JPH03232489A - Partial double-stranded oligonucleotide and method for forming same oligonucleotide - Google Patents

Abstract

NEW MATERIAL:A partial double-stranded oligonucleotide in which part of terminal region of each oligonucleotide is a partial double-stranded oligonucleotide bonded in a complementary sequence and total hydrogen bond number of base of complementary sequence part is >=13 and each non-bonding part is a template. USE:Formation of nucleic acid probe. PREPARATION:Two single-stranded oligonucleotides having complementary base sequences being base sequence parts in which hydrogen bond formed of either one oligonucleotide and other oligonucleotide at 3' ends is >=13 are synthe sized by a DNA synthetic device and these two oligonucleotides are bonded in a complementary part to partially constitute double strand.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Field] The present invention relates to a method for forming double-stranded oligonucleotides.

Furthermore, the present invention relates to a vine-forming method that is suitably utilized in a method for forming labeled double-stranded oligonucleotides.

[Conventional technology]

With the recent development of genetic engineering technology, it has become possible to clone a specific gene and express it in Escherichia coli, Bacillus subtilis, etc. to obtain a large amount of protein, which is a gene product. This method allows fast-growing bacteria to produce proteins, so it has the advantage of being able to easily obtain large amounts of proteins that would otherwise be difficult to purify and separate using enzymes, making it possible to reduce industrial costs. become.

However, on the other hand, any protein can be made delicious (
There is no guarantee that it will be manifested. In such cases, there are many cases in which expression has become possible by constructing a synthetic gene by replacing the nucleotide sequence of the structural gene of the desired protein with codons commonly used in the host, for example, E. coli.

Recently, attempts have been made to modify proteins, investigate the relationship between their functions and amino acid sequences, and make them more functional. In such cases, a gene is constructed in advance by introducing as many restriction enzyme cleavage sites as possible into the structural gene of the protein without changing the amino acid sequence, and then synthesized.
In many cases, the protein is modified by expressing it and then using the introduced restriction enzyme cleavage site to replace a portion of the protein.

The currently used gene (hereinafter referred to as double-stranded oligonucleotide) synthesis method involves, for example, dividing each strand of the desired DNA into 100mers or less, synthesizing it with a DNA synthesizer, and then creating double-stranded oligonucleotides by annealing. There is a method to make them double stranded, or to connect them so that they are lined up in order after making them into double strands. To explain specifically, 1
When trying to synthesize a double-stranded oligonucleotide of 00 base pairs, two 100-mer oligonucleotides are synthesized, and then complementary oligonucleotides are annealed to form a double strand, or
When trying to synthesize a base-paired double-stranded oligonucleotide, four 100-mer oligonucleotides are synthesized, then each complementary oligonucleotide is annealed to form a double-stranded oligonucleotide, and the double-stranded oligonucleotide is synthesized. Methods such as connecting two sets are used.

To create the double-stranded oligonucleotides mentioned above, if the heavy chain oligonucleotides are 100 mar or less, synthesize two of each and use the brimer extension method without forming double-strands by annealing.
Double strands can be formed.

Specifically, when synthesizing a double-stranded oligonucleotide of 100 base pairs, one 100-mer oligonucleotide is synthesized and used as a template, and another oligonucleotide of 8 or more bases with a complementary sequence to the oligonucleotide is synthesized. Nucleotides can be bound as primers, and nucleobases can be sequentially polymerized from the primer side.

On the other hand, as typical NA labeling methods, methods using (1) terminal labeling method, (2) nick translation method, (3) substitution synthesis method, and (4) primer extension method are known.

Each method for obtaining a labeled double-stranded oligonucleotide will be described below.

The end-labeling method is a method in which the 5'-end phosphate group is removed with alkaline phosphatase, and polynucleotide kinase is applied to it to label it when it is phosphorylated again.
It is used as a radioactive label. In addition, 3' end labeling includes the terminal transferase method, the DNA polymerase method, and the like. The terminal transferase method is a method in which a large number of enzyme-labeled nucleotide triphasides are sequentially attached to the 3' end, while the DNA polymerase method is a method in which the protruding single-stranded portion of DNA that has been cut with a restriction enzyme is modified with an enzyme. In this method, a labeled nucleotide is incorporated when forming a complementary double strand. In this terminal labeling method, the number of labeled sites is limited to about one or two, so it is difficult to obtain a probe with high specific activity. Generally, labeling is performed with a radioactive isotope with high specific activity.

On the other hand, nick translation and substitution synthesis methods incorporate a large number of labeled compounds, and D
NA probes can be created. In other words, in nick translation, DNase derived from the pancreas is used to
Randomly hydrolyze the double strands of A to create cuts. DNA polymerase I recognizes this break and divides the DNA strand into 5
At the same time, complementary NA is synthesized from the 5' side to the 3' side using the non-nicked DNA strand as a template, at which time a labeled nucleotide triphosphide is incorporated as a substrate. It will be done. Furthermore, the replacement synthesis method is a method in which both 3' ends of the double strand are trimmed to an appropriate length using the 3' exonuclease activity of T4 DNA polymerase, and then labeled nucleotides are incorporated during repair by the polymerase activity. All of these methods are effective only when labeling long DNA of several hundred base pairs or more.

The primer extension method is an application of the Sanger method, which is a method for determining the base sequence of DNA. A single-stranded DNA oligonucleotide that serves as a template is synthesized, and 8 or more bases with a complementary sequence to the 3' end of the single-stranded DNA oligonucleotide are synthesized. oligonucleotide of DNA polymerase I as a primer, and
This is a method in which a labeled nucleotide is incorporated when synthesizing DNA having a complementary sequence from the 5' side to the 3' side using rgefragment or the like.

By the way, in recent years, the development of protein sequencers and D
The spread of NA synthesis equipment has led to significant advances in genetic engineering. In other words, it is now possible to easily determine part of the amino acid sequence of a small amount of protein, and furthermore, it has become possible to automatically synthesize oligonucleotides using a DNA synthesizer, making it possible to easily determine the amino acid sequence of a protein of interest. It became possible to determine a portion of the DNA, estimate the base sequence of the DNA based on it, chemically synthesize it, apply some kind of label, and use it as a probe.

Further, the oligonucleotide probe can be used to detect cylindrical red blood cells,
Restriction enzyme fragment long-length gene analysis (RFLP) associated with certain types of muscular dystrophy (genetic diseases, cancerous diseases, or infectious diseases)
f ragment length polymorph
Hism) has also been widely used.

[Problems to be solved by the present invention] In this way,
Recently, it has become very important to create synthetic genes, but the synthesis ability of commercially available DNA synthesizers is limited.
Currently, it is about 100mer or less. Moreover, the yield cannot be said to be high. Therefore, the synthesized oligonucleotide must be separated by gel electrophoresis or the like to extract only the desired band. For example, in the case described above (when a double-stranded oligonucleotide of 200 base pairs is synthesized), four 100-mer oligonucleotides are synthesized and further purified before use.

Next, these oligonucleotides are annealed to form a double strand and linked, and the two sets of oligonucleotides are bound in two ways: AB order and BA order. Therefore, for the conjugate, it is necessary to determine the base sequence and select only the AB order. Two types of conjugates are always obtained in both directions, and it is necessary to sequence them to obtain only the desired one. However, the above-mentioned operation is quite complicated, and furthermore, if purification is performed to satisfy purity, the synthesis yield becomes poor, and the method is not satisfactory in terms of both purity and yield.

Furthermore, as mentioned above, even if a double-stranded oligonucleotide is formed by the primer extension method, the maximum number of base pairs in the double-stranded oligonucleotide before being linked by annealing is up to 100 (currently However, the ability to synthesize single-stranded oligonucleotides is 100mer or less)
However, no method has been available for synthesizing a double-stranded oligonucleotide of 200 base pairs without ligation.

On the other hand, generally speaking, the longer the length of the DNA oligonucleotide used as a probe, the more errors in complementary binding during hybridization can be prevented. However, in order to obtain a long labeled DNA by the primer extension method, a long single-stranded DNA is required as a template. However, the synthesis yield in a DNA synthesizer decreases as the length of the oligonucleotide to be synthesized increases.

Furthermore, since by-products with short chain lengths also increase, it is necessary to separate and purify the target product in order to use it as a template DNA.

Furthermore, when a long region is synthesized by DNA polymerase, the synthesis may be stopped midway due to some obstacle, resulting in a difference in the length of the labeled oligonucleotides. In particular, when incorporating a non-radioactive labeling substance, the side chains of the labeling substance may interfere with the enzymatic reaction, resulting in products that are shorter than expected. This not only reduces the efficiency of hybridization, but also the hybridization reaction conditions (temperature, formamide content, etc.)
This may affect the hybridization reaction itself and cause it to malfunction.

Furthermore, in this method, one strand of the duplex only functions as a template; only one strand on the primer side is labeled and acts as a probe in the hybridization reaction solution. Only half of this is actually used, which is poor efficiency.Furthermore, during the hybridization reaction, this unlabeled template DNA competes with the labeled probe, causing a decrease in detection sensitivity. There is a possibility.

This problem applies to all probes synthesized by the primer extension method, regardless of the length of the probe, and in systems that require highly sensitive detection, a large amount of probe is required, and in some cases It may also be necessary to collect only the part of the mold that does not contain the label.

In addition, when linking by annealing, the longer the annealed part is, the more stable the probe is, but in the case of short probes used for detecting genetic diseases, the proportion of the annealed part to the whole increases, and the labeled part becomes more stable. The specific activity as a probe decreases.

[Purpose of the invention]

Therefore, an object of the present invention is to provide a method for easily forming a double-stranded oligonucleotide with high precision and high synthesis yield.

The present invention also provides a method for forming labeled double-stranded oligonucleotides with high precision and high synthesis yield, and further provides a method for forming labeled double-stranded oligonucleotides that act as probes with high specific activity. The purpose is to

[Means and actions to achieve the purpose]

That is, the present invention provides that: a) a portion of the terminal region of each oligonucleotide has a mutually complementary base sequence part, and the complementary base sequence part is between one oligonucleotide and the other oligonucleotide; a step of synthesizing at least one pair of oligonucleotides having a base sequence portion forming a number of hydrogen bonds of 13 or more; b) a step of bonding the pair of oligonucleotides with the complementary base sequence portion; C) each oligonucleotide. The present invention provides a method for forming an oligonucleotide, which comprises a step of polymerizing a nucleotide with a nucleobase.

The present invention also provides a method for forming a labeled double-stranded oligonucleotide using the nucleobase labeled in step C) above.

Furthermore, a partially double-stranded oligonucleotide obtained in the above step in which a part of the terminal region of each oligonucleotide is linked in a complementary sequence, and a hydrogen supply of a base in the complementary sequence part is provided. Also provided are partially double-stranded oligonucleotides in which the number of bonds is 13 or more and each non-bond part is a template.

The present invention aims to solve the above-mentioned problems, and was invented in a primer extension method in which each strand of a double strand functions as both a template and a primer.

In the present invention, the template and primer refer to the single strand that protrudes from the non-bonding part when two types of synthesized oligonucleotides form a partial double strand at complementary sequence parts, which is called the template. Among the strands that make up the partial double-strand, the strand that participates in binding on the opposite side of the protruding single strand is called the primer.

That is, the present invention will be specifically explained as follows.

(a) Two single-stranded oligonucleotides with complementary base sequences, which are base sequence parts with 13 or more hydrogen bonds formed between one oligonucleotide and the other oligonucleotide at their 3' ends, are DNA. Synthesize using a synthesizer. (b) Next, these two oligonucleotides are bonded at complementary portions by an annealing reaction to partially form a double strand. (C) The partial double strands thus formed serve as primers for two respective synthesized DNAs (by different nucleotide triphosphades and reagents for the polymerization of the nucleotide triphosphades). 5 using the double-stranded portion as a template.
A double strand is formed by synthesizing oligonucleotides with complementary sequences from the '' side to the 3' side.

To explain in more detail, the length of the oligonucleotide synthesized in (a) may be shorter than the actually required length.

The total number of hydrogen bonds in the complementary regions when forming a pair of oligonucleotides is preferably 16 to 24, but it may be shorter if it is 13 or more, more preferably 16 or more. It doesn't matter if it's long.

(b) In the annealing reaction, the two types of single-stranded oligonucleotide mixtures are heated at 65 degrees or higher for 1 minute or more, preferably 65 degrees for 10 minutes, or 90 degrees, in an appropriate buffer.
Heat at 5 degrees for 1 minute or more, then allow the solution to cool to room temperature. Through this reaction, the oligonucleotides bind to each other in complementary sequences to form a partial double strand.

(C) Adding nucleotide triphosphides dATP, dCTP, dGTP as synthesis reagents to the solution, and
Add an appropriate amount of TTP.

In addition, enzymes used as polymerization reagents include E, col
i DNA Δ polymerase I, DNA polymerase K
lenow fragment, T4 DNA polymerase (T, Man
iatis, et al.

Molecular Cloning 108°C
o1d Spring Harbor Lab
oratory), T7 DNA polymerase (S, T
abor et al. Proc.

Natl, Acad, Sci, USA, 84°4767
-4771 (1987), Thermostable DNA Polymerase (R, 5aiki, et.

al, 5science, 239. 487-4
91 (1988), other available NA polymerases, reverse transcriptases, and other enzymes, such as those that bind the nucleotides in a suitable manner to form complementary primer extension products of each nucleic acid. Contains promoting enzymes.

Further, the polymerization reaction temperature may be any temperature as long as the hydrogen bonds in the annealed portion are not broken and any of the above polymerization reagents works.

For example, a system in which the polymerization reaction is carried out at 0 to 40°C using the Klenow fragment of DNA polymerase is preferred.

Furthermore, when polymerizing a nucleobase labeled with an oligonucleotide, nucleotide triphosphides such as dATP, dCTP, and dGT are added to the solution as synthesis reagents.
Appropriate amounts of P and TTP are added, and at this time one or more labeled nucleotide triphosphides are added. In this case, only the labeled substance may be added, or an unlabeled substance may be mixed. As the labeling substance, not only radioactive isotopes but also non-radioactive labeling substances such as biotin or dinitrophenyl nucleotide derivatives can be used. The enzyme used as the polymerization reagent is as described above.

Furthermore, functional oligonucleotides can be obtained by using an immobilized substance instead of the labeling substance. The immobilized substance can be used in combination with a polymerization reagent to cause DN to undergo an extension reaction.
A is a nucleotide triphosphene derivative having a binding group that binds with a carrier with specific affinity to the nucleotide triphosphene introduced into the hybridization body, and specifically, the above-mentioned nucleotide triphosphene derivatives include biotin, heavy metal derivatives, etc. , homopolynucleotides, etc. are used.

The affinity bare part is the other component (comp).

nent).

For example, biotin-avidin or streptavidin, heavy metal derivatives-thio groups and polydG-polydC
Such affinity pairs include various homopolynucleotides such as polydA-polydT, polydA-polyU, and polydA-polyU.

The above-mentioned carrier binds to the nucleotide triphosphene derivative by affinity, but does not bind to the nucleotide triphosphene, and has the property of being able to separate hybridized products from non-hybridized products by binding to the nucleotide triphosphade derivative. It is fine as long as you have it. The enzyme used as the polymerization reagent is as described above.

When a double-stranded oligonucleotide is formed by the above formation method, a double-stranded oligonucleotide consisting of an oligonucleotide having a length of 100 mer or more can be easily produced.

(1) With the conventional brimer extension method, it is difficult to create approximately 100-mer genes at once with high precision and high yield. This is because, for this purpose, it is necessary to synthesize a template DNA of that length, and the synthesis limit of a DNA synthesizer is about 100 mar. Moreover, when attempting to synthesize 100 mar, the synthesis yield is currently less than 10%. Therefore, it is necessary to purify only the desired length and remove by-products before the next reaction. However, even a single base difference is extremely difficult to purify with high precision.

In contrast, in the method of the present invention, it is sufficient to synthesize an oligonucleotide with a length shorter than the length of the probe. As a result, when creating a gene of 100 base pairs, if the annealing part is 8 base pairs, for example, 5
It is sufficient to synthesize two oligonucleotides each having a length of 4 bases. Naturally, compared to the case of synthesizing an oligonucleotide of 100 bases, the synthesis yield is better in the case of 54 bases, and there are fewer by-products.

Therefore, purification is also easy.

Furthermore, according to the present invention, it becomes possible to synthesize genes of 100 mer or more, for example, genes of 200 base pairs, etc., all at once, which has been almost impossible until now. If two 100-mer oligonucleotides, which is the limit that can be synthesized at one time by a synthesizer, are synthesized and an enzymatic extension reaction is performed, a gene with a length close to 200 base pairs will be synthesized.

(2) Even in reactions using polymerization reagents, in the case of conventional methods, a large number of nucleotides had to be polymerized by enzymes. However, there are limits to the length that each enzyme can extend. As a result, the reaction stops midway and short genes are likely to be produced.

In the case of the present invention, the length of the nucleotides polymerized by the enzyme is considerably shorter than conventional methods. When creating a 100mer gene, it is sufficient to extend the gene by 46 bases, whereas the conventional method extends the gene by 92 bases. The reaction proceeds more completely in a shorter time when extending by 46 bases than when extending by 92 bases. By this, double-stranded DNA of uniform length can be obtained, and the efficiency of the ligation reaction to the vector and the efficiency of transformation can be greatly improved.

Furthermore, when the double-stranded oligonucleotide is labeled, the following effects can be achieved by using the method of the present invention.

(3) Even in reactions using polymerization reagents, in the case of conventional methods, a large number of nucleotides had to be polymerized by enzymes. However, there is a limit to the length that each enzyme can extend. Even in the case of labeling with radioactive isotopes, when the enzymatic reaction product is examined by gel electrophoresis, many by-products that are shorter than the desired band are seen.

Therefore, in the case of the conventional method, it was necessary to cut out only the desired length of DNA from the gel, extract the DNA, and then use it as a probe. In the case of non-radioactive labels, the structure of the labeling substance often inhibits the enzymatic reaction, resulting in the reaction stopping midway. Moreover,
Unlike radioactive isotope labels, detection uses a color reaction, etc., and therefore cannot be purified by gel electrophoresis, making purification difficult.

In the case of the present invention, the length of the nucleotides polymerized by the enzyme is considerably shorter than conventional methods. When creating a 50-mar probe, it is sufficient to extend it in increments of 21 bases, whereas the conventional method extends 42 bases. Compared to 42-base extension, 21-base extension allows the reaction to proceed more completely in a shorter time and requires no purification.

This not only saves the effort of purification, but also makes it possible to easily obtain labeled oligonucleotides of uniform length with a non-radioactive substance.

Furthermore, in the double-stranded oligonucleotide purified as a result, a labeling substance is incorporated into both strands, and each strand acts as a probe with high specificity, increasing the efficiency of hybridization.

Furthermore, if the nucleic acid sequence of the labeled double-stranded oligonucleotide obtained according to the present invention is associated with a genetic disease, cancerous disease or infectious disease, it can be effectively used for analysis.

Below, examples will be given and concretely explained.

Example 1 Preparation of a0 synthetic oligonucleotides The following nine types of oligonucleotides were synthesized using a DNA synthesizer (ABI, model 381A). (The final target 20mer double-stranded DNA was designed to have the same sequence.) ■ 5' ■ 5' ■ 5' ■ 5' ■ 5' ■ 5' ■ 5'3'TCACAAAATC3'TTGAGCGTCGATTT3'TCACAAAATCG3'TTGAGCGTCGATT3'TTGAGCGTCGATTTT3'TCACAAAATCGA3' TTGAGCGTCGATTTTT ■ 5' TCACAAAATCGACGCTCAA3
' ■ 5' TTGAGCGTCGATTTTGTGA3
' Of these, ■ and ■, ■ and ■, ■ and ■, ■ and ■, ■ and ■, ■
and ■ have mutually complementary sequences at their 3' ends,
■ and are all complementary sequences to each other.

Some of these synthesized oligonucleotides were subjected to 20% polyacrylamide gel electrophoresis containing 7M urea to examine their purity. As a result, the purity was 95% or more, so it was used in the following reaction without further purification.

2ug of each oligonucleotide in an Eppendorf tube
(approximately 130 pmole) of 10x annealing solution (1
00mMTr 1s-HCfpH8,0-60mM
MgCl2-60mM β-mercaptoethanol-
Add 5μl of 500mM NaC1) and dilute to 50μl with distilled water.
Adjusted to β. This was heated for 10 minutes in a beaker containing hot water at 65 degrees Celsius, and then slowly cooled to room temperature (required time: approximately 1 hour).

In this reaction, ■■ and ■, ■O and ■, ■■ and ■, ■■ and ■,
■■ and ■, ■■ and ■ oligonucleotides form partial double strands with a total number of hydrogen bonds of 11 to 16 as shown below.

■(■ and ■) Total number of hydrogen bonds in complementary parts・115′3′ TCACAAAAAATC 3TTA GCTGCGAGTT5' ■ (■ and ■) Total number of hydrogen bonds in complementary parts・ Also, ■■ and ■ are all complementary, so Below Forms double strands.

”AGTGTTTTTAGCTGCGAGTT5'■～
■ImM dATP, dGTP, TT in 50μl of solution
2 μl each of P and dCTP.

Add 5 μl of 10x annealing solution and 32 μl of distilled water, mix well, and add DNA polymerase I Kleno.
16 units of w fragment (manufactured by TOYOBO) were added and heated at 37 degrees for 1 hour to perform an extension reaction.

b. In order to confirm whether the double-stranded DNA of evaluations ■ to ■ was created as planned, the reaction solution of a was subjected to phenol extraction and ethanol precipitation, and then dissolved in H, 020 μm.
The 5' end of the double-stranded DNA was labeled with p32.

In a 1.5 ml Eppendorf tube, add 20 μl of the product from a above (0.5 M T r i
s-HCl p H7, 6,0,1MM g CI
2 50 m M dithiothreitol, 1 m M spermidine) 4 μl, Cr-”P:] ATP (125
uCi, 3.0OOCi/rnmo 1) 12.5μl
and T4-polynucleotide kinase (12 units°)
3 μl was added and reacted for 30 minutes at 37° C. (total reaction solution volume: 39.5 μl). After the reaction, 200 μl of 2.5M ammonium acetate was added to stop the reaction.

In order to remove unreacted "P-ATP" from this reaction product, 98% formamide-0,
After adding 20 μl of 05% xylene diano-bromophenol blue solution and heating at 90 degrees for 2 minutes to denature, electrophoresis was performed on a 10% polyacrylamide gel containing 7M urea. After electrophoresis at 100 OV for 3 hours, the gel was removed from the glass plate, an X-ray film was applied thereon, and the gel was left for about 30 seconds. When this film was developed, it showed a clear band at the same position as ■, with the same intensity as ■■ and ■■, while ■■ showed a band with an intensity of about 50% that of ■■.
Furthermore, for ■ and ■, faint bands of about 10% were observed.

From the above, it has been found that a usable double-stranded oligonucleotide can be formed by this method when the total number of hydrogen bonds in the complementary sequence portion is at least 13 or more.

Example 2 Table 1 shows the combinations of the number of bases in complementary parts and the total number of hydrogen bonds. For A-J shown in Table 1, the base sequences of the complementary parts were arbitrarily changed, and 5 sets (10
oligonucleotides of various types) into a DNA synthesizer (API
, 381A type). As in Example 1, these have mutually complementary sequences at their 3' ends.

A portion of these synthesized oligonucleotides was subjected to electrophoresis on 20% polyacrylamide containing 7M urea to examine its purity. As a result, the purity was 95% or more, so it was used in the following reaction without further purification.

2ug of each oligonucleotide in an Eppendorf tube
(approximately 130 pmole) of 10x annealing solution (1
00mMTr 1s-HCA pH8,0-60mM
MgCff1. -60mM β-mercaptoethanol-500mM NaCf) at 5μ! In addition, with distilled water 5
The volume was adjusted to 0 μl. This was heated for 10 minutes in a beaker containing hot water at 65 degrees Celsius, and then slowly cooled to room temperature (required time: approximately 1 hour).

In this reaction, the two oligonucleotides form a partial double strand as shown below.

5” CTCTG＾CAC＾TGCAGCTCCGGG
31111 3”GGGCTCTGCC＾GTGTCGAACAG
5゜50μ of this solution, f' with ImM dATP, d
2μl of GTP and dCTP, 0.4m each
M-biotinylated UTP (manufactured by BRL) at 5 μl 110x
Add 5 μl of annealing solution and 32 μl of distilled water, mix well, and then add K 1 e n of DNA polymerase ■.
Add 16 units of o w fragment (manufactured by TOYOBO) to 37
The mixture was heated for 1 hour at 30°C to carry out an extension reaction.

Then, in order to remove unreacted biotinylated UTP,
The reaction solution was passed through a gel filtration column (Bi.

gel P2; 0.5X5cm manufactured by Bio-Rad,
). Most of the target labeled nucleotide was recovered in the fraction that passed through the column.

Collect 0.5 ml of each fraction and
! was adsorbed onto a nitrocellulose filter, and a coloring reaction was performed according to the protocol of BRL. Regarding the results, the second fraction with a strong color was compared with the second fraction.
1 point for weak color development, and 0 point for no color development, and the scores are shown in Table 2 as (total score of 5 sets of oligonucleotides)/10×100 [%].

Note that the strongly colored second fraction indicates that these oligonucleotides are labeled with biotin.

From the above results, the total number of hydrogen bonds in the complementary sequence parts is 13
It has been found that this method allows the formation of usable oligonucleotides for stable sequences of at least 100 nucleotides.

Furthermore, when the total number of hydrogen bonds in the complementary sequence part is 13 to 15, some oligonucleotides are formed depending on the base sequence of the complementary sequence part and others are not, so it is generally It can be said that 16 or more is desirable.

Table 1 Table Example 3 Furthermore, for -R shown in Table 3, three sets (six types) of the following oligonucleotides were each placed in a DNA synthesizer (Applied Biosys-Tems Co., Ltd. 38
1A type). Table 3 shows the combinations of the number of bases and their total number of hydrogen bonds.

K-15'CTCTGACACATGCAGCTCC
GG3'5' GACAAGCTGTGACCGTCTCCG
GG3'-2 5' CTCTGACACATGCAGCTGCCC
G3'5' GACAAGCTGTGACCGTCTCGG
GC3' -3 5' CTCTGACACATGCAGC TCGCCG3'5' GACAAGCTGTGACCGT CTCGGCG3' -1 5' A A G G CCA, G G A A CCGTA
AAA3'5' AACGCCAGCAACGCGG CCTTTTAC3' -2 5' A A G G CCA G G A, A CCA G
TATT3'5' A A CG CCA G CA A CG CG G
CCAATACT3' -3 5' AAGGCCAGGAACCAAG TAA3'5' AACGCCAGCAACGCGGCCTTA
CTT3'5' TTAAGTTGGGTAACGCCAGGG
TTTT3'5' TACAACGTCGTGACTGGGAAA
A CC3' -2 5' TTAAGTTGGGTAACGCCAGAT
GGTA3'5' TACAACGTCGTGACTGGGTAC
CAT3'5' TTAAGTTGGGTAACGCCAGTC
AGTT3'5' TACAACGTCGTGACTG 5' GAGAGTGCACCATATGCGGTG
TGA3'5' CCTTACGCATCTGTGCGGTATT
TCACAC3'5' GAGAGTGCACCATATGCGTAG
CGT3'5' CCTTACGCATCTGTGCGGTAT
TACGCTA3'5' GAGAGTGCACCATATGCGCTA
GAC3'5' CCTTACGCATCTGTGCGGTAT
TGTCTAG3' ○-1 5' AATTCGAGCTCGGTAC 5' CCTGCAGGTCGACTCTAGAGG
ATCCCC3' ○ 5' AATTCGAGCTCGGTACCCGGC
ATC3'5' CCTGCAGGTCGACTCTA G A
G G G A T G CC3'5' AATT
CGAGCTCGGTACCCCGTTGC3'5' CCTGCAGGTCGACTCTA G A
G G G CA A CG 3 '5' T G
A G T G A G CT A A CT CA
CA T T A A T T 3 'GGGCAGT
GAGCGCAAC -2 5' TGAGTGAGCTAACTCACTATT
TTT 3'5' GGGCAGTGAGCGCAACGCAAAA
ATA3'5' TGAGTGAGCTAACTCACTATA
TAT3'5' GGGCAGTGAGCGCAACGCATA
TATA3'5' CGCCCCCCTGACGAGCATCAC
AAAAAATC3'5' TCGCCACCTCTGACTTGAGCG
TCGATTTTTT3' -2 5' CGCCCCCCTGACGAGCATCAC
TATGTAT3'5' TCGCCACCTCTGACTTGAGCG
TCATACATA3' -3 5' CGCCCCCCTGACGAGCATCAC
TTAACTT3'5' TCGCCACCTCTGACTTGAGCG
TCAAGTTAA3' -1 5' ACATACGAGCCGGAAGCATAA
AG3'5' TTAGGCACCCCAGGCTTTACA
CTTTATG3' -2 5' ACATACGAGCCGGAAGAAGAT
AC3'5' TTAGGCACCCCAGGCTTTACA
GTATCTT3' -3 5' ACATACGAGCCGGA, AGTGAT
CTT3'5' TTAGGCACCCCAGGCTTTACA
AAGATCA3' The underlined portions at the 3' ends are mutually complementary sequences.

A portion of these synthesized oligonucleotides was subjected to electrophoresis on 20% polyacrylamide containing 7M urea to examine its purity. As a result, the purity was 95% or more, so it was used in the following reaction without further purification.

2ug of each oligonucleotide in an Eppendorf tube
(approximately 130 pmole) of 10x annealing solution (1
00mMTri 5-HCA pH8,0-60mM
MgCj7. -60mM β-mercaptoethanol-500mM NaC1) 5μ! In addition, with distilled water 5
0μ! Adjusted to. This was heated for 10 minutes in a beaker containing hot water at 65 degrees Celsius, and then slowly cooled to room temperature (required time: approximately 1 hour).

In this reaction, the two oligonucleotides form a partial double strand as shown below.

S' CTCTGACACATGCAGCTCCCG
3'1111 3'GGGCCτCTGCCAGτGTCG^^CAG
S” 50ul of this solution! ImM dATP, dG
2μj each of TP and dCTP? Add 5μl of 0.4mM biotinylated UTP (manufactured by BRL), 5μl of 110x annealing solution, and 32μl of distilled water, mix well, and add Klenow fragment of DNA polymerase I (T
16 units (manufactured by OYOBO) were added and heated at 37 degrees for 1 hour to perform an extension reaction.

Then, in order to remove unreacted biotinylated UTP,
The reaction solution was passed through a gel filtration column (Bio-gel P2;
It was purified using Bio-Rad (0.5×5 cm). Most of the target labeled nucleotide was recovered in the fraction that passed through the column.

Collect 0.5 mjJ of each fraction, and
Adsorb μl onto a nitrocellulose filter, and
The color reaction was carried out according to the manufacturer's protocol. The results are shown in Table 4. For the oligonucleotides marked with O in Table 4, the second fraction developed a strong color, confirming that these oligonucleotides were labeled with biotin.

From the above results, the total number of hydrogen bonds in the complementary sequence parts is 13
It has been found that oligonucleotides can be formed by this method as long as the sequence is stable and has a sequence of 1 or more.

Furthermore, when the total number of hydrogen bonds in the complementary sequence part is 13 to 15, some oligonucleotides are formed depending on the base sequence of the complementary sequence part and others are not, so it is generally It can be said that 16 or more is desirable.

〔Effect of the invention〕

As is clear from the above examples, the present invention provides good synthesis yields and fewer by-products. Therefore, a simple purification method was obtained.

Furthermore, a method was obtained that allows genes with a length close to 200 base pairs to be synthesized at once.

Further, the labeled double-stranded oligonucleotide obtained according to the present invention has a short annealing portion and the labeling substance is incorporated into both strands, so that the specific activity of each strand is improved.

Claims (1)

[Scope of Claims] (1) a) A portion of the terminal region of each oligonucleotide has a mutually complementary base sequence part, and the complementary base sequence part is different from one oligonucleotide to the other. a step of synthesizing at least one pair of oligonucleotides whose base sequence portion forms 13 or more hydrogen bonds with the oligonucleotide, b) a step of bonding the pair of oligonucleotides at the complementary base sequence portion, c) ) A method for forming an oligonucleotide, comprising the step of polymerizing a nucleobase onto each oligonucleotide. (2) The method for forming an oligonucleotide according to claim 1, wherein a nucleotide triphosphide and a polymerization reagent are used in the step c). (3) The method for forming an oligonucleotide according to claim 2, wherein the polymerization reaction temperature in step c) is 40°C or lower. (4) The polymerization reagent is E. coli DNA polymerase,
E. Klenow fragment of E. coli DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase,
3. The method of forming an oligonucleotide according to claim 2, wherein the oligonucleotide is a thermostable DNA polymerase or a reverse transcriptase. (5) The method for forming an oligonucleotide according to claim 1, wherein the nucleobase used in step c) is labeled. (6) The method for forming an oligonucleotide according to claim 5, wherein the labeled nucleotide is labeled with a radioactive isotope, a biotin derivative, or a dinitrophenyl derivative. (7) d) The method for forming an oligonucleotide according to claim 1, further comprising the step of separating the oligonucleotide obtained through step c) into single strands. (8) d) The method for forming an oligonucleotide according to claim 5, further comprising the step of separating the oligonucleotide obtained through step c) into single strands. (9) a) A portion of the terminal region of each oligonucleotide has a mutually complementary base sequence part, and the complementary base sequence part is a hydrogen formed by one oligonucleotide and the other oligonucleotide. a step of synthesizing at least one pair of oligonucleotides having a base sequence portion having a bond number of 13 or more; b) a step of binding the pair of oligonucleotides at the complementary base sequence portion; c) adding a nucleic acid to each oligonucleotide. A method for forming a nucleic acid probe, comprising the steps of: d) polymerizing a base; and further separating the double-stranded oligonucleotide obtained through step c) into single strands. (10) A partially double-stranded oligonucleotide in which a portion of the terminal region of each oligonucleotide is linked in a complementary sequence, and the total number of hydrogen bonds between bases in the complementary sequence portion is 13 or more and a partially double-stranded oligonucleotide with a template at each non-binding portion.