JPH04179495A - Fused protein, and method for producing peptide or protein - Google Patents

Abstract

NEW MATERIAL:A fused protein of the formula (A is carrier; B is amino acid sequence capable of being specifically cleaved with an active type protein C; C is the objective peptide or protein). USE:A fused raw material capable of stably and massively producing the objective peptide or protein by a genetic recombination technique. PREPARATION:For example, a plasmid pDCP 2411 containing the gene of a protein A as a carrier protein but not containing the recognition sequence of an active protein C is digested with a restriction enzyme EcoRI, BamHI. The product is ligated with a synthetic DNA coding an amino acid sequence such as Phe-Thr-Phe-Arg which is a recognition sequence of the active protein C. The product is further ligated with a gene coding the objective peptide or protein to prepare the gene of the fused protein. The gene is ligated with an expression vector and subsequently inserted into Escherichia coli to form a transformant, which is cultured to provide the fused protein of the formula.

Description

Detailed Description of the Invention [Industrial Application Field] The present invention utilizes genetic recombination technology to produce a peptide or protein as a fusion protein, and then reacts with a specific protease to produce a peptide or protein. The present invention relates to fusion proteins useful for producing peptides or proteins, and methods for producing peptides or proteins.

[Prior Art and Problems to be Solved by the Invention] When producing heterologous peptides or proteins using genetic recombination technology, it is often impossible to mass-produce them even if the target gene product is directly expressed. The reason for this is that the translation initiation reaction of the target gene is inhibited due to the influence of the higher-order structure of mRNA near the start codon [D,
t, E, Fiers, Gene, 9. l
(1980)], it has been pointed out that when the target gene product has a low molecular weight, it is particularly easily degraded by host-derived proteases.

Fusion protein methods are attracting attention as a method to solve these problems. In this fusion protein method, a target peptide or protein is fused with a carrier such as a peptide or protein that is stable and produced in large quantities in the host. Note that this fusion protein method also includes the case of using a general protein carrier, that is, a carrier having less than 50 amino acids. Furthermore, even when expressed directly as a fusion protein, processing by methionine 7 minopeptidase in the host is incomplete, so methionine derived from the initiation codon remains without being completely removed, resulting in methionine at the N-terminus. In many cases, a target gene product with added molecule is obtained. It has been pointed out that gene products with a second methionine added may have antigenicity problems (
(Japanese Unexamined Patent Publication No. 171699/1982). Therefore, in order to obtain the desired peptide or protein from such a fusion protein or a methionine-added gene product, it is necessary to cut only the desired portion from the fusion protein. Conventionally, chemical methods and enzymatic methods are known as methods for this cutting out.

Chemical methods include, for example, Me using cyanogen bromide.
C-terminal truncation of t [D, V, Goeddel,
et al, Proe, Na1l, Acad,
Sci, IJSA 7G, 106-110 (1
979>), B N F S-skatole (Skat
ol) and hechlorosuccinimide (NC5)
C-terminal cleavage of rp [Y, 5aito, et a
t,, J, Biochcs+, Iol, 123-
134 (1987)], ASp-Pro cleavage with tonoic acid, 70% formic acid [Biochem, Biop
h>s, Res, Cogvun,, 40.11
73 (1970)], A with hydroxyamine
Cleavage between sn-Gly is known. However, due to the strong structure dependence of the substrate fusion protein, the yield of cleavage reactions is low and side reactions are likely to occur, except for cleavage with cyanogen bromide. Cleavage with cyanogen bromide is widely used, but it cannot be used when Met is present in the target gene product, and it is almost impossible to use it when the next amino acid after Met is Ser or Thr. The cleavage reaction may not occur. Also, between Asp and Pro, Asn
When cutting between -Gly, amino acids remain on both the N-terminus and C-terminus of the peptide or protein produced after cleavage, so the cleavage results in the desired amino acid sequence at the N-terminus and C-terminus. It is difficult to obtain gene products.

As an enzymatic method, before the peptide bond to be cleaved (P
specificity for the amino acid at position i) or after (position Pi'),
That is, a cleavage method using a protease with strict primary specificity, for example, cleavage of the C-terminal side of Arg or Lys using a trypsin-like enzyme such as trypsin or endoproteinase [J, 5hine.

et at, Nature, 285.456-46
1 (198G)], cleavage of the C-terminal side of Lys by lysyl endopeptidase, endobroteinase Lys-C, etc. (Japanese Unexamined Patent Publication No. 1982-275222), Glu , Cleavage of the C-terminal side of Asp (Special publication 1980-50
1391), etc. are known. however,
These proteases are generally effective only when the amino acid they recognize is not included in the gene product of interest, and are applicable to only very limited gene products.

Enzymes that have not only primary specificity but also specificity for the sequence surrounding the peptide bond to be cleaved, that is, strict secondary specificity, are also used. For example, chicken pro a-2 collagen (with collagenase)
col Iagen) and Pro-X-Gly-Pro cleavage between
c, Na11. Acad, Sci, USA,
81.4692-4696 (1984)], cleavage of the C-terminal side of I le-Glu-Gly-Arg by blood coagulation a (Japanese Unexamined Patent Publication No. 135591/1983)
, Gly-Pr by Thrombin
C-terminal cleavage with o-Arg (JP-A-62-135
500), kallikrein (Kal l 1kre)
Va.
C-terminal cleavage of 1-Asp-Asp-Asp-Asp-LyS [T, P, Hopp, et al.
Biotechnology, 6, 1204-12
10 (19H) and JP-A-56-186200], Pro-Phe-Hi by renin
5-Leu-Leu-Va 1-Tyr's Leu-L
Cutting between eu (Japanese Unexamined Patent Publication No. 60-262595), poly(
p'oly) -〇 ly C-terminal cleavage (JP-A-160496), ubiquitin (Ubiqui
tin) -N a-Protein Hydrolase (pro
Ubiquitin (U) by tein hydrolase
C-terminal cleavage (T, R, Bu
tt, et al., Proc, Na11. A
cad, Sei.

USA, 86.2540-2544 (1989)
], Gl by urokinase
Cleavage of the C-terminal side of u-Gly-Arg (JP-A-2-10
No. 08115), etc. have been reported. However, in degradation by collagenase and renin, peptides remain on both the N-terminal and C-terminal sides of the cleavage site, making it difficult to obtain a gene product having the desired amino acid sequence. Many enzymes, including thrombin and blood coagulation factor Xa, have been reported to cleave at sites other than their intended sequences [J, Y, Chang
, Eur, J., Bjochem, 151.21
7-224 (1985), S, NiN15hika
, et al., Protein Engineering
r, l.

487-492 (1987), etc.].

Therefore, an object of the present invention is to provide a fusion protein that is useful for efficiently cleaving a target peptide or protein from a substrate fusion protein using a highly specific enzyme.

Another object of the invention is to provide a method for producing a peptide or protein that can efficiently excise a target peptide or protein from a substrate fusion protein using a highly specific enzyme.

[Structure of the Invention] The present inventors focused on activated protein C, which exists in the blood of animals, is involved in blood coagulation and fibrillation, and selectively cleaves only a specific amino acid sequence site. As a result of extensive research, we found that when a fusion protein in which a carrier and a target peptide or protein are bound via the above-mentioned specific amino acid sequence is treated with the activated protein C, the target peptide or protein can be efficiently excised. , completed the invention. That is, the present invention has the following formula: % [wherein A represents a carrier, B represents an amino acid sequence that can be specifically cleaved by activated protein C, and C represents a target peptide or protein] The present invention provides a fusion protein expressed as

The present invention also provides a method for producing a peptide or protein, which comprises treating the above fusion protein with activated protein C.

In this specification, the left side of the peptide is designated as the N-terminal side, and the right side is designated as the C-terminal side, according to the usual sequence description method.

The sequence of carrier A is not particularly limited, or it is preferable that there is no active protein C recognition sequence. Examples of such carrier A include β-lactamase, β-galactosidase, chloramphenicol acetyltransferase, RecA protein, trpE
, human interleukin-2, human growth hormone, dihydrofolate reductase, protein A1λcll, alkaline phosphatase, penicillinase, etc., or all or part thereof; derivatives thereof. The derivative includes:
These include those in which Cys has been removed or replaced, those in which cyS has been added, and those in which the recognition sequence of activated protein C has been removed.

In addition, carrier A contains Met derived from the start codon.
Also included are sequences encoding fusion proteins that are linked only to the N-terminal side of a processing signal immediately before the target gene product or via one to several tens of amino acids.

Carrier A may be any peptide or protein produced by the host microorganism within the microbial cell, outside the microbial cell, or within the periplasm, and may be an amino acid in some cases. Preferred carrier A is a peptide or protein produced extracellularly by a host microorganism.

Preferred carriers include Staphylococcus aureus [Staphylococcus aureus].
s aureus )]. This protein A has a promoter region involved in gene expression and a liposome binding site. The promoter region is, for example, Staphylococcus aureus 83
strain 25-4 [Uhlen et al., J. Bi.

1, Chew, 259.1695 (1984)
], and has a hairpin structure at positions -131 to -120 and a palindromic sequence at positions -151 to -138. However, a preferable promoter region is This is a region represented by the base sequence proposed in Publication No. 245677.

This promoter region corresponds to the sequence from −300 to −1, and its characteristics are as follows:
It differs from the promoter region derived from the -4 strain in that the above-mentioned hairpin structure and palindromic sequence are absent.

Downstream of the promoter region (1st to 108th base sequence)
There is a gene encoding the S region involved in secretion, and a structural gene exists downstream of this secretion signal region (base sequence 109th to 1524th). The structural genes are E (109th to 276th base sequence), D (
277th to 459th base sequence), A (460th to 633rd base sequence)
It is composed of 6 units consisting of B (base sequence 634th to 807th), c (base sequence 808th to 981st), and X (base sequence 982nd to 1524th), and the N-terminal , and are combined in the above order. Also, there are 1525-1552525-1552nd coding parts, 1525-1527525
~1527th A A (Y) The E region is a unit present at the N-terminus of protein A, and has a relatively low binding ability with immunocropurin G (IgG). D
, A, B, and C regions each have a strong binding ability with the Fc portion of IgG, and the X region is a unit that has the function of binding protein octad molecules to the cell wall of Staphylococcus aureus.

Thus, protein A has five repeating regions that specifically bind to the Fc region of IgG and a region that binds to the cell wall. Taking advantage of this, it is possible to link the target peptide or protein after the region that specifically binds to the Fc region, express it as a fusion protein, and then easily purify it by affinity chromatography. can.

Therefore, the gene encoding the protein covers the region of protein A that has the ability to bind to the Fc portion of IgG, particularly up to the 440th amino acid in the mature protein of protein A, that is, the structural gene of protein A. The region up to Asp, which is the 440th amino acid (excluding the signal peptide), is preferred. Further, the protein preferably has a region up to the 187th amino acid in the mature protein of protein A, that is, up to Leu, which is the 187th amino acid (excluding the signal peptide) in the protein A structural gene.

As mentioned above, protein A of Staphylococcus aureus contains
It contains promoters involved in gene expression, liposome binding sites, secretion signals, and protein-encoding regions. Therefore, a plasmid into which protein A has been introduced has the ability to secrete and express, and when a peptide or a gene encoding a protein is linked after the protein-encoding region, a fusion protein consisting of a protein and a peptide precursor is secreted and expressed. .

As the amino acid sequence that can be specifically cleaved by activated protein C, for example, sequences of naturally occurring substrates, sequences contained in inhibitors, etc., sequences consisting of low molecular weight peptides, etc. can be used. Such an amino acid sequence is
For example, in a protein C inhibitor, the amino acid sequence Phe-T at a site that is degraded by active protein C
hr-Phe-Arg.

A blood coagulation factor that is a natural substrate for activated protein C.
Amino acid sequence around the cleavage site Pro-G1n-1,e
u-Arg, the amino acid sequence Leu-Ser-Thr-A whose cleavage was confirmed by experiment using a low molecular weight peptide
Examples include rgnato. Among these amino acid sequences, P
Particularly preferred is he-Thr-Phe-Arg. These amino acid sequences may be modified by adding amino acids or peptides to the N-terminus or C-terminus. The above exemplary amino acid sequences, especially Phe-Thr-Phe-Ar
The amino acid sequence with Thr-11u added to the N-terminus of g further enhances the recognition specificity by protein C.

The target peptide and protein C are not particularly limited. Peptides and protein C include, for example, insulin, gastrin, various opionoid peptides, epidermal growth factor, endothelin, and vasoactive intestinal polypeptide [Va5oactive Intest
[inal polypepiide (hereinafter abbreviated as VIP)], atrial diuretic hormone (ANP), substance P1 calcitonin, insulin-like growth factor I,
II, various physiologically active peptides such as calanin, motilin, and hasopressin; inhibitors such as hirudin, nigrine C1-secreting 0 blood cell-derived protearsin inhibitor, human albumin, blood coagulation factors, lymphoid protein, nerve growth factor, and hepatocytes. It includes various differentiation-inducing factors such as regeneration factors and proteins such as growth factors.

Preferred peptides include VIP, which consists of 28 amino acid residues and has pharmacological effects such as vasodilatory effects and blood flow increasing effects [5science 18
9.1217 (1970)], V IP is represented by the following amino acid sequence.

t(-His-Ser-Asp-Ala-Vat-Ph
e-Thr-^sp-^sn-Tyr-Thr-Arg
-Leu-Arg-Lys-Gln-Met-^1 a
-Va I -Lys-Lys-Tyr-Leu-As
n-Ser-I Ie-Leu-Asn-OH In VIP represented by this amino acid sequence, the 17th amino acid is L
Prior art document [
JP-A-1-296996 and Eur.

J. Biochem, 178.343-350 (
1988)].

In addition, V I P ha, C-terminus 1: Gly-X (in the formula,
X is OH, Lys-Oft, ^r g -OIt, L
ys-^rg-OH or Arg-Lys-OH) is preferably used as a VIP precursor.

When active protein C is applied to such a fusion protein, it is cleaved at a specific site, and the target peptide or protein can be efficiently obtained.

Activated protein C can be obtained, for example, by treating and activating protein C collected from blood with thrombin or the like.

The advantages of the manufacturing method of the present invention will be explained by taking the VIP as an example.
This will be explained more specifically. Inside the VIP, the Met,
Arg, ^rg-Lys 5Lys-Lys, A
Since VIP contains a sequence that can serve as a cleavage recognition signal such as sp, it is difficult to excise VIP from the fusion protein using conventionally reported methods. however,
When an amino acid sequence that can be specifically cleaved by the active protein C is used, VIP can be efficiently excised. For example, as carrier A-, positions 1 to 402 of protein A derived from Staphylococcus aureus, as spacer B, Phe-Thr-P
he-Arg, and as target peptide C, VIP
By treating VIP-Gly, a biosynthetic precursor of You can get a good deal. .

Limited degradation of the fusion protein by activated protein C can be carried out under various conditions. For example, pH 6-9, O-0.3M NaCl, 0-10mM CaC
The target peptide or protein can be excised by reacting activated protein C and the substrate fusion protein in a reaction solution containing 12 at a temperature of 20 to 45°C for about 1 to 48 hours.

The ratio of active protein C to substrate fusion protein is
It can be selected within a range that does not impair reaction efficiency, and usually active protein C0,001 to 0 per mole of substrate fusion protein.
．． It is about 2 moles. The pH may be adjusted by adding a suitable acid or base, or by adding a suitable buffer such as Tris-
It may be adjusted with a buffer solution containing hydrochloric acid, phosphoric acid, succinic acid, acetic acid, 3,3-dimethylglutaric acid, fumaric acid, etc.

The reaction solution contains additives that do not inhibit the reaction, such as ionic, nonionic, or Amphoteric surfactants; organic solvents such as methanol, ethanol, isopropanol, and acetonitrile; protease inhibitors that do not inhibit active protein C, and the like may be added.

The reaction between the substrate fusion protein and the enzyme may be carried out in a batch manner using a free enzyme or an immobilized enzyme in which the enzyme is immobilized on a carrier. Examples of carriers for immobilized enzymes include conventional carriers such as polyacrylamide, chitin, dextran, carrageenan, celite, and cellulose. The reaction may be carried out using a combination of a free enzyme and a membrane-type bioreactor, or may be carried out using an immobilized enzyme in a continuous l-ioreactor or the like.

The fusion protein can be obtained using conventional genetic engineering techniques, for example, by constructing a plasmid containing a gene encoding the fusion protein, transforming a host microorganism with this plasmid, and culturing the resulting host microorganism. can.

More specifically, first, a gene encoding carrier A and a gene encoding peptide or protein C are combined with the amino acid sequence B in correspondence with the structure of the fusion protein.
are linked via a gene encoding. By linking the promoter, which is a control site for expression, a liposome binding site, and a secretion signal to the obtained gene fragment, and linking the obtained DNA fragment to vector DNA,
It is not necessary to introduce genes encoding proteins, liposome binding sites, secretion signals and proteins into the vector. For linking the DNAs, conventional linking techniques can be used, such as the restriction enzyme method in which DNA cut with a restriction enzyme is linked to .\Vt DNA using a recase, or the linker method.

The vector DNA may be NA as long as it can be replicated by a host microorganism, or it is preferably a plasmid DNA that can be replicated by a bacterium belonging to the genus Bacillus, which is a preferred host microorganism. Examples of such vectors include:
Plasmid pUB110 derived from Staphylococcus sp.
pc194, pBD64, pE194, psAO50
1SpT127 and derivatives thereof. Bacillus subtilis containing these plasmids are all stored at the Ohio University Bacillus Stock Center (address:
484. West 12th Avenue, C
olgus 0hai.

, 43210 U, S, A,).

By transforming a host microorganism with the plasmid obtained as described above, a microorganism that produces the fusion protein can be obtained. Transformation of the host microorganism with the plasmid can be carried out using conventional methods, e.g.
et al.'s protoplastization method [Chang, S.,
eL al,, Mo1. Gen, Gen
et,, 188. 1ll-115 (1979) 1
This can be done using, etc.

The host microorganism may be, for example, yeast, mold, etc., but may include Escherichia spp., Bacillus spp., or Staphylococcus spp.
Microorganisms of the genus Taphylococcus are preferred.

Microorganisms of the genus Bacillus, especially Bacillus subtilis (Ba
cillus 5ubtilis) is highly safe and secretes a large amount of protein outside the bacterial body. Furthermore, among Bacillus subtilis, a strain whose extracellular protease productivity is reduced by a technique such as mutation is preferable.

When such strains are transformed with plasmids, degradation by host-derived proteases can be significantly suppressed, and fusion proteins can be efficiently obtained in large amounts.

Examples of Bacillus subtilis with low protease productivity include (
1) Bacillus subtilis (Bacillus 5)
ubtilis) D B 104 strain [J, Bact
eriol, 160; 442-444. (19
] and Bacillus subtilis 104HL strain [B
ioehem, Biophys, Res, Co+
mmun, 128; 601-606. (198
(2) Applicant or Japanese Patent Application Laid-open No. 64-3728
Bacillus subtilis DY- proposed in Publication No. 4
16 strains (Feikoken Bibori No. 9488); (3) Bacillus subtilis which lacks the ability to produce alkaline protease and neutral protease and whose protease activity is 3% or less of the wild strain;
Examples include strains into which the spOAΔ677 mutant gene has been introduced. Particularly preferred strains are those belonging to (3) above, and such strains include, for example, Japanese Patent Application No.
No. 281440, as proposed by the present inventors, Bacillus subtilis strain 104HL was infected with spo O^△.
Bacillus subtilis 5P with 677 mutant gene introduced
Bacillus subtilis strain 5PL14 (Feikoken Bibori No. 113988), which is a strain of Bacillus subtilis DY-16 into which the s poOA△677 mutant gene has been introduced, is included. .

The fusion protein can be obtained by culturing and recovering the transformed host microorganism. In addition, when the fusion protein is accumulated in the bacterial body or periplasm, the fusion protein can be obtained by a conventional method, for example, by disrupting the bacterial body.

The host microorganism can be cultured according to conventional liquid culture. That is, the transformed strain can be cultured by shaking culture or aerated agitation culture in a liquid medium containing conventional components such as inorganic salts, carbon sources, nitrogen sources, growth factor components, etc.

The pH of the medium is, for example, about 7 to 8. The cultivation is carried out under the usual conditions employed for the cultivation of microorganisms, e.g.
~45°C, preferably 25-40°C, culture time 6-60
This can be done under conditions of approximately 1 hour.

[Effects of the Invention] In the method for producing a fusion protein and a peptide or protein of the present invention, a peptide or protein as a gene product of interest can be efficiently obtained.

[Examples] The present invention will be described in more detail based on Examples below, but the present invention is not limited to these Examples. In the Examples, unless otherwise specified, enzymes manufactured by Zakushuzo (1) were used and reactions were carried out under the conditions described in their specifications.

(1) Preparation of protein C from bovine blood J, Bio
ehem, 97.1347-1355 (1985)
Protein C was purified from bovine blood according to the method described in . That is, 171 in 201 bovine blood immediately after slaughter.
Plasma was prepared by adding 0 volume of 0.11 M sodium citrate and centrifugation. 1/10 volume of 1M barium chloride was added to the plasma, and the enzyme was recovered as a barium citrate precipitate. The obtained precipitate was solubilized by adding 40% saturated ammonium sulfate, and further ammonium sulfate was added to the centrifuged supernatant to dissolve the precipitate.
A 0% saturated ammonium sulfate solution was prepared, and the resulting precipitate was collected by centrifugation. After solubilizing and dialyzing the precipitate, DEAE
- Sephadex A-50 [manufactured by Pharmacia Co., Ltd., 2, 5 X 44 cs+]
and eluted with 0.3M NaCl using the NaCl stepwise elution method.

The 0.3M NaCl fraction containing the protein C fraction was concentrated by ultrafiltration, dialyzed, and then purified using Blue Sephas
Blue-3epharose) CL-6B [manufactured by 7Furmacia Co., Ltd., 2.5 x 42 cm],
The flow-through fraction was collected. By these operations 53゜5m
g of protein C was obtained.

In addition, protein C was quantified using J, Bioche+g
, 90, 1387-1395 (1981), Boc-Leu-Ser-
It was measured by amidase activity using Thr-Arg-pNA (Boc is a t-butoxycarbonyl group, pNA is a p-nitroanilide group) as a substrate. Moreover, the protein amount was calculated from E1%-13.7 at 280 rv.

(2) Preparation of active protein C Protein C5,9+gg and thrombin 0°14
50 m M Tris-HCl buffer (pH 7) containing
, 0) for 40 minutes at a temperature of 37°C, and after adjusting the pH to 6.0, 50mM sodium phosphate (
S-3epharose equilibrated at pH 6,0)
[Manufactured by Pharmacia Co., Ltd., 1.6X10゜5cIIl]
The flow-through fraction was collected to obtain active protein C.

(3) Preparation of peptides containing sequences surrounding the cleavage site The following peptides were each synthesized using a peptide synthesizer (manufactured by Applied Biosystems) and purified by reversed-phase liquid chromatography.

Sequences surrounding the cleavage site by active protein C of peptide KY-1 nibrotiin C inhibitor and 1 of VIP
Peptide Ac-Thr-IIe-Phe containing positions ~6
-Thr-Phe-Arg-His-8er-^5p-
Ala-Vat-Phe (Ac represents an acetyl group) Peptide K Y -2: Leu-Ser-Thr-A
Peptide containing positions 1 to 6 of rg and VIP^c-Th
r-l 1e-Leu-9er-Thr-Arg-Hi
s-8er-Asp-Ala-Vat-Phe (A
(c is the same as above) Peptide KY-3: peptide ^c-Glu-Glu-Pr containing the sequence surrounding the cleavage site of human blood coagulation factor Vll+ by activated protein C and positions 1 to 6 of VIP.

-Gln-Leu-Arg-His-Ser-Asp-
Ala-Val-Phe (A c is the same as above) (4) Cleavage of synthetic peptides with activated protein C KY-1, KY-2, and KY-3 were each 50 n
5ol containing 50mM Tris-HCl (pH 8°0)
, 1 mM Ca Cl % and 0.1 M NaCl solution at 37° C. with 0.5% mol of active protein CO, and the resulting fragments were identified and the decrease in the substrate synthetic peptide was measured. The chromatograms obtained by reverse-phase liquid chromatography after 8 hours of reaction are shown in the first column.
It is shown in Figs. In addition, in the figure, KY-1 (1 to 6)
, KY-2 (1-6) and KY-3 (1-6) represent fragments of positions 1 to 6 in KY-1 to KY-3, respectively; KY-1 (7-12), KY −2(
7-12) and KY-3 (7-12) are respectively,
The fragments at positions 7 to 12 in KY-1 to KY-3 are shown.

The reaction rate after 1 hour was 57.3% for KY-1, KY
In the case of -2, it is 19.5%, and in the case of KY-3, it is 6.4%.As a result of analyzing the amino acid sequence of the generated fragment, all the cleavage sites were between Arg and His, as expected, and other No cleavage at this site was observed even after 8 hours of reaction.

These results revealed that Phe-Thr-Phe-Arg is preferable as the recognized sequence of active protein C.

(5) P^VIPG (P) expression plasmid pMD2B
Thr-11e- which is a recognition sequence of activated protein C
Plasmid p for expressing a fusion protein PAVIPG (P) in which VIP-Gly is fused to the C-terminal side of positions 1 to 404 of protein A via Phe-Thr-Phe-Arg.
MD235 was constructed according to the method described in Japanese Patent Application No. 2-221478.

(5-1) Preparation of plasmid pMD2oo Protein A
Plasmid pDCP2411 containing the gene (JP-A-63
-245677) (10 gg) with restriction enzyme E
Digested with coRI and BamHI (20 units each) to generate a 2.25 kb Ec containing the protein A gene.
The oRI/BamHI fragment was obtained. Next, this 2.25
kb EcoRI/BamHI fragment (18g) and plasmid pUB110 EcoRI/BamHI fragment (18g)
The HI long chain fragment (0°5utr) was ligated using TA DNA ligase (100unitS), and Bacillus subtilis B.
ac order 1us 5ubtilis PSLI strain (available from the Bacillus Genetic Stock Center at The Ohio State University) was transformed by the protoplast method [M
o1. Gen, Genet.

, 168. 111-115. (1979)
Ko .

The obtained kanamycin-resistant (Km) strain was transferred to LB medium (
1.0% tryptone, 0.5% yeast extract, 0.5% N
The cells were cultured in 10 ml of aCl5 pH 7,2 (containing 10 μr/mN of kanamycin Km) at 37° C. for 16 hours. Regarding the culture soil liquid, EL I S A [P
roc, Natl, Acad, Set, USA
, 80.697-701. (19113)] investigated the productivity of protein A and found that Bacillus subtilis 9, 5ubtilis containing plasmid pMD200
One strain of PSL was obtained.

(5-2) Chemical synthesis of VIP-GIV gene A DNA sequence encoding VIP-Gly consisting of 29 amino acid residues, a cleavage site for the restriction enzyme Pstl, and a recognition sequence for kallikrein at its N-terminus. A certain Phe-Arg
The DNA sequence of the spacer region containing
122bp VIP-Gly with added cleavage site of I
(hereinafter referred to as IP-Gl) gene by DNA synthesis (Pride Biosystems Model 381A)
was chemically synthesized. The base sequence and corresponding amino acid sequence of VIP-Gl obtained are shown below.

ThrrlePheThrPheArg Old 5Ser^5
pAIaValGATACGATCTTCACGTTC
CGCCATAGCGATGCGGTCACGTCTA
TGCTAGAAGTGCAAGGCGGTATCGC
TACGCCAGstI PheThrAspAsnTyrThrArgLeuA
rgLysGlnMet^1aValTTTACAGA
TAACTATACGCGTCTGCGCAAACAG
ATGGCGGTCAAGTGCCTATTGATAT
GCGCAGACGCGTTDingGTCTACCGCCA
GLysLysTyrLeuAsnSer I 1eL
euAsnG l yH**tt^^AAAATATC
TGAATTCTATCCTT^^CGGATAATA
GTTTTTTATAGACTTAAGATAGGAA
TTGCCGACTATCCTAGamHI (5-3) Production of host Bacillus subtilis 5PL14 strain with low protease productivity Bacillus subtilis (Bacillus 5ubti)
lis) SPL14 strain was produced according to the method described in Japanese Patent Application No. 1-281440. Incidentally, Bacillus subtilis 5PL14 strain has already been deposited as Microtech Research Institute No. 10988.

Bacillus subtilis strain ATCC 39096, which is a Bacillus subtilis having the spoOAΔ677 gene and the lincomycin resistance gene (hereinafter referred to as Lhn), was cultured with shaking at a temperature of 37° C. until the logarithmic growth phase using the LB medium shown in the table.

Table 1.0 Weight 96 Tryptone 0.5 weight % Yeast extract 0.5 weight % NaCJ pH 7.5 The bacterial cells contained in 50 ml of the culture solution were collected and subjected to the Saito-Miura method (H, 5aito, K, Miura, Bioc).
Old ta, Biophis, Acta, 72.61
9 (1963)), chromosomal DNA was extracted and purified.

Using the obtained chromosomal DNA, Bacillus subtilis DY-16 strain was transformed by the competent cell transformation method. Next, the obtained transformed strain was cultured using an LB agar plate medium containing 5 μg/ml lincomycin, and strains into which Lxn had been introduced were selected.

As a result, about 800 lincomycin-resistant transformants were obtained. Next, 51 strains deficient in sporulation ability were isolated from these lincomycin-resistant transformed strains in the following manner.

The transformed Bacillus subtilis was spread on a minimal agar medium containing 5C)sg/J of histidine and cultured at a temperature of 37°C for 48 hours.

Strains that met the following indicators 1 to 3 were selected as spore-forming ability-deficient strains.

1. The transformed strain was inoculated into the sporulation medium, and the colony lost the ability to produce melanin pigment. 2. At a temperature of 80°C, 1.
3. No spore formation is observed by microscopic examination.

Among the obtained 173 strains deficient in sporulation ability, the strain with the lowest protease activity was selected as described below, and its protease activity was measured.

The sporulation-deficient transformant strain and the parent strain Bacillus subtilis DY-16 strain were separately inoculated onto an LB agar plate medium containing 1% by weight of casein, and cultured at a temperature of 37°C for 24 hours. Since casein is degraded by protease secreted by the bacterial body, the size of the halo around the bacterial body formed by the decomposition of casein is used as an indicator to determine whether Bacillus or
We isolated 400 strains whose protease production ability was lower than that of the S. subtilis DY-16 strain.

Bacillus subtilis strain DY-16 and 40 transformed strains with reduced protease activity were each cultured overnight in 10 ml of LB medium, and 1 ml of the culture solution was centrifuged, and the supernatant contained the Bacillus subtilis strain. The activity of the protease was determined by IIPJ. That is, 0.2% FITC-casein (manufactured by Sigma), 100mM Tris-HCl buffer (p
H7,5), substrate solution 1 containing 2mM calcium chloride
00μ, supernatant test solution containing protease 100μ
was added, and the mixture was reacted at 37°C for 3 hours. After the reaction is complete,
The reaction was stopped by adding 200μ of 7.5% trichloroacetic acid to the reaction solution, and the supernatant was obtained by centrifugation.
After neutralization with Tris-HCl buffer (pH 8.5), fluorescence was measured at an excitation wavelength of 490 nm and an emission wavelength of 525 nm.

In addition, the enzyme activity that releases trichloroacetic acid soluble peptide equivalent to 1 μM Tyr from casein per minute is expressed as IU.
It was converted using Pronase (manufactured by Kaken Pharmaceutical Co., Ltd.) as a standard.

As a result, 5PL14 was selected as the strain with the lowest protease activity compared to the parent strain Bacillus subtilis DY-16.
It was made into a stock. The protease activity of this 5PL14 strain is about 3% of that of the parent strain Bacillus subtilis DY-16 strain. This 5PL14 strain has the above-mentioned genetic marker. Furthermore, all of these strains have auxotrophies for histidine and leucine, and multiple auxotrophies required by the host were confirmed in gene recombination experiments.

The pre-Me Bacillus subtilis 5PL14 strain was used as a host for the following fusion protein expression plasmid pMD235.

(5-4) Preparation of plasmid pMD235 The 5' end of the chemically synthesized VIP-Gl gene (5 μg) was phosphorylated, and then TaDNA ligase (200 unfts)
The Pstl/BamHI long chain fragment of plasmid pMD200 containing up to the part encoding Asp at position 440 in protein A (mature type) represented by the above formula was prepared using
18g) and Bacillus subtilis 5PL.
The L4 strain was transformed by the protoplast method. The obtained K
Plasmid pMD235 was obtained from the m strain.

DNA sequencing of the portion inserted into pMD235 using the M13 dideoxy method revealed that the VIP-Gl gene had been inserted as intended.

(6) Secretory expression of fusion protein Bacillus subtilis 5PL14/pMD235 strain transformed with the above plasmid pMD235 was
B medium A () Lipton 3.30o, yeast extract 2.0
%, casamino acids 2.0%, crucose 1.0%, NaC
10.74%, Na2HPO40.8%, KH2
PO40, 4%, MnC120, 06mM, kanamycin 10μg/ml, sodium succinate 0.5M, p
H7,2). After 9 hours of culturing at 37°C, the culture was terminated, and a culture supernatant was obtained by centrifugation. This culture supernatant was mixed with TST-buffer [50 m
M Tris-HCl (pH 7,6), 0.15M N
aC1,0°05% Tween 20]
IgG-3epharose FF (5
,OX26. Oes+) and TST-
After washing with bufl'er, elution was performed with 0.1M acetic acid. This IgG-3epharose fraction was mixed with phenyl (P
henyl)-5PWRP (2, 15x 15 cm
) using 0. Purified by gradient elution of acetonitrile in the presence of 0.05% trifluoroacetic acid and PAVIP
G(P) was obtained.

(7) Excision of VIP-Gly from PAVIPG (P) by activated protein C 50 mM) Lis-HCl (pH 8,0), 0.1
0.4 μg of the fusion protein PAVIPG (P) was reacted with 23 μg of activated protein C at 37° C. in a reaction solution containing 1 mM NaCl and 1 mM Ca C12. Chromatograms obtained by reverse phase liquid chromatography after 0 and 8 hours of reaction are shown in FIGS. 4 and 5.

When the peak eluted at a retention time of 25 minutes was fractionated and analyzed using a protein sequencer, it was found that VIP-G was completely isolated.
It was identified as ly.

[Brief explanation of drawings]

FIGS. 1 to 3 are chromatograms showing the results of the cleavage reaction of synthetic peptides KY-1, KY-2, and KY-3 by activated protein C, and FIGS. 4 and 5 are respectively, active proti>C
1 is a chromatogram showing the results of a cleavage reaction of VIP-GIy from PAVIPG (P). Patent applicant M.D. Research Co., Ltd. Agent
Person Patent Attorney Hoe 1) Mitsuru Life Figure 4 PAVIPG (Pl No. Time (X10 minutes) Figure 5 Time (X10 minutes)

Claims (1)

[Claims] 1. The following formula A-B-C [wherein A represents a carrier, B represents an amino acid sequence that can be specifically cleaved by activated protein C, and C represents a target peptide or fusion protein represented by ]. 2. Amino acid sequences that can be specifically cleaved by activated protein C include Phe-Thr-Phe-Arg, Leu
-Ser-Thr-Arg, or Pro-Gln-Le
The fusion protein according to claim 1, which is u-Arg. 3. A method for producing a peptide or protein, which comprises treating the fusion protein according to claim 1 or claim 2 with activated protein C.