JPH03218398A - Polypeptide, dan and its use - Google Patents

Abstract

NEW MATERIAL:A heparin-binding secretory transforming factor (hst-1)-defective mutein. USE:A promoter for therapy of burn and wound and a therapeutic agent for digestive tube ulcer. PREPARATION:For example, RNA is separated from human stomach cancer cells using the guanidine thiocyanate method, etc., and cDNA is synthesized using the separated RNA as a template. The synthesized cDNA is bound to a vector for formation of a cDNA library and the resultant cDNA library is subjected to cloning using a probe consisting of a part of hst-1 base sequence followed by selection of a clone containing DNA capable of coding hst-1. The above-mentioned DNA is separated and the codon of a gene capable of coding an amino acid at the amino terminal of a sequence for defection is changed in order to be bound to a vector. A host is transformed using the resultant recombinant DNA and the obtained transformant is cultured, thus obtaining the objective hst-1-defective mutein.

Description

DETAILED DESCRIPTION OF THE INVENTION The present invention provides a deletion mutein of heparin binding secretory transforming factor (hereinafter sometimes abbreviated as rhst-1j in the present specification) and a method for producing the same. Regarding technology.

Conventional technology hst-1 is sometimes written as HSTF 1 (
M. Yoshida et al., Proc. Na
tl. Acad. Sci. USA, vol.
．． 85, l) I). 4861-4864 (1988
)).

The hst 1 gene is a transforming gene isolated from human gastric cancer tissue [H. Sakamoto et al., Proc.
Natl. Acad. Scitl. s. A.
83: 3997 (1986)), the gene product of which is fibroblast growth factor (FGF), one of the cell growth factors.
) was found to be similar in structure and biological activity to [T
．． Yoshida et al., Proc. Nat
l. Acad. Sci. U. S. A. 84:
7305 (1987), K. Miyagawa et al.
ncogene 3, 383 (198 g)]. In addition, the hst-1 gene is useful not only for gastric cancer, but also for colon cancer, liver cancer,
It was isolated from Kaposi's sarcoma in an AIDS patient [T. K
Oda et al., Jpn. J, Cancer Res
．． (Gann) 78: 325 (1987), t
l. Nakagawa et al., Jpn. J.
Cancer Res. (Gann>78:651(1
987), Y. Yuasa et al., Jpn.
J. Cancer Res (Gann) 78:
1036 (1987), P. Delli Bov
i et al., Cell 50°729 (1987))
, this gene is basic FGF acidic FGF, i
It is thought that it forms the FGF family together with the nt-2 gene product. The gene isolated from Capon's sarcoma is also called K-FGF. Since the hst-1 gene is a transforming gene that functions as a cell growth factor, its gene product, like FGF, has the potential to become a therapeutic agent for damage or prevention.

The nucleotide sequence of the hst 1 gene has already been reported.
[M. Taira et al., Proc.
Natl. Acad. Sci.
U. S.A. 84: 2980 (1987). T
．． Yoshida et al. Proc. Na order 5 Acad. Sci. USA 84. 7305(
1987)), the same report states that the hst
-1 constituent amino acids are also shown.

However, it is thought that there are only 31 naturally occurring hst-1 molecules, and there have been no reports on the acquisition of hst-1 from biomaterials.

On the other hand, production of hst-1 using genetic recombination technology has been reported [P, Delli Bovi et al., C
ell50: 729 (1.987) and K. Mi
Yagawa et al., Oncogene 3:383 (19
88)]. However, even in these cases, mass production is extremely difficult.

Problems to be Solved by the Invention As mentioned above, there are many unknowns regarding the properties and biological activities of hst-. However, it is conceivable that hst-1 may be used as a medicine or reagent.

However, as mentioned above, there has been no example of mass production of hst1 to date.

Therefore, the present inventors used recombinant DNA technology to obtain this hs
We considered modifying t-1 in a manner that does not adversely affect its activity, but allows microbiological mass production. Such modifications may not only increase the production capacity in the cells mentioned above, but also increase the stability of hst-1, increase the cell proliferation activity per molecule, and even activate unknown biological activities. I thought that there is 4.

Means for Solving the Problems The present inventors used recombinant DNA technology to create a mutein gene with a portion of the hst1 gene deleted, and by expressing it in microorganisms, the hst-1 mutein was expressed in cells. Through intensive research into the increase in production capacity and activity within the body, and changes in biological activity, we discovered muteins that meet these objectives. As a result of further research based on these findings, the present invention was completed.

The present invention provides: (1) a deleted mutein of heparin binding secretory transforming factor (hst-1) (2); a recombinant DNA having a base sequence encoding the mutein of (1) above; (3) , a vector (4) containing the recombinant DNA of (2) above
), a transformant carrying the vector of (3) above, and (5) a method for producing the mutein of (1) above, which comprises culturing the transformant of (4) above in a medium.

hst-1, which is the base of the deletion mutein of the present invention, is the first
This is a protein consisting of the 175 amino acid sequence shown in the figure.

hst-1 was described by Taira et al., Proc. N
atl. Δcad. Sci[JSA, s4,
In nso-29s4 (Ms7'), it is shown as consisting of a 206 amino acid sequence.

The amino acid sequence is shown in FIG. However, Del
Ii-Bovi et al.
d Cellular Biology, 8. 293
3-2941 (1988), expressed in monkey COS-1 cells (the target product is called K-FGF).
This indicates that a product with 30 or 31 amino acids removed from the N-terminus is obtained. Therefore, h
The most appropriate mature protein of st-1 has an amino acid sequence (shown in Figure 1) in which 31 amino acids are removed from the N-terminus of a 206-amino acid sequence. It is believed that there is.

Examples of the deletion muteins of the present invention include those in which at least one of the constituent amino acids of hst-1 is deleted and have hst-1 activity.

The deletion mutein is preferably one in which 1 to 47 consecutive constituent amino acids of hst-1 are deleted, and more preferably one in which 1 to 43 consecutive constituent amino acids are deleted <<, 1 to 27 It is preferable to have one missing.

More preferred examples of the deletion type mutin of the present invention include:
Examples include those in which contiguous constituent amino acids from the N-terminus are deleted.

The chemical structure of the deleted hst-1 mutin of the present invention may depend on various factors. For example, the subject muteins may be obtained as acidic, basic or neutral salts. Furthermore, the present mutin may be a derivative with added sugar chain lipids, acetyl groups, etc. The mutin of the present invention is
It is a deleted form of hst-1 and may be the above-mentioned derivative, and any mutein having hst-1 activity is included in the muteins of the present invention.

The biological activity of the deleted hst-1 mutin of the present invention can be measured, for example, by the method of Sasada et al. (Mol.
llBiol. 8: 5 8 8 5 9 4
(198g)), the induction of DNA synthesis in mouse BALB/c3T3 cells was measured using [3H]thymidine incorporation as an indicator, using the method of Tada et al.
RNA of Immunological Me
thods+93+157 (1986)), by measuring the promotion of proliferation of vascular endothelial cells.
Or Auerbach et al.
entalBiology, 4 1, 3 9
(1974)), by measuring angiogenesis in chicken embryo chorioallantoic membrane.

The expression-type hector containing DNA having a base sequence that coats the hst-1 mutein of the present invention can be obtained by, for example, (a) isolating RNA encoding the hst-] protein, and (b) extracting a single-stranded complement from the RNA. DNA (cDNA),
Next, double-stranded DNA is synthesized, (c) the complementary DNA is incorporated into a plasmid, (2) a host is transformed with the obtained recombinant plasmid, (e) the obtained transformant is cultured, The desired DNA is extracted from the transformant by an appropriate method, such as colony hybridization using a NA probe.
(1) Isolate a plasmid containing the plasmid, and extract the desired cloned DNA from the plasmid.
(g) create a desired deletion on the cloned DNA, (h) optionally link an oligonucleotide containing an ATG codon, and (ri) link the DNA downstream of the promoter in the vehicle. It can be manufactured by

RNA encoding hst-1 can be obtained from various human cancer cells, such as gastric cancer, colon cancer, liver cancer, Kabosi sarcoma, human germ cell tumor, and NIH3T3 transformant derived from the human hst-1 gene.

As a method for preparing RNA from human cancer, the guanidine thiocyanate method [J, M. Chirgwin et al., Biochemistry
8 5294 (1979)].

Using the thus obtained RNA as a template, cDNA is synthesized using, for example, the method of llatson and Jackson (Watson, C.J. and Jackson).
n, J. F. , DNA Cloning, a Practical Approach
A Practical Approach) IR L
Press. Oxford, p79. 19
For example, the λ phage vector λgt l according to 85)
O (Huynh, T. V et al., DNA Cloning A Practical Approach, I R L
Press, Oxford, p49. 19
85) and inject this into Escherichia coli, such as C600.
HflA (Huynh. T. V. et al., supra)
can be infected to create a cDNA library.

The thus obtained cDNA library is then processed using a method known per se, such as the plaque hybridization method (Molecular Cloning Col. Maniatis et al.
d Spring] {arbor Laborator
y+ p320. 1982) and DNA Sequencing (Proc. Natl. Acad. Sci
．． LISA 74, 560 (1977), Nucleic Asino's Research (Nucleic
Acids Research) 9, 309
(1981)'] to select the desired phage clone.

The phage clones are then collected, e.g.
Davis et al.'s method (Advanced Bacteri Genetics)
alGenetics). Cold Spring
Harbor Laboratory (1980), extract the phage DNA, excise the cDNA portion using restriction enzymes, and convert it into a plasmid, such as pU.
It is also convenient to use it by re-incorporating it into c13 etc.

The cloned plasmid containing the DNA containing the base sequence encoding hst-1 can be used as is, or if desired, excised with a restriction enzyme.

The cloned gene can be ligated downstream of a promoter in a vehicle (vector) suitable for expression to obtain an expression vector.

In order to produce the mutein of the present invention, in addition to conventional 1l recombinant DNA technology, site-directed mutagenesis technology (Site-directed mutagenesis technology) is used.
is) is adopted. This technique is well known and has been developed by Lather. R.F. and Lecoq, J.P.
, Genetic Enciniaring
Engineering), Academic Press (1983), pp. 31-50. Oligonucleotide-directed mutagenesis was performed by M. Smith (
Smith, M. ) and S. Killam (Gill
am. S. ), Engineering Engineering, Principles and Methods, Plenum Press (1.981) 3
Volume 1-32.

In order to produce a structural gene encoding the mutein of the present invention, for example, (a) one consisting of a single chain of the structural gene of hst1;
hybridize the double-stranded DNA with a mutant oligonucleotide primer; (b) extend the primer with a DNA polymerase to form a mutant heteroduplex;
), and 12 (c) replicating this mutagenic heterodimer.

The size of the oligonucleotide primer is determined by the conditions necessary for stable hybridization of the primer to the gene region to be mutated and by the limitations of currently available oligonucleotide synthesis methods. Factors to be considered when designing Ogonucleotid F to be used for oligonucleotide-directed mutagenesis (e.g., overall size, size of portion that bypasses the mutation site)
is described by M. Smith and S. Gillam (ibid.). Generally, the overall length of the oligonucleotide is such that it optimizes stable and unique hybridization at the mutation site, and the extensions from the mutation site to the 5' and 3' ends are:
The size should be large enough to avoid editing mutations by the exonuclease activity of DNA polymerase. Oligonucleotides used for mutagenesis according to the invention typically have about 12 to about 24 bases, preferably about 14 to about 20 bases, more preferably about 14
1 to about 18 bases. These usually contain at least about 3 bases 3' to the codon that is altered.

There are three possible methods for creating a mutant hst-1 gene when the purpose is to obtain a mutein in which an hst-1 constituent amino acid is deleted. One is hst −
If the amine end of 1 is deleted, the second one is hst-
The central part of hst-1 is deleted, and the carboxyl terminus of hst-1 is deleted.

When deleting the amine terminus, the codon of the gene that coats the carboxyl terminus of the amino acid sequence to be deleted is changed to ATG encoding Met using site-directed mutagenesis, and then Either generate a recognition site for an appropriate restriction enzyme at the end to facilitate ligation with the promoter, or add AT to a gene whose amino terminus has been deleted using a restriction enzyme.
Oliconucleotides with G are ligated in reading frame.

When deleting the central portion of an amino acid sequence, unique restriction enzyme recognition sites are generated at the 5' and 3' ends of the gene encoding the sequence to be deleted using site-directed mutagenesis. By enzymatically digesting and extracting this region, and relinking the gene to its original form, a gene encoding hst-1 lacking the desired amino acid will be created.

Needless to say, at this time, restriction enzyme digestion should be used to prevent reading frames from being crossed.

When deleting an amino acid sequence on the carboxyl terminal side, the codon of the gene encoding the amino acid on the amino terminal side of the sequence to be deleted may be changed to a stop codon by site-directed mutagenesis.

The deletion mutein of the present invention may be one in which a constituent amino acid of hst-1 is deleted, and at least one amino acid therein is substituted with another amino acid.

Examples of the constituent amino acids before substitution include cysteine and things other than cysteine (L-aspartic acid, arginine).

15 When the constituent amino acid before substitution is cysteine, the substituted amino acid is preferably, for example, a neutral amino acid. Specific examples of the neutral amino acids include glycine, parine, alanine, leucine, inleucine, tyrosine, phenylalanine, histicine, tryptophan, serine, threonine, and methionine. Particularly preferred are serine and threonine.

When the constituent amino acid before substitution is other than cysteine, the substituted amino acid may be, for example, in terms of hydrophilicity, hydrophobicity, or charge of the amino acid.
Choose an amino acid that has properties different from those of the amino acid before being substituted. Specifically, when the amino acid before substitution is aspartic acid, examples of the amino acid after substitution include asparagine, threonine, valine, phenylalanine, and arginine, with asparaquine and arginine being particularly preferred.

When the amino acid before substitution is alkynine, examples of the amino acid after substitution include glutamine, 16-threonine leucine phenylalanine, and aspartic acid, with glutamine being particularly preferred.

When producing the deletion mutein of hst-1 of the present invention by site-directed mutation, it is possible to make multiple mutations in the DNA sequence, that is, the codons of the DNA corresponding to amino acids are degenerate. You have to be aware that there is.

For example, when the constituent amino acid is an amino acid other than cysteine and the purpose is to obtain a mutein in which this amino acid is substituted with another amino acid, the method for creating a mutant hst-1 gene is to use an oligonucleotide primer in the same manner as for cysteine. Make codon changes.

It goes without saying that the tezyne of the oligonucleotide primer differs depending on whether the amino acid is changed or not.

The primer is M l 3 [Yanisch-Perror
, CVieira, J. Messing+
Scene (Gene). 3 3 1 0 31 1
9 (1985), Messing J. Me7
7's Methods in Engineering
Enzymologil101 20-78(1
983)] fd [R. H errman et.
al Molecular and General Genet. (Mol. GenGenet.), 1.
77 231 (1980)], or φ×1 74
CM. Smith and S. Gilla
m, Shenetinok ● Engineering (Geneti
c Engineering) Plenum Pre
ss, Vol. 3+pl)l 32 (1981)). It is recognized that phage can carry either the sense or antisense strand of a gene. When carrying a phage or antisense strand, in addition to the mismatch with this codon that determines the triplet coded for another amino acid, the primer is identical due to codon degeneracy to the region of the sense strand that contains the fudon to be mutated. There may be cases where this is not the case. Similarly, when transporting the sense strand, other than the appropriate mismatch in the triplets that pair with the codon to be deleted,
It may not be complementary to the region of the sense strand that contains the codon that is mutated. The conditions used for hybridization are described by M. Smith and S. Gillam (supra).

Temperatures usually range from about 0'C to 70°C and generally from about 10'C to 50°C. After hybridization, the primer is E. coli DNA polymerase 1, T4D
The resulting dsDNA, which is extended with phage DNAJ2 by reaction with NA polymerase, reverse transcriptase or other suitable DNA polymerase, is converted into a closed circular dsDNA by treatment with a DNA ligase such as T4 DNA ligase.
Converted to A. A DNA molecule containing a single-stranded region is S
can be destroyed by endonuclease treatment.

The resulting mutagenized heterodimer is used to transform a competent host organism or cell. Replication of the heterodimer by the host produces progeny from both strands. Following replication, the mutant gene is isolated from the progeny of the mutant strand, inserted into a suitable vector, and this vector is used to transform a suitable host organism or cell.

]9 Next, phage DN carrying the mutated gene
A is isolated and incorporated into a plasmid.

A plasmid into which DNA can be incorporated is, for example, I) BR322 [gene. 2,
95 (1977)], pBR325 [Gene, 4.
, ]. 2 1 (1 9 7 8)], pUc +
2 [Jean. 19.259(] 9 8 2)]. pU
C l 3 [Scene, 19, 259 (1982),
pUB110 derived from Bacillus subtilis [Biochemical Biophysical Research Communication (Bioc
chemical and biological
lResearch Communication)
．． -1-12, 678 (1983)], but any other species can be used as long as it can be replicated and maintained within the host.

As a method for incorporating into plasmids, for example, T.
Maniatis et al. Molecular cloning (
Molecular Cloning) Coult Spring Harbor Laboratory (Cold
S spring H arbor L abora
239 (1982).

20 The cloned gene can be ligated downstream of a promoter in a vehicle (vector) suitable for expression to obtain an expression type recombinant vector.

Vehicle (vector) for creating silk replacement vector
For example, the plasmid pBR3 derived from E. coli
22. [gene, 2. 95 (1!
177) E,pE3 R 3 2 5 [scene,
4, 121. (1978)]. I) U C 1
2 [Gene, 19, 259 (1982)].
pUC 1 3 [Gene, 19, 259 (198
2)]), pUB110 derived from Bacillus subtilis [Biochemical Biophysical Research Communication (
Biochemical and Biophysics
alResearch Communication),
112. 6678 (1983)] pTP5,1
)C194), yeast-derived plasmids (e.g., pSH19,
psH15), bacteriophages such as λ phage, and animal viruses such as retroviruses and vaccinal viruses.

The gene has AT at its 5' end as a translation initiation codon.
G, and a T as a translation stop codon at the 3' end.
It may have AAXTGA or TAG. Furthermore, in order to express the gene, a promoter is connected upstream thereof. The promoter used in the present invention may be any promoter that is suitable for the host used for gene expression.

In addition, when the host for transformation is a bacterium of the genus Eschewahia, trp promoter, lac promoter, r
ecA promoter, λpL promoter, σpp promoter, T7 promoter, etc., or if the host is Bacillus, SP○1 promoter, SP○2 promoter, l)enP promoter, etc., if the host is yeast, P H 0 5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferred. In particular, it is preferable that the promoter is a trp promoter or a T7 promoter when the host is a strain of the genus Enerychia.

When the host is an animal cell, SV40-derived promoters, retrovirus promoters, etc. may be used, and SV4Q-derived promoters are particularly preferred.

A transformant is produced using the hector containing the DNA thus constructed.

Examples of the host include bacteria of the genus Escherichia, bacteria of the genus Bacillus, yeast, and animal cells.

Examples of the above-mentioned members of the genus Escherichia include Escherichia coli K l
2D H 1 [Proc. Natl. Acad
．． Sci. USA, 60+ 1 60 (196
August, MIo3 [Nucleic Acids Ichino Search, (Nucleic Acids Re
search) 9,309(] 98 1)], JA2
2 1 [Journal of Molecular Biology
Bio1ology) No. 20,517 (197 8)],
HB 1 0 1 [Journal of Molecular
Biology, Sat↓, 4 5 9 (1 9 6 9)]
, C600 “Genetics”
, 39, 440 (1954)].

Examples of the Bacillus genus include Bacillus subtilis M I
1 1 4 [(Gene, 74, 255 (1 983
)], 207-2 1 [Journal of Biochemistry
of Biochemistry) 9 5. 8
7 (1 9 8 4)].

Examples of the yeast include Saccharomyces cerevisiae.
siae) AH22R-. NA87-11A, DKD-
Examples include 5D.

As animal cells, cell lines
) is preferred, for example monkey cell COS-7 [cell (c
ell), 23, 157 (1981)], V
ero Chinese hamster cells CHO, mouse L
Examples include cells, human FL cells, and the like.

To transform the Escherichia bacteria mentioned above, for example, P
roc. Natl. Acad. Sci. U
SA, 692 1 10 (1 972), Gene, 17
, 107 (1982).

To transform Bacillus bacteria, for example, Molecular and General Genetics (Mole
cular & General Gene
tics), 24 168,] 1 1. (1979).

To transform yeast, e.g.
．． Acad. Sci. USA 75:l92
9 (1978).

To transform animal cells, e.g.
(Vjro1ology) 52, 456 (1973).

In this way, the deleted mutein cDNA of hst-1
A transformant is obtained that is transformed with a vector containing the vector.

When culturing a transformant whose host is a bacterium of the genus Escherichia or Bacillus, a liquid medium is suitable as the culture medium, which contains carbon sources necessary for the growth of the transformant, Nitrogen sources, inorganic substances, etc. are contained.

Examples of carbon sources include glucose, dextrin,
Soluble starch, sucrose, nitrogen sources include ammonium salts, nitrates, corn steep liquor,
Inorganic or organic substances such as peptone, casein, meat extract, soybean meal, and barley acetate extract; examples of inorganic substances include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. Further, yeast extract, vitamins, growth promoting factors, etc. may be added.

The pH of the medium is preferably about 6-8.

As a medium for culturing Escherichia bacteria, for example, M9 medium containing glucose and casamino acids [Miller
, Journal of Experiments in Molecular Genetics
Experiments in Molec
ularGenetics), 4 3 1 -4 3
3, Cold Spring Harbor
Laboratory, New York 1
9 7 2)] is preferred. If necessary, a drug such as 3β-indolyl acrylic acid can be added to make the promoter work efficiently.

The host is good. +7 In the case of Hyacia spp., the culture is usually about 15
It is carried out at ~43°C for about 3 to 24 hours, and aeration and stirring can be added if necessary.

If the host is Bacillus spp., the culture is usually about 30-40'
C for about 6 to 24 hours, and aeration and stirring may be added if necessary.

When culturing a transformant whose host is yeast, the medium may be, for example, Burkholder.
r) Minimal medium [Bostian, K. L
．． et al. Proc. Natl. Acad. Sc
i. USA, 7 7,4505 (1.980)]. Preferably, the pH of the medium is adjusted to about 5-8. Culture is usually about 20'C to 35°C and about 24 to 72°C.
Wait for a while and add aeration and stirring as necessary.

When culturing a transformant that is a host or an animal cell, the medium used is MEM medium [Science (3 science)
above λt, 50 1 (1 952)]. DMEM medium [Virology, 8,396 (1
959) Ko, RPMl 1640 medium [Journal of the American Medical Association (
The Journal of the Ame
rican Medical Association
) 199, 519 (1967)] 199 Medium [Proceedings of the Society 27 Yeti for the Society (1967)]
Proceeding or the Soci
ety I'orthe Biological
Medicine) 73.1 (1950)]. About 5 to 20% fetal bovine serum may be further added to this. Preferably, the pH is about 6-8. Cultivation is usually carried out at about 30 to 40'C for about 15 to 60 hours, with aeration and stirring added as necessary.

The hst-1 deleted mutein can be isolated and purified from the above culture, for example, by the following method.

When extracting the deleted mutein of hst-1 from cultured bacterial cells or cells, collect the blank cells or cells by a known method after culturing, and suspend them in a buffer containing a protein denaturing agent such as guanidine hydrochloride. A method of eluating the target protein out of the blank body using a French press, M3 sonication, lysozyme, and/or freezing and thawing to destroy the bacterial cells or cells, followed by centrifugation to extract the deleted mutein of hSt-1. You can use any method to obtain it as appropriate. Above all,
A method in which lysochye 1.28 and ultrasonic treatment are used in combination is preferred.

In order to purify the deleted mutein of hst-1 from the above-mentioned two-natant solution, separation and purification methods known per se can be appropriately combined. These known separation and purification methods include methods that utilize solubility such as salting out and solvent precipitation methods, dialysis methods, ultrafiltration methods, gel filtration methods, and SDS-
Methods that mainly utilize differences in molecular weight such as polyacrylamide Kel electrophoresis, methods that utilize differences in charge such as ion exchange chromatography, methods that utilize specific affinity such as affinity stomatography, and reverse Examples include methods that utilize differences in hydrophobicity, such as phase high-performance liquid chromatography, and methods that utilize differences in isoelectric points, such as isoelectric focusing.

More specifically, by subjecting the above supernatant to ion exchange chromatography using DEAE cellulose as a carrier, contaminating nucleic acids, acidic proteins, etc. can be removed. For example, it is effective to apply a clear solution to a DEAE cellulose ram equilibrated with a near-neutral buffer such as Tris and collect the fraction that passes through. In addition, by further applying ion exchange chromatography using CM cellulose as a carrier, the deleted mutein of hst-1 can be adsorbed onto the carrier, and purified by elution using a salt solution. .

The deleted mutein of hst-1 can be purified directly from the bacterial cell extract by column chromatography using an acidic resin such as CM Sephadex. For example, the supernatant may be equilibrated with a weakly acidic buffer (e.g., phosphate buffer)
This can be carried out efficiently by applying it to an M-cellulose column. After washing the column with the same buffer, the deleted mutein of hst-1 can be eluted by eluting the column with a buffer that further contains salt (eg, NaCl). After dialysis, these eluates were
Can be freeze-dried.

It is convenient to apply the affinity stomatography method using Hebarin-Sepharose as a carrier to the deleted mutein of hst-1 in an E. coli extract as a purification method for the deleted mutein of hSt=1. . For example, hst1 can be deleted by applying the above eluate to a heparin-Sepharose column equilibrated with a near-neutral buffer such as Tris or phosphate, washing thoroughly, and performing linear gradient elution with Nacl. It is possible to refine type muteins.

In particular, hepan columns developed for high performance liquid chromatography (e.g. Shodex AF-p
akH R・894, manufactured by Showa Denko, etc.) are effective.

Similar to the heparin sepharose column described above, the sample was applied with a near-neutral buffer solution, washed thoroughly, and then linear gradient elution with Nacl was performed. It can be recovered as

The specimen thus obtained can also be made into a dry powder by dialysis and freeze-drying. Furthermore, it is preferable to add serum albumin or the like as a carrier for storage, since this can prevent the sample from adsorbing to the container.

Furthermore, the coexistence of a small amount of a reducing agent during the purification process or storage process is suitable for preventing oxidation of the sample31. Examples of reducing agents include β-mercaptoethanol, dithiothreitol, and glutathione.

In this way, a substantially pure deleted mutein of hst-1 is obtained that is substantially free of pyrogens and endotoxins. Substantially pure hst- of the present invention
1 deletion type mutin has hst as protein content.
-1 deletion type mutin is 95% (w/w) or more, and hst-1 deletion type mutin is more preferably 98% (w/w) or more.

The polypeptide may have Met at its N-terminus.

The activity of the hst-1 deleted mutein thus produced can be measured by the known effect of promoting proliferation of BALBA/c3T3 cells.

In cells genetically infected or transformed with the DNA of the present invention, a large amount of hst-1 deleted mutin can be produced even in various cells that originally synthesize only a small amount of hst-1 deleted type or not at all. hst-] can be advantageously introduced.

The expression plasmid 1- containing the gene encoding the deleted mutein of hsL-1 of the present invention can be introduced into various cells to cause the cells to produce the deleted mutein of hst-1. Therefore, it is possible to obtain a large amount of deleted muteins of hsL-1.

The deleted mutein of hst-1 produced here has an activity to promote proliferation of cells such as vascular endothelial cells and an action to promote angiogenesis, and has low toxicity, so it can be used to promote healing of burns, wounds, post-operative tissues, etc. It can be used as a therapeutic drug. Moreover, it can be used as a reagent for promoting cell culture.

In order to use the hst-1 deletion mutein of the present invention as a medicine, it can be used as a powder as it is or in a pharmaceutical composition (with other pharmacologically acceptable carriers, excipients, and diluents).
e.g., injections, tablets, capsules, liquids, ointments),
It can be safely administered parenterally or orally to warm-blooded mammals (eg, humans, mice, rats, hamsters, rabbits, dogs, cats).

Injection preparations are carried out in a conventional manner using, for example, physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as tablets and capsules can also be prepared according to conventional methods. Furthermore, when producing pharmaceutical compositions such as injections, liquids, tablets, and 8 capsules, they are carried out under aseptic conditions.

When the HST-1 deletion type mutin of the present invention is used as the above-mentioned medicine, for example, the above-mentioned warm-blooded animal may be administered at a daily dose of about 1 ng, considering the administration route 1 and symptoms.
An appropriate amount is selected and administered from 100 μg/kg to 100 μg/kg.

Furthermore, when the hst-1 deleted mutin of the present invention is used as a reagent for promoting cell culture, about 0.01 to 10 μg per 1Q of medium, more preferably about 0.1
It is preferable to add it to the medium in an amount of ~10 μg.

The mutein of the present invention exhibits excellent cell growth-promoting activity and is stable under acidic conditions, so it can also be used as a therapeutic agent for ulcers, such as ulcers in the gastrointestinal tract.

In the specification and drawings of the present invention, when bases, amino acids, etc. are indicated by abbreviations, l IJPAC, -1tJ B
Commision on Bioche
It is based on the abbreviation based on the mical culture or the abbreviation commonly used in the field, and examples thereof are shown below. Furthermore, if an amino acid has optical isomers, unless otherwise specified, the L-isomer is assumed to be indicated.

DNA: Deoxyribonucleic acid cDNA ・Aiura's deo-bovine siribonucleic acid A ・Adenine T: Thymine G: Guanine C: Cytosine RNA: Ribonucleic acid dATP Deoxyade/syn tril-onucleic acid dTTP
: Deoxythymidine triphosphate dGTP : Deoxyguanosine triphosphate dcTP : Deoxycytidine triphosphate 35 ATP Tdr EDTA SDS Gly Ala Val Leu lie Ser Thr cyS Met Glu Δsp 1-yS Arg His Phe Ty r athenosine triphosphate: thymidine: Ethylenecyaminetetraacetic acid codedole/sodium sulfate green alanine parine leucine isoleucine Serine: Threonine: Cysteine: Methionine: Glutamate Aspartic acid Lysine Al-Bovine: Histidine: Phenylalanine Tyrosine 36 Trp Nitryptophan Pro Proline Asn: Asuno Shragin Gln: Glutamine The transformants obtained in the examples described below have been deposited with the Fermentation Research Institute (IFO), and have been submitted to the Institute of Microbial Technology (FRI), Agency of Industrial Science and Technology, Ministry of International Trade and Industry under the Budapest Treaty. It has been deposited as a deposit under. The accession number and date of accession are shown in Table 1 below.

(Margins below) The present invention will be described in more detail with reference to Examples below, but the present invention is not limited thereto.

The mutein in which amino acid number 27 is deleted from the N-terminus obtained in the following examples is referred to as hst-1 mutein N27, and its amino acid sequence is shown in FIG.

Example 1 a) Construction of expression plasmid Plasmit pKOc5 containing human hsL-1 cDNA (
Proc. Natl. Acad. Sci. US
A 84. 2980-2984 (1987)) Hi
cut with E. The DNA was blunted by E. coli DNA polymerase I Klenow fragment reaction. A BamHI linker was ligated here by T4 ligase reaction, and then cut with BamHI-S tyl to give 0.49
A kb DNA fragment was obtained. Synthetic oligonucleotide 5
'TATGCCGGTGGCAGCGCAGCC3' and 5'CTTGGGCTGCGCTGCCACCGG
CA3' was ligated to the 5' end of the above 0.49 kb DNA to obtain a 0.5 1 kb Ndel39 BamHI DNA fragment (start codon ATG Hi).
Nucleotide No. of hst-1 cDNA. 4.13
~916) was transformed into the canine intestinal expression vector pET3c (Gene
56, 125-135 (1987))
-BamH I to obtain pTB1051 (
Figure 4).

b) Expression of cDNA in the large intestine λ phage DE3 (Studie
r, F. ! I. et al J. Mol. Biol.
189: 113-130 (1986)) was lysogenized, and the plasmid pLysS carrying the lysozyme gene of T7 phage (Studier, F. W. et al. J. Mol. Biol. 189: 113-
130 (1986)) and E. coli MM 2 9
4 (D E 3 )/pLysS strain was created.

The plasmid pTB]051 obtained in (a) above was transformed into this Escherichia coli MM 2 9 4 (D E 3 )/pL
ysS strain and E. coli MM294(DE3)/pl
, ysS, pT B 1051 (IFO 1495
2 FERM BP2621) was produced. Contains 10 μg/Wei Kuro 40 Ramphenicol, 35 μg/Wei Anpinlin
7 medium and when the K Iett value was about 120,
Isopropyl β-D thiogalactopyranoside (I PT
G) was added to a final concentration of 0.4 mM, and the culture was continued for an additional 4 hours. Bacterial cells were collected by centrifugation, washed with water-cooled phosphate buffered serine (PBS), and then recollected and stored at 20°C until use.

C) Purification of recombinant hst-1 mutin lQliter
The cells collected from the culture were cooled in water at 250 °C at 10,mM T.
ris-HCf2 (pH 7.4), 10mM E
DTA, 0.5M NaCI2.1 0% sucrose, lm
Suspend in MPMSF and add egg white lysozyme to 0. 5 m
g/kura. 37 after being left in water for 1 hour
Incubate at °C for 5 minutes and sonicate under water cooling (
Centrifuge (SORVALL, 1
8Krpm, 30min, 4°C) to obtain a soil serum, which was used as a bacterial cell extract.

Bacterial cell extract 250 sterilized with 20mM Tris-HCQpH
Q Sepharose (Pharmacia) column (5 x 5 cm diameter) equilibrated with 7.6, 0.5 M NaC (solution)
The nucleic acid components in the extract were removed. Flow-through from the column and 20mM Tris-HC
Q. ．． The column washing solution with pH 7.6, 0.5M NaCQ solution was combined and collected (450 fractions passed through Q Sepharose). This fraction was added to heparinized column Shodex.
A Fpak HR 2094, (2cml DX2
5 cm, manufactured by Showa Denko). Column, 20m
MTris-HCQ pl{ 7.6 solution, then 20
mMTris-HCρ pH7.6.0.5M NaC
(!After washing with solution, 20mM Tris-HCQ p
H7.6, Bat 77, 0.5M to 2M(7)N
aC(2(7) linear gradient elution
ient elution, ] 80 min, flow rate 6.0 k/min).

The elution pattern is shown in FIG. In Figure 5, the vertical axis is the absorption value of ○D 280 and the NaC in the gradient.
(1 concentration is shown. The horizontal axis shows the fraction number. Gradient elution was started at timeO.

Fractions were collected every 0.75 minutes. Table 2 shows the specific activities of these proteins and the amount of hst-1 mutein recovered.

In addition, SDS-PAG of each fraction that gave a peak
E (12.5% polyacrylamide gel) is shown in FIG.

Table 2 Crude extract 2530 3.8
QI! Manyosu passing through fraction 2240
5.2 Heparin Lamb Elution Fraction (47-60)
6.5d) Approximately half of the elution fraction #56 (300 μg of protein) from the reversed-phase C4H PLC column was transferred to a reverse-phase C4 column (VYDAC
) The elution pattern was examined by applying a linear concentration gradient from 0% to 90% acetonitrile in the presence of 0.1% TFA. Flow rate 1 jaw/min. , with a gradient time of 60 minutes (Figure 7). SDS-PAGE (125% polyacrylamide gel) of the peak fraction detected at 36 to 37 minutes is shown in FIG. 8 together with fraction 56 eluted from heparin column 43.

In addition, in FIG. 8, 1 is a molecular weight marker (50
ng), 2 is fraction 56 (50 ng) eluted from the Heparin 7 HPLC column, 3 is Heparin HPLC.
Fraction 56 (100 ng
), 4 is the reverse phase HPLC elution fraction (50 ng
), 5 is 12 of the reverse phase HPLC elution fraction (100 ng)
．． The patterns of 5% polyacrylamide gel electrophoresis are shown. Furthermore, the specific activity of these proteins is 0 when recombinant human bFGF (rhbFGP) (European Patent Publication No. 237,966) is taken as 1.00.
．． It was measured as 43. Changes in specific activity during these purification processes,
and hst-]mutein N27 recovered are shown in Table 3. In Table 3, the specific activity is defined as 1 for the activity of bovine pituitary gland-derived FGF (manufactured by Takara Shuzo).

In this way, h having the amino acid sequence shown in FIG.
st-1 mutein N27 was obtained.

44 e) Biological activity The activity of hst 1 mutein was determined by the method of Sasada et al.
ada et al., Mol. Cell Bio1.
8: 588-594 (198g)) to induce DNA synthesis in mouse BAL B/c3 T3 cells [
The incorporation of 3H]thymidine was measured as an index. The results are shown in Table 2 above.

Example 2 (Promotion of vascular endothelial cell proliferation) The effect of hst-1 mutein N27 obtained in Example 1 on cell proliferation was measured as follows. The cells used in this assay were venous vascular endothelial cells (hereinafter referred to as HUVE cells) isolated from human umbilicus.

In addition, to measure the degree of cell proliferation, the MTT method described below is used. ，
The Say method was used.

The method of MTT assay is the method of Tada et al.
Methods), 93, 157 ('1986)] with some modifications.

That is, the HUVE cells that have been passage-maintained are 0002%E.
DTA (manufactured by Dojindo Chemical Co., Ltd., 345-01882)
Dissociated into single cells using a 0.125% tribucin enzyme solution (manufactured by Boehringer Mannheim) containing GIT containing 2.5% fetal bovine serum (manufactured by Whitaker Hyoproducts). Culture medium (Nippon Pharmaceutical Co., Ltd., 398
-00515) in HUV E cell culture medium. The number of cells contained in this cell suspension was calculated using a Coulter cell counting machine (Coulter, Model ZM).
It was subjected to the following culture. Add a 100 μC HUV E cell suspension containing 2×103 HUVE cells to a 96-well culture dish (Nunc, F96) and culture at 37°C using a Hitachi carbon dioxide gas-nitrogen gas controlled culture machine CH-16. type, co
2: 5%, O: 7%).

On the next day of culture, each sample was prepared using HUVE cell culture medium, and 100 μρ of each sample was added to HUVE cells cultured in a 96-well culture dish.

The sample used for the test was ■hst-1 mutein N
27 as the final concentration, O. O O 4 ng/extremely 2.
One prepared to give O ng/J was used.

(2) Heparin (manufactured by Sigma) was further added to Doki hst1 mutein N27 at a final concentration of 5.0 μg/unit. After adding each sample, culture was continued for 3 days, and the culture medium was removed from the culture dish.
mg/kura MTT reagent (manufactured by Dojindo Chemical Co., Ltd., 341
Add 100 μQ of HUVE medium containing 01823) and
It was kept warm at 7°C for 4 hours. Then, add 10% SDS aqueous solution (Wako Pure Chemical Industries, Ltd., 191-07145) to 100μ
ρ was added and kept warm for 4 hours. After the reaction was completed, the 96-well culture dish containing the reaction solution was shaken, and the absorption of the reaction solution at a wavelength of 590 nm was measured using a microtiter plate absorbance measuring device (manufactured by Titertech, MCC341). The results obtained are shown in FIG.

In FIG. 9, the horizontal axis indicates the concentration of hsl-1 mutein N27 added to the culture solution of vascular endothelial cells.

The vertical axis shows the S
It is the absorbance at a wavelength of 590 nm of the solution measured after solubilizing the reaction product with a DS solution,
The amount corresponds to the cell amount. hst-1 mutein N27
The solid line (■) indicates the case where the compound is added alone, and the hst of each concentration is
The case where heparin was added to the -1 mutein N27 is shown by the broken line. Thus, the hst1 mutein N27 did not show cell proliferation promoting activity against HUVE cells alone within the range of concentrations studied, and when coexisting with 5.0 μg/year of heparin, HUV E Promoted cell proliferation.

Example 3 (CAM Assay) The hst-1 mutein N27 obtained in Example 1 was analyzed using CAM (Chorio Allantois Me
mbrane) assay was performed. The method for the CAM assay is Auerbach's method.
al Biology), 41, 391 (1974)
] with some changes. That is, fertilized chicken eggs were incubated in an incubator at 37°C for 3 days, the eggshells were removed, and the eggs were incubated at 37°C for another week (using Napco carbon dioxide incubation 48-6300, Co: Q%). , H, O saturation). A polypropylene disk with a diameter of 6 mm was coated with various concentrations of HST-] mutein N27 (20 mM of hsL-1 mutein N27), lithium-hydrochloric acid (pH 7./l), 1
, dissolved in a buffer solution consisting of the composition of OMNaCQ)
200 ng and 50 ng, air-dried in a clean bench, and then added to chicken chorioallantoic membrane (CAM).
) and further incubated at 37°C for 3 days to observe the state of blood vessel formation. Also, hst − 1
An aqueous solution of heparin (manufactured by Sigma) was spotted at a concentration of 10 μg on the mutein N27 solution, and as a control, a solution containing an equal amount of bovine serum albumin (manufactured by Sigma) without hst-1 mutein N27 was spotted. After air drying in the same manner, a sample was prepared by placing it on the chorioallantoic membrane. The results obtained are shown in Table 4. Angiogenesis was observed with hst-1 mutein N27200 ng alone. When heparin was used in combination, angiogenesis was observed not only with 27200 ng of hst-1 mutein N2 but also with 50 ng. However, almost no angiogenesis was observed with buffer alone and heparin alone.

Table 4 Positive rate of CAM assay (numerator: number of positives, denominator Example 4 (amino acid composition) Purified protein (14 μg) of hst-1 mutein N27 obtained in Example 1-d) was tested for glass hydrolysis After adding 200 times the amount (v/w) of constant boiling point hydrochloric acid containing 4% thioglycolic acid to a tube and sealing the tube under reduced pressure,
Hydrolysis was carried out at 0°C for 24 hours.

After hydrolysis, the tube is opened, hydrochloric acid is removed under reduced pressure, and the residue is reduced to 0.
．． It was dissolved in 02N hydrochloric acid and amino acid analysis was performed using a high-speed amino acid analyzer model 835 manufactured by Hitachi, Ltd. Note that cystine and cysteine were not measured. The number of residues of each amino acid was calculated and the results are shown in Table 5.

The number of amino acid residues shown in Table 5 matched extremely well with the amino acid composition of hst-1 mutein N27 deduced from the base sequence of the cDNA.

Table 5 Amino acid hst-1 mutein N27 Measured values for estimated hst-1 mutein Amino acid set Glu/inN27
Gln Ser Gay His Atg Thr Ala Pro Tyr Val Met H-Cys I1e 10,3 10,8 15.5 34 10.1 6.0 12 95 5.8 9,2 2.7 Leu 14-. 4
15Phe 8.3
9Trp
Example 5 (Amine-terminal amino acid sequence and carboxyl-terminal amino acid residue) 28 μg of the purified protein of hst-1 mutein N27 obtained in Example 1-d) was analyzed using a gas phase protein sequencer (Applied Biosystems Inc.
．． Amino acid sequence analysis of the N-terminus was carried out using a model 470A (manufactured by Mimaki, Inc., Model 470A). The generated phenylthiohytantoin-amino acid (PTH-amino acid) is prepared by Micropak
It was identified and quantified using an sp-C-18-3 column and a high-performance liquid chromatograph manufactured by Varian. The results are shown in Table 6. From this result, the amino acid sequence of the amino terminal portion of hst-1 mutein N27 was consistent with the sequence expected from the DNA base sequence of the expression plasmid. It was also found that methionine derived from the translation initiation codon was removed.

Furthermore, as a result of examining the amino acid residue at the carboxyl terminal using the hydrazine degradation method, leucine, which was predicted from the cDNA sequence, was detected.

Table 6 PTH - Amino acids Val 345 Ala 409 Ala 418 Gln 321 Pro 236 Lys 211 Glu 172 Ala 216 Ala 320 Val 177 Gin 153 Ser 38 Gly 108 Ala 124 Gly 140 Asp 116 Tyr 105 Leu II3 Leu 182 Example 6 (purified hst - DN of 1 mutein N27
A synthesis-inducing activity) DNA of the purified hst-1 mutein N27 obtained in the previous Example 1-c) for mouse BALB/c3T3 cells
The synthesis-inducing activity was examined by the method described in Example 1-e), and the results are shown in FIG.

In Fig. 10, 1 row shows the results of FGF derived from bovine pituitary gland, 101 shows the results of hst-1 mutein N27, and 1△1 shows the results of hst-1 mutein N27 in the presence of hevarin (50 μg/Tn1). The results are shown below. From FIG. 10, it was revealed that hst-1 mutein N27 had an activity similar to that of bovine pituitary gland-derived FC;F (manufactured by Takara Shuzo) and did not exhibit heparin dependence.

Example 7 (Cell growth promoting activity of purified hst-1 mutein N27) DMEM medium (Flo
BALB/c3T3 cells were sown in a Linbro dish (manufactured by Flow) using a DMEM medium supplemented with 0.5% FCS, and the sample was added at the same time. The number of cells was counted after 3 days and shown in FIG.

In Figure 11, 1●- is hst-1 mutein N27
The results of
The results for hst-1 mutein N27 in the presence of each are shown. From Figure 11, hst-1 mutein N27
was found to have cell growth-promoting activity, and that this activity was enhanced by the addition of heparin.

Example 8 (Stability under acidic conditions) Example 1-c
hst-1 mutein N27 (Iμg/d) obtained in )
and rhbF G F were respectively placed at pH 4.0 and 37°C, and the residual activity was measured over time by the method of Example 1-e), and the results are shown in FIG. 12.

In Figure 12, 101 is hst-1 mutein N27
---[]1-1 shows the results of bFGF. Furthermore, in FIG. 12, the activity at the start of incubation is expressed as 100%. From this result hs
The t-1 mutein N27 was found to be more stable than bFGF under acidic conditions.

Example 9 (Transforming activity of hst-1 mutein N27) Hst-1 mutein N27 Long/Long in mouse B
When added to ALB/c3T3 A3 1 cells and cultured, remarkable morphological changes resembling transformed cells were observed. Furthermore, when heparin (25 μg/m) was added at the same time, a similar morphological change was observed at 271 ng/hst-]mutein N2.

Furthermore, it was revealed that hst-1 mutein N27 has colony-forming activity on soft agar media. That is, 10% FCS-DME containing 0.5% agar (Batato Agar, Difco) was prepared using linbro dish.
BALB/c3T3 A31 on top of M medium 0.5-
A 0.3% agar medium in which 103 cells were suspended was overlaid.

At this time, hst-1 mutein N27 100-10
When 00 ng/IRfl is added to an agar medium and cultured in a CO incubator, it becomes 0.5 to IRfl after about 2 weeks.
Colony formation was observed at a frequency of X10-'.

56 Example 10 (Effect on binding between bFGF and receptor) The hst-1 mutein N27 of the present invention is highly homologous to bFGF. bFGF has receptors in several cell lines, and its cell proliferation activity is expressed. The binding of bFGF to its receptor in cells is inhibited by the hs of the present invention.
We investigated whether t-1 mutein N27 inhibits this. bF
Binding experiments between GF and receptors were carried out using another cell growth factor (TG
[Methods in Enzymology] using the binding experiment method of F-B)
Molology), 146, 167 (1987)].

Rat C6 glioma cells (purchased from Inu Nippon Pharmaceutical) were used as target cells. As the radiolabeled bFGF, iodine-labeled bovine bFGF manufactured by Amersham was used.

As a control, recombinant human bFGF (rhb
FGF) was used. Culture C6 glioma cells in a 24-well culture plate, remove the culture medium, and add buffer for binding experiments (Eagle MEM medium, 25mM HEP).
E S (pH 7.5), 0.15% gelati
n, 5. 0 μg/7n Ildextran s
ulfate) was added. 1.7KBq iodine label b
F G F and various concentrations of hst-1 mutein N27
Alternatively, rhbF GF was added as a control, the amount of the reaction solution was set to 300 μg, and the reaction was carried out at 4° C. for 3 hours. After the reaction was completed, the reaction solution was removed, washed with Hank's balanced salt solution, and washed with 0.5% Triton-X1.
Cell membranes were solubilized with 0.0 solution, and the radioactivity contained therein was measured using a gamma dosimeter manufactured by Aloka. A large excess of rhbFGF 4.0μg/
The radioactivity when +d coexisted was determined separately, and the value was used as the amount of non-specific binding and was subtracted from the amount of radioactivity obtained previously to calculate the amount of specific binding. The concentration of rhbFGF was calculated by dividing this specific binding amount by the specific radioactive activity of the radiolabel, and the number of cells used in the reaction was separately counted using a cell counting machine (Coulter Counter Model ZM). It was quantified to determine the amount of rhbF GF bound per cell. The results obtained are shown in FIG. In Figure 13, the horizontal axis represents hst-1 added to the reaction solution in the binding experiment.
mutein N27, as well as rhbF added as a control.
The concentration of GF is shown. The vertical axis was calculated from the amount of radiolabeled rhbFGF measured after the reaction. The amount of rhbFGF binding (femtomole (fmol)) per 106 cells used in the reaction is shown. The amount is rhbF
It corresponds to the binding amount of rhbF GF to the GF receptor. The case where hst-1 mutein N27 was added is shown by a solid line, and the case where rhbFGF was added is shown by a broken line.

As is clear from FIG. 13, the hst-1 mutein N27 of the present invention did not exhibit any effect of inhibiting the binding of rhbFGF to the receptor within the concentration range studied.

Effects of the Invention The HST-1 mutein of the present invention has a high effect of promoting healing of damage to living tissues, and therefore, it is effective against burns. It can be advantageously used as a therapeutic agent such as a healing promoter for wounds, etc., and
It can also be used as a treatment for ulcers in the gastrointestinal tract.

[Brief explanation of drawings]

FIG. 1 shows the amino acid sequence of the mature protein of hst-1. FIG. 2 shows the amino acid sequence predicted from the hst1 coding region including the leader sequence constituting the open reading frame of hst-1 cDNA. FIG. 3 shows the hst-1 mutein N obtained in Example 1.
27 amino acid sequences are shown. Figure 4 shows plasmid pTB10 obtained in Example 1.
51 construction diagram is shown. FIG. 5 shows the elution pattern obtained in Example 1. FIG. 6 shows the SDS-PAGE migration pattern obtained in Example 1. FIG. 7 shows the elution pattern obtained in Example 1. FIG. 8 shows the SDS-PAGE migration pattern obtained in Example 1. FIG. 9 shows the hst-1 mutein N obtained in Example 2.
The results of measurement of the promoting effect on cell proliferation of 27 human vascular endothelial cells are shown. FIG. 10 shows the mouse BALB/c obtained in Example 6.
The results regarding DNA synthesis inducing activity against 3T3 cells are shown. FIG. 11 shows the results of cell proliferation promoting activity obtained in Example 7. FIG. 12 shows the residual activity obtained in Example 10 under acidic conditions. FIG. 13 shows the radiolabeled rhbF obtained in Example 10.
hst-1 mutin N27 for GF binding experiments
The results of measuring the effect of are shown.

Claims (6)

[Claims] (1) Deletion mutein of heparin binding secretory transforming factor (hst-1). (2) The mutein according to claim 1, wherein 1 to 43 consecutive constituent amino acids of hst-1 are deleted. (3) A recombinant DNA having a base sequence encoding the mutein according to claim 1. (4) A vector comprising the recombinant DNA according to claim 3. (5) A transformant carrying the vector according to claim 4. (6) A method for producing the mutein according to claim 1, which comprises culturing the transformant according to claim 5 in a medium.