JPH0272882A - Expression vector - Google Patents

Abstract

PURPOSE:To provide an expression factor containing specific replicator, promoter region, restriction enzyme nicking side and terminator region and capable of expressing an exogenote in a cell of Candida maltosa which is an anascosporogenous yeast. CONSTITUTION:The objective expression vector contains (1) a replicator functioning in the cell of Candida maltosa, (2) a promoter region originated from the chromosome DNA of Candida maltosa, (3) restriction enzyme nicking site at the downstream of the promoter region and (4) a terminator region originated from LEV2 gene of Saccharomyces cerevisiae. The nucleotide sequence of the DNA containing the promoter region is preferably the one expressed by the formula.

Description

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to the use of the nonspore-free yeast Candida, Mal 1-sa (C
andida maltosa),
This invention relates to an expression vector for expressing a foreign gene.

Conventionally, Escherichia coli is the main host for recombinant DNA.
2 strains (EK system), Bacillus subtilis (BS system) and Saccharomyces cerevisiae (Saccharomyces scere).
visiae) (SC series) has been widely used,
For example, knowledge is accumulating that certain gene products are unstable and easily degraded or toxic to the host in the EK system, but are stably produced in the SC system.

Therefore, when the purpose is mass production of useful substances, the selection of host cells is also an important point, and expanding the range of host selection based on taste has important significance. Currently, in addition to the above-mentioned hosts, (Acet.

Culis (CH series), Pseudomona
sutida (PP series) ii (ZR series) and the like are also coming into use.

In order to further expand the range of host selection, the present inventors investigated n-
We focused on the yeast of the genus Candida, which has the ability to metabolize special organic compounds such as the ability to assimilate alkanes and decompose uric acid. (Candida maltos
With the aim of applying a) to the production of useful substances and the treatment of industrial waste, Candida maltosa (Candida maltosa)
ida maltosa) have been developed (e.g., Takagi et al., J.

Bacteriol, 167551 (1986);
Takagi et al., Curr, Genet, ll 451
(1987) i JP-A-62-74287 and JP-A-6274288).

On the other hand, it is known that the presence of a promoter, which is a gene signal necessary for transcription initiation, and the strength of the promoter activity play important roles in order to efficiently express a foreign gene in a host cell. However, Candida maltosa
) Currently, there is little knowledge about the promoter of the gene (for example, Takagi et al., Curr
, Genet, 11451 (1987)).

In view of the current situation, the present inventors first determined that in order to obtain a promoter that functions in Candida maltosa cells,
Considering the need to develop a plasmid hector for promoter search, we developed a plasmid hector for promoter search.
pPLc1 and pPLC2 (patent application 1989-19896)
2) was developed, and the chromosomal DNA of Candida maltosa was
From A, DNA containing a promoter that exhibits strong activity when the carbon source is glucose, glycerol, and tetradecane.
We obtained a DNA fragment containing a promoter whose activity was suppressed when the fragment and carbon source were glucose, but showed strong activity when glycerol and tetradecane were used.

As a result of repeated efforts, studies, and ingenuity to develop an expression vector using the DNA fragments obtained in this way, the expression vector of the present invention is capable of expressing a foreign gene in Candida maltosa cells. It was confirmed that the vector was excellent as an expression vector for the expression, and the present invention was completed.

The present invention utilizes a novel host-vector system using Candida maltosa as a host cell, which has the ability to assimilate n-alkanes, which is a useful property not found in conventional host cells. The present invention provides an expression vector for obtaining the desired expression vector.

The expression vector of the present invention includes (1) a replication origin that functions in cells of Candida maltosa, (2) a promoter region derived from the chromosomal DNA of Candida maltosa, and (3) a restriction enzyme provided downstream of the promoter region. Cleavage site (4) Escherichia coli is characterized by containing the terminator region derived from the LEU2 gene of Satucharomyces cerevisiae, but is also capable of replication and selection in Escherichia coli to facilitate plasmid adjustment, etc. It also has the characteristics of a shuttle vector.

The replication origin that functions in Candida maltosa cells represents a DNA nM region that controls the functions necessary for the plasmid vector to replicate in the cells. Since a plasmid has not yet been isolated, it is necessary to prepare a DNA region having such a function from the chromosomal DNA of the cell.

That's what the chromosomal DNA of Candida maltosa looks like.NA? An example of a method for adjusting the +Jl region has already been disclosed in the literature, and it can be carried out according to that method. ^1 (for example, Tak
agi et al., J. uacteriol, 16755H19
86) and JP-A-62-74288), pptc
It is convenient to use t and pPLC2 (see Japanese Patent Application No. 62-198962).

The promoter region derived from the chromosomal DNA of Candida maltosa represents the region that carries the gene signal that enables transcription of the gene when the foreign gene upstream and downstream of the 38 SR region is inserted. Such regions can be obtained by cleaving the chromosomal DNA of Candida maltosa by appropriate means such as digestion with restriction enzymes, and creating plasmid vectors pPLc1, ppt, and c2 for promoter search.
The plasmid is obtained by inserting it into leucine-requiring Candida maltosa (e.g., strain 3288) cells, selecting transformants in which the leucine-requiring requirement has been removed, and collecting the plasmid from the transformants. (See Japanese Patent Application No. 62-198962).

The restriction enzyme cleavage site provided downstream of the promoter region is a cleavage site for incorporating a foreign gene,
Any restriction enzyme may be used, but among the commonly used restriction enzymes, those that do not have a cleavage site in other parts of the expression vector, such as Smal, are convenient.

A restriction enzyme cleavage site can be easily created, for example, by inserting a commercially available appropriate synthetic linker.

The terminator region derived from the L EU 2 A trochanter of Satucharomyces cerevisiae represents a region that carries a gene signal to stop gene transcription, thereby efficiently expressing foreign genes. You can make it happen. Although such a region can be adjusted from the chromosomal DNA of Satucharomyces cerevisiae,
A plasmid that already contains such a region, e.g. YEp
13 (Broach et al., Gene 8121 (19
It is easy to adjust from 79) etc.

Since it is easier to construct and prepare a plasmid using E. coli as a host, it is preferable to construct it as a shuttle vector that can be reproduced and selected in E. coli.

Vectors that can be replicated and selected in E. IIa include:
Seed vectors such as pUclB (Mess
ing, Methods in EnzyIIIolo
gy 1012O-78 (1983)) etc. can be used.

The expression vector of the present invention can be constructed as follows. 5a chromosomal DNA of Candida maltosa
A DNA fragment of about 1 to 2 Kb was obtained by cutting with u3AI, and this fragment was inserted into the Bal1) II cleavage site of pPLc:1 to create Candida maltosa strain 3288 (patent application No. 6).
2-198962)). The transformants were grown for 110 days at 30°C on a minimal medium containing glucose, glycerol, or tetradecane as the carbon source, and plasmid DNA was recovered from the transformants that grew when the carbon source was glucose, glycerol, or tetradecane. , pcP- containing the insert as shown in FIG.
Get AI. Plasmid DNA is recovered from transformants that do not grow when the carbon source is glucose but grow when glycerol and tetradecane are used, and pCP-81 containing the inserted fragment as shown in FIG. 1 is obtained. pCPA
[as II], and pCP-81 as II
and [1gl], each containing approximately 0.9 Kb and 2.9 Kb including the promoter region. Collect OKb DNA fragments,
pU-C191ES (pUc19 with EcoRl and Sm
pUcP-AI (3,
6 Kb) and pUcP-Bl (4,7 Kb).

Next, pUcP-^l and pUcP-Bl were added to BstEn
After cutting with Baa old and Sea 1 to delete the LEU2 gene region derived from ρPLCI and ligating a Sma I linker, it was cut with Baa old and Sea 1 to create a gene containing the promoter region of about 0.6
A DNA fragment of approximately 1.7 Kb was obtained. This DN
The A fragment was obtained by cleaving P+JCT1 (YEp13 with Xho I and 5ail).
ae), the DNA fragment containing the two genes was transformed into pUclB
into the Xho I cleavage site of p
UL18 is cut with Fok I, ligated with a Sma I linker, and then cut with Sal 1 to obtain a DNA fragment of approximately 0.3 Kb containing the terminator regions of the two genes. Next, this DNA fragment was divided into ρUC19, Sma I and S
[A plasmid obtained by inserting the plasmid into the site cut with BaIII and S+ma I and further introducing the Ba Wei HI cut site upstream of the Eco RI cut ILJ position of the multiple cloning site] was inserted into the site cut with BaIII and S+ma I. Plasmid pSC-AI as shown in Figure 3
(3,6Xb) and pSC-81 (4,7Kb).

Furthermore, pSC-AI and pSC-Bl were transformed into Baa II
Approximately 0.9 Kb and approximately 2.0 Kb containing promoter and terminator regions obtained by cutting with I and Sal+. OK
The DNA fragment of b was inserted into pBT810B (TRA fil region derived from Candida maltosa (Takagi).
et al., J. Bacteriol, 167551 (1986
), Japanese Patent Application Publication No. 62-74288 and Japanese Patent Application No. 62-198'
162] into the Eco Rr cleavage site of pBR322, then T RA ? The Xho I cleavage site within the iJ\ region contains c-H[S (histidine-requiring Candida maltosa (Chang et al., J. Gen', ^pp1
．． Microbio1.30189 (1984)) which complements the auxotrophy of Candida maltosa I
A DNA fragment derived from strain AM12247] was inserted into the Bglff cleavage site of the plasmid obtained by inserting the DNA fragment derived from strain AM12247.
Plasmids pCEV-AI (11°4 Kb) and pCEV-Bl (12,5 Kb) as shown in the figure are obtained.

As a host cell for Candida maltosa, a histidine auxotrophic mutant strain CHI derived from Candida maltosa IAM 12247 strain can be used. Candida maltosa strain CHI has been deposited at the National Institute of Microbial Technology under the number FERMP-10173. Furthermore, the plasmid vector of the present invention can be used for Saccharomyces cerevisiae and Escherichia coli (Escherichia coli).
olk) can be used as a host (Tak
agi et al., J. Bacteriol, 16755H
1986); JP-A-62-14281 and JP-A-62-
14288>.

Transformation of host cells, preparation of DNA from host cells, etc. can be carried out according to known conventional methods (Ilinnen et al.
et al., Proc, Natl, ^cad, sci, UsA
751929 (1978) and Ito et al., J. Bac.
See Teriol, 153165 (1983).

To express a foreign gene using the expression vector of the present invention, for example, a DNA fragment containing the foreign gene is made blunt-ended using T4 DNA polymerase, etc., if necessary, and then inserted into an expression vector cut with Sma I. The resulting recombinant plasmid was ligated to Candida maltosa CH.
It is sufficient to introduce it into one stock.

Whether or not a foreign gene product is produced can be confirmed using a conventional method known in the field of biochemistry, such as a binding reaction with an antibody against the gene product.

Next, the present invention will be explained in detail with reference to examples, but the examples are given only to help give a concrete understanding, and do not limit the scope of the claims in any way.

Example 1: Obtaining a DNA fragment containing promoter region i region Candida maltosa (Candida maltosa)
osa) IAM12247 strain (wild strain) was cultured in YEPD medium (yeast extract 1%, peptone 2%, glucose 2%) for 30'C148 hours, harvested, and the chromosomal DNA
was extracted.

Approximately 10 u of Konochromosomal DNA was added to buffer A (10 mM T
ris・IIcI pH”1.5.100mM Na
C1, 10mM MgCIz, la+M DTT) and 20 units of 5au3ΔI in a 50μl reaction.
After reacting at 7°C for 15 minutes to cut the chromosomal DNA, 0% to 10% sucrose density gradient centrifugation (Hitachi RPS
410-ter, 28.0 OOrp+w, 22 hours) to recover a mixture of DNA fragments of about 1 to 2 Kb. Meanwhile, about 10 μg of plasmid pPLCI (Figure 2) was added to 50 μl containing the above buffer A and 24 units of BamHI.
After incubating in the reaction solution at 30°C for 118 hours, phenol extraction and ethanol precipitation were performed to recover the DNA.

This DNA is approximately 0. 1 μg and 0.1 μg of the above approximately 1-2 Kb chromosomal DNA fragment mixture were added to buffer B (20 mM
Tris, IICI (p) 17.6), 1kM Mg
Crt, 10m) IDTT, 1mHATP) and 3
The ligation was performed by reacting at 12°C for 18 hours in a 10μ2 reaction solution containing 50 units of T4 DNA ligase.

Using this reaction solution, E. coli IE, coli JA221
The strain was transformed, and plasmids were fractionated from colonies of the obtained ampicillin-resistant transformants and used as a Candida maltosa scene library.

Next, Candida Maltosa (Candjda ma
ltos Crest J288 strain (leucine auxotrophic strain, FERM
P~9478, Japanese Patent Application No. 62-198962) was transformed with the above scene library using the lithium metal method of Ito et al. The transformants grown on each carbon source were grown on a 30" plate (shown in Table 1) for 110 days. Next, the transformants grown on each carbon source were grown on a minimal medium containing 2% of the above carbon source (the composition is shown in Table 2). As shown in Table 3, transformants that grew on any carbon source (group A) and transformants that did not grow on glucose but grew on glycerol and tetradecane (group B). was gotten.

Select one strain each from group A and group B transformants,
When the plasmids were prepared and the restriction enzyme intercalation pattern was analyzed, plasmids ρCP-AI and pCC-81 having inserted DNA fragments as shown in FIG. 1 were obtained. The DNA base sequences of the inserted DNA fragments containing the promoter regions of pCP-AI and pCP-81 were
As determined using the Ky method, the base sequences were as shown in FIGS. 5 and 6, respectively.

Table 1. Composition table 2 of CD medium. Composition table 3 of minimal medium. Transformed strain growing on minimal medium + growth Not growing Example 2: Approximately 5 μg of the plasmid pCP-AI of Homobek V = He1 and B1 was added to a 50 μ2 reaction containing the above buffer A and 20 units of l1ae II. Approximately 5 μg of plasmid pCP-81 was also mixed in the buffer A described above, 20 units of l1ae11 and 20 units of Bgl I.
50μ including! After incubation at 37°C for 18 hours in a reaction solution of 0.6% agarose gel electrophoresis, approximately 0.6% containing the promoter region was incubated. 9Kb and about 2
．． A DNA fragment of OKb was obtained.

This DNA fragment was treated with 67mM Tris.IIcI.
(pH 8,8).

6.7mM MgCb, 16.6mM (NH4
) zsO4110mM 2-mercaptoethanol, 6
．． 7 μm EDT^, 0.0167% bovine serum albumin, 2IIIM dNTT' (dATP, dTTP, dG
After incubation at 37°C for 55 minutes in a 20 μl reaction solution containing 3 units of 74 DNA polymerase, phenol extraction and ethanol precipitation, the DNA was recovered.

Furthermore, the recovered DNA fragments were combined with a commercially available Bag old linker (approximately 0.02 Azb) that had already been phosphorylated.

units) from the above buffer B and 350 units of T4 DNA.
After ligating by reacting for 218 hours at 12°C in a 10 μl reaction solution containing ligase, the DNA was recovered by phenol extraction and ethanol precipitation.

On the other hand, about 4 μg of plasmid pUc19Es was incubated in a 20 μ2 reaction solution containing the above buffer A and 20 units of BaIIIll at 30° C. for 118 hours.
DNA was recovered by phenol extraction and ethanol precipitation.

This DNA is approximately 0. approximately 0.9 Kb and approximately 2.0 Kb containing IIIg and the promoter region described above. Approximately 0.1 μg of each OKb DNA fragment was added to the above buffer B and 350 units of T4D.
12°C in a 10 μl reaction solution containing NA ligase.
The mixture was reacted for 8 hours and ligated.

Next, using this reaction solution, Escherichia coli and Seitan JA221
The strain was transformed and ampicillin-resistant transformants were obtained.

Plasmid DNA was prepared from these transformants, and the restriction enzyme pattern was analyzed to select transformants containing plasmids PUCP-AI and pucp-[11 as shown in FIG. 3.

Plasmids pUcP-AI and pUcP-Bl each about 1
After incubating 0 μg in a 50 μ2 reaction solution containing the above-mentioned buffer A and 24 units of BstEII at 60° C. for 11 hours, phenol extraction and ethanol precipitation were performed to recover DNA. Further, in a 50 μl reaction solution containing the above buffer A and 20 units of Pstl at 37° C.
After incubation for 8 hours, phenol extraction and ethanol precipitation were performed to recover DNA.

This DNA was converted into Takara Shuzo K11o-5equence D.
React at 25°C using eletionKiL and incubate for 30
DNA was collected by sampling every second. Approximately 0.5 μg of the recovered DNA and the commercially available Sea I linker, which had already been phosphorylated, were incubated for 12 hours in a 10 μP reaction solution containing the above buffer B and 350 units of 74 DNA ligase.
The mixture was reacted at °C for 11 days and ligated.

Next, using this reaction solution, E. coli E, coli JA
221 strain was transformed to obtain ampicillin-resistant transformants.

Plasmid DNA was prepared from these transformants, and
Determine the DNA base sequence near the LIla■ cleavage site,
Plasmids pUcP-^1d and pUCP- as shown in Fig. 3, which are deleted up to ATC in the LEU2 gene region
Transformants containing Bld were selected.

Approximately IO μg of each of plasmids pUcP-Ald and pUcP-Bid were incubated at 37°C in a 5Oag reaction solution containing 20 units of SmaI in 20% of the buffer A described above.
After incubation for 18 hours, 0.6% agarose gel electrophoresis was performed to detect approximately 0.0
．． 6Kb. A DNA fragment of approximately 1.7 Kb was obtained.

On the other hand, approximately 5 μg of plasmid pUcT1 was added to the buffer described above. &
A, 20 units of Oam III and 20 units of Sma
After incubation at 37°C for 18 hours in a 50μ2 reaction solution containing +, phenol extraction and ethanol precipitation were performed to recover the plasmid containing the terminator region. Approximately 0.1 μg of this DNA and approximately 0.1 μg each of the approximately 1.7 Kb DNA fragment containing the promoter region were placed in a 1 Oag reaction solution containing the above buffer B and 350 units of T4 DNA ligase at 12°C for 18 hours. They were reacted and ligated.

Next, using this reaction solution, E. coli E, coli JA
221 strain was transformed, and a transformant resistant to ampinrin was obtained.

Plasmid DNA was prepared from these transformants, and the restriction enzyme cleavage pattern was analyzed to select transformants containing plasmids pSC-Al and pSC-Bl as shown in FIG.

Plasmids pSC-AI and pSC-Bl each about 10μ
g to the above 11 street solution A, 20 units of Ba+m old and 20
37°c1 in a 50μ2 reaction solution containing 5all units of
After incubation for 18 hours, 0.6% agarose gel electrophoresis was performed to obtain approximately 0.9 Kb and approximately 2.0 Kb containing promoter and terminator regions. OKb's DN
Fragment A was obtained. This DNA fragment was treated with 50mM Tris.
・IIcI (pt17.2), 10n+M Mg5O
a, 0.1mM DTT, 50 1teg/ml B
SA, 0.2mM dNTP (dATl”, dTTP
, dGTP, dCTP) and 3.5 units of DNA polymerase (Klenow Fragment).
After incubating for 130 minutes at 22°C in the reaction solution of al., the DNA was extracted with phenol and precipitated with ethanol.
was recovered. The recovered DNA and a commercially available Bgl II linker that had already been phosphorylated were ligated by reacting for 18 hours at 12°C in a 1θμ2 reaction solution containing the aforementioned buffer B and 350 units of T4 DNA ligase. DNA was recovered by phenol extraction and ethanol precipitation.

Separately, about 5 μg of plasmid p[1THIOB was incubated at 37°C in a 50 μl reaction solution containing the above buffer A and 20 units of BglII. After incubation for up to hours, DNA was recovered by phenol extraction and ethanol precipitation.

Approximately 0.9 Kb and approximately 2.0 μg of this DNA and approximately 0.9 Kb including the promoter and terminator described above. OKb's DN
Approximately 0.1 μg of each A fragment was ligated by reacting for 58 hours at 12°C in a 10 uN reaction solution containing the above buffer B and 350 units of 74 DNA ligase.Next, this reaction solution was used to inject into the large intestine [ ] E. coli strain JA221 was transformed to obtain ampicillin-resistant transformants.

Plasmid DNA was prepared from this transformant, and the restriction enzyme cleavage pattern was analyzed to generate plasmids pCEV-AI and ρC1'V-B1 as shown in Figure 4.
A transformant containing the following was selected.

[Brief explanation of the drawing]

FIG. 1 shows a DNA fragment containing a promoter region derived from Candida maltosa chromosomal DNA that has been inserted into pCP-AI and ρCP-Bl. Figure 2 shows plasmid vectors for promoter search.
pPLcl is shown. FIG. 3 shows the construction process of ρ5C-AI and pSC-Bl. FIG. 4 shows expression vectors pCEV-AI and pc[! V
-81 construction process is shown. FIG. 5 shows the DNA base sequence of the promoter region contained in pCP-AI. FIG. 6 shows the DNA base sequence of the promoter region contained in pCP-81. Figure 1 pCP-AI H-111←0.6KbpSau3. A
Restriction enzymes tested by I5au3AI: EcoRI, PstI, XhoI, C1aI,
BamHI, Smal, HindllFigure 8Figure 2BamHI Figure 4Figure 5 pCP-AI promoter region DNA sequenceFigure 6 pcp-Bl promoter region DNA sequence (Part 1)
)+0 20 30
40 +50 GATCT
GTCAT CAAAGGAAAT ACGACGAA
Tr CCGACGACCA TGATTT, ATGT
GATCATrAGCCTCTrTCGCA GGAC
TACTCA ACAATCCACCATTrCTTCA
CCTATCAATCTATATrTAGTACGT
rCTCGGCG TGTCTrTrCA AACAA
AA person person CCATCATC person A TGTCTrCAT
CTrCTTCTGTCGTrGTTGATA GT
TT'TCTCTTTTTTc人ACAAT TGCG
CGGCACGATACGCTCTTGATGAA
ATr CAACAGATCT+10
120 130 140
150AAAGAAAATAAAAAAG
C person ATT TrCAAATrTr TGCTATT
CCA GATrAAGATGGATAAAATAGT
TTAAAGTrCG CCGATCTCCG
PersonTCCCCTCTG GTCCGCCCAT16
0 +70 +80
190 200TTrGATr
ACT AAATr, AGTTr AAAC person AT thought
NRIBUG 人人TCGTGCT口TCCAAATACAT
AA GCCCAGC人AA AAATrTGAAA
GAAAAGGTrT CTGTATCATA2
+0 220 230
240 250cTTTTTT person T
CA CGTGTGTTGA TrCTCATCC
T TACATAT! TT GCAAACTrTGG
ATrATrATrT GCATrTTGAT G
TAAATCTGT TTrATTG person AG AA
TGATTTAGTTGAACTGAT TTrATC
AAGA AGCTGGTGGA TAATAATCT
CAGGTrT-TrCCAATCACCCACAAA
GAAGG GGAGAAAluT person ATAAAACC
ACAGATATmTTTTTCTrTATr TCT
TGCGTrT GAGA人ATCAT GG人人AATCTr TTCACC人人人人wcTTTcT
rr rrmouth TrTCCT TCCTCGCAGT T
ATGTGTGTCGCGATCATCATCATTrA
CATCAATrGTrG7CCGACTATGGT
AGTCA/ITrGT TTGTTrTTGGCGT
TTTTTAT TTTTAACAGG TCCTCC
TAAA n1go7rrr'rr TTTGGTTTG
AGAAGTGGTGT G person ATGAGAAA
AGAAGAA'lAA TrTATCGGGA
TAGA, ATATTTTTTTrACCGAT TCC
AGAT, ACA ACA, TCAAATA AATC
TAACTG GGATrTrTCTCGCGTCT]
”CG CGAATCTrTr TTTTCGAAC
TAAAGT人TTGT TrTrTrACTA
TTTrTGCTTA CAACCTATrT CTT
TTCTTTT TATTTTGTTT TTTGTr
ACAGTATAGAAATCACTCGTAAACA
ACAAAACAA AG, LILI VISIT TAA CACT
AAAG person ACAACGC person AA CCCTAAC
ATT CCAATGTGGAGAAGAATC
AA AACT7ACAGAA C 650, 670680690700 TATCACT, AAG ACAGACAAAACAAA
CAATTT=to cccc, rise to person ACA Nhe On-to G person TC Figure 6 (Part 2) TAATrGTNGT CTAGTrTTAT T
CTr'GTATCG CACACATCACTAC
ATCAATACGmTGTCA CCGCTrTrC
T GCTCCGGTACTTrGTCCCCGA AA
TAGGATTTCTrTTITAT TAGTAC
AATCTAGTCATAAT AGATATGGGGG
AAAATAATATATTATTrATmT AATAG
TmT ATrTTCCC person T CACGCT person A
GCAAAATAAAAATAAAAACGCCG TT
GTTCTGCT GATGCTTTI'T TrTC
TrTr'CT TrCCATrTrACGATrCA
AACTrTGGTrCTT ATCTGACATCG
ACCCAGGTr TTCTrTITrT+010
1020 1030
+040 1050TrTrCTTGAA
TCTTGTrATCAACAACATATAA CGA
TGAAGAA GAAAAAATn Ding GCCCTCTC
GT person TrTCC person ATA ACTTATCTCT
AGGTrTAACA CGTGTrOTTc11
30]+40 1+50C
GCCATrCTA AACGGAAAACTCAA
TrCATCTCACTCAATr Person AAG Person T Person TAG] 480 1190
1200CCTTACCTrTCTrTCCCAG
CCCGTGAAAA TATrTCGATr ATC
TGGCGAA+230 1240
+250TAGTACTAGGAGAAA
CTCACCTGTrTAIIIAAATCAAAAAAT
CG entered υ visit ATG1280 +290
1300CCGTATGTGT AC Nributsurenribenjin AGnlili customization TA GTCCACTA1 completedCCCCACnriA+330 1340
1350MACAATAT TrTCTAGA
AA GCGTr, AACAC】360 ATCTTGATC

Claims (5)

[Claims] (1) Non-spore yeast Candida maltosa (￥Can
a replication origin that functions in cells of Saccharomyces cerevisiae (Saccharomyces cerevisiae), a promoter region derived from the yeast chromosomal DNA, a restriction enzyme cleavage site provided downstream of the promoter region.
LE of aromyces￥￥cerevisiae￥)
An expression vector characterized by containing a terminator region derived from the U2 gene (2) The expression vector according to claim 1, wherein the nucleotide sequence of the DNA containing the promoter region is the following sequence [there is a gene sequence] (3) The expression vector according to claim 2, which is plasmid pCEV-A1. (4) The expression vector according to claim 1, wherein the nucleotide sequence of the DNA containing the promoter region is the following sequence [there is a gene sequence] (5) The expression vector according to claim 4, which is plasmid pCEV-B1.