JPH0372869A - Urea-nonproductive practical brewing yeast, method for breeding the same and production of sakes (japanese rice wines) using the same - Google Patents

Abstract

PURPOSE:To suppress formation of ethyl carbamate which is a carcinogen and breed the subject yeast usefully for production of SAKEs by transforming a yeast with a specific plasmid and breaking or substituting arginase gene. CONSTITUTION:A plasmid having both a gene providing a dominant marker for selecting a transformant and part of arginase gene is used to break or substitute the arginase gene and breed the objective yeast. Furthermore, e.g. a DNA fragment of Saccharomyces/cerevisiae capable of coding arginase is cloned to afford plural plasmids in which tolerance to geneticin and sulfometuron-methyl as respective selection markers are linked to the middle of a coding region. In transformation, the aforementioned plasmids are preferably mixed, etc.

Description

DETAILED DESCRIPTION OF THE INVENTION (Field of Industrial Application) The present invention is directed to the yeast (
The arginase gene (CARI) of commercial brewing yeast
), and its breeding method and its utilization.

The urea-nonproducing commercial brewer's yeast, which is the transformant of the present invention, lacks arginase (EC3, 5, 3, 1), an enzyme that decomposes arginine into ornithine and urea, so urea production is suppressed. has been done. Therefore, it is possible to suppress the production of ethyl carbamate, a carcinogen derived from urea.

In other words, by using the transformant of the present invention, it is possible to produce alcoholic beverages, etc., which have the same alcohol fermentation rate and quality as the parent strain, and which do not contain ethyl carbamate at all. Therefore, the present invention greatly contributes to the production of alcoholic beverages, alcohol, and other brewed foods.

(Background of the invention, prior art, and problems thereof) In general, during the production of various brewed foods and drinks (sake, shochu, fruit wine, beer, whisky, brandy, soy sauce, miso, aged sake, etc.),
The presence of urea, which varies considerably in content, is a problem worldwide because it reacts with ethanol to form ethyl carbamate (urethane), a carcinogen.

Conventional methods for reducing urea include using mutant strains lacking arginine permease, which is involved in the uptake of arginine into yeast cells, or using ureaamide lyase, which decomposes urea into ammonia and carbon dioxide. Methods have been taken to use disinhibited mutant strains, but even with these strains, the amount of urea can only be reduced to about half of the conventional amount.

Moreover, these mutant strains generally have slower fermentation than the parent strain, so they are easily contaminated with other yeasts, making it difficult to obtain reliable effects.

The present inventors, in Japanese Patent Application No. 63-268097, bred urea-nonproducing yeast by disrupting or replacing the arginase gene. A chamber strain (haploid) is used, and since it is haploid, there are problems such as a slow fermentation rate in practical use.

The practical brewing yeast (Satsucharomyces cerevisiae), which is normally used in the production of sake, shochu, fruit wine, beer, rice wine, brandy, aged sake, etc., is diploid (or higher-order polyploid). In addition, it has properties required for the production of various alcoholic beverages, such as alcohol resistance for sake and shochu, sulfite resistance for fruit liquor, and low-temperature fermentability for beer, and is significantly different from laboratory strains. There is.

Therefore, while maintaining excellent characteristics as a practical brewer's yeast,
In order to provide a marker for selection of transformants, markers such as auxotrophy cannot be provided by artificial mutation such as in laboratory strains, and drugs (e.g., oligomycin, geneticin, erythromycin, pleomycin, −
It is necessary to use dominant markers such as resistance to azaguanine, nystatin, sulfometuron methyl, etc.), resistance to heavy metals (copper, zinc, cobalt, mercury, etc.), and killer fluorescence secretion.

In addition, in order to destroy or replace the target gene in commercial brewing yeast, it is necessary to destroy or replace the same gene on two (or more) chromosomes, and multiple Construction of a plasmid for destruction or replacement is required.

(Means for Solving the Problems) From the above viewpoint, the present inventors have adopted resistance to dienetisin (G418) and sulfometuron methyl (SN) as drug resistance as selection markers for practical brewing yeast. The arginase gene (C
We conducted extensive research with the aim of constructing a plasmid for ARI) disruption.

First, the present inventors cloned a DNA fragment encoding Saccharomyces cerevisiae arginase, and created plasmid A in which a 5M resistance gene (SMRI) as a selection marker was ligated to the middle of the coding region.
was built. Similarly, 641 as a selection marker
Plasmid B was constructed in which the 8 resistance gene (G41F!y) was linked.

As a method for transforming diploid practical brewer's yeast, (1
) Transformation using either plasmid A or plasmid B (2) Transformation in two steps using plasmid A and plasmid B (3) Plasmid A
There are three methods of transformation using a mixture of plasmid B and plasmid B, but method (1) is extremely inefficient. Method (2) and then method (3) are highly efficient. They found that a transformant can be obtained, and by this method, a transformant in which the arginase gene present on two chromosomes of a commercial brewing yeast is disrupted can be obtained.

When alcoholic beverages were produced using the obtained transformant, no urea production was observed.Therefore, it was confirmed that ethyl carbamate was not produced and the alcohol fermentation rate and alcohol quality were the same as the parent strain. In recognition of this, we have completed the present invention.

(Detailed Description) The genomic DNA donor used in the present invention is Satucharomyces cerevisiae, and specifically, the yeast No. 7 yeast (
commercially available products).

A method for extracting chromosomal DNA from this bacterial cell and a method for creating a chromosomal scene library is 1, for example, Agric.

Biol, Che+m,, Vol, 53.431~
436. (1989).

In isolating the gene from the chromosome scene library obtained above, the DNA sequence of the arginase gene of Satucharomyces cerevisiae (J, Bact
eriol Vol, 160.1078-1087(1
A DNA oligomer synthesized based on 984)) is prepared, and plaque hybridization is performed using it as a probe to clone the DNA of the arginase gene of Satucharomyces cerevisiae.

Plasmids A and B for gene disruption are constructed as follows.

Plasmid A was constructed by using 0.
Bgl II − of plasmid pUc′18-HP incorporating a 9 kbp Hindm-Pst I fragment.
The Kpn I fragment was removed and, instead, a Bam of approximately 3.5 kbp containing the 8M resistance gene excised from pVX509 was used.
Connect the HI-Kpn I fragment to create plasmid A.
(PCAT-20) is produced (Fig. 1).

In addition, plasmid B is constructed using approximately 6 kbp B'am HI-B'am HI containing the arginase gene.
A plasmid in which the fragment was integrated into pUc119 (p
cAR112), G41 excised from YCpGll
1.7kbp Pvu■-Pvu containing 8 resistance genes
Plasmid B (pcAT
-IE, pcAT-IF) (Fig. 2).

In transformation, since commercial brewing yeast is diploid (or higher-order polyploid), it is necessary to destroy the relevant genes on two chromosomes. First, plasmid A'It
Cut the DNA at the AVal site, convert it into a linear DNA, transform it into commercial brewing yeast, and select transformants in which the gene on one chromosome is destroyed and 3M resistance has developed. Next, the transformant was transformed again using a linear DNA of about 7 kbp obtained by cutting plasmid B at the Ban + HI site, and the gene on the remaining chromosome was destroyed.
Select transformants that have developed resistance to 041g. Such two-step transformation is performed to obtain the desired transformant.

Note that the determination of whether the arginase gene has been disrupted is confirmed by Southern blotting, and the presence or absence of arginase activity is determined by measuring the arginase activity using the following method.

Transformants and parent strains were grown in arginase non-inducing medium (yeast nitrogen base (N free)) 0.17%, glucose 2% (Nl(4), So, 5d) or arginase inducing medium (arginine hydrochloride in non-inducing medium). 10m salt
M addition) was inoculated to 2XIO7 cells/mQ, and
After shaking and incubating at 0°C for 4 hours, collect the bacteria and wash. This bacterial body is 1
Suspend in 011M Tris-HCl buffer (pH 7.0) and disrupt with glass beads.

Centrifuging this homogenate at 1500 rpm for 10 minutes, the supernatant was used as an enzyme solution, and the urea produced by reacting with arginine as a substrate was quantified using a urea kit manufactured by Toyo Jozo Co., Ltd.
Define arginase activity. Next, by using this transformant to produce alcoholic beverages such as sake, fruit wine, beer, shochu, whisky, brandy, aged sake, etc. in a conventional manner,
It is possible to produce alcoholic beverages that do not contain urea at all, and in turn, it is possible to produce alcoholic beverages that do not generate ethyl carbamate.

Next, examples of the present invention will be shown.

Example 1 Cloning of the arginase gene of Satucharomyces cerevisiae; Sake Yeast Association No. 7 (Satsucharomyces cerevisiae)
Scene library of chromosomal DNA (preparation method: Ar
ic, Biol, Chell,, Vol, 53.
Clones containing the arginase gene were selected by plaque hybridization using the method described in 431-436 (1989). This series of operations is a conventional method (Molecular Cloning).
, P63-67゜Cold Spring Harb
or Laboratory (1982)).

The two probes used for plaque hybridization were synthetic oligomers (32-35) with the following sequences radiolabeled with 31p.

NR-15'TGGACAAATAACCCCGATGC
TGGTCTTTTATGG3'NR-25'ATGT
ATA to AACCCTGATCTGGCTATTCAT
From approximately 20,000 plaques of TCCATG3', we were able to select one clone that hybridized to both the NR-1 and NR-2 probes.

The DNA fragment derived from Satucharomyces cerevisiae association No. 7 inserted into these clones was
Complete digestion with HI yielded a 5 to 6 kb DNA fragment that hybridized with the two probes.

This DNA fragment was ligated to E. coli plasmid vector pUc119 to obtain plasmid PCAR112, from which a restriction enzyme cleavage map of the inserted fragment was prepared (PCAR112 in FIG. 2).

Example 2 Preparation of a plasmid for arginase gene disruption; Method for preparing plasmid A: A 0.9 kbp DNA fragment derived from the arginase gene excised from pcAR112 shown in FIG. 2 using restriction yeast Hind m and Pst I was
Ligate UC18 with T4DNAIJ gauze and pt
lc18-HP was produced. In order to provide this with a selection marker, the approximately 3.5 kbp (7) BamHI-Kpn I vector encoding pldX509yosu5MR1 was used.
The fragment was excised using restriction yeast and PUC18-HP
The Bgl II-Kpn I fragment of was cut out using restriction enzymes and then ligated using T4 DNA ligase.
Plasmid A for arginase destruction (pCAT-2D)
was created.

Production method of plasmid B: Bgl I of pcAR112
After excising the I-BgI II fragment with a restriction enzyme, it was blunted with Klenow treatment and dephosphorylated with alkaline phosphatase.
1.7kbp Pvu IT encoding 8y-
Cut out the Pvu II fragment with a restriction enzyme and add T4
Ligate using DNA ligase.

Plasmid B (pCAT-LH and Pvu II
- pCA with opposite insertion direction of Pvu II fragment
T-IF) was produced.

Example 3 Preparation of Satucharomyces cerevisiae that does not produce arginase; Using the arginase gene disruption plasmid hole and B, Satucharomyces cerevisiae Sake Yeast Association No. 9 (diploid) (commercial product) was transformed by the method of Ito et al. (J
, Bacteriol,, Vol 153.163
(1983)).

Specifically, sake yeast (Kyokai No. 9) was cultured with shaking at 30°C in 100 m of YPD medium (% yeast extract, 2% polypeptone, 2% glucose, PI (5,3)), and collected by centrifugation during the logarithmic growth phase. After washing with TE buffer, the cells were suspended in the same buffer at a concentration of 2 x 10'' cells/mQ.

This 0.5-ml solution was transferred to a small test tube, 1 equivalent volume of 0.2M lithium acetate solution was added, and the mixture was shaken at 30°C for 1 hour.

From this, 0.1ml was transferred to a 1.5mM Eppendorf tube, and plasmid A (pCAT-2D) was added.
DNA solution treated with restriction enzyme AvaI to make it linear (
1 μg/μQ) was added, and the mixture was incubated at 30° C. for 30 minutes.

Next, 150 μQ of sterilized 70% ppa-4ooo was added and mixed well. After standing at 30°C for 1 hour, the Eppendorf tube was placed in constant temperature water at 42°C for 5 minutes,
Immediately cool the bacterial cells to room temperature, wash them with sterile water at room temperature,
90 strains (9 cells/μg DNA) growing in 5M-containing medium (yeast nitrogen base (W10 amino acid) 0.67%, glucose 2%, agar 2%, sulfometuron methyl 1100pp (added after autoclaving))
transformants were obtained. Next, plasmid B (PCAT-IF) was added to three of these strains using restriction enzymes Ban+HI.
DNA solution (0.8μg/μQ) treated with
) ioμa was added, and transformation was performed in the same manner as for plasmid A described above. Of the 210 transformants obtained, 80 strains were treated with an arginine-containing medium (yeast nitrogen base (N-free) 0.17%, glucose 2%, arginine hydrochloride 20+aM, agar 2%).
), 5M-containing medium and G418-containing medium (yeast extract 1%, polypeptone 2%, glucose 2%)
.

56 strains (7 cells/μg DNA) that can grow on 2% agar and 600 ppm geneticin (added after autoclaving)
was isolated as the target strain. Also, at this time, plasmid A
It was also possible to obtain a transformed strain in one go using a mixture of B and B (using a DNA concentration of 1000 μg each). In this case, the selection medium is a medium containing 5M, which is about 1
000 transformants were obtained and then among these 0418
We isolated two strains that can grow in a medium containing the following.

The arginase-deficient strain thus obtained (AL-1
The arginase activity and intracellular urea, etc. of ~AL-3) and the parent strain are shown in Table 1. Since no arginase activity was observed in the transformed strain even in arginine-induced culture and non-induced culture, two It was confirmed that this was a strain in which both the arginase genes on the chromosome had been disrupted.

Furthermore, the amount of intracellular urea was extremely small compared to the parent strain.

Umbrella Arginase activity (μmole Urea/h
r, /+ng protein)** Umbrella Below the detection limit (<0.5) Furthermore, it was confirmed by Southern blotting that the arginase gene was disrupted. AL-1 strain is FERN
It has been deposited with the Institute of Fine Technology as P-10903.

Example 4 Brewing of alcoholic beverages using transformants; Transformant A
L-I FERM P-10903 and the parent strain (Kyokai No. 9) were cultured in 10 mfl of YPD medium at 30°C overnight with shaking, then the bacteria were collected and washed, and 200 g of total rice was grown using the ingredients and manufacturing conditions shown in Table 2. We prepared sake.

Amount of yeast added: 5 x 10' cells/pumped water m12 upper tank Method: Centrifugation (3500 r, p, m, 15 iin) The progress of alcohol fermentation was measured by the decrease in weight due to the generation of CO□.
It is shown in Figure 3. In addition, the urea content and various components of the alcoholic beverages are shown in Table 3.

It was possible to produce sake that was almost the same as the previous one, and contained no urea at all. Furthermore, no formation of ethyl carbamate was observed after storage by pasteurization.

[Brief explanation of drawings]

FIG. 1 is a diagram illustrating the production of plasmid A for gene disruption of the arginase gene, FIG. 2 is a diagram illustrating the production of a similar plasmid B, and FIG. 3 is a diagram illustrating the progress of alcohol fermentation of the parent strain and the transformant.

Claims (1)

[Scope of Claims] 1) A non-urea producing practical brewing yeast in which the arginase gene has been disrupted or replaced. 2) A method for breeding urea-non-producing practical brewing yeast, which is characterized by disrupting or replacing the arginase gene using a plasmid having both a gene serving as a dominant marker for selecting transformants and a part of the arginase gene. 3) A method for producing alcoholic beverages, alcohol, etc., characterized by using the urea-non-producing practical brewing yeast according to claim 1.