy, Feb. 379-384 (1987)],
Secretion of Escherichia coli β-lactamase using the subtilisin gene [5ui-1, as Vang, at
at,, Journal or Ractcrlol
ogy, Vol, 18g, No, 2. NOV
, +005-1009 (1986)] and] Secretion of human α-interfero [Palva, 1.
at at, Gene, 22. 22
9-235 <19113n] etc. have been reported. As seen in these reports, proteins derived from various prokaryotes are efficiently secreted and produced using Bacillus subtilis as a host. For example, in the case of Staphylococcus aureus protein, approximately 1 g/j
Secretory production of is observed.

However, in the case of secretion of mouse β-interferon and human α-interferon derived from eukaryotes, the secreted amount is small.

For example, in the case of human α-interferon, the secretory production amount is about 500 μg/j.

In addition, regarding the secretory production of peptides with a small number of amino acids or their precursors, we have developed a 25-amino acid atrial diuretic hormone [human aerial diuretic hormone] using the subtilisin gene of Bacillus subtilis.
The secretory production of tlc α-racLor (hANF) has been reported [1. In-Pa Wang,,
at al, + Gene, 69.39-47 (1
988)]. However, even in this case, the secreted production amount is as low as about 500 μg/J. The main causes of this are thought to be inhibition of peptide secretion and degradation by protease secreted by Bacillus subtilis.

These things mean that when Bacillus subtilis is used as a host, it is not easy to secrete and produce eukaryotic-derived proteins or peptides outside the bacterial cell. Furthermore, there is a possibility that the C-terminal side of some or all of secreted and produced proteins and peptide molecules may be degraded by host-derived proteases. Therefore, it is difficult to secrete and produce a peptide having a complete amino acid sequence by microorganisms such as Bacillus subtilis.

The object of the present invention is that even if the peptide is derived from eukaryotes,
The object of the present invention is to provide a plasmid that is useful for efficiently secreting and producing a large amount of a peptide having a complete amino acid sequence outside of microbial cells, and a transformed strain transformed with this plasmid.

Another object of the present invention is to provide a method for producing a peptide precursor protein that can efficiently obtain a large amount of a peptide having a complete amino acid sequence as a peptide precursor.

[Structure of the Invention] In order to achieve the above object, the present inventors, as a result of intensive studies, discovered a gene in which a plurality of genes encoding peptides are linked to a gene encoding a protein secreted outside the microbial cell by a host microorganism. ligating the fragment and vector DNA,
When transforming a host microorganism with the obtained plasmid, it is necessary to culture the transformed strain to ensure that a peptide precursor protein containing multiple peptides with complete amino acid sequences is efficiently produced in large quantities outside the microbial cell. Found,
The invention has been completed. That is, the present invention provides a plasmid in which a gene fragment in which a plurality of genes encoding peptides are linked to a gene encoding a protein secreted outside the microbial cell by a host microorganism, and vector DNA are linked.

The present invention also provides a transformed strain in which a host microorganism is transformed with the plasmid.

Furthermore, the present invention provides a method for producing a peptide precursor protein, in which the transformed strain is cultured and a peptide precursor protein containing a plurality of peptides is secreted outside the cell.

The present invention will be explained in detail below.

The plasmid of the present invention contains a gene encoding a protein secreted extracellularly by a host microorganism. The protein may be any protein that functions as a carrier and is secreted outside the microbial cell by the host microorganism. Preferred proteins include Bacillus (Bacillus II)
) bacteria, especially Bacillus subtilis (1) acil
It is a protein secreted by the US 5ubLIIis). Bacillus subtilis is highly safe and secretes large amounts of protein outside the bacterial body.

Proteins secreted by Bacillus bacteria to the outside include proteins originally secreted by Bacillus bacteria, such as α-
Not only amylase, neutral or alkaline protease, benicillinase, cellulase, etc., but also proteins of foreign organisms such as Staphylococcus aureus [Staphylococcus aureus].
It also includes protein A derived from [eus)]. Preferred proteins include protein A described above.

Protein A will be explained below.

Protein A has a promoter region involved in gene expression and a liposome binding site. The promoter region is, for example, Staphylococcus aureus strain 8325-4 [
Uhlen et al., J., n1o1. Che1, +259
．． 1695 (1984) derived from Ko, -131 to -1
Although a promoter having a hairpin structure at position 20 and a palindromic sequence at positions -151 to -138 may be used, a preferable promoter region is the base region proposed by the present applicant in JP-A No. 83-245677. This is an area represented by an array. This promoter region is -30
It corresponds to sequences 0 to -1, and its feature is that, unlike the promoter region derived from the Staphylococcus aureus strain 8325-4, the hairpin structure and palindromic sequence are absent.

Downstream of the promoter region (1st to 108th base sequence)
There is a gene encoding the S region involved in secretion, and a structural gene exists downstream of this secretion signal region (base sequence 109th to 1524th). The structural genes of protein A are E (109th to 276th base sequence), D (277th to 459th base sequence), A (
460th to 633rd base sequence), B (634th to 8th
It consists of six units consisting of (base sequence 07th to 981st), C (base sequence 808th to 981st), and X (base sequence 982nd to 1524th), and from the N-terminus,
Combined in the above order. Also, 1525-1552
The nucleotide sequence is a non-coding part, 152
A termination codon TAA exists at positions 5 to 1527. E
The region is a unit present at the N-terminus of protein A, and has a relatively low binding ability to immunoglobulin G (IgG). D.A.

The B1 and C regions each have a strong binding ability with the Fc portion of IgG, and the X region is a unit that has the function of binding eight protein molecules to the cell wall of Staphylococcus aureus.

Thus, protein A has five repeating regions that specifically bind to the Fc region of IgG and a region that binds to the cell wall. Utilizing this fact, the target peptide can be linked after the region that specifically binds to the Fc region, expressed as a fusion protein, and then easily purified by affinity chromatography. Therefore, the protein-encoding gene has the ability to bind to the Fc portion of IgG in the protein A region, especially the 44-44 region in the mature protein of protein A.
The region up to the 0th amino acid, that is, up to Asp, which is the 440th amino acid (excluding the signal peptide) in the protein A structural gene, is preferred. Also,
The protein is 18 in the mature protein of protein A.
The region up to the 7th amino acid, ie, up to Leu, which is the 187th amino acid in the protein A structural gene (excluding the signal peptide), is preferred.

In addition, as mentioned above, protein A of Staphylococcus aureus
contains a promoter involved in gene expression, a liposome binding site, a secretory signal, and a protein-encoding region. Therefore, a plasmid into which protein A has been introduced has the ability to secrete and express, and when a peptide-encoding gene is linked after a protein-encoding region, a peptide precursor protein consisting of a protein and a peptide precursor is secreted and expressed. .

Note that the size of the protein may be the entire protein molecule or a portion thereof, as long as it functions as a carrier.

Furthermore, the gene encoding the protein may be derived from a living organism or may be chemically synthesized. The gene may encode the entire protein or a portion thereof, depending on the size of the protein.

The plasmid of the present invention is characterized in that it contains a tandem gene in which a plurality of genes encoding a target peptide are linked to the gene encoding the protein.

The peptide is not particularly limited as long as it is composed of natural amino acids. Specific examples of peptides include, for example, vasoactive intestinal polypeptide [Vaso
actlvcIntestinal Polypep
LIde (VIP)], atrial diuretic hormone (ANP)
, insulin, gastrin, various opioid peptides,
Epidermal growth factor, endothelin, substance P1 calcitonin, insulin-like growth factor i.

(2) Physiologically active peptides such as galanin, motilin, and vasopressin, and inhibitors such as hirudin and nigrin C1-secreting leukocyte-derived protease inhibitor. Peptides also include proteins such as various differentiation-inducing factors and growth factors such as human albumin, blood coagulation factors, lymphocytes, nerve cell growth factors, and hepatocyte regeneration factors.

Preferred peptides include VIP, which consists of 28 amino acid residues and has pharmacological effects such as vasodilatory effects and blood flow increasing effects [5science 18
9.1217 (1970)], V IP is represented by the following amino acid sequence.

11-+11s-Ser-Asp-Ala-Vat-P
he-Thr-^5p-Asn-Tyr-Thr-^r
g-1, au-Arg-Lys-Gln-Mct-Al
a-Val-Lys-Lys-Tyr-Leu-Asn
-3er-l 1e-1, eu-Asn-011 VIP represented by this amino acid sequence differs from the prior art document [
JP-A-1-298998 and 1 Eur.

”, n1oche*, 178.343-350 (1
9H)].

Mata, VIP has cty-x at the C-terminus (wherein, X is O
ll, Lys-011, ^rg-011, LFS-A
rg-011, or Arg-Lys-011)
It is preferable to use it as a VIP precursor to which is added.

Genes encoding multiple peptides may be extracted from living organisms or may be chemically synthesized. Note that genes that encode multiple peptides of the same type in a continuous sequence are generally not known. Therefore, it is preferable to use a plurality of chemically synthesized genes as genes encoding a plurality of peptides.

Further, the plurality of peptides may be composed of a plurality of peptides of the same type, or may be composed of a plurality of peptides of a different type.

The number of peptide-encoding genes linked to the protein-encoding gene may be 2 or more, but is usually about 2 to 20.

It is preferable that an enzymatically or chemically cleavable spacer sequence (amino acid sequence) exists between the plurality of genes encoding the peptides. Using the cleavable spacer sequence, the peptide or a peptide-containing fragment can be cut out and separated from the peptide precursor into a container. Note that when a spacer sequence for cleavage is not required when isolating a peptide, there is no need to interpose a spacer sequence between multiple genes.

Examples of chemically cleavable spacer sequences include:
Met cleaved by cyanogen bromide [C-terminal side is cleaved. D.V.Gocdel,ot al.
Proe, Na11. Acad, Sc1. u
s^76, 106-110 (1979)]]BNFS
Trp is cleaved by -skatol) and N-rioosuccinimide (NC5) [C-terminal side is cleaved. Y, 5alto, at al,, J.

Bloches, 101.123-134 (19
87)], As cleaved by acids such as 70% formic acid
p-Pro [Asp-Pro is disconnected. old oc
hcm, l'3iophys.

Res, Cosmun, 40.1173 (19
70) ], As cleaved by hydroxyamine
n-Gly [Asn-cty is cleaved] and the like.

Enzymatically cleavable spacer sequences include, for example, Arg, Lyg [Arg, Lys C, which is cleaved by trypsin-like enzymes such as trypsin and endoproteinase.
The distal end is cut off. J, 5hlne, at a
l,, Nature, 285.456-461 (
1980)], lysyl endopeptidase, endobroteinase Lys-C, etc.
The C-terminal side of yS is cleaved. Japanese Patent Publication No. 81-27522
2), Glu, Asp (Glu,
The C-terminal side of Asp is cleaved. Special publication 1986-501
No. 891), summer 1e-Glu-Gly-Arg which is cleaved by blood coagulation factor
Gly-Pro-A cleaved by hrombin)
rg (C-terminal side is cleaved. JP-A-82-135
500), Kallikrein
) is cleaved by Phe-Arg [C-terminal side is cleaved. JP-A No. 62-24848911], Pro [(terminal side is cleaved) cleaved by prolyl endopeptidase.
6, 2942 (1977)), urokinase (u
Glu-Gly- cleaved by
Arg (C-terminal side is cleaved. JP-A-2-1006
Publication No. 85), etc.

Further, enzymatically cleavable spacer sequences include dipeptides Lys-Arg and Arg-Arg.

Includes Arg-Lysb Lys-Lys. As a protease that specifically hydrolyzes between these amino acids, Escherichia coli (P, 5chorlchla col+
) derived OmpT protease [Protease ■.

K., Suglsoto, et al.
J, Bacterol, 170. 5625-5
632 (198g)], Salmonella typhimurium (Sal+gonalla Lyp former muriu
E-Protcin [J, Gro
dberg and J, J., Dunn, J.
nacLcrlol, 171.290B-2905(
1989)], a protease involved in the biosynthesis of analgesic peptides [W, Denser and K.

Brand, Bioches, r31ophys,
Res, Commun,, 138, 35 [1-3
82 (198B)].

Proteases that specifically hydrolyze the N-terminal side of the spacer sequences Arg-Lys and Arg-Arg include, for example, proteases related to the maturation of somatosfutin [P, Gluschankor, cla.
J, Riot, Chc+n, 262.9615-
9620 (1987)].

Furthermore, spacer sequences Lys-Arg, Arg-A
Examples of proteases that specifically hydrolyze the C-terminal side of rg include IRCM-serine protease (S
erine ProLcasc) 1 [J, ^,
Crowlish, cl al,, J, +3io
1. Chcm, 261.10850-10858 (
198[i)], ]POMC-converting enzyme) [Y
, P, 1. Oh, at al.

J, l1io1. Chas, 260.7194-
7205 (1985)], yeast Saccharog+yccs, K, Mlzun
o, at al,, Bioahcti, Biop
hys, Rcs, Cosmun.

144, 807-814 (1987)], ] Kluyvcromyccs), Sporopolomyces (Sporobolosyccs)
, FilobasidfUI
, llanscnula , lssaLchcnkla , Pichia (
Pichia), Rhodosporidium (Rhodosp.
oridiui), Saccalomycopsis (Sacc
proteases derived from P. harog + ycopsis (Japanese Patent Application Laid-open Nos. 1-191683 and 2-49585).

Among these spacer sequences, Lys-ArgSArg-Arg whose C-terminal side can be specifically hydrolyzed by the yeast-derived basic amino acid residue pair-specific protease
, or Pro-Arg are preferred.

The vector DNA into which the gene is integrated in order to secrete the peptide precursor must be able to be replicated by the host microorganism.
Any DNA may be acceptable, but it is preferably plasmid DNA that can be replicated in bacteria of the genus Bacillus. As the vector, depending on the host that secretes the protein outside the bacterial body, conventional vectors such as Staphylococcus-derived plasmids pUB110, pc194, pBD64, pE194,
Examples include pSAO501, pT127 and derivatives thereof. A preferred vector DNA is plasmid pU
This is the DNA of B110. Bacillus subtilis containing these plasmids are all stored at the Ohio University Bacillus Stock Center (address: 484. Vast 1
2nd Avenue, Colgus 0haio
, 43210 U, S, ^).

The plasmid of the present invention can be constructed by conventional ligation techniques, such as the restriction enzyme method in which DNA cut with a restriction enzyme and vector DNA are ligated using a ligase, the linker method, and the like. That is, a promoter liposome binding site, which is a control site for expression, and a secretion signal are linked to a gene fragment in which a gene encoding the protein and a plurality of genes encoding peptides are linked, and t
A plasmid can be constructed by ligating the isolated DNA fragment to vector DNA. Note that when using the protein A, etc., which contains a promoter, a liposome binding site, a secretion signal, and a region encoding a protein, it is not necessary to introduce the promoter, liposome binding site, secretion signal, and gene encoding the protein into the vector.

Conventional genetic engineering methods can be used to construct genes encoding multiple peptides and link each gene fragment. In this case, an E. coli host vector can also be used. For example, the construction of a tandem trochanter will be explained using VIP as an example. To construct genes encoding multiple VIPs, GACN, which is a nucleotide sequence recognized by the restriction enzyme Tthllll, is added to the 5' side of the VIP gene.
The existence of NNGTC can be utilized. The fragment cut by the restriction enzyme Tthllll 1 has a protruding end but does not have a symmetrical structure. Therefore, the cleavage fragment using the restriction enzyme Tthllll 1 is used to introduce multiple genes encoding peptides in the desired direction. This is an extremely useful point. That is, as the VIP gene to be inserted, the 5'
A gene is synthesized that has a cleavage site for the restriction enzyme Tthllll on its side and does not have a cleavage site for the restriction enzyme on its 3' side.

On the other hand, the plasmid into which the VIP gene has been introduced is cut with the restriction enzyme Tthl 111, the 5' phosphate residue is removed with alkaline phosphatase, and the VIP gene to be inserted is ligated with DNA ligase. E. coli is transformed with the obtained vector, the transformed strain is cultured, and a plasmid into which two VIP genes are introduced is prepared. By repeating the above operation, it is theoretically possible to tandem the VIP gene any number of times using this Tthllll cleavage site,
A plasmid in which multiple VIP genes are linked can be prepared.

In addition, the cleavage site recognized by the restriction enzyme Tthllll is
By adding it to the 5' side of a gene encoding another peptide and sequentially linking it in the same manner as described above, the gene encoding another peptide can be made into a tandem.

The transformed strain of the present invention can be obtained by transferring the plasmid to a host microorganism and transforming the host microorganism. The host microorganism is not particularly limited as long as it secretes tannocorinoid substances outside the bacterial body, but bacteria of the genus Noctilus, especially Bacillus subtilis, for which a large amount of genetic and biochemical knowledge has been accumulated and is highly safe, may be used. It is preferable to have one. Furthermore, among Bacillus subtilis, a strain whose extracellular protease productivity is reduced by a technique such as mutation is preferable. When such a strain is transformed with the plasmid, degradation by host-derived protease can be significantly suppressed, and a large amount of peptide precursor can be obtained efficiently.

Examples of Bacillus subtilis with low protease productivity include (
1) Bacillus subtilis (Bacillus 5)
ubLllis) D B 104 strain [J, rlac
tcriol, 160; 442-444. (1
984)] and Bacillus subtilis 104) IL strain [111oches, formerly Ophys, Res, Co
m5un, 128, 601-606. (1985
)] ; (2) The applicant has filed a patent application in Japanese Patent Application Laid-Open No. 64-37284.
Bacillus subtilis DY-1 proposed in the publication No.
6 strains (Feikoken Bibori No. 9488); (3) Bacillus subtilis, which lacks the ability to produce alkaline protease and neutral protease, and whose protease activity is 3% or less of the wild strain;
Examples include bacterial strains into which the poOAΔ677 mutant gene has been introduced. Particularly preferred strains are those belonging to (3) above, and such strains include, for example, Japanese Patent Application No. 1-2
As proposed by the inventors in No. 81440,
Spo O^△6 to Bacillus subtilis 104HL strain
Bacillus subtilis 5PO with 77 mutant gene introduced
Bacillus subtilis strain 5PL14 (Feikoken Bacteria No. 109118), which introduced the s poOAΔ677 mutant gene into Bacillus subtilis DY=16 Hayashi, etc. It can be done.

Transformation of the host microorganism with the plasmid can be carried out using conventional methods, such as the protoplastization method of Chang et al. [Chang, S., at al., Mo.
1. Gon, Genet, 16g, lll-
+15 (1979)].

Furthermore, in the production method of the present invention, the transformed strain is cultured and a peptide precursor protein containing a plurality of peptides is secreted outside the bacterial cells. The transformed strain can be cultured according to conventional liquid culture as long as the peptide precursor can be secreted and expressed. That is, the transformed strain can be cultured by shaking culture or aerated agitation culture in an adult medium containing conventional components such as inorganic salts, carbon sources, nitrogen sources, growth factor components, etc. pH of medium
is, for example, about 7 to 8. The culture is carried out under the usual conditions employed for culturing microorganisms, such as a temperature of 15 to 45°C;
Preferably, it can be carried out under conditions of 25 to 40°C and a culture time of about 6 to 60 hours. More specifically, for example,
100 ml of M in a 500 ml pleated Erlenmeyer flask
odlus A medium [5tophon R, Pahn
estock, all,, ^pplied an
d Envlrorvontal Mlcroblol
ogy, Feb. 379-384 (1987)]
By inoculating the transformed strain and culturing at 37° C. for about 15 hours, a large amount of peptide precursor protein containing a plurality of peptides can be secreted outside the bacterial cells.

By subjecting the culture supernatant to separation and purification means, such as affinity chromatography, the peptide precursor protein can be separated and purified from the culture solution and recovered. The peptide contained in the recovered peptide precursor protein is not degraded and has a complete amino acid sequence.

The target peptide can be obtained by chemically or enzymatically cleaving the spacer sequence of a peptide precursor protein. When cutting the spacer sequence, it is preferable to cut the C-terminal side of the spacer sequence. In particular, it is preferable to specifically hydrolyze the C-terminal side of the spacer sequence using a yeast-derived basic amino acid residue pair-specific protease. The protease mentioned above does not cleave the spacer sequences Arg-Lys and Lys-Lys sequences, is relatively easy to prepare in large quantities because it is yeast-derived, and is generally highly safe. , particularly preferred.

If the protease specifically recognizes the spacer sequence and specifically hydrolyzes the C-terminus of the spacer sequence, t1 can be used alone.

In addition, (a) when the protease specifically recognizes the spacer sequence and specifically hydrolyzes the N-terminus of the spacer sequence or between the spacer sequences, (b) the protease can start from the N-terminus of the spacer sequence with basic amino acids. A peptide can be obtained by treating the above-mentioned fusion protein in combination with an aminopeptidase that releases a basic amino acid and/or a carboxypeptidase that releases a basic amino acid from the C-terminus.

It specifically recognizes basic amino acids, and C of the spacer sequence.
Carboxypeptidase or aminopeptidase that RMs basic amino acids from the terminal side or N-terminal side can be used regardless of its origin as long as it has such characteristics. Examples of carboxypeptidase and aminopeptidase include carboxypeptidase B
(E, C, 3, 4, 17, 2), carboxypeptidase E (enkephalin compertase), carboxypeptidase N (E, C, !1.4.17.3)
,ysaa [sacca tff? Exl gene product from Ises cerevisiae; A, Dmochovsk
a, at at,, Ce11.50.573-58
4 (1987)], aminopeptidase B (E,
C, 3, 4, 11, ll), etc.

The molecular weight of the obtained peptide can be determined by a conventional method such as agarose gel electrophoresis, 5DS-polyacrylamide gel electrophoresis, etc., and the peptide can be identified by analyzing its amino acid sequence. can.

Effects of the Invention The plasmid of the present invention and the transformed strain transformed with the plasmid efficiently secrete and produce a large amount of peptide having a complete amino acid sequence, even if the peptide is derived from eukaryotes.

In the production method of the present invention, a peptide having a complete amino acid sequence can be efficiently produced in large quantities as a peptide precursor.

[Examples] The present invention will be described in more detail based on Examples below, but the present invention is not limited to these Examples. The enzymes used in the examples were all manufactured by Blind Shuzo (1), and the reactions were carried out under the conditions described in their specifications.

Example 1 (1) Plasmid pMD2D (1) Construction of plasmid pMD200, which uses Bacillus subtilis as a host, expresses the protein A gene of Staphylococcus aureus, and secretes and produces protein A in the supernatant. The construction diagram is shown in Figure 1.

Plasmid pDCP2411 containing protein A gene
(Refer to Japanese Unexamined Patent Application Publication No. 83-245677), the protein A gene cloned from a single strain of Staphylococcus aureus was transferred to a plasmid that can be replicated in Escherichia coli.
This is a plasmid linked to Uc11g. pDcP24
The acquisition method of No. 11 and the complete base sequence of the protein A gene contained in pDCP2411 are described in the above-mentioned JP-A-83-24.
It is described in detail in Japanese Patent No. 5877.

An E. coli transformant containing this plasmid was extracted using the alkaline method [Sambrook et al., Mol.
culler CIoning, l, 33 (19
+19)] pDCP2411 was prepared.

pDcP2411 was cut with restriction enzymes EcoRI and BamHI to generate a protein A gene containing approximately 1.9
After separating the kb DNA fragment (hereinafter referred to as protein A gene fragment) using agarose gel electrophoresis,
It was eluted and purified using electroelution method [Sambroo
k, at al,,MolecularClonl
ng, 8.28 (1989)], the protein A-producing genetic fragment contains a promoter liposome binding site of the protein A gene, a signal sequence for secretion, and a structural gene for protein.

Next, the vector pUBllo was treated with the restriction enzyme Eco.
About 3.7 Kbkb generated by cutting with RI and BamHI
The DNA fragment (hereinafter referred to as pUB110 vector-generated gene fragment) was separated using agarose gel electrophoresis in the same manner as above, and then eluted using electroelution method.
Purified.

The protein A gene fragment and the pUB1]0 vector gene fragment were ligated using T4 DNA ligase to construct plasmid pMD200.

(2) Construction of a plasmid containing the gene encoding VIP In order to construct the VIP gene, according to the amino acid sequence of VIP, the corresponding gene codons are matched to the codon usage of Bacillus subtilis, and the following 8Fi genes are ABI430A
Produced using a DNA synthesizer.

5'-TCTAGAGTCGACGTCATTGA
AGGAAGAATGAC^^TTTTTACATTC
AGGCATAGCGACG-3゜-CTCAGCTG
CAGT^^CTTCCTTCTTACTGTT^^A
AATGT＾＾GTCCGTATCGCTGCG5゜5-CAGTCTTCACAGAT＾＾CTACACG
CGTTTA^GAAAGCA^^TGGCTGTG-
33-TCAG^^GTCTCTATTGATGTGC
GC^^^^TTCTTTTCGTTTACC-5' 5°-^AAA^^TATTTGAATTCTATTC
TTAACGGCTAATAGATCTAAAAGA
AGCAGG-3゜3-GACACTTTTTAT^
^^CTTAAGATAAG^^TTGCCGATTA
TCTAGATTTTTCTT-5゜5'-TTCCT
CCATACCTGCTTCTTTTATTTGTC
AGCATCCTGATGTTGGATCCGCATG
-3°3°-CGTCCAACGA to GTATGGAC
GAAGAAAAATA^AC^GTCGTAGGAC
Phosphate was added to the 5' end of each synthetic DNA using TACAACCTAGGC-5''Ts-DNA kinase. In addition, plasmid pUc19 was digested with restriction enzyme Xb.
al and sph! and cut with DNA ligase, 5
Each synthetic NA with a phosphoric acid added to the end is
Insert between Xba l-3ph 1 of UcIQ, VI
Plasmid pMD321a containing the P-G I Y gene
was built. FIG. 2 shows a diagram of the construction of plasmid pMD321a.

The nucleotide sequence and amino acid sequence of the synthetic gene portion in the obtained pMD321a are shown below.

■shicoRI 5acl Kpnl 5salBa-
Old XbalAATTCGAGCTCGGTACCCGG
GGATCCTCTAGAPhcGIul, eu(il
yThrArgGlyScrSarArgII l c
I l^atll 6
0GTCGACGTCATTG^^GG^^G^^TG
ACAAValAspValIlaGluGlyArg
MeLThrllca 7thllll TTTTTACATTCAGGCATAGCGACGC
AGTCTTCPheThrPhc＾rgllsSo
rAspAlaValPhe Protein C-OVIP ^CAGATAACTACACGCGTTTAAG^^
^GCThrAspAsnTyrThr^rgLeu^
rgLysGIn1':coRI AAATGGCTGTGAA＾^＾ATATTTGAA
TTCTATTMetAIaValLysLysTyr
LeuAsnSerlleBgllll 18
0 CTTAACGGCT^^Ding^GATCTAAAAAG
^^G1, cuAsnGlyHHH CAGGTTCCTCCATACCTGCTTCTTTT
TTATTTGBaa+H1 ph1 TCAGCATCCTGATGTTGGATCCGCA
TGCGTGACTGGGAAAACCCTGGCGT
TACCCAThis synthetic gene part is the blood coagulation factor Xa that is present before the base sequence encoding vrp-cry.
recognition sequence 11eG1uG1yArg, Met cleaved by BrCN, and protein C recognition sequence Th
It is constructed from the gene encoding rl 1ePheThrPheArg.

Further, downstream of the VIP-GIV gene, after two stop codons (TAATAG), the terminator-CM of Bacillus subtilis subtilisin, l1onjo, at
al., J. RiotcchinoIogy, 2.
75-85 (1985)].

(3) Construction of a plasmid containing genes encoding 5 molecules of VIP Plasmid p M D 3 containing genes encoding 5 molecules of VIP (hereinafter referred to as tandem VIP genes)
The construction diagram of 21 R5a is shown in FIG.

5' of V I P-G 1 y gene of pMD321a
On the side, GACGCAGTC, which is a cleavage recognition base sequence for the restriction enzyme Tthllll, is present. On the other hand, as shown in Figure 3, Tth
A gene whose 3' side cannot be cut was synthesized, leaving the lllll cleavage site.

In addition, in order to cleave and recover the tandem V I P-G I y, Lys-Arg, which is a recognition sequence for cleavage by a basic residue pair-specific protease (Japanese Unexamined Patent Application Publication No. 1982-49585), was used. Introducing the corresponding gene, the third
VIP-Gly- for tandemization as shown in the figure.
Lys-Arg Doden gene synthesis was performed.

Next, pMD321a was completely cleaved with Tthllll, and the 5' phosphate group was removed with alkaline phosphatase. Then, it is mixed with the prepared VIP-Gly-LysArg gene for tandemization, and the DNA
After ligation using ligase, E. coli strain 1M109 was transformed.

A plasmid gene was prepared from the obtained ampicillin-resistant transformant, and a plasmid pMD321R2a was constructed in which two VIP-Gly genes were linked in tandem as intended.

The obtained pMD321R2a contains 7t in the vicinity of the 5' region of the two tandem V I P-G I Y genes.
It has only one cut point due to hl 111.

Then, p M D 321 R2a is T th 1
1.11 and cleaved with alkaline phosphatase.
After dephosphorylating the region, VIP-
After mixing with Gly-Lys-Arg synthesis and ligating with DNA ligase, Escherichia coli 1M109 strain was transformed. A plasmid was prepared from the obtained ampicillin-resistant transformant to obtain plasmid pMD321R3a into which three genes of interest were introduced in tandem. The same operation was repeated further, and the five V I P-G I Y genes were
pMD linked in tandem via Lys-Arg
321R5a was produced.

(4) Construction of plasmid pMD500R5 FIG. 4 shows the construction of plasmid pMD500R5, which uses Bacillus subtilis as a host and secretes a peptide precursor containing 5 molecules of VIP (hereinafter referred to as peptide precursor).

After cutting the plasmid pMD200 with the restriction enzyme Pst■, a DNA branching kit (BlunLing
Kit) to blunt the ends, and then add restriction enzyme s
The fragment was cut with ph I, and the approximately 5.5 Kb fragment was purified by agarose gel electrophoresis and used as a vector for integrating the tandem VIP gene.

To integrate the tandem VIP gene into the vector, the plasmid pMD321R5a was digested with the restriction enzymes Kp n 1. After cutting with , the ends were blunted using a DNA branching kit, and further cut with restriction enzyme 5phI to give approximately 0.5
The Kb fragment was obtained by purifying it by polyacrylamide gel electrophoresis. This DNA fragment has a structure in which a tandem VIP gene is linked downstream of a gene encoding an amino acid sequence recognized by blood coagulation factor Xa and protein C. Furthermore, a gene encoding Guy is linked to the C-terminus of each VIP gene in order to amidate VIP. Furthermore, V I P-G
Between the genes encoding IY, there is a recognition sequence Lys for PBR5-protease, a type of basic amino acid residue-specific protease, in order to cleave and recover VIP-GIF from the peptide precursor protein. -A
The gene encoding rg has been inserted.

Next, the vector DNA and the tandem VIP gene fragment were ligated using T4 ligase to construct a peptide precursor protein secretion plasmid pMD500R5. This pMD500R5 uses Bacillus subtilis as a host and contains Arg-Gly-3er-5, which contains amino acid sequences corresponding to positions 1 to 402 of protein A and the recognition sequences of blood coagulation factor Xa and protein C as a spacer.
er -Arg-Va 1-A5p-Va 1-11e
-Glu-Gly-Arg-Met-The-IIe
-Phe-Thr-Phe-Args "This is a plasmid having a structure in which five molecules of the biosynthetic precursor of VIP, V I P-G 1 y, are linked together via Lys-Arg as a monopeptide.

(5) Production of peptide precursors using Bacillus subtilis as a host The method of Chang et al. [Chang, S.
, at al.

Mo1. Gcn, Ganct, 1611. l
pMD500R according to ll-115 (1979>)
5 by Bacillus subtilis 5PL14 (FERM
P-10988) was transformed. The obtained transformed strain Bacillus subtilis 5PL14 (pMD500
VIP'Q in the peptide precursor protein secreted by R5) (Feikoken Kyoiku No. 11742) was measured by the method shown below.

First, a medium containing 0.5M succinic acid (Mcdful
l) Using 100ml of A medium, 5PL14 (pMD
500R5) was cultured with shaking at 37°C for 16 hours.

After stopping the culture, the protease inhibitor phenylmethylsulfonyl fluoride (
PMSF), EDTA added, temperature 4℃, 1500
The cells were centrifuged at 0 rpm for 10 minutes to remove bacterial cells.

After filtering the culture supernatant with a 0.22 μm filter,
A column filled with 5 ml of IgG-Sepharose gel (manufactured by Pharmacia Co., Ltd.) was
2 ml of the obtained culture supernatant using a ml capacity syringe.
was injected to purify the peptide precursor protein i. The column was washed with 20ml of TST buffer [50mM Tris-HCl (pH 7,6), 150mM NaCfI, 0.
After washing with 05% Tvean 20],
The peptide precursor protein was eluted using 10 ml of 0.1 M acetic acid (pH 3,0). The eluate was immediately neutralized using 1/2 volume of 0.2 MQ ammonium carbonate solution. The obtained peptide precursor protein eluate was concentrated using an ultrafiltration (molecular weight cutoff: 10,000) filter, and then fractionated using reversed-phase high performance liquid chromatography under the following conditions.

Column TSK gel I'hanyl 5pPV-RI'
Inner diameter 4.6i+mX7.5an Flow rate 1.0ml/min Solvent A: 0.05% trifluoroacetic acid B: 0.04
4% trifluoroacetic acid/60% acetonitrile gradient 15.0 to 38%/46 min, 2 ml/% Next, vIp-cty was quantified by enzyme immunoassay using "enzyme immunoassay" (edited by Eiji Ishikawa et al., Medicine). This was done using the method described in Shoin).

First, a rabbit was immunized with VIP to obtain anti-VIP serum. From this anti-VIP serum, the 8th test of "enzyme immunoassay"
In the maleimide-hinge method described on pages 3-92, nori anti-VI
P-1gG, anti-V I P-F(ab')z, anti-VIP
-Peroxidase-labeled-Fab' was prepared.

VIP-GIV was measured by enzyme immunoassay according to the following procedure.

Anti-V I P-F (a
b') 2 was aspirated and blocked with 1% bovine serum albumin. VIP-
Anti-VIP-F (ab') absorbed Gly in the same phase.
2, washed, anti-VIP-peroxidase labeled-Fab2 was added, and V"I bound to the same phase was washed.
P-Gly was sandwiched. After removing free labeled antibody, 10mM ortho-phenylenediamine (OPD)
), 0.025% hydrogen peroxide, and 50 mM sodium acetate buffer (pH 5.0) were added, and the dye produced by the peroxidase reaction was measured by absorption at a wavelength of 490 nm.

Applied Biosystems (AB
V I P-G I Y, whose amino acid composition was confirmed by solid-phase synthesis using a peptide synthesizer manufactured by I) Co., Ltd. and purified by reverse-phase high-performance liquid chromatography, was used.

As a result, the target peptide precursor protein was secreted and produced, and in ELISA, VIPi+
When the protein amount was calculated from the absorption at the wavelength 214 na of the peak that showed monomorphism, it was found that the V
Based on the molecular weight of the IP portion, the amount of VIP contained in the secreted peptide precursor protein was 3.2 mg/J.

Example 2 Production of peptide precursor using Bacillus subtilis as a host The Bacillus subtilis 5
PL14 was transformed in the same manner as in the example. The peptide precursor protein secreted by the obtained transformed strain SPL14 (pMD500R5) was purified as follows.

First, 4J of 1ug A medium containing 0.5M succinic acid.
5PL14 (pMD500R5) was permeabilized and cultured at 37°C for 16 hours. After stopping the culture, reduce the concentration to 1
Add PMSFSEDTA to 0mM and incubate at 4°C.
The cells were centrifuged at 5,000 rpm for 30 minutes to remove bacterial cells. After filtering the obtained culture supernatant with a 0.22 μm filter, 3.61 ml of the culture supernatant was poured into 300 ml
IgG-Sepharose gel (manufactured by Pharmacia Co., Ltd.)
The peptide precursor protein was purified by injecting the solution into a column packed with the peptide at a flow rate of about 6 ml/min. The column was prepared in Example 1.
Using TST buffer 2,881 with the same composition as
After washing at a flow rate of 4 m and 17 minutes, 0. 1M acetic acid (
The peptide precursor protein was eluted using pH 3.0) at a flow rate of 4 ml/min. At this time, the elution point was 17
Immediately neutralized using 2x 0.2 Mff1 ammonium carbonate solution. The obtained peptide precursor protein eluate was concentrated using an ultrafiltration (molecular weight cutoff: 10,000) filter, and then the peptide precursor was fractionated under the following conditions.

Column Phcnyl-5PvRP Inner diameter 21.5+imX15cm Flow rate 6ml/Z min Solvent A: 0.05% trifluoroacetic acid B: 0.04
4% trifluoroacetic acid/60% acetonitrile gradient 27.5-30% 15 (1 min, 120 ml/%) Then, by freeze-drying the fractionated components, the target peptide precursor protein of 64,000 molecules was obtained. In addition, in the same manner as in Example 1, the wavelength was 214 nm.
When the amount of protein was calculated from the absorption of 4), about 37 mg of peptide precursor protein was obtained from the culture solution in 4).

Reference Example 1 V I P-G 1y from peptide precursor protein
100 μg of the excised and fractionated peptide precursor protein of -Lys-Arg was treated with a basic amino acid residue pair-specific protease (JP-A-2-49
No. 585) 0.1 mU [ ] U is 30°C, 50 m
M Tris-HCl (pH 7,0), 0.1% Lubrol PX, 0,5 m M CaC
0.1 mM Boc-GIn-Ar in
Under the conditions of reaction with g-Arg-MCA (Boc is a t-butoxycarbonyl group, MCA is 4-methylcoumaryl-7-amide), 1 μmol of AM per minute.
C (7-amino-4-methyl-coumarin)] and 50 mM Tris-HCl (pH 7.0)
, 1mM CaC1)z at 37°C. The reaction solution after a reaction time of 6 hours was analyzed using reversed phase high performance liquid chromatography, the two peaks that appeared were fractionated, and their amino acid sequences were analyzed using a protein sequencer. ys
-Completely consistent with A r gs and VIP-Guy. This revealed that a peptide precursor containing VIP with a complete amino acid sequence was secreted and produced.

Reference Example 2 VIP-Gly was excised from the peptide precursor protein. 100 μK of the separated peptide precursor protein was treated with a basic amino acid residue pair-specific protease (JP-A-2-49
585) 0, 1 mU (IU means the same activity as above) and 10 mU of carboxypeptidase B (manufactured by Sigma) [IU is 25mM Tris-HCl (
1mM Bz-Gly-Ar in pH 8,0)
g (Bz represents a benzyloxycarbonyl group) and 2
Under reaction conditions at 5°C, the enzyme activity was set to release 1 μmol of Arg per minute] and
The reaction was carried out at 7°C. The reaction solution after a reaction time of 6 hours was analyzed using reversed phase high performance liquid chromatography, the two peaks that appeared were fractionated using reversed phase high performance liquid chromatography, and the amino acid sequence was analyzed using a protein sequencer. It was completely consistent with VI P-G IV. This revealed that a peptide precursor containing VIP with a complete amino acid sequence was secreted and produced.

[Brief explanation of the drawing]

FIG. 1 is a diagram of the construction of plasmid pMD200, FIG. 2 is a diagram of the construction of plasmid pMD321a, FIG. 3 is a diagram of the construction of plasmid pMD 321 R5a, and FIG. 4 is a diagram of the construction of plasmid pMD500R5. Patent Applicant M-D Research Co., Ltd. Agent Patent Attorney Hoe ■ Mitsuru Life Diagram coRI coRI εeoRI amHI coRI amHI Diagram Kinesion XbaI-5phI Figure 4

Claims (1)

[Scope of Claims] 1. A plasmid in which a gene fragment in which a plurality of genes encoding peptides are linked to a gene encoding a protein secreted outside the microbial cell by a host microorganism, and vector DNA are linked. 2. Protein is Bacillus (￥Bacillus￥)
The plasmid according to claim 1, which is a protein secreted by the genus Bacteria. 3. Proteins secreted by Bacillus bacteria are secreted by Staphylococcus aureus.
Claim 2 is protein A of S. ccusaureus).
Plasmids listed. 4. The gene encoding the peptide is vasoactive.
Intestinal Polypeptide (Vasoactive)
2. The plasmid according to claim 1, comprising a nucleotide sequence encoding eIntestinal Polypeptide. 5. Vector DNA is Bacillus (￥Bacillus
The plasmid according to claim 1, which is a plasmid DNA that can be replicated in bacteria of the genus ¥). 6. A plasmid capable of replicating in Bacillus bacteria is pUB
110. The plasmid according to claim 5. 7. A transformed strain in which a host microorganism is transformed with the plasmid according to claim 1. 8. The host microorganism is Bacillus (￥Bacillus￥)
The transformed strain according to claim 1, which is a strain of the genus Bacterium. 9. The host microorganism is Bacillus subtilis
The transformed strain according to claim 8, which is P. llussubtilis ¥). 10. The transformed strain is Bacillus subtilis (Bacillus subtilis).
llussubtilis) SPL-14 (PMD50
Claim 1 which is
Transformed strains described. 11. A method for producing a peptide precursor protein, which comprises culturing the transformed strain according to claim 1 and secreting a peptide precursor protein containing a plurality of peptides to the outside of the bacterial cell.