JPH02227075A - New polypeptide - Google Patents

Abstract

PURPOSE:To efficiently produce polypeptide by culturing host cell transformed with plasmid including DNA coding polypeptide having amino acid sequence capable of adding at least one saccharides. CONSTITUTION:Plasmid having amino acid sequence capable of adding at least one new saccharides and containing DNA coding polypeptide capable of adding saccharides by amino acid-substitution, amino acid-omitting or amino acid- inserting to polypeptide is prepared. Host cell is transformed using said plasmid and the transformant is cultured in medium to accumulate polypeptide or glycosylated polypeptide in the cultured matter. Next, polypeptide or glycosylated polypeptide is collected from the cultured matter.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of Industrial Application The present invention provides a new I! A novel polypeptide having an amino acid sequence to which a chain can be added, a glycosylated polypeptide thereof, a deoxyribonucleic acid (DNA) encoding the polypeptide or the glycosylated polypeptide, the DN
The present invention relates to a method for producing the polypeptide or the glycosylated polypeptide using a recombinant plasmid containing A, a host cell transformed with the recombinant plasmid, and a transformed cell.

The invention is applicable to all polypeptides. The polypeptide provided by the present invention to which a new sugar chain has been added has various functions added to the sugar chain, and has superior physical properties and activities compared to natural proteins. Therefore, the glycosylated polypeptide provided by the present invention is expected to be useful in a wide range of fields.

For example, the polypeptides or glycosylated polypeptides of the invention may be human granulocyte colony stimulating factor (hG-C5F).
), hG with a new sugar chain added at an appropriate site
- CSF has increased resistance to proteases.

This novel hG-CSF has been shown to be effective for clearance in the blood (
It is also fully expected that the removal rate (removal) is slow, and its use as a medicine is expected.

Similarly, when the glycosylated polypeptide of the present invention is urokinase (UK), UK with a new sugar chain added to an appropriate site has a thrombolytic effect superior to that without the addition, and has a thrombolytic effect on cerebral thrombosis. It is expected to be used as a therapeutic agent for myocardial infarction.

Conventional technology Proteins produced by prokaryotes such as Escherichia coli do not have sugar chains, whereas proteins produced by eukaryotes such as yeast, molds, plant cells, or animal cells have sugar chains attached. in many cases.

The sugar chains to be added can be roughly divided into two groups. One is an N-glycoside-linked sugar chain that binds to asparagine (Asn) residues in proteins, and the other is O-glycoside chains that bind to serine (Ser) or threonine (Thr) residues in proteins. It is a linked sugar chain.

N-glycoside-linked sugar chains have a common core structure consisting of two N-acetylglucosamines and three mannose trivets, and based on their sugar chain structure, there are three types: high-mannose type, complex type, and hybrid type. They are classified as follows (Figure 1). These asparagine-linked sugar chains are 1
A lipid intermediate (Gl
csMan, GIcNAca-PP-00 (Figure 2)
is used as a precursor.

The reaction pathway by which lipid intermediates are formed is well known as the "dolichol phosphate cycle" (Figure 3).

The sugar chain of this libido intermediate is then attached to the Asn residue in the amino acid sequence (N-glycosylation site) such as Asn-X-3er/Thr in the polypeptide chain being generated in the lumen of the rough endoplasmic reticulum (rER). The moieties are transferred together to form an N-glycosidic bond. In this case, X may be any amino acid other than proline (P r o), and this reaction is carried out by oligosaccharyltransferase (oligosaccharyltransferase), a type of membrane enzyme.
Old 1go-5accharyl transferas
After this, the sugar chain undergoes trimming and processing during the process of passing through the rER and Golgi apparatus, and is completed as a high-mannose type, hybrid type, or complex type (e). (Figure 4).It is known that many glycosidases and glycosyltransferases are involved in the trimming and processing process.

High-mannose types are often found in glycoproteins of animal and plant origin, as well as yeast and mold, whereas complex-type sugar chains are presumed to be limited to those of animal origin.

As mentioned above, the N-glycoside-linked sugar chain is Asn-X-3e r/Th r (X is Pro
In many proteins, the Asn-X-3er/Thr
There is a sequence, and if this sequence exists, it does not necessarily mean that the a-string will be added. Facts William J. Lennarz
suggest that the three-dimensional structure of the protein is important in promoting win binding. It is Asn-X-5e
A simple tripeptide with the sequence r/Th r,
In vitro, denatured proteins that do not have the intricately folded spatial structure of natural proteins
This is based on the knowledge that it is relatively easy to bind sugar chains enzymatically.

On the other hand, in O-glycoside-bound aIl, it is bound to the Ser or Thr residue in the polypeptide via N-acetylgalactosamine, and galactose, sialic acid, fucose, and terminal N-acetylgalactosamine are bound to it. is common [Osuzuki Suzuki et al.: Proteins, Nucleic Acids, Enzymes, 30°513 (1985)]. Furthermore, unlike the case of N-glycoside-linked sugar chains mentioned above, rER is not involved in their synthesis, and it is thought that all of the synthesis takes place in the Golgi apparatus.Johnsgn et al.
e11), 32.987 (1983)]. Also, ]N-
Unlike the case of glycosidic bonds, I! There is also no regularity in the amino acid sequence in addition. However, Pro-Thr/Ser.

Thr/5er-Pro, Thr/5et-X+N
It is known that when Pro exists nearby, such as in 5-Pro, the w1 chain tends to be added.

In this case, X may be any amino acid [Takahashi et al.: Proceedings on the National Academy of Sciences (Proc, Natl., Acad, Sc.
i,), USA, 81°2021 (1984)]
.

Although much remains unknown regarding the essential biological functions of sugar chains of glycoproteins, various functions of sugar chains have been clarified to date through research on many glycoproteins.

First, I! Chains are known to stabilize proteins. One example is delayed clearance in the blood.

Human erythropoietin (lacking asparagine-linked sugar chains) or l
Human erythropoietin (which aggregates) whose chains have been removed by enzymatic treatment exhibits activity in vitro, but is rapidly cleared in vivo and is known to have low activity [Dodal et al.
et al.: Endocrinology
f), 116.2293 (1985) and Browne et al.: Cold Spring Harbor.
・Symposia on Reontative Biology (Cold Spr, Harb, Symp,
Quant.

Biol, ), 51.693 (1986)]. Also, human granulocyte/macrophage colony stimulating factor (h
GM-CSF) naturally has two N-glycoside-linked sugar chains, but it is known that reducing the number of sugar chains increases the clearance rate from rat plasma in proportion [ Donahue et al.: Cold Spring Harbor Symposia on Quantitative Biology (ColdSpr.
, Harb, Symp, Quant, Riot, ),
51.685 (1986)].

The rate of clearance and the site to be cleared also vary depending on the structure of the sugar chain;
It is known that -CSF is cleared in the kidney, whereas hGM-CSF from which sialic acid has been removed has a faster clearance rate and is cleared in the liver. In addition, a, -acid glycoproteins with different sugar chain structures were biosynthesized in the presence of various asparagine-linked sugar chain biosynthesis inhibitors in a rat liver primary culture system.
The clearance rate from rat plasma and rat perfusate was investigated.
In both cases, the C gloss (G
ross) LA: European Journal on
Biochemistry (Our, J, Biochem,)
, 16283 (1987)). Another example of stabilization is that sugar chains are known to confer protease resistance. For example, fibronectin (fibronectin)
When the formation of sugar chains of ctin is inhibited by tunicamycin,
The rate of intracellular protein degradation of the obtained sugar chain-deficient fibronectin is increased [Olden et al.: Cell, 13, 461 (1987)], and the addition of carbohydrates improves thermostability and anti-freezing properties. It is also known to increase sex. Furthermore, it is known that sugar chains contribute to increasing the solubility of proteins such as erythropoietin and β-interferon.

Glycans also help proteins maintain their correct three-dimensional structure. Removal of the two naturally occurring N-glycoside-linked aw4 chains of the pus-binding glycoprotein of vesicular stomatitis virus inhibits the transport of the protein to the cell surface, but a new I! It is known that it will be restored when a chin is added. In this case, removal of sugar chains induces association between protein molecules through disulfide bonds,
As a result, it was revealed that protein transport was inhibited. Furthermore, the newly added sugar chain is thought to be able to maintain the correct three-dimensional structure of the protein by inhibiting this association, making protein transport possible again. Also,
It has been shown that there is considerable flexibility in the position at which new sugar chains are added. On the other hand, it has also become clear that depending on the position of introduction, the transport of proteins with natural sugar chains may be completely inhibited [Rose et al.: Journal on Biological Chemistry (J ,Biol,Chen+,),
263. 5948 and 5955 (1988):
l.

I! Examples are also known in which chains mask antigenic sites on polypeptides. h GM-CSF, prolactin,
Interferon-γ, Rauscher
) Experiments using polyclonal antibodies or monoclonal antibodies against specific regions on leukemia virus gp70 and influenza hemagglutinin peptides have led to the conclusion that the sugar chains of these proteins inhibit the reaction with antibodies. Ta. However, on the other hand, it is also known that certain proteins induce immune reactions, suggesting that sugar chains play a dual role.

It is known that sugar chains themselves are sometimes directly involved in the expression of glycoprotein activity. Examples include glycoprotein hormones such as luteinizing hormone, follicle-stimulating hormone, and chorionic gonadotropin.

Finally, an important function of sugar chains is their involvement in cognitive phenomena. There are many known examples in which sugar chains are thought to be involved in recognition phenomena between cells, protein interrogation, or cells and proteins, and the location of in vivo clearance may differ depending on the structure of the sugar chain. This is one example.

The above has described the structure and function of sugar chains of glycoproteins.

Significant progress has been made in methods for analyzing the structure and function of sugar chains, and it has become possible to conduct various analyzes of the physicochemical properties of sugar chains bound to peptide backbones.

In particular, highly specific enzymes (exoglycosidases) that sequentially dissociate sugar chains, and glycopeptidases and endo-glycosidases that cleave the bonding points with peptide chains without damaging both the peptide chains and sugar chains, have come into practical use. It is noteworthy that this has made it possible to conduct detailed research on the biological roles of sugar chains. It is also possible to add new sugar chains using glycosyltransferase. For example, sialic acid can be newly added to the end of a sugar chain using sialic acid transferase. By using various other glycosyltransferase and glycosidase inhibitors,
Techniques for changing the sugar chains added are also well known.

As with the membrane-bound glycoprotein of the vesicular stomatitis virus mentioned above, there are examples in which the technique of adding sugar chains has been used to study the function of anti-alcoholic agents, but it is difficult to develop polypeptides with high industrial value. There are no examples of it being used for improvement yet. Generally, physiologically active polypeptides often have undesirable properties such as decreased activity due to protease cleavage, decreased activity due to heat treatment, or susceptibility to clearance when administered in vivo. To date, there have been no examples of increasing protease resistance, thermostability, or blood stability by modifying the amino acid sequence of such polypeptides and intentionally adding new sugar chains. unknown. In the present invention, we have developed a method to improve various properties of the above polypeptide by intentionally adding new sugar chains.

Problems to be Solved by the Invention Physiologically active polypeptides generally have disadvantageous properties such as decreased activity due to protease cleavage, decreased activity due to heat treatment, and susceptibility to clearance when administered in vivo. many. For example, UK is rendered inactive by a protease called thrombin. Improving these properties of bioactive polypeptides is an important issue.

Means for Solving the Problems In order to solve the problems, the present invention has developed a new method for adding $1 to physiologically active polypeptides.

This method involves changing the amino acid sequence of a polypeptide so that a new sugar chain can be added to a desired site, such as near the protease cleavage site, and then using recombinant DNA techniques to generate DNA encoding the mutant polypeptide. This method utilizes constructing a recombinant expression vector, introducing it into a microorganism or animal cell, and expressing it.

When the properties of the glycosylated polypeptide obtained by such a method were investigated, it was discovered that it was endowed with excellent properties such as protease resistance, leading to the completion of the present invention.

DETAILED DESCRIPTION OF THE INVENTION According to the present invention, a novel polypeptide having an amino acid sequence to which at least one sugar chain can be added, a glycosylated polypeptide thereof, a DNA encoding the polypeptide or the glycosylated polypeptide; A recombinant plasmid containing the DNA, a microorganism or animal capsule containing the recombinant plasmid, and a method for producing the polypeptide or the glycosylated polypeptide using the microorganism or animal cell are provided.

The purpose of the present invention is to add at least one new sugar chain to any polypeptide or glycosylated polypeptide, thereby enhancing any of the functions of the sugar chain described above.
It is intended to be newly added to a polypeptide or a glycosylated polypeptide. For example, the present invention provides a new
By adding ta, the purpose is to stabilize a polypeptide or a glycosylated polypeptide to prolong its clearance in the blood, and to direct the polypeptide or glycosylated polypeptide to a specific location in the body. It is something to do. Furthermore, in cases where cleavage of polypeptides by proteases is significantly involved in biological activity, I! By adding i#l, protease resistance can be increased and biological activity can be controlled.

In order to create an amino acid sequence in a polypeptide that allows the addition of new sugar chains, amino acid substitution in the polypeptide,
This can be achieved by methods such as amino acid deletion and amino acid insertion.

For example, asparagine (Asn) is known as an amino acid for binding N-glycoside-linked sugar chains, and serine (Set) and threonine (Thr) are known as amino acids for binding O-glycoside-linked sugar chains. Therefore, these amino acids may be present at suitable positions on the polypeptide.

Preferably, an amino acid to which a sugar chain can be added is introduced into the target polypeptide by introducing a tripeptide represented by Asn-X-Thr/Ser (X is an amino acid other than proline) into an appropriate site of the target polypeptide. can be present in the polypeptide.

Introduction of this tripeptide can be carried out according to the method of site-specific mutagenesis of genes.

What is important when adding a new sugar chain is the position at which the sugar chain is added. As mentioned above, sugar chains may not be added depending on the position on the polypeptide, and even if new sugar chains are added, the correct three-dimensional structure of the polypeptide may be disrupted and membrane transport may be inhibited. In some cases, the activity may be lost. Therefore, the position at which a new sugar chain is added needs to be at least on the surface of the polypeptide. In a polypeptide whose three-dimensional structure is already known, its surface site is obvious, so the attachment site can be easily determined. Furthermore, in order to minimize the decrease in activity due to glycosylation, it is desirable to be as far away from the active site as possible in terms of steric structure. Therefore, in polypeptides in which the active site is known in addition to the three-dimensional structure, the addition site can be determined by taking the above into account. On the other hand, when the three-dimensional structure of a polypeptide is unknown, its surface site can be estimated by calculating its hydrophilicity (HVdropathy) from the polypeptide's primary structure. Also, from the -order structure, Chou-Fasman
[Biochemistry
) 13, 211 (1974).

Biochemistry
13. 222 (1974), Advanced Enzymology (Adv.

εnzymo1. ) 47, 45 (1978)] or the method of Robson [Journal on Molecular Biology (J,!Jol
, Biol.) 107, 327 (1976).

120.97 (197B)], it is also possible to estimate the location where a turn structure is likely to be formed. Furthermore, more detailed information regarding surface sites can be obtained by treating with various proteases and identifying sites that are likely to be cleaved. It is thought that the vicinity of the protease cleavage site is likely to be located on the surface of the polypeptide, so when trying to efficiently add sugar chains to the polypeptide, it is necessary to When attempting to obtain an additional polypeptide, it becomes an ideal target site for glycosylation. In addition, polypeptides with sugar chains added near the protease cleavage site are expected to become resistant to the protease, and in order to stabilize them, sugar chains are added near the protease cleavage site. It can be said that it is very suitable as a part.

It is preferable to introduce a glycosylation site within 8 amino acid residues from the protease cleavage site of the polypeptide.

In addition, whether the three-dimensional structure is known or unknown, glycosylation sites are actually introduced into some of the sites selected as above, and it is confirmed whether the f1 chain is actually added there. There is a need. In addition, regarding polypeptides with added sugar chains, whether they retain biological activity or not,
It is necessary to evaluate whether there is any decrease in activity and whether superior functions are added.

The polypeptide targeted by the present invention may be any polypeptide as long as it has physiological activity, but preferably colony-stimulating factors (granulocyte/macrophage colony-stimulating factor, granulocyte colony-stimulating factor, macrophage colony-stimulating factor) ), tissue plasminogen activator (t-P
A), urokinase (UK), interferon-α
, inter7eron-β, interferon-γ, lymphotoxin, lipocortin, superoxide dismutase, erythropoietin, interleukin-1,-
Examples include 2, -3, -4, -5, -6 or -7.

The method for adding α-alpha to a polypeptide is as follows. First, a DNA encoding a mutant polypeptide in which the amino acid sequence at a desired site, such as the vicinity of a protease cleavage site, has been modified to enable the addition of a new sugar chain is constructed using recombinant DNA techniques. Next, by introducing the DNA into an expression vector and expressing it in microorganisms (yeast, mold, etc.) or animal cells (CHO cells, Namalva cells, etc.), the new 11-molecule-added polypeptide is produced. peptides can be obtained. When attempting to add an N-glycoside-linked sugar chain, N
-Glycosidic binding site (Asn-XSer/Thr:X
may be modified to produce any amino acid other than Pro). Construction of a DNA encoding a mutant polypeptide can be performed using site-specific mutagenesis or a synthetic NA linker.

Furthermore, the function of sugar chains is highly dependent on their structure. Therefore, it is important to change the structure of the added sugar chain and select a sugar chain that provides better properties, and the present invention also includes such an optimization process.

Methods for changing the structure of sugar chains include the following.

1) Change the host that produces the protein. 2) Microorganisms or animal cells containing the above recombinant plasmid,
(2) Culture in a medium containing an inhibitor of enzymes involved in the biosynthesis or processing of sugar chains, such as deoxynojirimycin, 1-deoxymannojirimycin, and swainsonine. 3) Ii anti-added protein, sialidase, β
- Treatment with various glycosidases such as galactosidase, β-N-acetylglucosaminidase, β-mannosidase, endoglycosidase, and glycosyltransferase such as sialic acid transferase.

The case where the polypeptide or glycosylated polypeptide of the present invention is hG-CSF, UK, and t-PA will be explained more specifically.

(1) When the polypeptide or glycosylated polypeptide of the present invention is hG-C5F: hG-CSF produced in Escherichia coli using recombinant DNA technology and purified
Analysis using the G-C5F derivative hG-CSF [ND28] (see Reference Example 16) revealed that the 144th phenylalanine (Phe) residue from the N-terminus of the mature polypeptide of hG-CSF is degraded by chymotrypsin. It turned out to be easy. In addition, hG-CSF [
ND28), the N-terminal 4 to 7 amino acid residues are linked to various proteases (subtilisin, chymotrypsin,
It was also found that they were more easily cleaved by trypsin, etc. Note that hG-CSF [:ND28] is
It is known that the activity is increased compared to mature hG-CSF produced and purified using E. coli. From the above-mentioned findings, it is estimated that the portion near the Ni: end of hG-CSF CND28] and the vicinity of the 144th position from the N-terminus are present on the surface of the polypeptide. So hG-
6th or 14th from the N-terminus of CSF [ND28]
An attempt was made to add a sugar chain to the 5th amino acid residue.

hG-CSF is a derivative that has a glycosylation site at the 6th amino acid residue from the N-terminus of hG-C5F [ND28].
[ND2 BN6], and the derivative with the Fi-adding site at the 145th amino acid residue from the N-terminus is hG C
S F CN D 28 N145]. In this case, acquisition of protease resistance is expected due to the addition of sugar chains. Stabilization of the polypeptide is also expected to slow its clearance in the blood.

hG-CSF used in the present invention, hG-CSF[ND28
), hG-CSF CND28N6) and hG-C
The amino acid sequences of SF CND28N145) are shown in Tables 1, 2, 3, right, and 4, respectively.

In the present invention, hG-CSFShG-CSF CND28
), hG-CSF (ND28N6) and hc-C
DN that codes for 5F [ND28N145) respectively
hG-CSF is obtained by constructing A by recombinant DNA technology, inserting it into a recombinant expression vector, introducing it into animal cells, and expressing it.

hG-C5F CND28], hG-CSF [:N
D28N6) and hG-C5F CND28N145
] can be produced. Among the polypeptides obtained in this way, hG-CSF [:ND28N6]
and hG-CSF CND28N145], approximately 173 new sugar chains (
N-glycosidic linkage type a) is added. Also hG
-CSF CND28N6] and hG-CSF [N
D28N145], when we compared the protease sensitivity of those with and without new sugar chains added, we found that the ones with new sugar chains were more resistant to proteases. Also, hG-C
It was also found that in 5F (ND28N6:l), the one to which a new sugar chain was added was more stable against heat than the one from which it was removed enzymatically, demonstrating the effectiveness of the present invention. In addition, hG-CSF (N
It has also been revealed that a new o-glycosidic bond is added to D28) l, :.

In this case as well, those with new sugar chains added are more resistant to proteases.

(2) When the polypeptide or glycosylated polypeptide of the present invention is UK or t-PA: Currently used thrombolytic agents include urokinase (UK) and streptokinase (SK); The lytic agent has no affinity for the thrombus component fibrin. Therefore, large doses are required to dissolve the thrombus, and by activating not only plasminogen adsorbed to the thrombus but also plasminogen in the blood, systemic fibrinolysis is accelerated and bleeding tendency is increased. appear. For these thrombolytic agents, tissue plasminogen activator (t-PA), which has fibrin affinity, and prourokinase (p r o-UK), which is an inactive precursor of UK, are used.
has been attracting attention recently.

Since t-PA has fibrin affinity, it is expected to specifically adsorb to thrombi and dissolve thrombi efficiently, while at the same time not causing systemic fibrinolysis. t-PA exists in single-stranded type and double-stranded type, and the single-stranded type is converted into the double-stranded type by plasmin. 'Two-layer t-PA is the active type, but single-layer t-PA also exhibits fibrinolytic activity equivalent to that of two-layer tj+t-PA in the presence of fibrin degradation products. When comparing the fibrin affinity of single chain t-PA and double chain t-PA, it has been revealed that single chain t-PA has stronger fibrin affinity (Tate et al.: Biochemistry). (Bioc
hemistry) 26, 338 (1987)
]o Therefore, it can be said that single-chain t-PA has higher specificity for blood clots and is superior to double-chain t-PA.

On the other hand, UK also exists in single-chain and double-chain types, and plasmin converts the inactive single-chain UK into the active two-chain UK. This inert one bottle UK is pro
Also called K. This inactive single-chain UK, i.e. p
In the presence of a protease called thrombin, r o-UK is converted to a double-stranded UK that has lost its activity [Ich 1nose et al.: Journal
on Biological Chemistry (J, Biol,
Chem, ) 261. 3486 (1986))
C Gurewich and Pan
nell) Niblat (Blood) 69. 76
9 (1987)], this sensitivity to totropine is a disadvantageous property for pro-UK.

As mentioned above, the thrombolytic enzymes t-PA and p
r o-UK is converted into an unfavorable form by the action of proteases such as plasmin and thrombin. Therefore, if the method described in the present invention can be used to add sugar chains near the cleavage site of these proteases and reduce the sensitivity to these proteases, it is expected that a more excellent thrombolytic enzyme will be produced. From this point of view, the 164th Phe residue of the mature pro-UK was converted to an Asn residue, and the DNA encoding the derivative UK-Sl, in which the N-glycoside-linked 11i compound was introduced into this Asn residue, The 153rd Leu residue of mature pro-UK was replaced with an Asn residue, and the 155th Pro residue was replaced with a Thr residue, and this Asn residue was replaced with an N
- A DNA encoding a derivative UK-33 into which a glycoside-linked sugar chain was introduced was constructed.

Note that the natural pro-UK used in the present invention, UK-31
The amino acid sequences of UK-S3 and UK-S3 are shown in Table 5 and
It is shown in Tables 6 and 7.

In the present invention, pro=UKSLTK-31 and UK-
Pro-UK
and UK-51 and UK with new sugar chains added.
-33 is manufactured. The p r o obtained in this way
-UKl When comparing the properties of UK-Sl and UK-33, UK-31 and UK-53 are naturally pro-
It was found that the sensitivity to thrombin was lower and the blood stability and thermal stability were improved compared to the UK case, demonstrating the effectiveness of the present invention also in the UK case.

When the polypeptide or glycosylated polypeptide of the present invention is hG-CSFSUK or t-PA,
DN encoding hG-CSF, UK or t-FA
A is hG-CSF.

Metsenger RN code UK or t-PA
cDNA obtained by reverse transcription from A using recombinant DNA technology
, DNA encoding hG-CSF1tJK or t-'-PA obtained from chromosomal DNA.

Synthetic RNA encoding hG-C5FSUK or t-PA can be used.

Any hG-CSF cDNA can be used as long as it encodes hG-CSF, and specifically, pcSF2 can be used. pCSF2 was produced by the present inventor, and its production method is described in Reference Example 4.

The hG-CSF cDNA in pcsF2 was purified using dideoxy phage (dideox) using M13 phage.
y 5equence) method [Jay Messing (J,
! Jessing et al.: Gene 19,
269 (1982)). pCSF
The hG-CSF cDNA in 2 lacks part of the signal sequence but completely contains the mature protein part. The base sequence of the mature protein portion is shown in Table 1.

As human t-PA cDNA or human UK cDNA, any cDNA that encodes human t-PA or human UK can be used.
Specifically, plasmid ptPA? human t-PAcD in
NA or plasmid ptJKl or pUKll
Human UK cDNA in can be used. ptP
A7, pUKl, and pUKll were manufactured by the present inventor, and the manufacturing method thereof is described in Reference Examples 1 and 2.3. UKcD in pUKl and pUKll
NA was determined by the dideoxy 5 sequence method using M13 phage.

Although the human UK cDNAs in pUKl and pUKll do not encode complete pro-UK, the base sequences of each cDNA partially match the base sequences shown in Table 5.

In addition, E. coli containing ptPA7 is ε5cherichi
acoli BtP^? (FBRM 0P-1467)
As Escherichia coli containing pUKI
a coli El 1 (FERM 0P1463
), and E. coli containing pUKll as Esche
richia coli El to 11 (FERM 0
P-1464) and was deposited with the Institute of Microbial Technology (Feikoken) of the Agency of Industrial Science and Technology on September 3, 1986.

DN encoding hG-CSFSUK or t-PA
Any plasmid can be used as the plasmid for incorporating A as long as the DNA can be expressed in E. coli or animal cells. Preferably, hG-
In order to express CSF%UK or t-PA, foreign DNA can be inserted downstream of an appropriate promoter, such as a trp system or Iac system promoter, and a Shine-Dalgarno sequence (hereinafter referred to as an SD sequence) can be inserted. ) and the start codon (ATG) by an appropriate distance, for example, 6
A plasmid adjusted to ~18 bases can be used. A specifically suitable plasmid is pKYPIO (Japanese Patent Application Laid-Open No. 58-11060) constructed by the present inventors.
0), pTrS33 (Reference Example 5), and the like.

Further, as a plasmid used when expressing DNA encoding hG-CSF, UK, or t-PA in animal cells, any plasmid that can express the DNA in animal cells can be used. Preferably, a suitable promoter, for example SV40 early promoter
-9-1 Foreign DNA can be inserted downstream of the SV40 late promoter, and a plasmid having a polyA signal, a splicing signal, etc. can be used.

A specifically suitable plasmid is pAGE103 constructed by the present inventors [: Mizukami et al.: Journal on Biochemistry (J, Biochem
,).

101, 1307-1310 (1987)], ps.
EIPA1-9A and psEIPAlsEldh f r
1-9A (Reference Example 9) and the like.

E. coli containing pAGE 103 is Bscherichi
acoli EAGE 103 (FERM BP
-1312) and was deposited with the Institute of Fine Technology on March 23, 1986. In addition, dihydrofolate reductase (hereinafter d
For example, pSV2-dhfr[:
1st Subrama? -(S, Subramani) et al:
Molecular and cellular biology (Mo
l, Ce1l, Riot, ) 1.854 (1
981) E etc.

D encoding novel polypeptides and novel glycosylated polypeptides of hG-CSF, UK or t-PA
Recombination of NA and vector DNA can be performed using mono-quantitative recombinant DNA techniques, in which both DNAs are digested with restriction enzymes and then ligated using T4 DNA IJ gauze. For ligation, the ends of DNA fragments digested with restriction enzymes are processed using a embedding reaction using DNA polymerase I/Klenow fragment, an embedding reaction or shaving reaction using T4 DNA polymerase, or a DNA IJ linker is used. It can also be done by a method.

Using pC5F2 as a plasmid carrying h G-CS F c DNA and pUKl and pUKll as plasmids carrying pro-UK cDNA, and if necessary, using a chemically synthesized DNA IJ linker or site-specific mutation, h G- An example of constructing a recombinant plasmid incorporating DNA encoding CSF and a novel UK polypeptide or a novel glycosylated polypeptide will be described below.

First, hG-CSF drama conductor hG-CSF (ND28)
An example of constructing a recombinant plasmid pA328 for expressing (see Reference Example 16) in animal cells will be described.

As shown in FIG. 5, pAS3-3 (Reference Example 1
After cutting 0) with Mlur and ApaLI, about 3,
Purify the OKb DNA fragment. The same plasmid was also used as A
After cutting with atI and Mlul, approximately 6.3 Kb of DNA was obtained.
Purify the fragments. On the other hand, pCfBD28 (Reference Example 16
(see) was cut with Aat■ and XhoI, approximately 0.3 Kb
Purify the DNA fragment. These three DNA fragments and the synthetic DNA shown in FIG. 5 are ligated using T4 DNA ligase to obtain pA328.

Next, an example of constructing a recombinant plasmid pASN6 encoding a novel hG-C9F plasmid having an addition site for an N-glycoside-linked sugar chain at the 6th amino acid residue from the N-terminus of hG-CSF (NO38). Let's talk about.

As shown in FIG. 6, pAS3-3 was
After cutting with I and ApaLI, approximately 3. Purify the OKb DNA fragment. In addition, pAS28 was combined with Xhol and M l
After cutting with uT, a DNA fragment of approximately 6.55 Kb is purified. These two DNA fragments and the synthetic RNA shown in Figure 6 were joined using 74DNAIJ gauze to create pASN6.
get.

Next, the 14th
An example of constructing a recombinant plasmid pASN145 encoding a novel hG-CSF polypeptide having an N-glycoside-linked sugar chain addition site at the fifth amino acid residue will be described.

Construction of pASN145 is performed using site-directed mutagenesis. As shown in Figure 7(1), pCfBD28 was
After cutting with n and BamHI, a DNA fragment of approximately 0.94 Kb is purified. In addition, Ml of M13 phage vector
After cutting 3mp 19RF DNA with Sma I and Bam HI, a DNA fragment of about 7.24 Kb is purified. The two DNA fragments thus obtained are ligated using T4 DNA ligase to obtain pt19BD28C. Next, this pt19B028c was transfected into Escherichia coli JM105, and single-stranded pt19BD was extracted from the obtained phage.
Get 28c. As shown in the same Figure 7(1), M
After cutting 13mp19RF DNA with H-indm and EcoRI, a DNA fragment of approximately 7.2 Kb is purified. This approximately 7.2 Kb DNA fragment and the single-stranded p
t19BD28c is mixed and annealed again after denaturation treatment to generate gapped duplex DNA, which is then purified. Next, this gapt
The synthetic N shown in Figure 7(1) is added to the duplex DNA.
After annealing A, it is brought into its current state using the R//- fragment and T4 DNA ligase. This circularized DNA was transferred to E. coli J
M105 strain is transfected to obtain pt19BD28cN145 into which site-specific mutations have been introduced.

Next, as shown in Figure 7(2), pt19BD28N
Bgj CN 145! After cutting with I and BamHI, approximately 0
．． 85. Purify the DNA fragment b. On the other hand, pcfBD
After cutting 28 with Ba-mHI and BgiI, approximately 3.25 b
Purify the DNA fragment. The two DNs obtained in this way
pcfBD28N145 is obtained by ligating each A fragment with T4DNAIJ gauze.

Next, as shown in the same FIG. 7(2), pCfBD
After cutting 28N145 with Bann[ and BamHI, a DNA fragment of approximately 1.3 Kb is purified. After cutting the approximately 1.3 Kb DNA fragment thus obtained with DdeI, the DNA
After filling in the protruding ends by treatment with polymerase Klenow fragment and further cutting with AatU, the DNA fragment of approximately 0.2b is purified. In addition, pAS28 was converted into AatII
After cutting with and XhoI, a DNA fragment of about 0.8 Kb is purified. Also, I) SEIPAISEldhfrl-9A
After cutting (Reference Example 9) with Sma■ and Xhol, approximately 8.
Purify the 7 Kb DNA fragment. Approximately 0.
pASN was created by ligating three DNA fragments of approximately 0.8 to b1 to approximately 8.7 to b using T4 DNA ligase.
I get 45.

Next, we will describe an example of constructing a recombinant plasmid psEIUKSI-1d that expresses UK-31, a UK derivative with an N-glycoside type sugar chain added near the thrombin cleavage site, in animal cells.

As shown in Figure 9, pUKl (Reference Example 2)
After cutting with Pstl and BamHI, 890hp of D
Purify the NA fragment. On the other hand, Ml 3mp 18RFD
NA C Yan 1sch-Peron
ron) et al.: Gene 33. 103(1
985) ] with Pstl and BamHI, the DNA fragment of b is purified to approximately 7.2. Both DNA fragments obtained in this way are converted into T4DNA! The plasmid pUKmps1 was obtained by ligating with J gauze and subcloning part of the UK cDNA into the Ml 3mp 18 vector.

Next, after preparing the single-stranded DNA of pUKmpsl by a conventional method, as shown in FIG.
The base sequence is changed so that an N-gugucoside sugar chain is added to the th amino acid residue. That is, the synthetic NA 5'-GGGG for converting Phe-164 to Asn
AGAAAACACCA CC-3' and Ml 3mp1
Using synthetic DNA 5'-GTTTTCCCAGTCACGAC-3' for DNA sequencing of No. 8 as a primer, the single-stranded DNA of pUKmpsl was converted into double-stranded DNA using Escherichia coli DNA polymerase and Klenow fragment.
At the same time as converting to NA, a mutation is introduced at a desired position. The double-stranded DNA into which mutations have been introduced in this way is transformed into Pst
After digestion with EcoRI and EcoRI, a DNA fragment of approximately 600 bp is purified. On the other hand, pUKll carrying UK-cDNA
After cutting (Reference Example 3) with Aat■ and Pstl, approximately 1
．． Purify the DNA fragment of 0.b. Also, UK cDN
pUKB with Kpn I site introduced at the 3' end of A
After cutting lol (Reference Example 12) with AatII and EcoRI, a DNA fragment of about 2.9 Kb is purified. The three types of DNA fragments obtained in this way are T4DNA!
J gauze to obtain the recombinant plasmid pUKSI encoding the UK derivative UK-31.

Subsequently, as shown in FIG. 11, a foreign gene expression vector psEIPAlsEldhf rl-9A (Reference Example 9) having the dhfr gene for gene amplification was prepared.
) was cut with Kpn I and Xho I, and then b
The DNA'A fragment was purified. On the other hand, recombinant plasmid psEIUKprol-LA expressing UK (Reference Example 1
After cleaving 3) with Xhol and 8g1■, a bdDNA fragment of approximately 0.75 was purified. In addition, after cutting pUKsl encoding UK-31 with KpnI and BgIl■,
A DNA fragment of approximately 1.15 Kb is purified. The three types of DNA fragments thus obtained are joined together using T4DNAIJ gauze to obtain a recombinant plasmid psEIUKSI-1d capable of expressing UK-3t.

Similarly, a recombinant plasmid pSEUKS3 capable of expressing UK-33 can be obtained.

The reaction conditions in the above recombinant technique are as follows.

Digestion reaction of DNA with restriction enzymes is usually 0.1-20u.
g of DNA at 2-200mM (preferably 10-40mM
M > T r i s -HCl (p) 16.0-9
．． 5 preferably pH 7.0-8.0), O-200m
M of NaCl 1,2-20Il1M (preferably 5-10
Restriction enzyme o
, t-too units (preferably 1 for 1 μ of DNA)
~3 units) at 20 to 70°C (the optimal temperature varies depending on the restriction enzyme used) for 15 minutes to 24 hours. The reaction is usually stopped by heating at 55 to 75°C for 5 to 30 minutes, but a method of inactivating the restriction enzyme with a reagent such as phenol or diethylpyrocarbonate can also be used.

Purification of DNA fragments or gapped duplex DNA generated by restriction enzyme digestion is performed using low melting point agarose gel electrophoresis (hereinafter abbreviated as LGT method) [
El Wieslander (L, Wieslander) =
Analytical Biochemistry
icalBiochemistry) 98.305 (
1979) or the agarose gel freeze-thaw method (hereinafter abbreviated as AFT method).

This AFT method is an agarose gel containing DNA fragments (
equal l TEa for slices (0.7-1.5%)
Equilibrium [10mM Tris-HCj! (pH 7,5
), 1mM EDTA] and twice the amount of phenol (saturated with TEil buffer) and after mixing,
This is a method in which freezing and thawing are repeated twice at -70°C and 65°C, and then the upper aqueous solution produced by centrifugation is separated, and DNA fragments are recovered by ethanol precipitation.

DNA fragment recovery machine Max Yield A E-324
DNA fragments can be eluted and purified from agarose gel or polyacrylamide gel by electrophoresis using Type 1 (manufactured by Atto Co., Ltd.) [Hereinafter, this method will be abbreviated as electro-elution method. ].

The DNA fragment binding reaction is carried out using 2 to 200 mM (preferably 10 to 40 mM) Tris-HCl (pH
6.1 to 9.5, preferably pH 7.0 to 8.0),
2-20mM (preferably 5-10mM) MgCl3
．． 0.1-10mM (preferably 0.5-2.0mM
) ATP% 1-50mM (preferably 5-10mM)
In a reaction solution containing dithiothreitol (hereinafter also referred to as DTT), using T4 DNA ligase 1 to t, ooo units, at 1 to 37°C (preferably 3 to 20°C) for 15 minutes to
It is carried out for 72 hours (preferably 2 to 20 hours).

The recombinant plasmid DNA produced by the ligation reaction is
If necessary, the transformation method of Cohen et al.
SA, 69.2110 (1972)) or Hanahan's transformation method [)1anahan: Journal on Molecular Biology (J, Mo1. Bi
ol, > 166, 557 (1983)) into E. coli.

Recombinant M13 phage RF generated by binding reaction
DNA can be obtained by known transfection methods if necessary [
Yoshiyuki Kuchino et al.: Proteins, Nucleic Acids, Enzymes, 294 (198
4)), Escherichia coli strain JM105 [JoMessing et al.: Gene 3]
3.103 (1985)].

Isolation of recombinant plasmid DNA and recombinant M13 phage RF DNA from Escherichia coli was performed using the method of Birnboim et al.
, C. Birnboim) et al.: Nucleic Acid Research.
7, 1513 (1979)).

One bottle from recombinant M13 phage $11 DN
Isolation of A is performed according to a known method [Yoshiyuki Kuchino et al.: Proteins, Nucleic Acids and Enzymes 29, 294 (1984)].

The deoxyoligonucleotide used in the present invention is synthesized using a solid phase synthesis method C8,L using the phosphate amidite method.

Beaucage et al.: Tetrahedron Letters (Te
tra-hedron LettJ 22.1859 (
1981)], andori, 'J.

BcBrie et al. 24.245 (1983)), Applied Biosystems 380A-D
NA Synthesizer [Applied Biosystems
In'c1Foster C1ty, C^9440
4]. When using the synthesized deoxyoligonucleotide in a reaction to combine with other DNA fragments, approximately 20 picomoles (pmoles)
) deoxyoligonucleotides in 204 T4 kinase buffer 1:50mM Tris-HCj! (pH7
,6), 10mM MgCl= , 5mM DTT
, 0.1 mM EDTA, 0.5 mM ATPI by adding 5 units of T4 DNA kinase.
′-phosphorylate. When used as a probe for hybridization, add 20 to 50 mM ATP in place of 0.5 mM ATP in the T4 kinase buffer described above.
μCi Cr-”P”JATP (3000Ci/mm
o+, 7 fujiam (^mersham, Arli
The 5' end is radiolabeled using Arlln Heights, It).

For structural analysis of plasmid DNA, refer to plasmid D
After digesting NA with 1 to 10 types of restriction enzymes, the cleavage site is examined by agarose gel electrophoresis or polyacrylamide gel electrophoresis. Furthermore, when it is necessary to determine the base sequence of DNA, we use the dideoxy 5 sequence using the Noodle 13 phage.
) determined by law.

The polypeptide and glycosylated polypeptide of the present invention can be produced in the following manner using E. coli or animal cells as a host.

First, an example of producing a novel hG-CSF polypeptide using E. coli as a host will be described.

A plasmid (e.g. pcfBD28N145) was used to inoculate E. coli with the -12MM294 strain (Proc, Natl.

Acad, Sci, USA, 73. 417
4.1976> and ampicillin resistance (^
pcfBD28N1 from among the colonies of
45 is selected. pcfBD28N14
By culturing E. coli containing 5 in a medium, a novel hG-C5F polypeptide can be produced in the culture.

The culture medium used here is for the growth of E. coli and for new h.
Both synthetic and natural media can be used as long as they are suitable for producing G-CSF polypeptides.

Carbon sources include glucose, fructose, lactose, glycerol, mannitol, sorbitol, etc., and nitrogen sources include NH4Cj! , (NH4)2S
Other nutritional sources include O4, Casamino Acids, Yeast Extract, Polypeptone, Meat Extract, Batatotryptone, Corn Steep Liquor, and HPO.

)1. PO,, NaC1, Mg5Oa, vitamin B
1, MgCl2, etc. can be used.

Cultivation is carried out at pH 5.5 to 8.5 and temperature of 18 to 40° C. with aeration and stirring. Since the novel hG-CSF polypeptide accumulates in the cultured cells after 5 to 90 hours of culture, the cells are collected from the culture, and the cells are disrupted by ultrasonication.
Centrifuge to obtain bacterial cell residue. From this bacterial cell residue, the method of Marston et al. [F, A, 0, Marston et al.
[110/TεCHNOLOGY 2.800 (19
84)) or the method of Pennica et al.
et al.

! Nature (~ture) 3 (II, 214<
4983) E, or the method of Winkler et al. [W
inkler et al.: Bio/Technology (810/TBCHNOLOGY) 3, 990(1)
985)'], the novel hG-C5F polypeptide can be extracted, purified, solubilized, and regenerated.

Next, a method for producing a novel hG-CSF polypeptide or a novel hG-C5F glycosylated polypeptide using animal cells as a host will be described.

Novel hG-CSF polypeptide or new hG-CS
As a host for expressing the F-glycosylated polypeptide, any animal cell that can express the polypeptide or the glycosylated polypeptide can be used. Specifically preferred animal cells include dhf
r-deficient CHD cells [G, Llrlaub & L, A, C
hasin): Proc.

Natl, ^cad, Sci,, USA, 77,
4216 (1980)).

An example of producing a novel hG-csF polypeptide or a novel hG-CSF glycosylated polypeptide using pASN6 as a plasmid expressing a novel hG-CSF and dhfr-deficient CHO cells as a host will be described below.

Plasmid pASN6 was prepared using, for example, the calcium phosphate method [Graham & Van der Nyb].
der Eb): Virology
52, 546 (1978)] LJ, F) d
h f r-deficient CHO strain.

Transformants having pASN6 can be selected, for example, using MEM ALPHA medium (ribonucleic acid and deoxyliponucleic acid free: manufactured by Gibco Oriental) containing 6418 and dialyzed fetal bovine serum. Furthermore, new hG-C was extracted from among the transformed strains using methotrexate.
It is also possible to obtain a transformed strain in which the 8F polypeptide gene is amplified.

By culturing the obtained transformed strain in a medium, a novel hG-CSF polypeptide or a novel hG-
C9F glycosylated polypeptides can be produced.

Examples of the culture medium include Ham's FIO medium supplemented with various serums (e.g., fetal bovine serum), Ham's F12 medium (manufactured by Flow Lab), Dulbecco's MEM medium, RPMI-1640 medium (manufactured by Hinaga Pharmaceutical Co., Ltd.), MEMALPHA medium, and the like. A mixed medium is used. For the culture medium, if necessary,
Glutamine 0.5-5mM, antibiotic [henicillin (2
5U/1Tll), streptomycin (257zg/
ml), G 418 (0.3 mg/ml, etc.), baking soda (0.01%), etc. may be added in appropriate amounts.

For culturing, various culture bottles, dishes, roller bottles, spinner flasks, jar fermenters, etc. can be used. Culture is usually carried out at a seed cell density of 5×
10' to I x 10' cells/ml, 30 to 40
℃ for 2 to 10 days, the substance of the present invention is mainly secreted outside the cells depending on the cell density.

Cells were removed from the culture by centrifugation, and fresh h
G-CSF polypeptide or novel hG-C5F
Separate and extract the glycosylated polypeptide.

The above describes the method for producing a novel polypeptide and a novel glycosylated polypeptide using E. coli or animal cells as a host in the case of hG-CSF, but the same method can be used for producing UK or any other protein. Can be done.

Furthermore, the hG-CSF activity obtained as described above is measured as follows.

Bone marrow cells were aseptically removed from the femurs of 8- to 12-week-old C3H/He male mice (Shizuoka Experimental Animal Cooperative Association), and a-Minim was added with 10% fetal bovine serum (FBS).
um Es5nential Medium (Flow
Laboratories (hereinafter abbreviated as a-MEM medium). This cell (approximately 5XlO' cells) suspension 1.
5 ml of nylon wool
(Wako Pure Chemical, Nylon Fiber 146-0
4231> in a column (0.3 g) packed with 5%
React for 90 minutes at 37°C in a CO incubator. Next, α-MEM medium preheated to 37° C. is passed through the column to obtain bone marrow cells that are eluted and non-adsorbable to nylon wool. The cells are washed once with α-MEM medium and adjusted to a predetermined concentration.

Then, the method of Mabe et al. [0kabe T, et al.
, cancerResearch 44.4503-
4506 (1986)], the bone marrow hematopoietic stem saturation colony forming ability is measured. That is, a-MEM 0.
0.2 ml of bone marrow cells (2×10′ cells/ml) prepared in the above method is mixed with a mixture of 0.4 ml of 2ml11FBS and 0.2 ml of each sample diluted in two stages. Add to this 0.6% agar (1 fco,
^gar purified # 0560-01) solution was mixed in equal volume (1.0 ml), and 0.5 ml was
Hole multi-date 5 (manufactured by Nunc, $143982)
) (5 x 10' pieces/dish, n=3)
a) Culture at 37°C for 7 days in a 5% CO2 incubator, and count the number of colonies consisting of 40 or more cells using a microscope (Olympus, x40). After counting the colonies, they were carefully taken out onto a slide glass, fixed for 30 seconds with a mixture of acetone and formalin, and then subjected to the method of Kubota et al. XI),
Hematology, 8.339-344 (19
80)) to perform esterase type 2 staining and identify each colony.

The titer of each sample is calculated as follows from the counting results in the two-step dilution of the colony formation test.

The activity that gives the maximum A value for colony formation of intact G-CSF used as a standard is defined as 50 units, and in order to convert this to the dilution rate of each sample and the activity per unit ml, multiply it by 20 and calculate the power. value (unit).

Specific activity is the titer (unit/■) per unit protein (mg)
Display in .

In addition, the protein amount of hG-CSF is
It is determined by enzyme-linked immunosorbent assay (ELISA) using monoclonal antibodies. The standard material used at this time was E. coli-produced,
A hG-CSF preparation purified and quantified by the Lowry method is used. In addition, the anti-hG-CSF monoclonal antibody was prepared using the method of Hana et al. [Hana et al.: Cancer Research.
rRes,).

46, 4438 (1986)). The activity of t-PA or UK is
Plate 0 assay [: Granelli-Pipe
rno and Re1ch: Journal on Experimental Medicine (J, ExP, Med,) 14
8, 223 (1978)).

Examples in which the polypeptide or glycosylated polypeptide of the present invention is hG-CSF or UK will be described below. Examples 1 to 5 are examples in which the polypeptide or glycosylated polypeptide of the present invention is hG-C5F, and Examples 6 to 13 are examples in the case of UK.

Example 1 Construction of recombinant plasmid pA328 for expressing hG-C5F derivative hG-CSF [ND28] (see Reference Example 16) in animal cells (see Figure 5): pAS3 obtained in Reference Example 10 -32■ 10mM
Tri 5-HCl (pH 7,5), 7mM
g C12, 6mM 2-mercaptoethanol and 150mM NaCj! (hereinafter referred to as “Y-
150 buffer solution), 10 units of restriction enzyme Mlul (manufactured by Takara Shuzo Co., Ltd.; all restriction enzymes hereinafter are manufactured by Takara Shuzo Co., Ltd. unless otherwise specified) were added, and a digestion reaction was carried out at 37°C for 2 hours. , 5 units of ApaL I were added, and a partial digestion reaction was further carried out at 37°C for 10 minutes.From this reaction solution, the DNA of approximately 3.0 b was extracted by the LGT method.
Approximately 0.5 g of the fragment was purified and collected.

Also, the same plasmid 2. 10mM Tris-HCj
! (pH 7,5), 7 mM M g Cl 2.6
mM 2-mercaptoethanol and 50 mM K
1 (hereinafter abbreviated as "K-50 buffer"), 10 units of restriction enzyme AatII (manufactured by Toyobo Co., Ltd.) was added, and a digestion reaction was performed at 37°C for 2 hours.

After that, NaC was adjusted to 11g to 100mM.
Add C1, add 10 units of M l u T, 37
The reaction was further carried out at ℃ for 2 hours. From this reaction solution, LGT
Approximately 1 inch of a DNA fragment of approximately 6.3 Kb was purified and recovered using the method.

Separately, 2 g of pCfBD28 (see Reference Example 16) was dissolved in 20 d of Ni-50 buffer, 10 units of restriction enzyme Aatff (manufactured by Toyobo Co., Ltd.) was added, and a digestion reaction was performed at 37° C. for 2 hours. Then, NaCJ was added so that the NaC1 concentration was 50mM, 10 units of Xhol was added, and the temperature was kept at 37°C.
The digestion reaction was carried out for an additional 2 hours. From this reaction solution, LG
A DNA fragment of approximately 0.1R of approximately 0.3 Kb was purified and recovered by the T method.

On the other hand, the N-terminal amino acid T of mature hG-C5F
hr is replaced with Ala, and the third amino acid Leu is replaced with Th.
r, Gly, the fourth amino acid, Tyr, and Pr, the fifth amino acid.

To replace with Arg, use the following DNA! A J-linker was synthesized.

First, -heavyweight DNA (43mer, 2 types) was synthesized using an Applied Biosystems 3g0A-DNA synthesizer. Next, synthesized DNA (43mer,
2 types), 20 pmol each, 50mM T
r 1s-HCR (pH 7,5), 10mM Mg
C1zs 5mM dithiothreitol, 0.1mM
Dissolve in 40 d of a buffer containing EDTA and 1 mM ATP (hereinafter abbreviated as "T4 kinase buffer"), add 30 units of T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.), and incubate at 37°C for 60 minutes. A phosphorylation reaction was performed.

M I u I -A derived from pAS3-3 obtained above
paLI fragment (approximately 3.0 Kb) 0.5. AatII-Mlul fragment derived from the same plasmid (approximately 6.3 b) 1.
0g and Aatn-Xhol fragment (0,3 Kb) from pCfBD28 0.1. 20mM Tris-
HCJ (pH 7,6), 10mM MgCl,
, 10mM dithiothreitol and 1mM ATP
(hereinafter this buffer will be abbreviated as "T41J gauze buffer") containing the above D.
NA! Approximately 1 pmol of Inker was added.

Add T4DNA to this mixed solution! 400 units of J gauze (manufactured by Takara Shuzo Co., Ltd., hereinafter the same) were added, and a binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli H.
Strain 8101 [Bolivar et al.: Gene (
Gene) 2.75 (1977)] using the method of Cocone et al.
n) et al.: Proceedings on the National Academy of Sciences (Proc. Natl. A.
cad, sci,) USA.

69, 2110 (1972)) (hereinafter, this method will be used for the transformation of E. coli) to obtain an ampicillin (Ap) resistant strain. From this transformed strain, a known method [H.C. Birnboim (If.

C., Birnboim) et al.: Nucleic acid.
Research (Nucleic Ac1ds Res,)
7, 1513 (1979)) (hereinafter referred to as plasmid D
Plasmid D was isolated using this method.
NA was isolated.

The structure of the resulting plasmid was determined by restriction enzyme digestion and M1
Confirmation was made by the Deideoxy Seefence method using 3 phages. This plasmid is called pA328 (see Figure 5). The microorganism containing plasmid pΔ32B is Es
cherichia coliBAS2B FBRM
It was deposited with the Institute of Fine Technology on September 24, 1986 as 0P-2069. The polypeptide (hG-CSF derivative) encoded by the plasmid has the following amino acid residue substitutions compared to mature hG-CSF.

The polypeptide (hG-CSF derivative) encoded by pA328 is hereinafter referred to as hG-C5F [ND2g].

Example 2 Encodes a novel hG-C5F polypeptide in which an N-glycosidic sugar chain can be added to the 6th amino acid residue from the N-terminus of hG-C5F [ND28] (see Reference Example 16) Construction of recombinant plasmid pASN6 (see Figure 6): pAS3- obtained in Reference Example 1O
32ug was dissolved in 20ml of Y-150 buffer, 10 units of restriction enzyme M lul was added, and a digestion reaction was performed at 37°C for 2 hours. Thereafter, 5 units of ApaLI were added, and a partial digestion reaction was further performed at 37°C for 10 minutes. From this reaction solution, approximately 3.0 and approximately 0.5 b DNA fragments were obtained using the LGT method.
(2) was purified and recovered.

Separately, dissolve pA328 2■ obtained in the previous section in 20cm of 'f'-150 buffer, add restriction enzyme Xhol and Mlu■
10 units of each were added, and the digestion reaction was carried out at 37°C for 2 hours. From this reaction solution, approximately 6.55 b
A DNA fragment of 1.0 mm was purified and recovered.

On the other hand, hG-C5F encoded by pAS28 of Example 1
In order to replace Ala, the 6th amino acid from the N-terminus of CND28) with Asn, and form an addition site for an N-glycoside-linked sugar chain, the following DNA! I synthesized a J-linker. DNA below! New 5naB1 in J car
Since the design is such that a cleavage site is created, the linker was incorporated by cutting with the restriction enzyme 5naB1! ! I can endure it.

Ipponko DNA (43mer% 2 types) was synthesized using an Applied Biosystems 380A-DNA synthesizer.

Synthesized DNA (43mer, 2 types) l;! #
(7) Dissolve 20 picomole of O(7) in 40 μg of T4 kinase buffer, T4 polynucleotide kinase 3
0 units was added and the phosphorylation reaction was carried out at 37°C for 60 minutes.

0.5 gg of the Mlul-ApaL fragment derived from pAS3-3 (approximately 3.0 Kb) obtained above and 1 g of the Xho I-M Jul fragment derived from pAS 28 (approximately 6.55 Kb) were dissolved in T4 ligase buffer containing a total volume of 30 Makoto. About 1 picomole of the above D N A Unker was added to this mixed solution.

Add 400 units of T 4 DNA to this mixture! I
Gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the reaction mixture containing the recombinant plasmid, E. coli strain H8101 was transformed by the method of Cohen et al. (both inversely) to obtain an Ap-resistant strain. Plasmid DNA was isolated and purified from this transformed strain according to a known method. The structure of the plasmid DNA was determined by restriction enzyme digestion and M13
・Confirmed by Deideoxy Sea Fence method using phages. This plasmid is called pASN6. The microorganism containing plasmid pASN6 is Escherichia
It was deposited with the Institute of Fine Technology on September 24, 1986 as a coli EASN6 FERM 0P-2070.

The polypeptide (hG-CSF) encoded by the plasmid
Is conductor) has the following amino acid residue substitutions compared to mature hG-C5F.

The polypeptide (hGCSF derivative) encoded by pASN6 is hereinafter referred to as hG-CSF [ND28N6].

Example 3゜bG-cSF [:ND28] (See Reference Example 16)
Recombinant plasmid pAsN1 encoding a novel hG-CSF polypeptide in which an N-glycoside-linked sugar chain can be added to the 145th amino acid residue from the N-terminus of
Creation of 45 [No. 7 (see Figure 13 and Figure 7 (2)])
: (a) Template-end strand DNA (-end strand pt19B02
8c) Creation: pCfBD28 (see Reference Example 16) 3
μg of 10mM Tri 5-HCI (pH 7
, 5>, 7mM MgCl! *, dissolved in 20% buffer solution (hereinafter abbreviated as "Y-0 buffer") containing 6mM 2-merjybutene9)-ol, and IO unit of restriction enzyme pvuff was added, followed by a digestion reaction at 37°C for 2 hours. Ta. Then, add NaCj! so that the NaCl1 concentration is 100mM.
was added, 10 units of BamHI was added, and the reaction was further carried out at 37°C for 2 hours.

From this reaction solution, hG-CSF[ND2
Approximately 0.94 Kb DNA encoding the C-terminal part of [8]
Fragment (PvulI-Barr+Hr fragment) about 0.5Ji
I got g.

On the other hand, the M13 phage vector Mt3mp 19
RFDNA (manufactured by Takara Shuzo Co., Ltd.) 1■ in total amount of 50d Y-
0 buffer, 10 units of restriction enzyme Sma I was added, and a digestion reaction was performed at 37°C for 2 hours.

After that, add NaC so that 1g of NaC becomes 100mM.
Add C1, add IO units of restriction enzyme BamHI and add 37
Digestion reaction was carried out at ℃ for 2 hours. From this reaction solution, approximately '? , 24 Kb DNA fragment (Smal
-BamHI fragment) about 0.8. I got it.

Pvun-BamHI fragment obtained above (approximately 0.94 Kb
) 0.2J1g and Sma l-BamHI fragment (approximately 7
．． 24Kb) 0.05cm was dissolved in 50 units of T4 ligase buffer, 400 units of T4 DNA IJ gauze was added to this mixture, and the binding reaction was carried out at 12°C for 16 hours using a known method [Messing et al.: Methods]. In Enzymoron-(Methods inεr+zymo
Escherichia coli strain JM105 was transfected using the above reaction solution according to the method of E. coli, 20 (1983)] to obtain a recombinant phage. From the cultured cells of Escherichia coli JMI strain 05 infected with this recombinant phage, recombinant M1 was extracted according to the plasmid DNA recovery method.
3 phage RF DNA was recovered.

This RFDNA (this is called pt19B028c)
The structure of was confirmed by digestion with BamHl, EcoRI, and Bgfl, and polyacrylamide gel electrophoresis. Single-stranded pt19BD28c was recovered from this recombinant phage according to the above-mentioned known method and used as a template.

) gapped duplex DNA (Gap
Creation of pedDu'plex DNA>: Ml
3mp 19RFDNA (manufactured by Takara Shuzo Co., Ltd.) 3JLg in 1
0mM Tris-HCl (pH 7,5), 7mM
MgCl2.6mM 2-mercaptoethanol and 100mM NaCj! Buffer solution containing [hereinafter referred to as “Y
The restriction enzymes EcoRI and )(indII) were added in 10 units each, and the digestion reaction was carried out at 37°C for 2 hours. From this reaction solution, approximately 7.2 Kb DNA fragment (EcoRr-Hindm fragment) approximately 2.5tLg
I got it.

EcoRI-Hind derived from this mp 19RF DNA
III fragment (approximately 7.2 Kb)2. The template-end strand DNA obtained in the previous section, pt19BD28CIN, was diluted with 50mM Tr.
is-HCl (pH 7,8), 7mM g C12
The DNA was dissolved in a buffer solution (hereinafter abbreviated as "1 Klenow buffer") containing 6 mM 2-mercaptoethanol and denatured by boiling at 100°C for 6 minutes. Thereafter, the DNA was denatured at 65°C for 10 minutes at 37°C. The template was left for 40 minutes at 4°C, 40 minutes at 4°C, and 10 minutes in water to perform an annealing reaction to generate gapped duplex DNA in which only the hG-CSF gene portion in the template was single-stranded. Gapped duplex DNA was recovered by the LGT method.

(C) Mutagenesis (ρt 19BD28CN 1
45) h encoded by pA328 obtained in Example 1
c-CSF CND28] 145th from 173N terminus
A single tJI DNA shown below was synthesized by replacing Gln, the amino acid No. 1, with Asn, and Arg, the amino acid No. 147, with Set, to form an addition site for an N-glycoside-linked sugar chain. Below - End strand DNA
Some of them are designed to generate a new Pvu I site, so those into which a mutation has been introduced can be protected by cutting this site with the restriction enzyme Pvul.

- Synthesis of the heavyweight DNA was carried out using an Applied Neuiosystems 380A-DNA synthesizer. 1 g of the synthesized single-stranded DNA was dissolved in 50 d of T4 kinase buffer, 30 units of T4 polynucleotide kinase was added, and a phosphorylation reaction was performed at 37° C. for 60 minutes.

Next, this phosphorylated one-stack DNA 0.2 u
g and the gapped duplex DNA obtained in the previous section.
1 ug of 6.5mM Tri 5-HCI (
pH7.5), 8mM MgCi
*, 1mM 2-MeJL/captoethanol and 100mM NaCj! A buffer solution 34d containing
Dissolve it in and leave it at 65℃ for 60 minutes and at room temperature for 30 minutes.
1 taDN A gapped decoplex DN
A was annealed.

Add dATPldTTP and dCTP to this solution.

After adding dGTP to 0.5mM each,
1.5 units of DNA polymerase ■ Klenow fragment and 4
00 units of T4DNA! J gauze was added and an elongation reaction was performed at 4°C for 16 hours.

E. coli JM105 was transfected using the reaction solution to obtain a mutated phage.

RF from E. coli JM105 infected with mutagenic phage
The DNA was recovered and the structure V11
confirmed. pt the RF DNA into which the desired mutation has been introduced.
It is called 19BD28cN145.

(6) Construction of pcfBD28N145 (see Figure 7 (2)) Dissolve 3 pt19BD28cN145 obtained in the previous section in 50 bottles of Y-100!! solution, and add 10 each of restriction enzymes Bgll (manufactured by Boehringer Mannheim) and BamHI. unit was added, and the digestion reaction was carried out at 37°C for 2 hours.

An approximately 0.85 Kb DNA fragment (Bgl 1-Ba
mHI fragment) was obtained.

On the other hand, pCfBD28 (see Reference Example 16) 2■
Dissolve the restriction enzyme BamH in JJi's Y-100 buffer.
10 units of I was added and the digestion reaction was carried out at 37°C for 2 hours. Thereafter, 5 units of restriction enzyme Bg11 were added, and a partial digestion reaction was performed at 37°C for an additional 10 minutes. From this reaction solution, LGT
A DNA fragment of approximately 3.25xb (BamHI-
0.5μ of Bgl I fragment) was obtained.

Bgji derived from pt19BD28cN145 obtained above
0.4ug l-BamHI fragment (approximately 0.85b) and p
Bgl 1-BamHI fragment from CfBD28 (approximately 3
．． 25 b) 0.5ug of T4' ligase buffer 60
Add 400 units of T4 DNA ligase to 1
The binding reaction was carried out for 16 hours at 2°C.

E. coli H8101 strain was transformed using the reaction solution, and A
A p-resistant strain was obtained. Plasmid DNA was isolated from the transformed strain and structurally analyzed by restriction enzyme digestion. Add plasmid DNA having the desired structure to pcfBD28N145
It is called.

(e) Construction of pAsN145 pCf obtained in the previous section, BD28N 145.5. 50d
Dissolve the restriction enzyme BanIII in y-too buffer.
(manufactured by Toyobo Co., Ltd.) and BamHI (10 units each) were added, and a digestion reaction was performed at 37°C for 2 hours. From this reaction solution, L
Approximately 1.3 Kb DNA fragment (BanII
I-BamHI fragment) 1■ was obtained. This approximately 1.3 Kb
Dissolve one DNA fragment of
Digestion reaction was carried out at 7°C for 2 hours. DNA was recovered by extraction with an equal volume mixture of phenol-chloroform (hereinafter abbreviated as phenol-chloroform extraction) and ethanol precipitation, dissolved in 30 m Klenow buffer, added with 2 units of DNA polymerase I/Klenow fragment, and incubated at 37°C for 1 hour. A time reaction was performed. After inactivating the DNA polymerase I/Klenow fragment by treating at 68° C. for 10 minutes, the DNA was recovered by ethanol precipitation.

The recovered DNA was dissolved in 150% buffer for 20 d.
10 units of restriction enzyme AatlI (manufactured by Toyobo Co., Ltd.) were added and a digestion reaction was carried out at 37°C for 2 hours. From this reaction solution, LG
A DNA fragment of approximately 0.2 b was obtained using the T method.
(Flat end)-Aatfl fragment] about 0.1 .mu. was obtained.

Separately, 2 ug of 2 g of pAs obtained in Example 1 was dissolved in a 20-day buffer, 10 units of restriction enzyme AatII (manufactured by Toyobo Co., Ltd.) was added, and a digestion reaction was performed at 37° C. for 2 hours. Thereafter, 5 units of the restriction enzyme Xhol were added, and a partial digestion reaction was carried out at 37°C for an additional 10 minutes. From this reaction solution, a DNA fragment of approximately 0.8b (AatII
-XhoI fragment) approximately 0.1■ was obtained.

On the other hand, psBIPAlsBldhfrl obtained in Reference Example 9
-9^2 was dissolved in 20d of Y-0 buffer, 10 units of restriction enzyme Sma I was added, and a digestion reaction was performed at 37°C for 2 hours. Thereafter, NaCl was added so that the NaCl concentration was 100 mM, and restriction enzyme Xh was added.

10 units of I was added, and the digestion reaction was further carried out at 37°C for 2 hours. About 8.7xb of D was obtained from this reaction solution by the LGT method.
About 1 inch of NA fragment (Sma I-X, ho I fragment) was obtained.

D derived from pcfBD28N145 obtained as above
del (flat end) -AatlI fragment (approximately 0,2 K
b) Approximately 0.1■, AatII-Xho from pAs28
I fragment (about 0.8b) about 0.1■, pSEIPAIS
Sma I-Xho1 fragment from Eldhfrl-9A (about 8.7 h) about 1. Dissolve 400 units of T4DNA in 30d of T4DNA IJ gauze buffer! I gauze was added and the binding reaction was carried out at 4°C for 18 hours. The colon IHBIOI strain was transformed using the reaction solution to obtain an Ap-resistant strain. A plasmid was isolated from the transformed strain and subjected to structural analysis by restriction enzyme digestion. As a result, plasmid DNA pAsNl 45 having the desired structure was obtained. The microorganism containing plasmid pASN145 is IEscherich
ia coli BASN145 FERM 0P-20
No. 71, it was deposited with the Institute of Fine Technology on September 24, 1986. The polypeptide (hG-
CSF derivative) has the following amino acid residue substitutions compared to mature hG-CSF.

The polypeptide encoded by pAsNl 45 (hG-C
SF derivative) hereinafter hG-C5F[:ND28N145
].

Example 4 hG-CSF (ND28), hG-C5F (ND
28N6], hG-CsF' (ND28Ni5] and hG-CSF production by animal cells = (1) pA
hG-CSF by animal cells harboring 32g [ND
[28] Production: pA328 was introduced into the dhfr CHO strain according to the calcium phosphate method. That is, 10% Fe2 and 7.5% Na HCOs solution [manufactured by Flow Laboratories] 11
50 volumes of MEM ALPHA medium (containing ribonucleic acid and deoxyribonucleic acid: manufactured by Gibco Oriental) [hereinafter, this medium will be abbreviated as MEMα (non-selective medium). was inoculated (a 6C1 liter diameter dish was used for culturing; manufactured by LUX (hereinafter, a LUX Dayplate was used for culturing)) and cultured at 37°C in a COz incubator for one day. On the other hand, pA328 to4 was set to 450m
of 10mM Tris-HCj! (pH 7,5) solution, 500 g of 2801NaCl,
1,5mM NazHPOa, 50mM HEPES
A solution containing (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid) (pH 7.1) was added and mixed. Furthermore, 504 2.5M CaCJ!
The solution was added and mixed, and the mixture was allowed to stand at room temperature for 5 minutes. This D
The entire amount of the NA solution was added to the dhfr-deficient CHO strain, which had been cultured for an additional hour after removing the medium and adding fresh MEMα (non-selective medium HOml), and incubated for 8 hours.PBS
The cells were washed with water, 5 ml of MEMα (non-selective medium) was added, and cultured for 16 hours. Cells in PBSCNaCl 8
g/l, K(10,2g/l, Na 2HP O4(
Anhydrous) 1.15 g/l, KH2P0゜0.2 g/J), 0.05% trypsin, 0.02% EDTA
After adding solution 3d containing (ethylenediaminetetraacetic acid) and removing the excess solution, the mixture was incubated at 37° C. for 5 minutes (trypsin treatment). 10% dialysis FC3 (manufactured by Gibco Oriental), 1150 volumes of 7.5% Na HCO3 solution, 1/1 volume of 100X non-essential amino acid solution
00 amount, G418 (manufactured by Gibco Oriental) 0,
MEM ALPH added to 3 mg/ml
A medium (ribonucleic acid and deoxyribonucleic acid free) [
Hereinafter, this medium will be abbreviated as MEMα (selective medium)] to thoroughly suspend the cells, and cultured in a COa incubator at 37° C. for 5 days using a dish with an ioam diameter. Cells were washed with PBS, MEMα (selective medium) was added, and cultured for 5 days. The same operation was performed and the cells were cultured for an additional 5 days. After washing the cells with PBS, trypsinization, suspending the cells by adding 1O...1 of MEMα (selective medium), and incubating the cells in a 6 cm diameter dish at 37°C in CO2.
The cells were cultured in 2 incubators for 3 to 7 days. After treating the emerging colonies with trypsin, 10 m containing 50 nM mentrexate (hereinafter abbreviated as MTX) was added.
Cell concentration 5X10' using 1 MEMα (selective medium)
/m+ in one datesch with a diameter of 10 cm. The medium was replaced every 5 days using the above medium three times in total. The MTX-resistant colonies that appeared were isolated as single colonies, and cultured until confluent using a 6cI11 diameter dish. After that, F.C.S.
After 2 days, the production amount of hG-CSF [ND281) in the culture solution was examined, and it was found that clone Nα22 produced the most hG-CSF [ND281].
5F CND28] The production amount was 10 μ/10 6 cells/2 days. This clone was added to 100ml of 50nMM
Falcon (containing MEMα (selective medium) containing T
After culturing in a 3027 type roller bottle and reaching confluence, the cells were cultured for 3 days using the above medium from which FCS was removed.

This 100 ml culture solution was used in Example 5.

(2) hG-C by animal cells harboring pASN6
Production of SF CND28N6: Using pASN6 and dhfr-deficient CHO cell line,
hG-CSF [ND
28N6) was obtained. Among them, the production amount of clone Nα16 is the highest, and its production amount is 7■/10
It was 6 cells/2 days.

This clone was cultured in a Falcon 3o27 type roller bottle containing MEMα (selective medium) containing 100+nl of 50 nM TX, and after reaching confluence, it was cultured for 3 days using the above medium from which FCS was removed.

This 100ml culture solution was used in Example 5.

(3) h by animal cells harboring pAsN145
Production of G-CSF CND28N145): pASNI
hG-CSF CND28 in a similar manner to that described above using 45 and dhfr-deficient CHO cell lines.
A cell line producing N145] was obtained. Among them, clone 9 had the highest production amount, and its production amount was 7μ/10' cells/2 days. This clone was added to 100ml of 50
Cultured in a Falcon 3027 type roller bottle containing MEMα (selective medium) containing nM MTX, and after reaching confluence, using the above medium from which FCS was removed,
It was cultured for 3 days.

This 100ml culture solution was used in Example 5.

(4) Production of hG-CSF by animal cells harboring pAS3-3: Similar procedures to those described above using pAS3-3 obtained in Reference Example 1O and the dhfr-deficient CHO cell line. Thus, a cell line producing hG-C5F was obtained. Among them, the production amount of clone Nα5 is the highest (the production amount is lO /
It was 10'm cell and 2 days old. This clone is 100m
1 of MEMa (selective medium) containing 50 nM MTX
After reaching confluence, the cells were cultured in a Falcon 3027 roller bottle containing FC8, and then cultured for 3 days using the above medium from which FC8 had been removed.

This 100ml culture solution was used in Example 5.

Example 5゜Glycosylated derivative of hG-C5F, hG-CSF (N
D28), hG-CSF (ND28N6] and h
Study on protease resistance of G-C5F [:ND28N145] and thermostability of hG-C5F [ND28N6) (1) Confirmation of glycosylation Natural hG-C5F obtained in Example 4, hG-C5F [
ND28], hG-CSF CND28N6) or hG-CSF CND28N145]. After completely removing cells by centrifugation, each sample 15 was subjected to 5DS-polyacrylamide gel electrophoresis [ Laernmli: Neich+
-(Nature) 227, 680 (1970)
). At this time, CH that does not contain plasmid DNA
Culture supernatant of O cells and hG-C produced and purified with E. coli
SF and hG-CSF [ND28) (see Reference Example 16) were also subjected to 5DS-polyacrylamide gel electrophoresis. The pattern obtained by silver staining the gel after electrophoresis (using a silver staining kit manufactured by Wako Pure Chemical Industries, Ltd.) is shown in FIG. 8(1).

On the other hand, after transferring the proteins on the same gel to a nitrocellulose membrane, enzyme antibody staining was performed using an anti-hG-CSF single antibody [Fumi Yamabe, Cell Engineering, 2.1061 (198
3)) is shown in Figure 8C2). Anti-hG-
The CSF single-loan antibody was prepared using the method of Hana et al. [Cancer Res.
46.4438 (1986)] was used.

Natural hG-CSF or h produced in CHO cells
G-CSF is known to have one O-glycoside-linked sugar chain added to the 133rd Thr residue from the N-terminus. It is also known that there are two types of sugar chains added at this time: those containing one sialic acid and those containing two sialic acids [Oheda et al.: Journal on Biochemistry (J, Binchem), 103 .544 (19
88) ].

In this study, we also used hG produced in CHO cells.
One O-glycoside-linked sugar chain was added to -CSF. Furthermore, some sugar chains to be added contained one sialic acid and others contained two sialic acids. The two bands of hG-CSF seen in FIG. 8(1) or FIG. 8(2) are due to the difference in the number of sialic acids.

In contrast, hG-CSF [ND
28), it was found that in addition to those with one O-glycoside-linked sugar chain, there were also those with two O-glycoside-linked sugar chains. In addition, hG-CSF with a newly introduced N-glycosylation binding site in [hG-CSF CND28]
CND28N6] and hG-CSF ('ND28N
[145], approximately 1 of the total hG-C5F produced together.
An N-glycoside-linked sugar chain was added to /3.

At that time, in hG-CSF CND2 BNl 45), there was also one to which a new 0-glycoside-linked sugar chain was added, as in the case of hG-CSF [:ND28). Therefore, hc-C5F [ND28N
'l 45], there are four types of polypeptides depending on the type and number of sugar chains added. That is, in addition to those with one O-glycoside-linked sugar chain added like the natural type, those with two O-glycoside-linked sugar chains, one O-glycoside-linked sugar chain, and N- Those with one glycoside-linked sugar chain and O-glycoside-linked sugar chain I! 2 chains, 1 N-glycosidic sugar chain
This addition exists. On the other hand, hG-CSF
(ND28N6] has almost no new O-glycoside-linked sugar chain added.

The addition of N-glycoside-linked sugar chains means that N-glycanase (Seikagaku Corporation) is an enzyme that cleaves the bond between N-glycoside-linked sugar chains and polypeptides.
This was confirmed by processing. In the case of 0-glycoside-linked sugar chains, 0-glycanase and sialidase (
Both were confirmed using Seikagaku Corporation). FIG. 8(3) is a schematic diagram of FIG. 8(2), and describes the type and number of sugar chains each band has.

(2) Examination of protease resistance As shown in the previous section, hG-cs produced in CHO cells
F' (ND28], hG-csF' END28N
6) and hG-CsF' (ND28N145), there were those with new sugar chains added and those without. Therefore, by directly adding IJ psin to the culture supernatant described in the previous section, which contains both those with and without new sugar chains added, protease resistance was compared depending on whether sugar chains were added or not. hG-C5F (
ND28), hG-CSF [ND28N6], and hG-CSF (ND28N145) were added to 450 mg of the culture supernatant from the previous section, respectively, and 0.5 mg/ml of chymotrypsin [manufactured by Sigma] was added at 24 μl each.
It was kept warm at 37°C. After adding chymotrypsin 10,20
, 30, 60, 120. After 180 minutes, samples of 60 d were collected and treated with 5DS-polyacrylamide gel electrophoresis buffer [0,25 M Tri 5-HCl (pH 6,8).
, 8% Sodium Lauryl Sulfate (SDS), 40%
The reaction was stopped by adding 20 m of glycero-JL+, 0.004% bromophenol blue).

A sample to which chymotrypsin was not added was also prepared and used as a sample at θ minutes after the addition of chymotrypsin.

Next, each sample 20d was subjected to SO3-polyacrylamide gel electrophoresis, and after the polypeptide was transferred to a nitrocellulose membrane, enzyme-antibody staining was performed in the same manner as in the previous section. As a result, hG-CSF (ND28), hG-C
SF (ND28N6), hG-CSF [ND28N
145), it was found that those to which a new sugar chain was added were more resistant to chymotrypsin than those to which no sugar chain was added.

hG-CSF CND28) has two 0-glycoside-linked sugar chains (natural type)
Those with this addition were more resistant to chymotrypsin [No. 8 (Figure 8)].

Furthermore, in the case of hG-CSF [ND28N6], those with newly added N-glycoside-linked sugar chains were more resistant than those without them [Figure 8 (5)].

In the case of hG-CSF (ND28N145), there are two types: one with one 0-glycoside-linked sugar chain (natural type) and the other with one 0-glycoside-linked sugar chain (natural type), and
One newly added glycoside-linked sugar chain, N-
There are four types of polypeptides, one with a newly added glycoside-linked sugar chain and one with both newly added, but in this case as well, the one with a newly added N-glycoside-linked sugar chain is better. It had become resistant. Also, N-
Those with newly added O-glycoside-linked sugar chains in addition to glycoside-linked sugar chains were even more resistant [
Figure 8 (6)].

(3) Study on thermostability 5 ml of the serum-free culture solution containing hG-CSF (ND28N6) obtained in Example 4@ was injected into molkat)-10 (Mi'
It was concentrated to 500 d using J-Pore Co., Ltd.). Next, 100d of it was passed through a 5uperose 12 column (manufactured by Pharmacia) (1cm x 30C) to obtain hG-CSF [ND28
Only N6) was collected. For chromatography, 0.
1MTr i 5-HCJ! (pH 8,0), 0.2M
A buffer containing NaCji', 1mM EDTA was used. The column was passed at a rate of 0.5 ml/min. The above chromatography was repeated three times, and a solution containing human G-CSF l"ND28N6) to which N-glycoside-linked sugar chains were added (human G-C5F concentration was approximately 1.74 g/ml)
About 1.5 ml of was obtained. To 350ml of this solution, add 1%
:/ (Tween) 3.5 ul of 2Q and IJll (0,25 ul of N-glycanase (manufactured by Seikagaku Corporation)
Units) and reacted at 37°C for 17.5 hours.
N-glycoside-linked sugar chains were removed. Also, N-
Use sterile water instead of glycanase! The added material was also prepared at the same time and subjected to the reaction in the same manner. After the reaction was completed, a portion of both reaction solutions was subjected to 5DS-polyacrylamide electrophoresis, and then silver staining was performed to confirm that N-glycoside-linked sugar chains had been removed in the N-glycanase-treated sample. confirmed.

Both of the above reaction solutions were used in an experiment to compare thermal stability at 56° C. immediately after the completion of the reaction. 60 m of each reaction solution was kept at 56°C, and 0. 30. After 120, 240, and 360 minutes, 104 samples were taken, and hG-CSF activity was measured by a colony forming ability test using mouse bone marrow hematopoietic stem cells. The results are shown in Figure 8 (7).The activity in Figure 3 is the activity after incubation at 37°C for 17.5 hours.
The residual activity is expressed as %.

The activity after incubation at 37° C. for 17.5 hours was 48.1% in the N-glycanase-treated sample and 66.8% in the control, when the activity before incubation was taken as 100%.

As shown in Figure 8 (7), hG-CSF [ND28N6] (control) with N-glycoside-linked sugar chains added is different from hG-CSF [ND2] with the same sugar chains removed.
8N6] (N-glycanase treatment).

Example 6 Construction of UK-31 expression plasmid psEIUKs1-1d: (1) Construction of template single-stranded DNA (single-strand pUKmps1): Approximately 3.5% of the plasmid psEIUKs1-1d obtained in Reference Example 2 was used. pUKl of 30〃Y-100
The mixture was dissolved in a buffer solution, 10 units each of restriction enzymes Pstl and BamH were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, AFT method [BioTechniques 2. 6 row 67 (1984)] using 890bfl Pstl
- BamHI DNA fragment was purified.

On the other hand, the M13 phage vector M13mp18
RF DNA (manufactured by Takara Shuzo Co., Ltd.) approximately 1 cm in total amount 3 (ld
Dissolve restriction enzymes Pstl and Ba in Y-100 buffer.
10 units of mHI and mHI were added, and the digestion reaction was carried out at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 7.
In step 2, the h DNA fragment was purified.

The 890 bp D derived from pUK1 thus obtained
About 7.2 b from NA fragment and Ml 3mp 18RF
The DNA fragment was dissolved in a total amount of 20 d of T4 ligase buffer, 300 units of 74 DNA IJ gauze was added, and a ligation reaction was performed at 4°C for 18 hours.

Next, a known method [Messing et al.: Method in enzyme
n [! zymology) 101.20 (1983
)], E. coli strain JM1G5 was transfected using the above reaction solution to obtain a recombinant phage.

Subsequently, E. coli JM105 strain was infected with this recombinant phage according to a known method [cited above], and single-stranded phage DNA was recovered from the culture solution. Further, double-stranded phage DNA was recovered from the cultured bacterial cells according to the plasmid DNA recovery method. This double-stranded phage DNA (p
The structure of UKmpS 1) was confirmed by restriction enzyme digestion (see Figure 9).

(2) Introduction of mutations into UK-cDNA using oligonucleotides: (A) Preparation and phosphorylation of synthetic RNA for mutation introduction: Change the 164th amino acid residue Phe of UK to Asn and add a sugar chain. UK derivative (hereinafter referred to as UK-
In order to produce 17 bases (abbreviated as 3L), N
A5'-GGGGAGAA^^CACCACC-3'
was synthesized using an Applied Biosystems 380A-DNA synthesizer.

Next, 25 picomole of the synthetic NA obtained in this way (
pa+gles) in 10 range of 50mM Tris-H.
CI (pH 7,6), 10mM MgCl,,5
mM DTT, 0.1mM, EDTAlo, 5mMA
The 5' end was phosphorylated by adding 5 units of 74 DNA kinase (manufactured by Takara Shuzo Co., Ltd.) in a solution containing TP and reacting at 37°C for 30 minutes.

(B) Introduction of site-specific mutations using two types of oligonucleotide primers: The single-stranded recombinant phage DNA 6.5m obtained above (
containing about 2ug of DNA) and 14 10x polymerase buffer (500mM Tri 5-HCI (p
H7,8), 70mM g C1x, 60mM
2-mercaptoethanol, 0.25mM dATP
% 0.25mM dCTP, 0.25mM dGTP and 0.25mM dTTP] and the synthetic NA2m for mutagenesis obtained above (2.5 pmol) was heated to 65°C for 5 minutes and then to 55°C for 5 minutes. After incubating at 37°C for 10 minutes and at 25°C for 10 minutes, 3 units of Escherichia coli DNA polymerase I Klenow fragment (manufactured by Takara Shuzo Co., Ltd.) (hereinafter abbreviated as Klenow fragment) was added and incubated at 25°C. The reaction was allowed to proceed for 30 minutes. Next, this reaction solution was added with a polymerase buffer at a concentration of 10 times that of IJll and 0.
．． 5pmole/JJII M13 primer M4 (
Add 6 m (manufactured by Takara Shuzo Co., Ltd.) and 3 units of Klenow fragments, and make 37
After reacting at ℃ for 10 minutes and at 25℃ for 40 minutes, 10 m
2-M ATP and 300 units of T4 DNA ligase were added, and the binding reaction was carried out at 11°C for 18 hours. This reaction solution was subjected to phenol extraction and chloroform extraction, and then DNA fragments were recovered by ethanol precipitation. This DNA fragment was dissolved in a total volume of 30% Y-100 buffer, 12 units of EcoRI and 12 units of PstI were added, and a digestion reaction was performed at 37°C for 2 hours.

After heat treatment at 65℃ for 10 minutes, approximately 60℃ was applied using the AFT method.
A 0 bp PstI-EcoRI fragment was purified.

(C) Integration of the DNA fragment into which the mutation has been introduced into the vector Approximately 3 g of pUK11 plasmid DNA obtained in Reference Example 3
was dissolved in Y-50 buffer of 30% and 10 units of Aat
ll (manufactured by Toyobo Co., Ltd.) and 8 units of Pstr, 37
Digestion reaction was carried out at ℃ for 2 hours. After heat treatment at 65°C for 10 minutes, approximately 1. OKb AatI[-
The PstI fragment was purified. Separately, p obtained in Reference Example 12
Approximately 3 blocks of UKB101 plasmid DNA' were converted to 304 Y-
50 units of AatII and 10 units of EcoRI were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, approximately 2
．． In step 9, the AatlI-EcoRI fragment of b was purified.

Aa t I derived from pUK11 thus obtained
I-Ps t I fragment (approximately 0.05 g) and pUKBl
AatI[-EcoRI fragment (approximately 0.1q) derived from 01
Pstl-EC9RI of approximately 600 bp with mutations introduced.
Dissolve the fragments in 20 d of T4 ligase buffer,
One unit of T4 DNA ligase was added, and the ligation reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain C6005F8 [Procedure of the National Academy of Sciences (Proc.
Natl, ＾cad, sci,)US＾72゜341
6 (1975) 3 to obtain an Ap-resistant strain.

From this transformed strain, a recombinant plasmid pUKS1 was isolated using a colony hybridization method, which hybridizes with a probe in which the 5' end of the synthetic NA for mutation introduction (described above) was radiolabeled with 32P. It was confirmed that pUKS 1 had the desired structure by structural analysis by restriction enzyme digestion and the Deideoxy Seefens method using M13 phage (see Figure 10).

(3) UK-S1 expression plasmid psEIUKs1-1
Creation of d: psBIP^l5B1dhfrl- obtained in Reference Example 9
! )^ Dissolve approximately 2 g of plasmid DNA in 304 y-oa buffer, add 10 units of Kpn I, and incubate at 37°C for 2
A time digestion reaction was performed. followed by 1.5 m of 2M Na
C1 and 10 units of Xhol were added, and the digestion reaction was further carried out at 37°C for 1 hour. After heat treatment at 65°C for 10 minutes, A
A DNA fragment of approximately 8.6 Kb was purified using the FT method. In addition, prol-1 plasmid DNA was added to the pset mouth.
Approximately 3 gg was dissolved in 30 d of Y-100 buffer, 12 units of BglII and 12 units of Xhol were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65° C. for 10 minutes, the DNA fragment b was purified to approximately 0.75 using the AFT method. On the other hand, the pUKsl plasmid DNA obtained above
Dissolve approximately 3 g in 304 Y-0 buffer and add 15 units of K.
pn I was added and the digestion reaction was carried out at 37°C for 2 hours. followed by 1.54 units of 2M NaCl and 12 units of 13g1
U was added, and the digestion reaction was further carried out at 37°C for 1 hour.

After heat treatment at 65°C for 10 minutes, approximately 1.
15, the DNA fragment b was purified.

psEIP^l5E1dhf obtained by straining in this way
Approximately 8.6 Kb DNA fragment derived from rl-9A (approximately 0.1
Jig), approximately 0.75 derived from psE1UKproll^
Kb DNA fragment (approximately 0.02 gg), and pUKS
A DNA fragment of approximately 1,15 Kb derived from I (approximately 0.0
2■) in a total volume of 204 T4 ligase buffer,
00 units of T4DNA! l gauze was added, and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA, psEIUKsl-1, was obtained from this transformed strain.
When psEIUKsl-1d was isolated and structurally analyzed by restriction enzyme digestion, it was confirmed that psEIUKsl-1d had the desired structure (see Figure 11).

Microorganisms containing plasmid psEIUKsl-1d are [!
5cherichia cali [1tlKS1-1
d September 2, 1986 as FERM 8P-2072
It was deposited with the Institute of Fine Technology on the 4th.

Example 7 Production of UK-31 and pro-UK polypeptides by animal cells: (1) Production of UK-51 polypeptide by CH○ cells harboring psEIUKsl-1d psEIUKsl-1d obtained in Example 6 was introduced into the dhfr-deficient CHO strain according to the calcium phosphate method. That is, the amount of FC3l/10 and 7.5% Na HCO3
Solution (manufactured by Flow Laboratories) 1
I to 5 ml of MEMα (non-selective medium) to which 150 volumes were added.
Cells were inoculated at a concentration of X 10'i [HIIa/ml] [a 6clI diameter plate was used for culturing].
(manufactured by LUX Co., Ltd. (hereinafter, a LUX Dish was used for culturing)] and cultured at 37° C. for 1 day in a Co2 incubator. On the other hand, pSEIUKSI-1d DNA
10 μm of 450% of 10 mM Tris-HCl (
pH 7,5) solution and add 500d of 28 to this solution.
0mM NaCj! , 1.5mM N a 2HP
O4, 50mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid)
(pH 7.1) was added and mixed. 5 more
A 0M 2.5M CaClx solution was added, mixed, and allowed to stand at room temperature for 5 minutes. The entire amount of this DNA solution was added to the dhfr-deficient CHO strain, which had been cultured for an additional hour after removing the medium and adding 10 ml of fresh MEMα (non-selective medium), and incubated for 8 hours.

The cells were washed with PBS, 5 ml of MEMα (non-selective medium) was added, and cultured for 16 hours. Cells in PBS CNa
C18g/j! , KCj! 0.2g/(1°Na*
HPOn (anhydrous) 1.15 g/It, KH2P0゜0
．． 2g/j! ], 0.05% trypsin, 0.05% trypsin.
After adding 3 ml of a solution containing 2% EDTA (ethylenediaminetetraacetic acid) and removing the excess solution, the mixture was incubated at 37° C. for 5 minutes (trypsin treatment). Dialysis FC3 (
Gibco Oriental) 10%, 7.5% NaH
MEMα containing 1150 volumes of CO, solution, 1/100 volume of 100× non-essential amino acid solution, and 0418 (manufactured by Gibco Oriental) added to 0.3 mg/m+
(selective medium) to suspend the cells well, and
The cells were cultured for 5 days at 37°C in a CO2 incubator. Wash cells with PBS and MEM
α (selective medium) was added and cultured for 5 days. The same operation was performed and the cells were cultured for an additional 5 days. After washing the cells with PBS, they were treated with trypsin, and 10 ml of MEMα (selective medium) was added to suspend the cells, and cultured in a 6 cm diameter dish in an incubator at 37° C. and CO for 3 to 7 days. After the colonies that appeared were treated with trypsin, they were implanted into a 10 cII diameter dateschew using 10 ml of MEMα (selective medium) containing 50 nM MTX at a cell concentration of 5 x 10'/a+1.

The medium was replaced every 5 days using the above medium three times in total. The MTX-resistant colonies that appeared were isolated as single colonies, and each colony was cultured using a 6 cm diameter potato plate until confluent. The UK in the culture medium was changed to MEMα (selective medium) containing 5 ml of 50 nMMTX after 1 day.
-31 activity using fibrin plate assay (G
ranalli-Pipern.

and Re1ch: Journal on Experimental Medicine (J, Exp9Med,) 148.2
33 (1978)). As a result, clone Sou 12 had the highest activity, and its UK-31 production amount was 5 fish/106 cells/day. 10 clones of this
Culture in a Falcon 3027 roller bottle containing 0 ml of MEMα (selective medium) containing 50 nM MTX, and after reaching confluence,
The cells were cultured for 3 days using the above medium containing 1117 ml of aprotinin (Pellinger Mannheim) in 10 ml from which CS had been removed. This loOml culture solution was used in Example 8.

(2) Production of pro-UK polypeptide by animal cells harboring psEIUKprol-IA: Reference Example 1
Recombinant branumid psEIUKprol obtained in 3.
-IA and pSV2-dhfr and dhfr-deficient CHO
Using cell lines, pro
- A cell line producing UK was obtained. Among these, clone Nα
The activity of 5 is the highest, and the production amount of pro-UK is 3■
/lO@cell/day. This clone is 100m
Cultured in a Falcon 3027 roller bottle containing MEMα (selective medium) containing 50 nM MTX of
After reaching confluence, I removed the FCS.
The cells were cultured for 3 days using the above medium containing II/ml aprotinin (Boehringer Mannheim). This 100
The culture solution of No. 1 was used in Example 8.

Example 8 Comparison of sensitivity to thrombin between natural pro-UK and glycosylated modified UK-81: (1) pro-UK
Purification of UK-3L and UK-3L from CHO cell culture medium: 10% each of serum-free culture medium containing natural pro-UK or glycosylated modified UK-31 obtained in Example 7
0.05% 5% lie/(Tween
) 5 ml of zinc (Zn)-chelate-Sepharose (Pharmacia) equilibrated with 50 mM phosphate buffer (pH 7,5) containing 80 and 0.05% NaNs (hereinafter abbreviated as PBS-TA). Japan Co., Ltd. (Pharmacia FinaChem
icals) was added thereto and mixed gently at 4° C. for over 1 hour. This mixture was mixed with Bio-Rad (Bio-Rad).
) was packed in an ecotu column made by the company.

After washing each column with PBS-TA containing 10 KID/ml aprotinin in 10 lO bed volumes,
ml aprotinin and 50mM imidazole (imida
Elution was performed with PBS-TA containing zole). This elution fraction was examined for the presence of urokinase protein by the fibrin plate assay method described above, and both fractions containing urokinase protein were collected. For this solution, P
5a+1 SP-Sephadex C50 (Pharmacia) equilibrated with B S-TA
Japan Co., Ltd. (Pharmacia Fine C
Chemicals) was added thereto, and the mixture was gently mixed at 4° C. for over 1 hour. This mixed solution was packed into a mini column (Sepacol Mini, manufactured by Seikagaku Corporation). The column was washed with 10 bed volumes of PBS-TA and then eluted with 3 bed volumes of PBS-TA containing 500 mM NaCl.

This eluate was then immediately treated with 1 ml of Benzamidine equilibrated with PBS-TA.
)-Sepharose 6 B (
(manufactured by Pharmacia Japan Co., Ltd.) was added thereto and gently mixed at 4° C. for 1 hour or more. This mixture was packed into a mini column (Sepacol Mini, manufactured by Seikagaku Corporation), and the flow-through fraction was collected. In this two-way flow, a single-stranded natural p
ro-UK or single-chain UK-3L was included.

The addition of a new N-glycoside-linked sugar chain to UK-51 was demonstrated when tJK-31 was analyzed using 5DS-polyacrylamide gel electrophoresis to analyze natural pro-tJK and UK-31. Natural type pro-UK
and that the molecular weight is larger than that of natural pro-UK.
By treating UK-81 and UK-81 with N-glycanase, the molecular weights of both decrease and become almost the same, making it certain that
I endured it.

(2) Thrombin sensitivity test of purified natural pro-UK and UK-81: The solution containing the natural pro-UK and UK-3l obtained above was tested for urokinase activity using a fibrin plate assay method. /+nl diluted with PBS-TA containing 300mM NaCl. 36 g of 24 μM human thrombin was added to this diluted solution 216d, and the mixture was kept at 37°C. Human thrombin is sigma thrombin, 2981U thrombin is 10
A preparation prepared by adding 0 IU of aprotinin and reacting at 37° C. for 1 hour was used. After adding thrombin, 15.30
．． 60. After 120 minutes, 63 songs were sampled, and 24 songs were sampled.
μM thrombin inhibitor (Thromstop IAm
The reaction was stopped by adding 94 g of Erican's Iagnost (manufactured by CA). A sample was also prepared in which a thrombin inhibitor was added immediately after the addition of thrombin (this was used as a sample 0 minutes after the addition of thrombin). In addition, as a control group, a sample to which no thrombin was added was kept at 37°C.

Next, each sample 22.5a was subjected to 5DS-polyacrylamide gel electrophoresis [Laemmli:Nature 227.680 (197
0) ], single-chain urokinase (
Derivative) was investigated to see if it became double-stranded. the result,
(See Figure 12 to find out that UK-31 has a lower double-stranded ratio than natural pro-UK). This result indicates that UK-31 is less sensitive to thrombin.

Furthermore, in order to confirm this result, the S-2444 amidolytic activity was measured. That is, the above sample was mixed with TNT buffer [:0.5
M Tris-HCI (pH 7,4), 0.38M
10 μM human plasmin (Pla
smin) was added thereto and reacted for 30 minutes at 37°C. Human plasmin manufactured by Boehringer Mannheim was used. Next, the chromogenic substrate S-2444 (1,2
50 mM; manufactured by abi Vitrum Co., Ltd.
4 was added and further reacted at 37°C for 90 minutes, then 40
The absorbance at 5 nm was measured and the amidolytic activity was calculated. The results are shown in FIG.

As shown in Figure 13, UK-31 is a natural pro-
It was found that the sensitivity to thrombin was lower than that in the UK.

Example 9 In of natural pro-UK and glycosylated modified UK-3l
Vivo evaluation: (1) Continuous infusion experiment: 4-6 month old male beagle dogs (body weight 5.5-11.5 kg)
The mice were anesthetized by intravenous administration of sodium bentoparbital (a 39 mg/kg), and artificial respiration with room air was performed. Natural pro-UK and glycosylated modified UK-S 1 obtained by the method of Example 8-(1) were continuously injected into the femoral vein for 30 minutes (2000 U/kg/min), and before administration (0 minutes) , 15.30.45.6 after the start of administration
Blood was collected from the femoral artery at each time point of 0.90 minutes.

The collected blood was immediately centrifuged to obtain plasma, which was stored frozen at -20°C until measurement. Using the obtained plasma, Example 9. - Whole body fibrinolytic factors were measured according to (3).

As a result, the glycosylated modified UK-51 was found to be similar to the native pro-
Similar to UK, it was found that systemic fibrinolytic factors were hardly activated (see Figure 45). In addition, using a sandwich-type enzyme immunoassay using an antibody against urokinase, we detected natural pro-UK and α-modified pro-UK-.
When the plasma concentration of 31 was measured, it was found that the natural pro
The elimination half-life of -UK from plasma was 12.0 minutes, while that of glycosylated modified UK-31 was 24.2 minutes, indicating an extended elimination half-life. In addition, regarding the area under the plasma concentration-time curve (AUC) at this time, the AUC of the wt chain-added modified UK-31 and the natural pro-
It was about 3.6 times the UK AUG [see Table 8-(A)].

(2) Experiment using bolus administration: Male and female mongrel dogs (body weight 4.6 to 13.0 kg) were used. Approximately 5 cm of the dog's femoral artery prepared in the same manner as above was exposed, and an electromagnetic blood flow meter was attached to the point closest to the center of the artery. Ligate the front and back of a part (approximately 1 cm) of the artery including the branch to create a small part without blood flow, and inject 0.2 to 0.4 m12 of 100 OU/- thrombin (Green Cross) through the branch. A thrombus was created in the area. The presence or absence of thrombus formation was determined by allowing blood flow to continue for 1 hour (1 to 1.5 hours) and confirming that spontaneous dissolution did not occur. Natural pro-UK and glycosylated modified UK-31 (0.6 mg/kg) were given as a rapid intravenous injection over 3 minutes, before administration (0 minutes) and after the start of administration on 15.30.4.
Blood was drawn at each time point of 5, 60, 90, and 120 minutes.

As a result, recanalization of the thrombus was not observed in the two dogs examined using the natural pr○-○, whereas recanalization was observed in all three dogs treated with the glycosylated modified UK-31. Ta. When we measured the whole body fibrinolytic factors at this time, we found that the native pro-UK showed a tendency to activate the whole body fibrinolytic factors, whereas the Ii anti-modified UK-3
1, no activation of systemic fibrinolytic factors was observed as in the case of 1nfusion (see Fig. 46).

At the same time, we measured the plasma concentrations of native pro-UK and glycosylated modified UK-31, and found that the elimination half-life of native pro-UK from plasma was 30.3 minutes. In contrast, the glycosylated modified UK-51 was 48.
1 minute, indicating an extension of the elimination half-life. Furthermore, the AUG at this time was about 5.6 times that of the natural pro-UK [see Table 8-(B)].

(3) Examination of effects on systemic fibrinolytic factors: Measurements were performed on three systemic fibrinolytic factors: α2-plasmin inhibitor, plasminogen, and fibrinogen.

Test plasma for all items was obtained as a supernatant by centrifuging a mixture of 9 volumes of whole blood and 1 volume of 3.8% citric acid at 3000 rpm for 10 minutes. In addition to this, the final concentration of PPACK (low phenyl
alanyl-L-prolyl-L-argin
ine chloromethyl ketone%C
ALBIOC) IBM ■, Lot #586042.1l
oechst) and 250 U/- of aprotinin (trasylol [phase],
Bayer) was added.

Measurement was done using Auto Analyzer AU510 manufactured by Olympus.
was used. The reagent used was α2-plasmin inhibitor, Sankyo's ALP Autocolor Sankyo was used for the quantification of plasminogen, and the fibrinogen reagent of International Reagent was used for the quantification of fibrinogen.

Table 8 Natural type pr o-UK right and I! Chain addition type modification UK-
Blood half-life (A) of 3l Continuous infusion (Peagle dog) p r o-UK 12.0±1.9 6
0.2±13,4UK-3t 24.2±10
．． 0 214 ±57.6 (B) Rapid intravenous injection (mongrel dog) Tl/2 (min) A[IC (Ko・Control 7ml) ro-UK 30.3±8.9 98.8±38.1 UK- 31 48,1 ± 2.0 555 ± 118 Example 10 Construction of recombinant plasmid pUKS3 encoding glycosylated modified UK-33: pUKs1 plasmid obtained in Example 6 (2)-(C) Approximately 2 cm of DNA was dissolved in 30 d of Y-100 buffer, 16 units (of frI and lO units) (indIII) were added, and the digestion reaction was performed at 37°C for 2 hours.
After heat treatment for a minute, the D of b was reduced to about 0.75 using the ATF method.
The NA fragment was purified. On the other hand, the pH obtained in Reference Example 20
Approximately 2j1 g of PA2 plasmid DNA was transferred to 30-Y-10
Digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, the ATF method was used to digest the mixture. A 4 Kb DNA fragment was purified.The following two synthetic NAs (43 bases and 43 bases) were synthesized and phosphorylated at the 5' end according to the method described in Example 1.

5'-GGCC^^AAG ACT ATT CGA
ACG CGT TTT AAG ATT ATT G
GG GGA G-3'3'-TT TTCTGA T
AA GCT TGCGCA^^^TTCTAA TA
ACCCCCT CTT AA-5' DNA fragment of approximately 0.75 to b (approximately 0.1 ■) derived from pUKS 1 and approximately 3.4 to b DNA derived from phPA2 thus obtained.
A total amount of 20 IJII of the A fragment (approximately 0.1 ■) and two types of 5' phosphorylated synthetic NA (1 pmol each).
The mixture was dissolved in T41J gauze buffer, 300 units of T4 ligase was added, and the binding reaction was performed at 4°C for 18 hours. Using the obtained mixture of recombinant plasmids, E. coli MM
The 294 strain was transformed to obtain an Ap-resistant strain. Plasmid DNA was isolated from this transformed strain, and structural analysis by restriction enzyme digestion and nucleotide sequencing by the M13 deideoxy-Siefens method were performed.
The plasmid DNA with base substitutions of 153-+Asn and Pro155-Thr was named pUKS3 (47th
(see figure). Table 7 shows the amino acid sequence of UK-33 obtained in the present invention.

Example 11 Construction of UK-33 expression plasmid pSEUKS3: pSεIPAISE1dhfrl- obtained in Reference Example 9
Approximately 2 ■ of 9A plasmid DNA was transferred to Y-0 of 301Jtt!
The mixture was dissolved in an equilibrated solution, 10 units of Kpn I was added, and the digestion reaction was carried out at 37°C for 2 hours. followed by 1.5〃2MNaC
1 and 10 units of Xhol were added, and the digestion reaction was further carried out at 37°C for 1 hour. After heat treatment at 65°C for 10 minutes, A
A DNA fragment of approximately 8.6 Kb was purified using the FT method. In addition, psEIUKprol-LA plasmid DNA
Approximately 3 μm was dissolved in 304 Y-100 buffer, 12 units of Bgln and 12 units of Xhol were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, A
The DNA fragment of b was purified to approximately 0.75 using the FT method. On the other hand, about 3 pUKs3 plasmid DNA obtained above
Dissolve ■ in 30d of Y-0 buffer, 15 units of Kpn
I was added, and the digestion reaction was carried out at 37°C for 2 hours. Subsequently, 1.54 of 2M NaCl and 12 units of Bgln were added, and the digestion reaction was further carried out at 37°C for 1 hour. 65℃,
After heat treatment for 10 minutes, b was reduced to about 1.15 using AFT method.
The DNA fragment was purified.

psBIPAlsε1dhfr obtained in this way
An approximately 8.6 Kb DNA fragment derived from l-98 (approximately 0.1
■), approximately 0.75 derived from psEIUKprol-IA
Kb(7) DNA fragment (approximately 0.02.
．． 02. ) was dissolved in a total volume of 20 d of T4 ligase buffer, 100 units of T4 DNA ligase was added, and the mixture was incubated at 4°C for 18
A time binding reaction was performed.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA%pSEUKS3 was isolated from this transformed strain, and structural analysis by restriction enzyme digestion revealed that I)
It was confirmed that SEUS3 has the desired structure (4th
(See Figure 8).

The E. coli strain containing plasmid pSEUKS3 is Esch
erichia coli ESELI to S3 (FE
RM 0P-2478) dated June 15, 1989, and was deposited with the Institute of Fine Technology under the Budapest Treaty.

Example 12 Production of UK-33 polypeptide in animal cells harboring pSEUKS3: Recombinant plasmid pSEUKS obtained in Example 11
A cell line producing UK-33 was obtained using a procedure similar to that described above using the 3 and dhfr-deficient CHO cell line. Among them, clone 13 has the highest activity, and its tJ
The production volume of K-33 is 3. /10” cells/day.

This clone, 100m! After culturing in a Falcon 3027 roller bottle containing MEMα (selective medium) containing 50 nM MTX and reaching confluence,
10KIU/ml without FC5! Aprotinin (
Using the above medium containing Boehringer Mannheim,
It was cultured for 3 days. This 100 ml of culture solution was used in Example 13.
It was used in

Example 13 Examination of thermal stability of glycosylated modified UK-33: Glycated modified UK-53 was purified from a CHO cell culture solution in the same manner as in Example 8-(1). Purified natural pro-UK and glycosylated modified UK-33 were added to 50 m
M phosphate, 200mM arginine, 100mM Na
C1, 0,01% 'l'ween 80. 10 μm in a buffer (pH 7,5) consisting of 0,05% sodium azide.
/- and incubated at 70°C.

Sampling was performed at 1, 2, 3, and 4 hours after the start of incubation, and immediately after cooling in water, a fibrin plate assay was performed to measure the residual activity (see Figure 49).

It was revealed that the modified glycosylated UK-53 is more stable against heat than the natural pro-UK.

Reference Example 1 Construction of plasmid ptP^7 carrying human t-PA cDNA: (1) Poly(A) from Detroit 562 cells
Preparation of RNA: human pharyngeal cancer cell line etroit56
2, the guanidine thiocyanate-lithium chloride method [Cathala et al.: DN
A) 2°329 (1983)], RNA having poly(A) was prepared as follows.

Human pharyngeal cancer mouth etroit562 C Peterson
Double de 4” ziconia (Peterson, W,
D., Jr.) et al.: Proceedings on the Society for Experimental Biology and Medicine (Proc, Soc, F.
ixp, Rial.

Med, ) 136, 1187 (1971)], l
O% calf fat serum, 100x non-essential amino acid solution (Fl
ow Laboratories, Inc.), 1 mM sodium pyruvate, and 0.1% lactalbumin hydrate (Gibco Oriental) using 50 ml of MEM medium (manufactured by Hinaga Pharmaceutical Co., Ltd.) in a tissue culture flask. (Manufactured by Corning, 150 (-Ill
>Grown inside.

After culturing at 37°C until confluent, the cells were washed with PBS and incubated at 1100 nm.
/m+ phorbol myristate acetate (P
MA: Phorbol myristate a
cetate) and 30 ml of the above medium from which calf fat serum was removed were added, and the mixture was further cultured at 37°C for 24 hours.

Cells were then treated with 0.05% trypsin, 0.02% EDT.
A cell suspension was obtained by treatment with 10 ml of a solution containing A. A total of 1X10@ cells were obtained from the six tissue culture flasks described above. From the cell suspension, 1.
Cells were collected by centrifugation at 100 × g for 10 min at 4°C, washed with 80 ml of phosphate buffer, and then incubated for 5 min.
M thiosinoic acid glutinous herring, IQmM BOT^, 50
mM Tris-HCj! (pH 7) and 8% (
V/V) Solution 1 consisting of 2-mercaptoethanol
Solubilization was carried out using a Portex mixer in 0ml.

This lysate was transferred to a centrifuge tube and 4MLiCj! solution 80
...1 was added and stirred, and then allowed to stand at 4°C for 20 hours.

9.00O with Hitachi RP R1G rotor
rpm, centrifuge for 90 minutes, and RNA was collected as a precipitate. The RNA precipitate was suspended in 50 ml of a solution consisting of 4 M urea and 2 M lithium chloride, and
After centrifugation for 60 minutes at 9.00 rpm in an IO rotor, RNA was recovered as a precipitate. 0 RNA precipitation
．． 1% sodium lauryl sulfate, 1mM EDTA,
10mM Tris-HCj! (pH 7.5), extracted with phenol-chloroform, and recovered by ethanol precipitation. Obtained RN
About 2.5 mg of A is added to 10 mM Tris-flcj! (
1 ml of a solution consisting of p) 18.0) and 1 mM ED T^
Dissolved in l. Incubate at 65°C for 5 minutes,
1mM 5M NaCl1 was added. The mixture was subjected to oligo(dT) cellulose column chromatography (manufactured by PL f3iochemical) (column volume 0.5 ml). Adsorbed Po! l (A) at 10mM
Tris-HCj! (p)17.5) and 1 mM
Approximately 90 g of mRNA containing Po'J (A) was obtained by elution with a solution consisting of EDTA.

(2) CD DNA synthesis and insertion of the DNA into a vector: Okayama-Be+'g
) method [Sorechycolla and Cellular Biolony (Mol, Ce11. Rial, ), 2
．． 16H1982)], cDNA was synthesized and a recombinant plasmid incorporating it was constructed. An outline of the process is shown in FIG.

pcDVl (Okayama and Barb)
Ma & Berg): Molecular and Cellular Biolony (Mo1. Ce1l, Rial
, ), 3°280 (1983) 1400Mg in 10m
M Tris-HCj' (pH 7,5), 6 mM
MgCJ 2 and 10n+M NaC1! In addition to 300 units of a solution consisting of
It was cut at one site. After phenol-chloroform extraction,
DNA was recovered by ethanol precipitation.

Approximately 200 μl of the Kpnl-cleaved DNA was mixed with 40mM sodium costocodylate, 30mM Tris-HCj! (pH
6,8), 0.2 dTTP was added to a buffer solution (hereinafter abbreviated as TdT buffer) consisting of 1mM CaCf, and 0.1mM dithiothreitol (hereinafter abbreviated as DTT).
In addition to 200d of the solution added to make it 5mM,
1 unit of terminal deoxynucleotidyl transferase (hereinafter abbreviated as TdT) (PL Bioc
Chemicals) was added thereto, and the mixture was reacted at 37°C for 11 minutes. Here, 3 of the Kpnl cleavage site of pcDVl
'Pop at the end! Approximately 67 J (dT) chains were added. From the solution, pcDVID with a poIJ (dT) chain was extracted by phenol-chloroform extraction and ethanol precipitation.
Approximately 1100 u of N^ was recovered. UDNA at 10mM T
ris-H(J (pH 7,5), 6mM MgCj
! x, 150d buffer consisting of 100mM NaCl
In addition, 360 units of EcoRI were added, and the mixture was heated at 37°C.
The reaction was allowed to proceed for 21 hours. After treating the reaction solution with the LGT method, approximately 3. The lkb DNA fragment was collected, and approximately 60 g of poly(
dT) Added pcDVl was obtained. The DNA was lomM
Tris-1 (C1! (pH 8,0) and 1mM E
It was dissolved in 500 d of a solution consisting of DTA, incubated at 65° C. for 5 minutes, cooled on ice, and 50 ml of 5M Na1J was added. The mixture was subjected to chromatography on an oligo(d^) cellulose column (manufactured by Collaborative Tip Research). Poly(dT) with sufficient chain length is adsorbed on the column,
Add this to 10mM TrisJICj! (pH8,0)
and 1mM E! Elute with a solution consisting of DTA and pop!
pcDVl (hereinafter abbreviated as vector primer) 27■ to which an I (dT) chain was added was obtained.

Next, linker DNA was prepared.

pLI C Okayama & Barb
& Berg): Molecular & Cellular
Biolon 40Jo1. Ce11. Rial, ), 3
．． 280 (1983) ] about 14 μm to 10 mM Tri
s-HCj! <pH 7,5), 6mM Mg! J
Buffer 20 consisting of 2 and 50mM NaC11
0 m and additionally 50 units of PstI at 37°C.
After reacting for 4 hours, PLI DNA was cleaved at Pstli1 position.

After phenol-chloroform extraction of the reaction product, ethanol precipitation was performed, and about 13 pLIDNAs were cut with PstI.
．． was recovered. Approximately 13μ of the DNA was added to 50JdI of a solution containing dGTP at a final concentration of 0.25mM in TdT buffer, and further TdT (P-L Bio-chemical
a11s) was added and incubated at 37°C for 13 minutes to add (d
Approximately 14 G> chains were added. After phenol-chloroform extraction, DNA was recovered by ethanol precipitation. M.D.
NA 10mM Tris-HC1 (pH 7,5),
6mM M g C122 and 60mM Na
In addition to 100 JJJl of buffer consisting of C1, an additional 80
One unit of HindI[I was added, incubated at 37°C for 3 hours, and pLlollA was cleaved at the H+ndI[I site. The reaction product was fractionated by agarose gel electrophoresis, and a DNA fragment of approximately 0.5 kb was separated using the DEAE paper method [Dretzen et al.: Analytical Biochemistry (Anal, 8iochem), 112
, 295 (1981)] and oligo(dG)
A chained linker DNA (hereinafter simply referred to as linker DNA) was obtained.

Approximately 4 μm of the poIJ (A) RNA prepared above and approximately 1.4 tails of the vector primer were mixed with 50 mM Tris-HCJ!
(p)18.3), 8mM MgCL, 30mM
KCf.

OJmM DTT, 2mM dNTP (dATP
, dTTP, dGTP and dCTP) and 10
Unit glue ponuclease inhibitor (P-L Bio
10 units of reverse transcriptase (manufactured by Ihigaku Kogyo Co., Ltd.) was added thereto and incubated for 90 minutes to synthesize NA complementary to the mRNA. The reactant is converted into phenol-
After chloroform extraction and ethanol precipitation, RNA-D
Vector brimer DNA with an added NA double strand was recovered. The DNA was dissolved in TdT buffer 204 containing 66 pM dCTP and 0.2 μM poly(A), and 14 units of T d T (manufactured by P-L Biochemicals) was added and incubated at 37° C. for 2 minutes.
Twenty (dC) strands were added to the 3' end. The reaction product was extracted with phenol-chloroform, and the cDNA-vector primer DNA with the (dC) chain added was recovered by ethanol precipitation. The DNA was diluted with 10mM Tris-H.
Cj! (pH 7.5), dissolved in solution 4004 consisting of 6mM Mg C12 and 60mM Nacl, and
Added 0 units of HindI[[, incubated for 2 hours at 37°C, and cut at the HindI[[] site. The reaction product was extracted with phenol-chloroform and precipitated with ethanol.
Five pmoles of (dC)-adducted cDNA-vector primer DNA was obtained. 0.2 pmol of the D N A and 0.4 pmol of the linker D N A in 10 mM Tris-)ICj! (p)17.5)
,0. IM NaCl' and 1mM EDT
Dissolved in 100ml of solution consisting of A, 65℃, 42℃, 0
The cells were incubated at ℃ for 10 minutes, 25 minutes, and 30 minutes, respectively. 20mM Tris-)ICj! (pH 7,5)
, 4mM MgCl 2.10mM (NH4)
2SO4,0,1M K(l and 0.1mM β-N
A reaction solution was prepared with the composition of AD so that the total amount was 1000 d. Add 25 units of Escherichia coli DNAIJ gauze (manufactured by New England Biolabs) to the reaction solution, and add 1 lt.
Incubated for 18 hours. Components were added to the reaction solution to give 40 μM each of dNTP and 0.15 mM β-NAD, and 10 units of E. coli DNA IJ gauze,
20 units of E. coli DNA polymerase I (P-L Bi
(manufactured by P-L Biochemicals) and lO units of E. coli ribonuclease H (P-L Biochemicals)
(manufactured by Nippon Steel & Co., Ltd.) and incubated at 12°C and 25°C for 1 hour each. In the above reaction, recombinant DNA containing cDNA
Circularization of A and the RNA portion of the RNA-DNA duplex become D
A complete double-stranded DNA recombinant plasmid was generated by replacing the DNA with NA.

(3) Recombinant DNA containing human t-PA-cDNA
Selection of human t-PA-cDNA (Pennica et al.: Nature 301.214 (1983)) using colony hybridization.
)] Synthesis of a base that matches a part of the base sequence of the t-PA signal peptide region NA 5'-^TGGATGCAATGAAGAGAGGGC
t-PA-cDNA was selected as a clone that associates with the 32p-labeled probe of TCTGCTGT-3' in the following manner.

First, using the recombinant plasmid obtained in (2), E. coli C6003F8 strain [Cameron Seeding on the National Academy]
On Science (Proc. Natl.

^cad, Sci,) USA 72.3416 (19
75)) Hanahan's method 01anahan: Journal on Molecular Biology (JoMol,
Biol, ), 166.557 (1983)). Approximately 10,000 colonies obtained were collected using the method of Hanahan and Meselson.
d Meselson: Methods in Enzymology
) 100, 333 (1983)) and fixed on nitrocellulose filters. Next, prehybridization of the filter was carried out using 6 XNETC1x
NE! T = 150mM N a C1, 15mM T
ris-HIJ (pH 7,5), 1mM EDTAI
, tox Denhardt solution, and 10 hg/m+ of fragmented E. coli chromosomal DNA at 65° C. for 4 hours or longer.

Add the above 3.2P to this prehybridization solution.
(65°C for at least 16 hours) to allow it to associate with the DNA on the filter. Next, filter the filter with 6xSSC (IXSSC=150mM NaC!!,
Wash twice with 15mM sodium citrate) at room temperature for 5 minutes.
2×SSC and 0.1% SO8 at 65° C. for 30 minutes. After further washing for 15 minutes with a solution containing 2xSSC and 0.1% SDS at 65°C,
Washed twice (5 minutes each) with SC at room temperature. After air drying the filter, one positive clone was identified by autoradiography. The base sequence of the cDNA of plasmid ptPA7 possessed by this positive clone was determined by the deideoxy-Siefens method using M13 phage. As a result, the cDNA of ptPA7 was found to have the amino acid sequence of t-PA reported by Pennica et al.
Nature + - (Nature) 301°214 (19
83)] was found to encode t-PA, which completely matches t-PA. However, it was found that the 95th aspartic acid codon (GAC) and the 51212th leonine codon (ACΔ) of mature t-PA were each GAT%ACC.

This strain is Escherichia coliE
It has been deposited with the Institute of Fine Technology as tPA7FERM BP-1467.

Reference example 2゜Plasmid p carrying human pro-UK cDNA
Construction of LIKl: cD of Detroit 562 cells created in Reference Example 1
The NA library was screened by colony hybridization method and human pro-UK cDNA
A clone was isolated. That is, first, using the recombinant plasmid obtained in Reference Example 1, E. coli C600SF8 strain [
Cameron: Proceedings
On the National Academy of Sciences (Proc, Natl, Acad.

Sci,) LISA 72.3416 (1975))
Hanahan's method [)1anahan: Journal
On Molecular Biology (J8Mol, B
iol, ), 166, 557 (1983)]. Approximately 30,000 colonies were obtained using the method of Hanahan and Meselson.
Meselson: Method 6-in-1 enzyme T
-Cl G (Method in [inzymolo
gy) 100.

333 (1983)] on nitrocellulose filters. Next, prehybridization of the filter was carried out using 6x NET110x Denhardt (
oral enrichment) fluid, and 100 ag/ln
in a solution containing 65 l of fragmented E. coli chromosomal DNA.
℃ for 4 hours or longer.

Next, human pro-LIKc DNA Holmes (
Holmes et al.: Biotechnology (Bio/Te
chnology) 3.

A 41-base synthetic NA 5'-GGGAATGGTCACTTTACCGAG that matches the base sequence of a part of the kringle region of 923 (1985))
GAAAGGCCAG(:ACTGACAC-3') Human pro-11Kc DNA isolated by the present inventors
Specifically, a probe labeled with 32p (corresponding to the underlined base sequence in Table 5) was added to the above prehybridization solution, and the DNA on the filter was added to the prehybridization solution.
(65℃ for 16 hours or more). The filters were then washed twice with 6x SSC (room temperature, 5 minutes each).
After that, incubate with a 57°C solution containing 1x SSC, O, and 1% SDS.
Washed for 0 minutes. After further washing with a 57°C solution containing 1X5SC and 0.1% SDS for 15 minutes, 2X with 6XSSC.
Washed twice (room temperature, 5 minutes each). After air drying the filter, one positive clone was identified by autoradiography. Plasmid p carried by this positive clone
The base sequence of UKl cDNA was determined by the deideoxy-Siefens method using M13 phage (Table 5).

As a result, the cDNA of pUKl is pr when following the amino acid residue numbering for pro-U in Table 5.

It was revealed that it encodes the pro-u translated region and 3' untranslated region downstream from the 41st Cys residue at -〇. The amino acid sequence of pro-LIK encoded by pUKl cDNA is
lolmes et al.: Biotechnology (Bio/Tec
hnology) 3.923 (1985)], but the third base of the four amino acid codons shown below was different.

254th amino acid Asn: AAC-4AAT
340th amino acid Leu: CTA-4CTG3
45th amino acid Pro: CCC-CCA34
6th amino acid Gln: CAA-CAG This strain is Escherichia coli EUK
IFERM BP-1463) has been deposited with the Institute of Fine Technology.

Reference Example 3 Construction of plasmid pUKII carrying human pro-IJK cDNA: The pro-tl cDNA encoded by the plasmid pUK1 obtained in Reference Example 2 contains the signal region of pro-U and the growth factor metoin. Since these regions were not included, cDNAs containing these regions were cloned using the procedure shown below.

First, the vector pCCK used for cDNA cloning
2 was constructed as follows.

(1) Construction of recombinant plasmid pCCK 1: Plasmid pRc19 containing cDNA of rat brain cholecystokinin (CCK, precursor) constructed by Kuwano et al. [: Kuwano et al.: Journal on Biochemistry (J, Bi
ochem,) 96.923-926 (1984))
Escherichia coli H8101 strain having the following was cultured, and pRc19 DNA was prepared from the cultured cells by a conventional method. The obtained pRc1
Dissolve approximately 3 μ of 9 DNA in 30 Y-50 buffer solutions and add 1
One unit of pvuII was added and the digestion reaction was carried out at 37°C for 1 hour. This reaction resulted in partial digestion of DNA by PvuII.

After heat treatment at 65°C for 10 minutes, approximately 53
A 0bP DNA fragment was purified. On the other hand, plasmid DNA pUC19 [Norran
der, J. et al.: Gene 26.10H
1983): pUC19 plasmid DNA can be obtained manually from Takara Shuzo Co., Ltd.] Approximately 1. yo containing 20mM KCl
30JJJt of a buffer solution was dissolved, 16 units of Smal was added, and the digestion reaction was performed at 30°C for 2 hours. After heat treatment at 65°C for 10 minutes, approximately 2.7 Kb DN was obtained using the AFT method.
The A fragment was purified.

Approximately 530 bp derived from pRc19 obtained in this way
DNA fragment (approximately 0.01Jig) and pU C19-derived (7) approximately 2.7Kb17) DNA fragment (approximately 0.05N
) in 204 T4'J gauze buffer,
Unit T4DNA! J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA from this transformed strain.

When pCCKl was isolated and subjected to structural analysis using restriction enzymes, it was confirmed that it had the desired structure (see Figure 15).

(2) Construction of recombinant plasmid pCCK2 Approximately 2 cm of pCCK1 plasmid DNA obtained above
0 buffer, add 12 units of 5ACl, and incubate at 37°C.
Digestion reaction was carried out for 2 hours.

Furthermore, 2M NaCj of 1.5 rhinoceroses! and 10 units of Ba
mHI was added and the digestion reaction was carried out at 37°C for 2 hours. 65
After heat treatment at ℃ for 10 minutes, approximately 0.55 using AFT method.
The Kb DNA fragment was purified. On the other hand, approximately 2 cm of pTrS33 plasmid DNA obtained in Reference Example 5 described below was subjected to the same reaction as above, and the resulting approximately 2.85 Kb 5acl-B
The amHI fragment was purified using the AFT method.

The approximately 0.55-b DNA fragment (approximately 0.024) derived from pCCKI thus obtained and the approximately 2.85-b DNA fragment (approximately 0.1■) derived from pTrS33 were added for 20 d.
of T4 ligase buffer and 50 units of T4D
NA! J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a ^p-resistant strain. Plasmid DNAIIICC 2 was isolated from this transformed strain, and structural analysis using restriction enzymes confirmed that it had the desired structure (see Figure 16).

(3) Isolation of plasmid pUK11 carrying human pro-LIKc DNA: Poly(A) RNA (mRNA) of approximately 8#C'7d 10m of Detroit 562 cells prepared in Reference Example 1
MTris-HCI (pH 7,5)-0,5mM E
[dissolved in DTA] was heated at 65° C. for 10 minutes and then rapidly cooled in water.

This solution was mixed with 50mM Tris-)1cJ! (p
H8,3), 8mM MgC12,30o+MKC1,
5mM DTT, lmMdNTP (dATP
, dTTPSdGTP and dCTP), lO units of bonuclease inhibitor 9- (P-LBioch
manufactured by chemicalls), and 5g/ml oligo (dT
)+2-1° (manufactured by Collaborative) (total amount: 80 animals), and then kept warm at 41° C. for 15 minutes. Next, 20 units of reverse transcriptase (manufactured by Seikagaku Corporation) was added and incubated at 4F for 90 minutes to extract cD complementary to mRNA.
NA was synthesized. After performing phenol-chloroform extraction and ethanol precipitation of the reaction product, 0.3M of 404
The mRNA was hydrolyzed by dissolving it in NaOH and standing at 37°C for 15 hours. Next, the IM of lO−
Tris-HCl (p! 47.5) and 0.3N of 40-
After neutralization by adding t((J), Ichiki-like cDNA was recovered by ethanol precipitation and dissolved in 28.5 d of H2C.

This solution was added to 50+++M Tris-11cj! (
p) 18.3) , 8mM MgC1,, 30mM K
Cj! , 5mM DTT, 1mM dNTP (d
ATP, dTTP, dGTP and dCTP), and 2.5/m+ synthetic NA primer CATGAGA
GCCCTGCTGG (matches the nucleotide sequence of part of the signal peptide region of human pro-ro) (total amount 404), and then incubated at 65°C for 10 minutes.
Subsequently, the mixture was kept at 41° C. for 30 minutes.

Next, by adding 10 units of reverse transcriptase and incubating at 41°C for 60 minutes, two single-layer cDNAs were isolated.
Converted to NA. The reaction product was subjected to phenol-chloroform extraction and ethanol precipitation, and then 25mM NaC
Dissolve 25 units of B in Y-011 equilibration solution containing 1.
(manufactured by England Biolabs) was added to s5H■, and a digestion reaction was carried out at 50°C for 2 hours. Furthermore, 1.2
Add 5-2M NaCl and 12 units of BamHI,
Digestion reaction was carried out at 7°C for 2 hours. After heating at 65°C for 10 minutes, the cDNA of b was approximately 1.1 to 1.4 using the AFT method.
The A fragment was purified.

On the other hand, the pCCK2 plasmid DNA obtained above
After cutting with Bs5HII and BamHI in the same manner as above,
Bs5HII-Ba of about 2.9 b using the AFT method
The mHI fragment was purified.

The cDNA of approximately 1.1-1.4 b obtained in this way
Dissolve the A fragment (about 0.02 g) and the pCCK2-derived DMA fragment of about 2.9 and b (about 0.05 μg) in 20-family T4 ligase buffer, add 200 units of 74 DNA IJ gauze, and add 4 The binding reaction was carried out for 18 hours at °C.

Using the obtained recombinant plasmid mixture, E. coli C6
By transforming the 005F8 strain, approximately 25.00
0 ^p-resistant strains were obtained, and from among these ^p-resistant strains, the probe used in the isolation of pro-UK cDNA in Reference Example 2 was extracted using the colony hybridization method described in Reference Example 2. Approximately 1000 positive clones associated with the same probe were obtained. Note that the hybridization and filter washing conditions were the same as in Reference Example 2. Plasmid pUK11 (see Figure 17) carried by the 1 positive clone thus obtained was isolated, and pr
o-11 signal peptide, growth factor domain,
The nucleotide sequence of the kringle domain region was determined by the deideoxy-Siefens method using M13 phage. As a result, the base sequence was llolme
s et al.: Bio/Technolo
gy) 3, 923 (1985)).

Reference example 4゜Plasmid pcSFl-2 carrying hG-CSF cDNA
and construction of pCSF2 (1) Poly(A)R from normal human peripheral blood macrophages
Preparation of NA: White blood cells obtained by centrifugation from the peripheral blood of a normal person were cultured in a plastic bottle, and macrophages, which are adhesive cells, were isolated by washing and removing non-adherent cells. From this macrophage, the guanidine thiocyanate-lithium chloride method [Cathala et al. DNA 2.329 (1983)
) RNA having poly(A) was prepared as follows.

400ml of peripheral blood from a normal person) Iitachi RPR
Centrifuge at 1800 rpm for 20 minutes in an IO rotor to precipitate blood cells, and collect 50ml of this! I phosphate buffered saline CN
aC18g/l, KCl 0.2g/l, anhydrous NaaH
PO* 1.15g/L KH2PO40.2g/L
(pH 7.2; hereinafter abbreviated as PBS)].

25 ml of this suspension was layered on 25 ml of lymphocyte separation solution [manufactured by Pionetics (81ON [!TlC5)], and
180°rpm at itachi RPRIOo-ter
, and centrifuged for 30 minutes. Separate the white blood cells in the middle layer and wash with an equal volume of PBS (Hitachi RPRIO).

- 150 rpm for 10 minutes), then 20 ml of RPM11640 medium containing 5% calf fat serum (
(manufactured by Hinaga Pharmaceutical Co., Ltd.) and cultured.

A tissue culture flask (manufactured by Corning) was used for culture. After culturing at 37°C for 1.5 hours, the culture supernatant was removed together with non-adherent cells. Another 20 ml of the same medium and Escherichia coli lipopolysaccharide (LPS) were added at a concentration of 0.3 mg/m+, and the mixture was further cultured at 37°C for 4 hours. Then,
Cells were collected from the culture medium by centrifugation at 1.100 x g and 4°C for 10 minutes, washed with 80 ml of PBS, and then
M guanidine thiocyanate, lomM EDTA,
Solubilized in 10 ml of a solution consisting of 50 mM Tri 5-HCI (pH 7> and 8% (v/v) 2-mercaptoethanol) using a Portex mixer. The solubilized material was transferred to a centrifuge tube and 80 ml of 4 M LiCf solution was added.
After adding m1 and stirring, the mixture was allowed to stand at 4°C for 20 hours.

9.00 O with Hitachi RPRIO rotor
After centrifugation at rpm for 90 minutes, RNA was collected as a precipitate. The RNA precipitate was suspended in 50 ml of a solution consisting of 4 M urea and 2 M lithium chloride, and
After centrifugation in a PRIO rotor at 9.00 Orpm for 60 minutes, RNA was recovered as a precipitate.

Precipitate the RNA with 0.1% sodium lauryl sulfate, 1 m
MEDTA, 10mM Tri5-HCl (
It was dissolved in 10 ml of a solution consisting of pH 7.5), extracted with phenol-chloroform, and recovered by ethanol precipitation. Approximately 0.8 mg of the resulting RNA was added to 10 mM T
r i 5-HCl (pH 8,0) and 1mM
It was dissolved in 1 ml of a solution consisting of EDTA. After incubating at 65°C for 5 minutes, 0.1 ml of 5M NaCJ was added. The mixture was applied to an oligo(dT) cellulose column [
P-L Biochem
ica+) chromatography (column volume 0.
5ml). mR with adsorbed poIJ(A)
NA was diluted with 10mM Tri 5-HCl (pH 7,5
) and 1 mM EDTA to obtain about 30 μm of mRNA containing poly(A).

(2) cDNA synthesis and insertion of the cDNA into a vector: Okayama-Berg (Okayama-Berg)
Method g) [Molecular and Cellular Biolon (Mol, Ce11.Bio+,), 2.1
61 (1982)), cDNA was synthesized and a recombinant plasmid incorporating it was constructed. An outline of the process is shown in FIG.

Po! prepared above! I (A) Approximately 3 μg of RNA and approximately 1.4 μg of vector primer were mixed in 50 mM Tri 5H.
Cj2 (pH 8,3), 8mM MgCl12°30m
MKCj! , 0.3mM DTT, 2mMaNT
P (dATP, dTTP, aGTP and dCTP)
and 10 units of glue bonuclease inhibitor (P-
Solution 22 consisting of L Biochemicals)
．． 3 m, add 10 units of reverse transcriptase (manufactured by Seikagaku Corporation), and incubate at 41°C for 90 minutes.
Complementary NA was synthesized. The reaction product was subjected to phenol-chloroform extraction, ethanol precipitation, and RN
Vector brimer DNA with A-DNA double molecule added
was recovered. The DNA was treated with 66 μM dCTP and 0
．． 14 units of T d T (P-L Bio-chem
icals) and incubate for 2 minutes at 37°C to add approximately 20 (dC) strands to the 3' end of the cDNA. The reaction product was extracted with phenol-chloroform, and the cDNA-vector primer DNA with the (dC) strand added was recovered by ethanol precipitation. The DNA was 10mM
TrisHC1 (pH 7,5>, 6mM
Dissolved in solution 4004 consisting of M g C1z and 60mM NaC1, added 20 units of )lindI[[, incubated at 37°C for 2 hours,
It was cut at the site. The reaction product was extracted with phenol-chloroform and precipitated with ethanol to obtain 0.5 pmol of (dC) chain-added cDNA-vector primer DNA. The D
0.2 pmol NA and 0.4 pmol of the linker-DNA described above.
picomole to 10mM Tri 5-HCj! (pH7
,5), 0.1M NaCA and 1mM EDT
Dissolved in 100d of solution consisting of A, 65℃, 42℃, 0
℃ for 10 minutes each.

Incubated for 25 and 30 minutes. 20mMTr
i 5-HCI (pH 7,5), 4mM M
gCj! *.

10mM (NH4)Is 04.0.1MK
Composition of Cl and 0.1mM β-NAD, total amount 1
A reaction solution was prepared so as to give a reaction temperature of 000d. 25 to the reaction solution
A unit of E. coli DNA! New England Biolabs) was added to J gauze and incubated at 11°C for 18 hours. The reaction solution was mixed with 40 μM each of dNTP, 0.15 m
Additional components were prepared to make M β-NAD, 10 units of E. coli DNA IJ gauze, 20 units of E. coli DNA polymerase I (P-L Biochemicals
) and 10 units of E. coli ribonuclease H (P
-L Bioche-micals) and 12
℃ and 25°C for 1 hour each. In the above reaction, circularization of recombinant DNA including cDNA and RN
The RNA portion of the A-DNA duplex was replaced with DNA, producing a complete double-stranded DNA recombinant plasmid.

(3) Selection of recombinant DNA containing hG-CSF cDNA: Using the recombinant plasmid obtained in (2), E. coli C
The 600SF8 strain was transformed according to the method of Scott et al. [Katsuya Shigesada: Cell Engineering 2.616 (1983)]. The approximately 9,200 colonies obtained were immobilized on a nitrocellulose filter. Oval et al. [Oval (N
agata) et al.: Nature 31
9, 415 (1986)] isolated hG-CS.
27 corresponding to the N-terminal 9 amino acids of the mature protein of F.
Base synthesis NA 5'-^CCCCCCCTGGGCCCTGCCAGCT
CCCT&-3' to 3ffp-labeled probe 6
We selected two strains that strongly associated with each other at 0°C [Grunstein
Grunstein-Hogness Method, Proceedings on the National Academy of Sciences (Proc, Natl., Aca.
d, Sci,) USA? 2゜3961 (1975
) ). Plasmid pcsF1-2 carried by these strains
And the entire base sequence of cDNA possessed by pcsF2 was determined by M
It was determined by the Deideoxy Seefence method using phage No. 13.

As a result, the c possessed by pcsFl-2 and pCSF2
The DNA was found to encode hG-CSF. The microorganism containing plasmid pCSF1-2 is Esch
erichia coli EC5FI-2 [FERM
40P-12201,! -L Te, Matafrasumito pcS
The microorganism containing F2 is Bscherichia coli
E CS F 2 [FERM BP-20731 has been deposited with the Institute of Fine Technology.

Reference Example 5 Construction of recombinant plasmid pTrS33: (1) ATG
Construction of vector pTrs2 (18): According to the procedure shown in Figure 18, the distance between the SD sequence and the ATG start codon is 1.
An ATG vector pTrs20 was constructed with 4 bases and a 5acl site immediately after the ka-ATG codon.

First, 3 g of pKYPlo prepared by the method described in JP-A-58-110600 was added to 30 d of Y-100 buffer.
Dissolve restriction enzyme BanIII and restriction enzyme Nrul in
New England Piolabs Co., Ltd.) was added thereto in an amount of 6 units each, and a cleavage reaction was carried out at 37° C. for 3 hours. From this reaction solution, a DNA fragment of approximately 3.8 to 0.0 mm containing Ptrp (BanI [I-Nrul fragment)] was obtained by the LGT method.
5. I got it.

On the other hand, in order to provide an ATG initiation codon downstream of Ptrp, the following DNA IJ anchor was synthesized by the triester method.

Synthetic NA of 19-mar and 17-mar (10 each
50mM Tris-41C1(p)
17.5), 10mM MgCl2.51T
Dissolved in a total volume of 20-mL solution containing IM dithiothreitol, 0.1mM EDTA and 1mM ATP,
Three units of T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.) were added, and a phosphorylation reaction was carried out at 37°C for 60 minutes.

Next, the pKYP10-derived Ban[[-Nru
Dissolve 0.1 g of the l fragment (approximately 3.8 b) and approximately 0.5 picomole of the above DNA linker in 20 ml of T4 ligase buffer, add 2 units of T4 DNA ligase, and incubate at 4°C for 1 g.
The binding reaction was carried out for 8 hours.

Using the obtained mixture of recombinant plasmids, E. coli H.
8101 strain [Boliver et al.: Gene (
Gene) 2, 75 (1977)) was transformed to obtain Apr colonies. Plasmid DNA was recovered from the cultured cells of this colony. The structure of the obtained plasmid was constructed using the restriction enzymes EcoRI, BanI [[,) (i
After cleavage with ndI[I, 5acI, and Nrul, it was confirmed by agarose gel electrophoresis. This plasmid is pTr
Named s20 (Figure 18) a pTrs2 (18)
The nucleotide sequences near the Ban1II and HindDI sites were confirmed to be as shown below using the Deideoxy Seefence method using M13 phage.

(2) Construction of pTrS33: Approximately 3 μg of the pTrs20 plasmid DNA obtained above was dissolved in 30% Y-0 buffer, 12 units of 5aCI was added, and a digestion reaction was performed at 37° C. for 2 hours. Another 1.5
Add m of 2M NaCl and 10 units of pstl and incubate at 37°C.
Digestion reaction was carried out for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of about 1.15 Kb was purified by AFT method.

On the other hand, pKYP26 prepared by the method described in JP-A No. 62-48699 [E. coli containing pKYP26 is Escherichia coli
cherichia coli I KYP26 (
FERM 0P-863)] was dissolved in 30 d of Y-100 buffer, 8 units of Pstl and 10 units of BamHI were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, approximately 1. ? The Kb DNA fragment was purified. Also, M13mp18RF DNA (No.
rrander.

J. et al.: Gene 26, 101 (198
3): M13mp18RF 011^ was prepared by Takara Shuzo Co., Ltd.) 2■ was dissolved in 30% Y-0 buffer, 10 units of 5ac I was added, and a digestion reaction was performed at 37°C for 2 hours. Furthermore, IM Na (l and 10
One unit of OlaI was added and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment (65℃, 10 minutes), the AFT method yields approximately 0
．． A fi 5 Kb DNA fragment was purified. Separately, two types of synthetic NAs (43 bases and 45 bases) shown in Figure 19 were synthesized using a DNA synthesizer, and 5'-phosphorus was synthesized using the same method as described above. Oxidized.

Approximately 1,15 from pTrs20 obtained in this way
nib DNA fragment (approximately 0.1 gg), approximately 1.7 Kb (7) DNA fragment derived from pKYP26 (approximately 0.1 ag)
, approximately 0.65 b DNA fragment derived from M13mpL8 (
Approximately 0.05 μm), 20 ml of the above two types of synthetic NAs (1 pmole each), which were right- and 5'-phosphorylated.
Dissolve 50 units of T4D in Makoto's T41J gauze buffer.
NA! I gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the mixture of recombinant plasmids thus obtained, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid pTrS33 was isolated from this transformed strain, and structural analysis using restriction enzyme digestion and Deideoxy Seefens method using M13 phage were performed to determine pTrS33.
It was confirmed that TrS33 has the desired structure (first
(See Figure 9).

Reference Example 6 Construction of recombinant plasmid pTerm2: pK
YP26 plasmid DNA [JP-A-62-48699] approx. 2. 10mM Tris-8C1 (pH 8,
0), 75mM NaCl, ? mMMgCL, 6o+M
It was dissolved in a solution containing 2-mercaptoethanol, 16 units of ^5p718 (manufactured by Boehringer Mannheim) and 10 units of PstI were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, AFT
A DNA fragment of approximately 1.7 b was purified using the method. On the other hand, about 2 gg of pTr320 plasmid DNA obtained in Reference Example 5 (1) was dissolved in 3040Y-100 buffer,
8 units of PstI and 10 units of NruI (manufactured by Boehringer Mannheim) were added, and a digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 1.5 kb was purified using the AFT method. In addition, two types of synthetic NA (19 bases and 23 bases) shown in Figure 20 were added to Applied Biosystems 380^ DNA.
They were synthesized using a synthesizer, and each was separately 5'-phosphorylated using a method similar to that described above.

The approximately 1.7 Kb DNA fragment derived from pKYP26 (approximately 0.1 g) obtained in this manner, the approximately 1.15 Kb DNA fragment derived from pTrs20, and two 5'-phosphorylated synthetic DNA fragments. (lpmole of each) in 20 - T4 ligase buffer and 50 units of T4
DNA! J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a ^ρ-resistant strain.

Plasmid DNA, pTerm2, was isolated from this transformed strain, and structural analysis by restriction enzyme digestion and Deideoxy Seefens method using M13 phage were performed to determine pTerm2.
It was confirmed that Term2 had the desired structure (Second
(See figure 0).

Reference example 7゜Recombinant plasmid pTsF1 (18) construction: Reference example 1
Plasmid pt carrying the human) t-PA cDNA obtained in
ptPA? from cultured cells of Escherichia coli C600SF8 strain carrying PA7 using a conventional method. DNA was prepared. Obtained ptP
Approximately 2 strands of A7 DNA were dissolved in Y-100 buffer 304, 8 units of restriction enzyme Bgl were added, and a digestion reaction was carried out at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 2.
A DNA fragment of 0.b was purified. Next pTrS33D
About 2 μ of NA (Reference Example 5) was mixed with 10 units of restriction enzyme BamHI in 304 Y-100 buffer, and a digestion reaction was carried out at 37° C. for 2 hours. After heat treatment at 65°C for 10 minutes, A
The DNA fragment of approximately 2.8 b was purified using the FT method.

About 2.0 b from ptPA7 thus obtained
(7) DNA fragment (approximately 0.14) and pTrS33-derived approximately 2.8-b DNA fragment (approximately 0.1 g), total amount 20
d was dissolved in T41J gauze buffer, 50 units of T4DNAIJ gauze was added, and a binding reaction was performed at 4°C for 18 hours.

E. coli MM 294 strain was transformed using the obtained mixture of recombinant plasmids to obtain an Ap-resistant strain. Plasmid DNA pTSFIO was isolated from this transformed strain and structurally analyzed by restriction enzyme digestion. , it was confirmed that it had the desired structure (see Figure 21).

Reference Example 8 Construction of recombinant plasmid pTA4: Approximately 3 cm of pTsF10 plasmid DNA obtained from Example 7 was dissolved in 30 JJIl of Y-0 buffer, 12 units of restriction enzyme Kpn I was added, and the mixture was incubated at 37°C for 2 hours. After performing the digestion reaction for 1.5 hours, 1.5 JJi of 3M NaCl and 12 units of the restriction enzyme BstEII (manufactured by New England Biolabs) were added, and the digestion reaction was further performed at 60°C for 2 hours. went.

Subsequently, an approximately 0.3 Kb DNA fragment was purified using the AFT method.

Apart from this, Escherichia coli IGHA2 (Feikoken FBRMB
P-400) and extract PGH from the cultured cells using a conventional method.
^2 Plasmid DNA, A (JP-A-6O-221091)
was prepared. Approximately 2 cm of the obtained pGHA2 DNA was
8 units of PstI and 8 units of BglU were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, approximately 0
．． A 75 Kb DNA fragment was purified.

In addition, approximately 3 ■ ptPA7 DNA (Reference Example 1) was added to 304
of Y-150 buffer, add 10 units of BglU, perform a digestion reaction at 37°C for 2 hours, and then add 12 units of BglU.
stB II was added, and the digestion reaction was further carried out at 60°C for 2 hours. Subsequently, using the AFT method, D of about L 55 Kb
The NA fragment was purified.

In addition, about 2 μm of pTerm2 DNA obtained in Reference Example 6 was added with 12 units of Kpn I in 30 days of Y-0 buffer, and the digestion reaction was performed at 37°C for 2 hours.
NaCj! and 8 units of PstI were added, and the digestion reaction was further carried out at 37°C for 2 hours.

Subsequently, an approximately 1.7 Kb DNA fragment was purified using the AFT method.

Four types of DNA fragments (pTsF
10-derived fragment 0.03J1gSpGHA2-derived fragment 0.05 shoulder, ptPA7-derived fragment 0.1 shoulder, and p
Fragment 0.1 from Tarm2. ) in 204 T4 ligase buffer and 200 units of T4 DNA! I gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, large intestine 1
The 1MM294 strain was transformed to obtain an Afl-resistant strain. Plasmid DNA pTA4 was isolated from this transformed strain,
Structural analysis by restriction enzyme digestion confirmed that it had the desired structure (see Figure 22).

Reference example 9゜t-P^ expression plasmid psEIP^ISε1dhfr
Construction of l-9^: (1) Construction of recombinant plasmid pAG E 105M: Plasmid pAG constructed by the present inventors
E28: Mizukami et al.: Journal on Biochemistry (J, Biochem,) 101, 1307-1
310 (1987)) was cultured, and pAGE28 DNA was prepared from the cultured cells by a conventional method. Approximately 2 cm of the obtained pAGE28 DNA was added to 30 y
-Too buffer was added, 8 units of Xhol and 12 units of Scal were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65℃ for 10 minutes, approximately 2
．． An 8 Kb DNA fragment was purified. On the other hand, plasmid pAGE103 constructed by the present inventors [Mizukami et al.: Journal on Biochemistry (J, B
iochem, ) 101, 1307-1310 (19
E. coli H8101 strain harboring 87)) was cultured, and pAGEi103 DNA was prepared from the cultured cells by a conventional method. Obtained PAGE! 103ON^ Approximately 3g in 30d Y-1
00 buffer, add 10 units of EcoRI,
Digestion reaction was carried out at 7°C for 2 hours. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. Dissolve this DNA fragment in a total volume of 404 polymerase buffer, add 6 units of Klenow fragment, and add 15 units of Klenow fragment.
The EcoRI protruding end was changed to a flat end by reacting at ℃ for 1 hour. The reaction was stopped by phenol extraction, followed by chloroform extraction, and then DNA fragments were recovered by ethanol precipitation. This DNA fragment was dissolved in 30 m Y-100 buffer, 12 units of Xhol was added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 0.4 b was purified using the AFT method. In addition, plasmid pKCR constructed by 0' Hara et al. [0' Hara et al.: Proceedings of the National Academy of Sciences (Proc.

Natl, ^cad, Sci,) LIS^78.1
527 (1981)) was cultured, and pKCR-DNA was prepared from the cultured cells by a conventional method. Approximately 2 g of the obtained pKCR-DNA was added to 30 u1 of Y-
150 buffer, 12 units of Ram old and 16 units of 5afI were added, and a digestion reaction was performed at 37°C for 2 hours.

After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation.

This DNA fragment was dissolved in a total volume of 40 mL of polymerase buffer, 6 units of Klenow fragment was added, and the mixture was reacted at 15°C for 1 hour.
The protruding end was changed to a flat end. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 1.85 Kb was purified using the AFT method.

Approximately 2,8 from pAGE28 obtained in this way
Kb DNA fragment (approximately 0.05■), pAG8103
An approximately 0.4 Kb DNA fragment (approximately 0.03■) derived from
and an approximately 1.85 Kb DNA fragment derived from pKCR (
Approximately 0.2 g) was dissolved in 20-related T4 ligase buffer,
300 units of T4 DNA! Add J gauze and heat at 4°C.
The binding reaction was carried out for 18 hours.

Using the mixture of recombinant plasmids thus obtained, Escherichia coli strain MM294 was transformed to obtain a kanamycin (hereinafter abbreviated as KIll) resistant strain. Plasmid pAGE105M was isolated from this transformed strain and structurally analyzed by restriction enzyme digestion, and it was confirmed that it had the desired structure (see Figure 23).

(2) Construction of recombinant plasmid pAGE106: Approximately 2 cm of pAGE105M-DNA obtained above was added to 304 y
-too buffer, added 12 units of Scal, and performed a digestion reaction at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, about 5. OKb's DNA
The fragment was purified.

On the other hand, in the same manner as in Example 1, 5'-phosphorylated E
coRI! An I-linker was prepared.

Approx.
．． Dissolve the 0 to b DNA fragment (approximately 0.1 g) and 1 pmol of 5'-phosphorylated EcoRI linker in 2b12 T4 ligase buffer and add 100 units of T4 DNA.
! J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a Km-resistant strain. Plasmid DN^pAGE106 was isolated from this transformed strain, and structural analysis by restriction enzyme digestion revealed that pAG
It was confirmed that El 06 has the desired structure (second
(See Figure 4) (3) t-PA expression plasmid psBI
Construction of P^1-5: pAGEl 06DN obtained above
Approximately 2 μm of A was dissolved in 304 Y-0 buffer, 12 units of pn[ was added thereto, and the digestion reaction was carried out at 37° C. for 2 hours. Additionally, 1.5 m of 2M NaCl and 10 units of Bam
Digestion reaction was carried out at 37°C for 2 hours. 65℃,
After heat treatment for 10 minutes, approximately 5. OKb
The DNA fragment was purified. On the other hand, p obtained in Reference Example 1
tPA7 plasmid DNA approx. was dissolved in 30 g of Y-0 buffer containing 75 mM NaCl, and 12 units of Fokl
Then, 12 units of EcoRI were added, and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, a DNA fragment of approximately 0.7 Kb was purified using the AFT method. In addition, two types of synthetic NAs (21 bases and 21 bases) shown in Figure 25
The bases) were synthesized using an Applied Biosystems 380A DNA synthesizer, and each was 5'-phosphorylated using the same method as described in Example 1.

Approximately 5.
OKb DNA fragment (approximately 0.1 Kb), approximately 0.7 Kb DNA fragment derived from ptPA7 (approximately 0.1 Kb), and EcoR of approximately 1.4 Kb derived from pTA4 prepared in Reference Example 8.
The I-KpnI fragment (approximately 0.05 g) and the two 5'-phosphorylated synthetic NAs obtained above (1 pmole each) were dissolved in 20 m T4 ligase buffer, and 50 units of Add T4 DNA IJ gauze, 4
The binding reaction was carried out for 18 hours at °C.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an m-resistant strain. Plasmid DNA psEIPA1-5 was isolated from this transformed strain, and structural analysis by restriction enzyme □ digestion and Deideoxy-Sequkins method using M13 phage were performed to p
It was confirmed that sEIPAl-5 had the desired structure (see Figure 25).

(4) Construction of t-p^ expression plasmid psatp^1-9: Dissolve approximately 2 g of the psEIPA, 1-5 DNA obtained above in 304 Y-0 buffer, and add 12 units of Kpnl.
was added, and the digestion reaction was carried out at 37°C for 2 hours. Furthermore, 1
．． 2M NaCl and 8 units of Hindm were added, and a digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, about 5. OKb's DNA
The fragment was purified. On the other hand, psEIPAl-5 DNA approx.
Dissolve ■ in 301Ji-Y-〇 buffer and add 12 units of K.
pnl was added and the digestion reaction was carried out at 37°C for 2 hours. Additionally, 1.04 of 2M NaCl and 10 units of NcoI
was added, and the digestion reaction was carried out at 37°C for 2 hours. 65℃, 1
After heat treatment for g minutes, the D of b was reduced to about 4.9 using the AFT method.
The NA fragment was purified. In addition, four types of synthetic NAs (47 bases, 49 bases, 49 bases and 47 bases:
These synthetic DNAs were synthesized from 5' (47 bases) of t-PAcDNA using an Applied Biosystems 380A DNA synthesizer, and each was separately synthesized using the same method as described in Example 1. 5'-phosphorylated.

About 5 from psEIPAl-5 thus obtained
．． OKb DNA fragment (approximately 0.1 g) and psEIPA
Approximately 4.9 Kb DNA fragment (approximately 0.1 g
) and four 5'-phosphorylated synthetic NAs (1 pmole each) were dissolved in 20 m T4 ligase buffer, 50 units of T4ON^ligase was added,
The binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a Km-resistant strain. Plasmid ON^psEIPA1-9 was isolated from this transformed strain, and ps
It was confirmed that BIPAl-9 has the desired structure (
(See Figure 26).

(5) Construction of recombinant plasmid pIJ C19H (Ap
Portapling of resistance genes): Plasmid DNA pUC19 created by Norlander et al.
(Norrander, J. et al.: Gene)
26, 10H1983); pUC19 plasmid DNA is available from Takara Shuzo Co., Ltd.].
111101 strain was cultured, and pU was extracted from the cultured cells by a conventional method.
c19[]NA was prepared. Obtained pUc19DNA
Dissolve approximately 2 μm in 30 JdI of Y-50 buffer, add 10 units of Hindl and 1 unit of DraI, and incubate at 37°C.
The digestion reaction was carried out for 1 hour. This reaction resulted in complete digestion of DNA with Hindm and partial digestion with Dral.

After heat treatment at 65°C for 10 minutes, approximately 1.
55 and the Hindnl-Dral fragment of b and approx. IKb
Two DNA fragments of the Drar-Hindlf [fragment] were purified. Separately, 20 pmol (pmo 1es) of
HindllI linker (C^^GCTTG; manufactured by Collaborative Research) was 5'-phosphorylated using a method similar to that described in Example 1.

The approximately 1.55-b DNA fragment (0.0a ug) derived from pUc19 obtained in this manner and the approximately 1.1-b DNA fragment (0.0a ug)
The NA fragment (0.03 g) and 1 pmol of 5'-phosphorylated Hindll linker were dissolved in 204 g of T4 ligase buffer and 50 units of T4 DNA! J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA A p U C19H was isolated from this transformed strain and structurally analyzed by restriction enzyme digestion.
It was confirmed that it had the desired structure (see Figure 27).

(6) Recombinant plasmid ps[! Construction of IPAI-9^ (insertion of Ap resistance gene into psBIPAl-9)
: About 2 shoulders of the pUc19H plasmid DNA obtained above was dissolved in 30 d of Y-50 buffer, and 8 units of
I[[] and 8 units of Prull were added, and the digestion reaction was carried out at 37°C for 2 hours. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. This DNA fragment was dissolved in a total amount of 40 g of polymerase buffer, 6 units of Klenow fragment was added, and the HindDI protruding ends were changed to flat ends by reacting at 15° C. for 1 hour. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 1.4 b was purified using the AFT method.

On the other hand, the t-PA expression plasmid psEIP obtained above
Dissolve about 2 chunks of A1-9 in 30 d of Y-150 buffer,
Add 8 units of XhoI and 8 units of EcoRV and heat at 37°C.
Digestion reaction was carried out for 2 hours. After heat treatment at 65° C. for 10 minutes, the DNA fragment b was purified to approximately 5.9 using the AFT method. Additionally, the pAGE28 plasmid MDN prepared above
Approximately 3 ml of A was dissolved in 30 d of Y-150 buffer, 10 units of XhoI and 10 units of EcoRV were added, and a digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 0.85 Kb was purified using the AFT method.

The thus obtained p U C198 derived approximately 1.
4. DNA fragment b (approximately 0.1 g) and psEIPAl-
About 5.9 b DNA fragment (about 0.1■) derived from 9 and p
Approximately 0.85 Kb NoroN^ fragment derived from AGE28 (approximately 0.
05 ■) in 20 d of T4 ligase buffer solution,
0 units of T4 DNA+J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a strain resistant to both Ap and Km. Plasmi from this transformed flHik)
'DNApSEIPAI-9^ was isolated and subjected to structural analysis by restriction enzyme digestion, and it was confirmed that it had the desired structure (see Figure 28).

The microorganism containing plasmid DNA psEIPAI-9A is Escherichia coli [1hPA
1-9^ Deposited as FERM BP-1460 at the Institute of Fine Technology on September 3, 1988.

(7) Construction of recombinant plasmid ρSε1clhfrlA: Approximately 2.0% of the pAGE 106 plasmid DNA obtained above. was dissolved in 30d(7)Y-50 buffer, 12 units of Asp718 (manufactured by Boehringer Mannheim) was added, and a digestion reaction was performed at 37°C for 2 hours. After phenol and chloroform extraction, DN was extracted by ethanol precipitation.
Fragment A was recovered. Asp718 was obtained by dissolving this DNA fragment in a total volume of 40-mL polymerase buffer, adding 6 units of Klenow fragment, and reacting at 15°C for 1 hour.
The protruding end was changed to a flat end. Subsequently, after phenol extraction and chloroform extraction, the DNA fragments recovered by ethanol precipitation were dissolved in a total volume of 304 Y-150 buffer, 10 units of M 1 u I was added, and a digestion reaction was performed at 37° C. for 2 hours. After heat treatment at 65°C for 10 minutes, AFT
A DNA fragment of approximately 3.3 Kb was purified using the method.

Separately, pSV2dhfr which selects the dhfr gene
Plasmid DNA C Subra-man
i) La: Molecule Cellular Biology (M
o1. Cell 1. Biol, ) 1. 854
(1981)] is dissolved in 304 y-too buffer to give 12 units of BgJ! If was added, and the digestion reaction was carried out at 37°C for 2 hours. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. This DNA fragment was dissolved in a total of 40 polymerase buffer solutions, 6 units of Klenow fragment was added, and the BglU protruding ends were changed to flat ends by reacting at 15° C. for 1 hour.

Subsequently, after phenol extraction and chloroform extraction, the DNA fragments recovered by ethanol precipitation were dissolved in a total volume of 30 d of Y-100 buffer, and 12 units of HindlI [
The digestion reaction was carried out at 37°C for 2 hours. 65℃
, about 0.75 using AFT method after 10 minutes of heat treatment.
The Kb DNA fragment was purified. Also, the ps obtained above
Approximately 3 µm of EIP Al-9A plasmid DNA was dissolved in 30 AI Y-100 buffer, 12 units of Hind µ was added, and a digestion reaction was carried out at 37°C for 2 hours.

Furthermore, 1.5d IMNaCj! and 12 units of Miu
1 was added, and the digestion reaction was carried out at 37°C for 2 hours. 65℃,
After heat treatment for 10 minutes, approximately 2.9 Kb was obtained using the AFT method.
The DNA fragment was purified.

The thus obtained pAGE106-derived DNA fragment (approximately 0.1 g) and pSV2dh f r-derived DNA
fragment (approximately 0.03■) and D from psEIPAl-9A.
The NA fragment (approximately 0.IN) was dissolved in 204 T4 DNA ligase buffer, 100 units of T4 DNA ligase was added, and the ligation reaction was performed at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an AI) resistant strain. From this transformed strain, plasmid DNA pSE1dhf rl
When A was isolated and structurally analyzed by restriction enzyme digestion, it was confirmed that it had the desired structure (see Figure 29).

(8) Recombinant plasmid psEIP^ISε1dhf
Construction of rl-9A: Approximately 3 g of the pSE1dhfrlA plasmid DNA obtained above was dissolved in 30 volumes of Y-100 buffer, 1 g of XhoI was added, and a digestion reaction was performed at 37°C for 2 hours. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. By dissolving this DNA fragment in a total amount of 40 g of polymerase buffer, adding 6 units of Klenow fragment, and reacting at 15°C for 1 hour,
The Xhol protruding end was changed to a flat end. Subsequently, after phenol extraction and chloroform extraction, the DNA fragments recovered by ethanol precipitation were dissolved in a total amount of 30 Y-150 buffer, 1 g of Mful was added, and a digestion reaction was performed at 37° C. for 2 hours. After heat treatment at 65°C for 10 minutes, A
A DNA fragment of approximately 4.4 Kb was purified using the FT method.

Separately, about 3 ug of the psEIPAl-9A plasmid DNA obtained above was dissolved in 304 Y50 buffer, 1 g of C1al was added, and a digestion reaction was performed at 37° C. for 2 hours. After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation. This DN
Dissolve the A fragment in a total volume of 404 polymerase buffer, and
The C1aI protruding end was changed to a flat end by adding a unit of Klenow fragment and reacting at 15°C for 1 hour. Subsequently, after phenol extraction and chloroform extraction, the DNA fragments recovered by ethanol precipitation were mixed with a total amount of 30 d of Y.
-150 buffer solution, Mj in units of 1 g! ul was added and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, the DNA of b was reduced to approximately 6.75 using the AFT method.
The fragment was purified.

The thus obtained pSE1dhfrlA-derived D
Dissolve the NA fragment (approximately 0.1 µ) and the DNA fragment derived from pSEIPAl-9A (approximately 0.1 µ) in 204 T4 ligase buffer, add 100 units of T4 DNA IJ gauze, and perform the ligation reaction at 4°C for 18 hours. went.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. From this transformed strain, plasmid DNA pSEIPAISE1d
When hfrl-9A was isolated and structurally analyzed by restriction enzyme digestion, it was confirmed that it had the desired structure (
(See Figure 29).

Reference Example 10 Construction of hG-CSF expression plasmid pAS3-3 = (
(See Figures 30 and 31).

(1) Construction of recombinant plasmid pC5F3-3: Dissolve pCSF2.2■ obtained in Reference Example 4 in 20 d of Y-150 buffer, add IO units of restriction enzyme Sad I,
Digestion reaction was carried out at ℃ for 2 hours. Then, the restriction enzyme Apa
Five units of LI was added, and the partial cleavage reaction was further carried out at 37°C for 10 minutes. From this reaction solution, approximately 4.0
The DNA fragment of b (Sail-ApaLI fragment) is approximately 1.
5. I got it.

On the other hand, in order to obtain cDNA completely containing the translated region of hG-CSF, three DNA linkers shown below were synthesized.

2 9mar', 31mer s 32m shown above
Er.

30mer and 39mer (2 types) double-stranded DNA is Applied Biosystems 380A-DNA.
Synthesized using a synthesizer.

20 pmol each of 29mer and 31mar, which are complementary to each other, was dissolved in 40d T4 kinase buffer, and T4
Add 6 units of polynucleotide kinase and 6 units at 37°C.
The phosphorylation reaction was performed for 0 minutes. 32ma complementary to each other
Phosphorylation reactions of r, 3Qmer, and 39mer were similarly performed.

Saj! derived from pCSF2 obtained above! I-ApaL
After dissolving 0.1 g of I fragment (approximately 4.0 Kb) in 30 g of T4 DNA ligase buffer, the above three sets of DNA! l
Addition of 2 pmoles of linker was carried out.

More T4DNA! 400 units of J gauze were added and the binding reaction was carried out at 4°C for 18 hours.

The O11111HB101 strain was transformed using the reaction solution to obtain an Ap-resistant strain. Plasmid DNA was isolated from the transformed strain, and structural analysis by restriction enzyme digestion revealed that the target plasmid DNA% pCSF3-3
It was confirmed that

(2) hG-CSF expression plasmid psEIGc3-
Construction of 3: Dissolve 3.3 g of pCSF3 obtained in the previous section in 40 d of Y-0 buffer and add 10 units of restriction enzyme Dra I.
Digestion reaction was carried out at 7°C for 2 hours.

NaCj so that 1g of NaCl becomes 150mM! was added, 10 units of restriction enzyme 5alI was added, and the cleavage reaction was further carried out at 37°C for 2 hours. From this reaction solution, LGT
A DNA fragment of approximately 0.7 Kb (Dral-3a
j! I fragment) about 0.6. I got it.

Apart from this, p A G E 106 obtained in Reference Example 9
．． Dissolve 2gg in 30d Y-0 buffer and add restriction enzyme Sm.
110 units of a were added and the cleavage reaction was carried out at 37°C for 2 hours. After that, N was added so that the NaCl concentration was 150mM.
aCj! was added, 10 units of restriction enzyme was added, and the cleavage reaction was further carried out at 37°C for 2 hours. From this reaction solution, a DNA fragment of approximately 5.0 b (Sm
al-3aj! I fragment) About 1.5 gg was obtained.

Next, Dral-5a derived from pCSF3-3 obtained above
i fragment (approximately 0.7 to b) approximately 0.6■ and SmaI-5alI fragment derived from pAGE106 (approximately 5.0 Kb) approximately 1.0
Dissolve 25g of T4 DNA ligase buffer in 400 g of T4 DNA ligase buffer.
Unit of T4 DNA! J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

E. coli H8101 strain was transformed using the reaction solution, and A
A p-resistant strain was obtained. A plasmid was isolated from the transformed strain, and structural analysis by restriction enzyme digestion confirmed that the plasmid DNA was the desired plasmid DNA% psEIGc3-3.

(3) IIG-CSF expression plasmid pAS
Creation of 3-3: pcfTAL (see Reference Example 15) 5■
-100 buffer solution, 10 units of each of restriction enzymes HindIII and BamHI were added, and a digestion reaction was performed at 37°C for 2 hours. From this reaction solution, approximately 1.6
Nib DNA fragment (HindIII-BamHI fragment)
I got 1■.

This approximately 1.6 Kb DNA fragment lAg was converted into 504 Y-
100 buffer solution, 10 units of restriction enzyme Ddel (manufactured by Toyobo Co., Ltd.) was added, and a digestion reaction was performed at 37°C for 2 hours.

DNA was recovered by phenol-chloroform extraction and ethanol precipitation, dissolved in 304 Klenow buffer, and D
Add 2 units of NA polymerase ■/Klenow fragment to 37
The reaction was carried out at ℃ for 1 hour. DN treated at 68℃ for 10 minutes
After inactivating the A polymerase (■)/Klenow fragment, the DNA was recovered by ethanol precipitation. The DNA recovered was 20
d), 10 units of restriction enzyme AatI (manufactured by Toyobo Co., Ltd.) was added to the mixture dissolved in 50% buffer solution, and a cleavage reaction was carried out at 37°C for 2 hours. From this reaction solution, an approximately 0.2 Kb DNA fragment CDdel (flat end)-AatII fragment was obtained by the LGT method.
Approximately 0.1. I got it.

Separately, 2 g of pSEIGC3-3 obtained in the previous section was dissolved in 204-150 buffer, 10 units of restriction enzyme Aat (manufactured by Toyobo Co., Ltd.) was added, and a digestion reaction was carried out at 37°C for 2 hours. Then, add 10 units of restriction enzyme XhoI and
The digestion reaction was carried out for an additional 2 hours. From this reaction solution, LG
Approximately 0.8 Kb DNA fragment (AatU-) was obtained by the T method.
(hol fragment) approximately 0.1 .mu. was obtained.

On the other hand, psεIP^l5E1dhfrl obtained in Reference Example 9
2 g of -9A was dissolved in 204 Y-0 buffer, 10 units of restriction enzyme Sma I was added, and a digestion reaction was performed at 37°C for 2 hours. Thereafter, NaCl was added so that the NaCl concentration was 100 mM, 10 units of restriction enzyme XhoI was added, and the digestion reaction was further performed at 37° C. for 2 hours. About 8.7 to 7 DNA fragments (Sm
About 1 ug of a I-Xho I fragment) was obtained.

Approximately 0.1 g of Ddel (flat end) and Aatn fragment (approximately 0.2 Kb) derived from pCfTA1 obtained as above,
AatU-XhoI fragment derived from psEIGc3-3 (approximately 0.8 Kb) approximately o, tJJg, pSEIPAISEI
Small-Xhol fragment derived from dhfrl-9A (approximately &
7 Kb) was dissolved in 304 74 DNA IJ gauze buffer, 400 units of T4 DNA IJ gauze was added, and a binding reaction was performed at 4°C for 18 hours. E. coli strain H8101 was transformed using the reaction solution to obtain an Ap-resistant strain.

A plasmid was isolated from the transformed strain, and structural analysis by restriction enzyme digestion confirmed that the plasmid DNA was pAS3-3 having the desired structure.

Reference Example 11 Construction of recombinant plasmid pUKA2: Plasmid pU carrying the pro-UK cDN^ obtained in Reference Example 2
pU was obtained from Escherichia coli C600SF8 strain carrying K1 by a conventional method.
KION^ was prepared. Approximately 2 blocks of the obtained pUK1ON^ were dissolved in 30 ρ of Y-100 buffer, 8 units of restriction enzyme Nco I and 8 units of Stu I were added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, A
The DNA fragment of approximately 1.2 b was purified using the FT method.

On the other hand, pTrS33 plasmid DNA obtained in Reference Example 5
About 2 ropes of A were mixed with 10mM Tris-HCI (pH 7,5
), 25mM KCI, 7mM MgC1a, 6m
M A solution containing 2-mercaptoethanol (hereinafter referred to as “K
-25 buffer”) Dissolve in 30 ul, 16
One unit of restriction enzyme Sna I was added, and the digestion reaction was carried out at 30°C for 2 hours.

followed by 1.5 d of I M NaCl and 10 units of Nc
oI was added, and the digestion reaction was further carried out at 37°C for 2 hours. After heat treatment at 65℃ for 10 minutes, approximately 2
．． An 85 Kb DNA fragment was purified.

The thus obtained approximately 1.2-b DNA fragment derived from pUK1 (approximately 0.05 ug) and the approximately 2.85-b DNA fragment derived from pTrS33 (approximately 0.1 gg) were combined in a total amount of 2.
It was dissolved in 0 d of T4 ligase buffer, 100 units of T4DN/MJ gauze was added, and the binding reaction was performed at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA, pUKA2, was isolated from this transformed strain and structurally analyzed by restriction enzyme digestion, and it was confirmed that it had the desired structure (see Figure 32).

Reference Example 12 Construction of recombinant plasmid pUKB101: Approximately 2 cm of pUKA2 plasmid DNA obtained above was added to Y-0 buffer 3
0, add 12 units of restriction enzyme Kpn I,
Digestion reaction was carried out at 37°C for 2 hours.

followed by 1.54 of 2M NaCl and 10 units of Nco I
was added, and the digestion reaction was further carried out at 37°C for 2 hours. 65
After heat treatment at ℃ for 10 minutes, approximately 1.2
The Kb DNA fragment was purified. On the other hand, approximately 2 μm of pTrS33 plasmid DNA obtained in Reference Example 5 was dissolved in 304-25 buffer solution, 16 units of Sma I was added, and 3.
Digestion reaction was carried out at 0°C for 2 hours. followed by 2M of 1.54
Add 1 NaCl and 10 units of Pst I and heat to 37°C.
Digestion reaction was carried out for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 1.15 Kb was purified using the AFT method.

In addition, pTerm2 plasmid ON obtained in Reference Example 6
Approximately 2 ml of the solution was dissolved in 304 Y-O buffer, 12 units of pnl was added, and the digestion reaction was carried out at 37 for 2 hours.

Next is 1. ! In+ 2M NaCl and 10 units Ps
tI was added, and the digestion reaction was further carried out at 37°C for 2 hours. After heat treatment at 65℃ for 10 minutes, approximately 1
．． In step 7, the DNA fragment b was purified. In addition, the following two types of synthetic NA (41mer and 45mar) are applied and
/Synthesized using a Tsuio Systems 380A-DNA synthesizer.

5' -GGG^^TGGTCACTTTACCGA
GG^^^GGCCAGCACTGACAC-3' (
41mer)-CCCTTAC[:AGTG^^AAT
GGCTCCTTTCCGGTCGTGACTGTGG
TAC-5' (45mer) These synthetic NAs were
0 pmoles (pmoles) of 20d T4 separately
By adding 5 units of T4 polynucleotide kinase in kinase buffer and reacting for 30 minutes at 37°C.
The 5' end of the synthetic NA was phosphorylated.

Approximately 1,2 K derived from pUKA2 thus obtained
b DNA fragment (approximately 0.054), approximately L 15 Kb DNA fragment derived from pTr333 (approximately 0.05 g),
Approximately 1.7 b DNA fragment derived from p7erm2 (approximately 0.
05■), and two 5′-phosphorylated synthetic ON^
(1 pmol each) was dissolved in a total amount of 20 g of T4 ligase buffer, and 300 units of T4 DNA ligase was added.
The binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a ^p-resistant strain.

Plasmid DNA from this transformed strain, I) UKBlo
M13 was isolated, and structural analysis by restriction enzyme digestion and M13
When the base sequence was determined by the deideoxy-Siefens method, it was confirmed that pU 8101 had the desired structure (see Figure 33).

Reference Example 13゜Human pro-11 expression plasmid psεIUKpro
Construction of l-IA: (1) Construction of recombinant plasmid pUKF2: pUKII plasmid DNA obtained in Reference Example 3
Dissolve about 3 μm in 30 d of Y-100 buffer, add 12 units of Ncol and 12 units of HindI, and add 37
Digestion reaction was carried out at ℃ for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 0.45 Kb was purified using the AFT method. On the other hand, pUK obtained in Example 11 (1)
Approximately 2cm of A2 plasmid DNA was transferred to 30u1 of Y-0! The mixture was dissolved in a buffer solution, 10 units of KpnI was added, and a digestion reaction was performed at 37°C for 2 hours. Next, 1.5 rhino 2M NaC1
and 10 units of Ndol were added, and the digestion reaction was further carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, AFT
A DNA fragment of approximately 1.2 b was purified using the method. In addition, approximately 2.0% of the pTerm2 plasmid DNA obtained in Reference Example 6 was used. was dissolved in 30 d of Y-011 buffer solution, 10 units of pnl was added, and the digestion reaction was carried out at 37°C for 2 hours. followed by 1.5 d of 2M NaCl and 8 units of HindI
[[] was added, and the digestion reaction was further carried out at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, about 2.
85, the DNA fragment of b was purified.

Approximately 0.45K derived from pUK11 thus obtained
b DNA fragment (approximately 0.02■), approximately 1.2b DNA fragment derived from pLJKA2 (approximately 0.05■), and pLJKA2-derived DNA fragment (approximately 0.05■).
A 2.85-b DNA fragment derived from Term2 (approx.
05■) was dissolved in a total volume of 20 μl of T4 ligase buffer, 50 units of T4 DNA ligase was added, and a binding reaction was performed at 4° C. for 18 hours.

Using the obtained mixture of recombinant plasmids, large intestine 1
The 1M11294 strain was transformed to obtain an Ap-resistant strain.

Plasmid DNA, pUKF2, was isolated from this transformed strain, and structural analysis by restriction enzyme digestion revealed that p
It was confirmed that UKF2 has the desired structure (34th
(see figure).

(2) Construction of recombinant plasmid pUKFpro: Approximately 2 μl of the pUKF2 plasmid DNA obtained above was added to 30 μl.
1 in yo buffer containing 25mM NaC1,
(manufactured by Ny England Biolabs) was added to 0 units of Bs5HII, and a digestion reaction was performed at 50°C for 2 hours.

followed by t, oJIi 2M NaCl and 10 units Hi
nd[[I was added, and the digestion reaction was further carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, a DNA fragment of approximately 4.3 Kb was purified using the AFT method. On the other hand, the following 6
Species synthesis NA (39mer, 41mer, 41
mer.

39mer, 17mer, 17mer) were synthesized and 5'-terminally phosphorylated according to the method described above.

5'-^GCTTGTCCCCGCAGCGCCGTC
GCGCCCTCCTGCCGCAG-3' (39ma
r) 3'-TCT CGG GACGACCGCGC-
5' (17+net) pU thus obtained
A DNA fragment of approximately 4.3 Kb derived from KF2 (approximately 0.1
) and 6 types of 5'-phosphorylated synthetic NA (1 pmol each) were dissolved in total 1204 T4 ligase buffer, 300 units of 74 DNA IJ gauze was added, and the solution was incubated at 4°C for 1 pmol each.
The binding reaction was carried out for 8 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a ^p-resistant strain.

Plasmid DNA from this transformed strain, I) UKFpr
M13 was isolated and structurally analyzed by restriction enzyme digestion and M13
When the base sequence was determined by the Deideoxy Seefens method, it was confirmed that Fpro had the desired structure at ρU (see Figure 35).

(3) Prol-1^ to the recombinant plasmid ρ5EIU
Construction: Approximately 2 g of pslEIPAl-9^ plasmid DNA obtained in Reference Example 9 was dissolved in 304 Y-0 buffer, 10 units of Kpn I was added, and a digestion reaction was performed at 37°C for 2 hours. followed by 1.5-2M NaCJ and 10
) lindIn was added, and the digestion reaction was further carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, AFT
A DNA fragment of approximately 6.3 Kb was purified using the method. On the other hand, about aug of the pUKFpro plasmid DNA obtained above was dissolved in 30 d of Y-0 buffer, and 15 units of K
pn I was added and the digestion reaction was carried out at 37°C for 2 hours.

followed by 1.5 m of 2M NaCl and 10 units of Hin
dII[ was added, and the digestion reaction was further carried out at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 1.
55, the DNA fragment b was purified.

The approximately 6.3-b DNA fragment (approximately 0.1.) derived from psBIPAl-9A thus obtained and pUKFpr
1.55 Kb DNA fragment (approximately 0.05 g) derived from
Dissolve the total amount in 20 Makoto's T4+J gauze buffer and add 100
One unit of T4DN ligase was added and the ligation reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain a ^p-resistant strain.

From this transformed strain, plasmid DNAPSεIUKpr
.

When 1-IA was isolated and subjected to structural analysis by restriction enzyme digestion, it was confirmed that prol-IA had the desired structure in psEIU (see Figure 36).

Reference Example 14゜l) Isolation of plasmid pLT1 carrying human LT cDNA: (1) Preparation of poly(A) and RNA from Luk II cells: From human lymphoblastoid cell line Luk II, guanidine thiocyanate-lithium chloride method [ Cathala
) et al: DeNA (DNA) 2゜329 (19
[83)], RNA having poly(A) was prepared as follows.

h) IJ lymphoblastoid cell line LuklIC Bellissini.
Berish Y. Rubin et al.: Proceedings on the National Academy
On Science (Proc, Natl, Acad
.

Sci,) USA82.6637 (1985))
was mixed with 5% calf fat serum and 1mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (H
The cells were inoculated into 11 RPM11640 medium (manufactured by Hinaga Pharmaceutical Co., Ltd.) containing EPES) at a concentration of 10' cells/ml and allowed to proliferate. A spinner culture bottle was used for culture. After culturing at 37°C for 48 hours, cells were collected by centrifugation and treated with long/ml 7olbol myristate acetate (PMA; Ph
transferred to fresh RPM 11640 medium containing 5% calf fat serum and 1 mM HEPES and further incubated at 37°C.
The cells were cultured for 48 hours. Subsequently, a portion of this cell suspension (
Cells were collected from 25 (lnl) by centrifugation at 1100X for 10 minutes at 4°C, washed with 80 ml of phosphate buffer, and then washed with 5 M guanidine thiocyanate, 1
0mM EOTA.

Solubilization was carried out using a portex mixer in 10 ml of a solution consisting of 50 mM Tri 5-HCl (pH 7) and 8% (V/V) 2-mercaptoethanol. Transfer this lysate to a centrifuge tube and add 4M LiCj
! After adding 80 ml of the solution and stirring, the mixture was allowed to stand at 4°C for 20 hours. Hitachi RP R10 rotor 9
After centrifugation at ,000 rpm for 90 minutes, RNA was collected as a precipitate. The RNA precipitate was suspended in 50 ml of a solution consisting of 4 M urea and 2 M lithium chloride, and
9.00 Orpm with RP R10 rotor, 6
After centrifugation for 0 minutes, RNA was again collected as a precipitate. R.N.
Add the precipitate of A to 0.1% sodium lauryl sulfate, 1 ml.
lEDTA.

It was dissolved in 10 ml of a solution consisting of 10 mM Tri 5-HCl (pH 7.5), extracted with phenol-chloroform, and then recovered by ethanol precipitation.

Approximately 2.5 mg of the obtained RNA was added to 10mM Tris.
-HCR (pH 8.0> and 1mM EDTA) was inkopated for 5 minutes at 65°C, and 0.1ml of 5M NaCj! was added. The mixture was coated on an oligo(dT) cellulose column [P.L. P-LB iochem ica 1
) Ri07 Tographie (column volume 0.5m1)
I put it on. Adsorbed Po! mRNA with J (A)
10mM Tri 5-HCj! (pH 7.5) and 1mM EDTA.
) was obtained.

(2) cDNA synthesis and insertion of the DNA into a vector: Okayama-Berg method [Molecular and Cellular Biol.
o1. Ce11. Rial, ), 2.161 (1
982)], cDNA was synthesized and a recombinant plasmid incorporating it was constructed. An outline of the process is shown in FIG.

Approximately 2 ag of poly(A) RNA prepared above.

Approximately 1.4 μ of Vector Brimer was added to 50 mMT'ri.
5-HCj! (pH 8,3), 8mM MgCj
! 2゜30mM KCl, 0.3mM DTT, 2
Dissolved in 22.3 d of a solution consisting of mM dNTPs (dATP, dTTP, dGTP and dcTP) and 10 units of bonuclease inhibitor (manufactured by P-L Biochen+1cals), and added 10 units of reverse transcriptase (manufactured by Seikagaku Corporation). In addition, the mixture was incubated at 41°C for 90 minutes to synthesize NA complementary to the mRNA. The reaction product was subjected to phenol-chloroform extraction and ethanol precipitation, and vector primer DNA added with the RNA-DNA double layer was recovered. The DNA was added to 66 μM dC
TdT buffer containing TP and 0.2 female poly(A) 20
- dissolved in 14 units of TdT (P-LBiochem
icals) and incubate at 37°C for 2 minutes to add 20 (dC) chains to the 3' end of the cDNA. The reaction product was extracted with phenol-chloroform, and the cDNA-vector primer DNA with the (dC) strand added was recovered by ethanol precipitation. 10mMT of the DNA
r i 5-HCj! (pH 7,5), 6mM Mg
Cβ2 and 60mM NaCj! Dissolved in 400d of a solution consisting of
Incubate for an hour and cut at the Hind[[ site.

The reaction product was extracted with phenol-chloroform and precipitated with ethanol to obtain 0.5 pmol of (dC)-adducted cDNA-vector primer DNA. 0.2 pmol of the DNA and 14 pmol of the linker DNAO were added in 10 m
MTr i 5-HCI! (pH 7.5), 0.1M
Solution 100 consisting of NaCl1 and 1mM EDTA
μe and incubated at 65°C, 42°C, and 0°C for 10 minutes, 25 minutes, and 30 minutes, respectively. 20mM T
r i 5-HCj! (p)17.5), 4mMMg
C11,10mM (NHl)2sO,,0,IM
KCj! and with a composition of 0.1 mM β-NAD,
The reaction solution was prepared so that the total amount was too utt. 25 units of Escherichia coli DNA'J gauze (manufactured by New England Biolabs) was added to the reaction solution and incubated at 11°C for 18 hours. The reaction solution was treated with 40 μM each of dNTP,
Additional ingredients were prepared to give 0.15mM β-NAD, and 10 units of E. coli DNA IJ gauze and 20 units of E. coli DNA polymerase I (P-L Bioche
micals) and 10 units of E. coli ribonuclease H (P-L Biochemicals).
was added and incubated at 12°C and 25°C for 1 hour each. In the above reaction, the recombinant DNA containing cDNA was circularized and the RNA portion of the RNA-DNA double strand was replaced with DNA, producing a complete double-stranded DNA recombinant plasmid.

(3) Selection of recombinant DNA containing human LT cDNA: Using the recombinant plasmid obtained in (2), E. coli C60
0SF8 strain [CamBron: Proceedings on the National Academy 4' of
Science (Proc, Natl, AcadSci
, ) USA 72.3416 (1975) ] 5
Cott et al.'s method [Katsuya Shigesada: Cell Engineering 2.616 (
1983)]. About 30,0 obtained
00 colonies were fixed on nitrocellulose filters. Human LT cDNA isolated by Genentech
Patrick Il, Gray + et al.: Nature 312.721 (198
4) 1? which matches the base sequence of part of the 5' untranslated region of )? Synthesis of marNA5'-GATCCCCGGCC
TGCCTG-3' to the 32p-labeled probe with 52
One strain that strongly associated at ℃ was selected [Grunstein-Hogness method, Proceedings of the National Academy of Sciences (Proc. Natl., A.
cad, Sci, )11sA 72.396H1
975)). Plasmid pLT1 carried by Ko (7) strain
The entire base sequence of the cDNA was determined by the deideoxy-Siefens method using M13 phage. As a result, it was revealed that the pLTl cDNA encodes human LT.

2) Construction of recombinant plasmid pLA1 (see Figure 37): Dissolve 5 µl of pLTl (4.7 Kb) obtained by the method in the previous section in a total volume of 50 d of Y-0 buffer, and add restriction enzyme XhoT.
10 units of I (manufactured by Boehringer Mannheim) were added, and the cleavage reaction was carried out at 37°C for 2 hours. Then, NaCl
was added to a final concentration of 150mM, and restriction enzyme N5i
10 units of 2x-England Biolabs M) were added and the cleavage reaction was further carried out at 37°C for 3 hours.

A DNA fragment of approximately 750 bp (Xh.

Approximately 0.3 μm of the U-Nsil fragment was obtained.

Separately, pLTl 20Jtg was added to 200u1 of Y-50
It was dissolved in a buffer solution, 40 units of restriction enzyme HaeI was added, and a cleavage reaction was performed at 37°C for 2 hours.

Next, NaCl was added to a final concentration of 150 mM, 40 units of N5iI was added, and the cleavage reaction was further carried out at 37°C for 3 hours. By polyacrylamide gel electrophoresis from the reaction solution, approximately 5 obp containing the N-terminal portion of LT was detected.
DNA fragment (Ha<em>Ns i I fragment) of approximately 40
ng was obtained.

On the other hand, the total amount of pGELl (3,4Kb) 3 ropes was 30d.
Y-100 buffer, 6 units each of restriction enzyme 5tur and restriction enzyme BglU were added, and a cleavage reaction was carried out at 37°C for 3 hours.

From this reaction solution, an approximately 2.3 Kb DNA fragment containing the Apr gene (S tu IBgI
m fragment) approximately 1.0 μm was obtained.

Next, 0.2 ug of the pLT1-derived XhoII-Nsil fragment (approximately 750 bp) obtained above and HaeI[l-N
20 ng of a i I fragment (approximately 50 bp) and Stul-Bgj from pGEL1! :T fragment (approximately 2.3 Kb) 0.
A total of 6 gg was dissolved in 20 volumes of T4 ligase buffer, and 2 units of T 4 DNA'J gauze (manufactured by Takara Shuzo Co., Ltd.) were further added to this mixed solution, and the reaction was carried out at 4° C. for 18 hours.

Using the recombinant plasmid DNA thus obtained,
Bscherichia coli KM 430 strain was transformed by the method of Cohen et al. to obtain Ap' colonies. Plasmid DNA was isolated and purified from this transformed strain according to a known method, and the plasmid DNA was transformed into 5tu
The structure of the plasmid was analyzed by cutting it with a restriction enzyme such as I. As a result, it was confirmed that the desired plasmid was obtained. This recombinant plasmid is called pLA.

3) Construction of LT expression plasmid pLsA1 (see Figure 38): Escherichia coli KM430 strain carrying pLAI (3, IKb) obtained in the previous section was cultured, and pLAI DNA was prepared from the cultured cells by a conventional method. Obtained pLAI DNA
Dissolve 3ug in 30d of Y-100 buffer and add 5tu
1 and BgII [3 units each were added and the cleavage reaction was carried out at 37°C for 3 hours. From this reaction solution, a DNA fragment of about 790 bp (StuI-Bg1m fragment) containing about 0.5 μm containing most of the human LT gene was obtained by the LGT method.

Separately, 1 g of pKYPlo 3J prepared by the method described in JP-A-58-110600 was added to 3 ml of Y-100 buffer.
Dissolve the restriction enzyme BanI [[ and the restriction enzyme Pst
6 units of each were added and the cleavage reaction was carried out at 37°C for 3 hours. From this reaction solution, approximately 1.0% of the tryptophan promoter (Ptrp) was extracted using the LGT method. I Kb
DNA fragment (Banm-Ps t I fragment) of approximately 0.6
．． I got it.

In addition, pGELl (3,4Kb)2Jtg was added to Y-1
Dissolve the restriction enzyme HindI in 20% of 00 buffer.

Add 4 units each of BamHI and PstI to 3
The cleavage reaction was carried out at 7°C for 3 hours. From this reaction solution, LGT
Approximately 1 containing a lipoprotein-derived terminator by the method
．． 7 Kb DNA fragment (Pstl-BamHI fragment) approximately 0.7. I got it.

On the other hand, Leu, which is the N-terminus of the mature human) LT polypeptide,
(CTA), the fifth amino acid Gly (
GGC) up to the second base (GO) and the start codon (ATG) necessary for expression must be added, and the distance between the SD sequence downstream of Ptrp and ATG is 6 to x
Due to the need to have an appropriate length between sbp and other reasons, the following DNA Unker was synthesized.

First, -wood-like DNA, 27-mar and 25-mar, were synthesized by the usual triester method. 20 pmol each of 27-mar and 25-mar in a total amount of 40 d T
4 kinase buffer, 6 units of T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.) was added, and a phosphorylation reaction was performed at 37°C for 60 minutes.

Next, Stul-Bgj derived from pLA1 obtained above! n fragment (approximately 790 bp) fl, 3g and expression vector pKYP
1 (18) Banm-Pstl fragment (approximately 1.IKb)
0.4 g and Pst[-BamHI from pGEL1
Dissolve 0.6 μl of the fragment (approximately 1.7 Kb) in 25 μl of 741J gauze buffer, and add the above DNA! to this mixture. Approximately 1 pmol of Inker was added. Add T4 to this mixed solution.
DNA! Six units of J gauze were added and the binding reaction was carried out at 4°C for 18 hours.

E. coli K using a reaction mixture containing the recombinant plasmid.
M430 strain was transformed and Ap' colonies were obtained. Plasmid DNA was recovered from the cultured cells of this colony. The structure of the obtained plasmid is based on restriction enzymes EcoR1 and B.
anIII.

After cleavage with Pstl, HindlI[, and EglK, it was confirmed by agarose gel electrophoresis. This plasmid is p
It is called LSAl. Bann[, HindI of pLsAl
The nucleotide sequence near n is as follows using the Maxam-Gilver F method [A.M. Maxam (^0M0
Maxam) et al.: Proceedings on the National Academy of Sciences (Proc, Na
tl.

^cad, Sci,), IIs^ 74.560 (1
977)].

Reference Example 15 Construction of hG-C5F expression plasmid pcfTA1 (3rd
(See Figure 9): Dissolve the pcsFl-2 DNA 2■ obtained in Reference Example 4 in a total volume of 20-y-too buffer, and add the restriction enzyme Apa
I [Boehringer Mannheim
Mannheim) and BamHI respectively.
Units were added and the reaction was carried out at 37°C for 4 hours.

From this reaction solution, 1.5 Kb DNA was extracted by the LGT method.
0.4 ug of fragment was purified and collected.

Plasmid pLSA1 separately prepared by the method of Reference Example 14
Dissolve 2ug in 20ml of Y-100 buffer, add restriction enzyme B
anI[[(manufactured by Toyobo Co., Ltd.) and BamHI 10 each
Units were added and the reaction was carried out at 37°C for 4 hours. From this reaction solution, 2.8 Kb DNA fragments o and a were obtained by the LGT method.
g was purified and collected.

On the other hand, the amino acids from the 1st to the 5th N-terminus of the mature hG-CSF polypeptide [threonine 1 (ACA or ACT), proline 1CCA or CCT), leucine' (CTA), glycine 4 (GGC), proline' ( It is necessary to provide the codon encoding CCC)) and the start codon (ATG> necessary for expression), and the SD-
Due to the need to keep the distance between the sequence and ATG to an appropriate length between 6 and 18 bp, the following DNA
A linker was synthesized.

First - book am DNA, 26mar and 20ma
r by the usual triester method [R Flare (R, Cr
ea) et al.: Proceedings on the National
Academy on Science (Proc, Natl.
Acad, Sci,), USA75.5765 (
1978)]. 261 Tler.

1 g of 2J of each 20mar was dissolved in T4 kinase buffer, 30 units of T4 polynucleotide kinase was added, and a phosphorylation reaction was performed at 37° C. for 60 minutes.

Apal-BamHI derived from pcsFl-2 obtained above
Fragment (1,5Kb) 0.4. and Ba derived from pLsA1
nnl-BamHI fragment (2,8 b) 0.2■ and 2
54 in 741J gauze buffer, and add the above DNA to this mixture! J car 0.1. added.

Further, 6 units of T4DNAIJ gauze were added to this mixed solution, and a binding reaction was performed at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli H.
BIOI strain [Bolivar et al.: Gene (
Gene) 2.75 (1977)] using the method of Cocone et al.
) et al: Proceedings on the National Academy of Sciences (Proc, Natl, A
cad.

Sci, ) USA, , 69.2110 (197
2) Transformation was performed according to ) to obtain AI)' colonies. Plasmid DNA was recovered from the cultured cells of this colony. The structure of the obtained plasmid is BanlllI,
Rs a I 5Pstl, HindII [, Bgll
After cutting with I, it was confirmed by agarose gel electrophoresis.

This plasmid is called pCfTA1. It was confirmed by the Deideoxy Siefens method using M13 phage that the nucleotide sequence near BanII[, HindI[I of pcfTAL is as follows.

Reference Example 16 Construction of pCfBD28: (1) Construction of plasmid pcfTB2 (18) in which part of the 3'-untranslated region of hG-CSF cDNA was deleted (
(See Figure 40): hG-C5F expression plasmid p obtained in Reference Example 15
2 ug of cfTA1 (4.3 Kb) was dissolved in 20 JL1 of Y-100 buffer, 4 units of restriction enzyme BamHI was added, and a digestion reaction was performed at 37° C. for 4 hours. Phenol-
After chloroform extraction, DNA was extracted by ethanol precipitation.
1.8 µ of fragments were recovered. Dissolve this DNA fragment in 20 volumes of Klenow buffer and add dATP, dTTP, dCTP%.
Add dGTP to 1mM each, and add 4
Add 1 unit of DNA polymerase I Klenow fragment,
The protruding ends were converted to flat ends by reacting at room temperature for 1 hour.

After phenol-chloroform extraction, 1.6 μl of DNA fragments were recovered by ethanol precipitation. The DNA fragment is
-10 units of EcoR dissolved in 20 u1 of 100 buffer
i was added, and the cleavage reaction was carried out at 37°C for 4 hours. From this reaction solution, a 2.5 Kb DNA fragment CBam was obtained using the LGT method.
HI (flat end)-EcoR■ fragment] lug was obtained.

Separately, pcfTA12■ was dissolved in 20% Y-100 buffer, 10 units of EcoRI was added, and the cleavage reaction was carried out at 37°C for 4 hours. Then, NaCl was added so that the NaCl concentration was 150 mM, and 10 units of EcoRI was added. Add praI, 3
The cleavage reaction was carried out at 7°C for 4 hours. After confirming complete degradation by agarose gel electrophoresis, 1. 0.2 inch of OKb DNA fragment (EcoRI-Dral fragment) was purified and recovered by the LGT method.

BamHI (flat end)-EcoRI fragment obtained above (
b) 0.2 g and EcoRI-Dral fragment (1
, 0 Kb) was dissolved in 25% of T4 ligase buffer solution, 6 units of 74 DNA ligase was added to this mixture, and 0.2 g of T4 ligase buffer was added.
The binding reaction was carried out for 18 hours at °C.

Using the mixture of recombinant plasmids obtained, E. coli 8
The 8101 strain was transformed to obtain A pr colonies. Plasmid DNA was recovered from the cultured cells of this colony. The structure of the obtained plasmid is 1(indII[
, and confirmed by agarose gel electrophoresis after cleavage with Pstl. This plasmid is called pcfTB2G.

(2) Construction of plasmid pCfTL38 encoding a polypeptide with N-terminal amino acid substitution of hG-CSF (see Figure 41): pC5F 1-2 (4,5
Dissolve 3 g of Kb) in 60 g of #Y-100 buffer, add restriction enzyme ApaI (manufactured by Boehringer Mannheim) and fI.
Add 8 units each of J-limiting enzyme BamHI and 37°C.
The cleavage reaction was carried out for 3 hours.

From this reaction solution, an approximately L 5 Kb DNA fragment (Apal-B
amHI fragment) was obtained.

On the other hand, pGELI C Sekine et al.: Proceedings of the National Academy of Sciences (P
roc, Natl, Acacl, Sci, > US8
82.4306 (1985) ) (B, coli I
GELI FERM BP-629 culture (3,4Kb) 2■ was dissolved in 40ml of Y-100 buffer, and restriction enzymes BindI[I, BamH
Add 4 units each of I and pstI and incubate at 37°C.
A time-cut reaction was performed. From this reaction solution, about 1.7 g
About 0.5 pieces of Kb DNA fragment (Pstl-Ban II fragment) were obtained.

Separately, 3μ of pKY'P10 prepared by the method described in JP-A-58-110600 was added to 60J of Y-100 buffer.
Add 6 units each of the restriction enzyme BanI [[(Toyobo Co., Ltd. 1K)] and the restriction enzyme Pstl.
The cleavage reaction was carried out at 7°C for 3 hours. From this reaction solution, LGT
About 1. I K b DNA fragment (Banl[[-P
s t E fragment) about Q, 5. I got it.

On the other hand, Th, which is the N-terminal amino acid of mature hG-CSF,
It is necessary to replace r with Ser, Cys, Arg, or Gly to provide the start codon (ATG) necessary for expression, and the distance between the SD sequence downstream of Ptrp and ATG is 6 The following DNA linker was synthesized because it needed to have an appropriate length of ~18 bp.

Ser (N is any base of G, A, T or C) First, -terminal strand DNA, 26-mar and 20-mar
was synthesized by the conventional triester method.26-me
20 pmol each of r and 20-mar to 404 T
4 kinase buffer, 6 units of T4 polynucleotide kinase was added, and a phosphorylation reaction was performed at 37°C for 60 minutes.

Next, Apa 1-Ba derived from pcsFl-2 obtained above
mHI fragment (approximately 1.5 Kb) 0.3. and pGEL1
Ps t I-BamHI fragment (approximately 1.7 K
b) 0.2g and expression vector pKYP1 (18)
Ban1 [[-Pstl fragment (approximately 1.1 Kb) 0.2
The total amount of the DNA linker was dissolved in 30% T4 ligase buffer, and about 1 picomole of the above DNA linker was added to this mixture.

Add 6 more units of T 4 DNA to this mixture! J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using a reaction mixture containing the recombinant plasmid,
1c600sF8 strain (FERM BP-1070) [
Cameron et al.: Proceedings of the National Academy on Science (
Proc, Natl, ^cad, Sci,), USA
72.3416 (1975)] and transformed A
Colonies of pl were obtained. Plasmid DNA was isolated and purified from this transformed strain according to a known method. The structure of the plasmid DNA is Pstl, EcoRl, BanI [
After cutting with I, it was confirmed by polyacrylamide gel electrophoresis. This plasmid was converted into pC as shown in Figure 41.
It is called fTL38. The sequence near the N-terminus of the hG-CSF derivative gene in the above plasmid was confirmed by the Deideoxy Seefence method using M13 phage.

(3) Construction of recombinant plasmid pcfWD1 (see Figure 42): 50d of pcfTAL 5M obtained by the method of Reference Example 15
Dissolve restriction enzyme Stu 110 in Y-100 buffer.
Unit and 10 units of restriction enzyme BanII [(manufactured by Toyobo Co., Ltd.) were added, and a digestion reaction was performed at 37°C for 1 hour. Approximately 1.0% of hG-CSF cDNA is extracted from the reaction solution by the LGT method.
3 b17) DNA fragment (B an lll-
Approximately 0.5 g of 5tuI fragment) was obtained. Separately, pKYP26 3■ produced by the method of Reference Example 2 was added to 504 y-too.
It was dissolved in a buffer solution, 16 units of BamH was added, and a digestion reaction was performed at 30°C for 1 hour.

This was added with lQmM Tris-HC1 (pH 7,
5).

After adding an equal amount of phenol saturated with 1mM EDTA and stirring vigorously, low-speed centrifugation (3,30Orpm, 1
The aqueous layer was collected under the same conditions (hereinafter the same conditions). After adding an equal amount of chloroform and stirring vigorously, the aqueous layer was collected by low-speed centrifugation. 1/10 volume of 3M sodium acetate was added, 2.5 volumes of ethanol was added, and the mixture was left standing at -20°C for 1 hour. Refrigerated centrifugation method (4℃, 11,000r
The precipitate was collected at 1 min). This precipitate was dissolved in 30 d of Klenow buffer, dATP, dTTP.

dcTP and dGTP were added at 100 μM each, 2 units of DNA polymerase I/Klenow fragment were added, and the reaction was carried out at 17° C. for 15 minutes. After treating at 68°C for 10 minutes to inactivate the DNA polymerase ①/Klenow fragment, NaCl was added to 100mM, 5 units of restriction enzyme PstI were added, and a digestion reaction was carried out at 37°C for 1 hour.

From the reaction solution, a DNA fragment of approximately 1.8 Kb [BamHI (flat end)-Pst [fragment] approximately 0.6 μm containing an lpp terminator was obtained by the LGT method.

Separately, add 4■ of pGEL 1 to 40〃 of Y-10.
0 buffer, add 10 units of restriction enzymes Bann1 (manufactured by Toyobo Co., Ltd.) and 10 units of Pstl, perform a digestion reaction at 37°C for 1 hour, and extract a DNA fragment of about 1Kb containing a tryptophan promoter from the reaction solution using the LGT method. (Ba
0.4 μ of nl [I-Pstl fragment] was obtained.

BanI[[-3tul] derived from pCfTA1 obtained above
Fragment (about 1.3 to b) about 0.2 gg, pKYP26
BamHI (flat end)-PstI fragment (approximately 1.8 Kb) approximately 0.1 ■ from pGELI, BamHI (flat end) from pGELI
1 [I-Ps t I fragment (approximately IKb) approximately 0.1■
0d's T4DNA! Dissolve in I gauze buffer, add 4 units of T4 DNA ligase, and incubate at 4°C.

The binding reaction was carried out for 18 hours.

E. coli H8101 strain was transformed using the reaction solution, and A
A colony of p' was obtained, and plasmid DNA was recovered from this colony by the method of Koki Birnboim et al. to obtain pcfWDl shown in FIG. 42.

(4) Creation of 19 in pcfT95 (see Figure 43)p
5 ml of CfTL3B was dissolved in 50 Makoto's Y-100 buffer, 1 θ units of restriction enzymes HindI[I and BgIl] were added, and a digestion reaction was carried out at 37° C. for 1 hour. A DNA fragment of approximately 2.6 Kb (HindIII-Bg1) containing a tryptophan promoter was obtained from the reaction mixture by the LGT method.
m fragment) approximately 0.7° was obtained. Separately pCf TL38.
100. Dissolve g in 1.5 ml of Y-IQO buffer,
Restriction enzymes BamH1 and )lindI[[ were added in 80 units each, and a digestion reaction was carried out at 37°C for 6 hours. D containing hG-CS F c DNA was extracted from the reaction solution by the LGT method.
Collect the NA fragments and ELUTIP''-d
(manufactured by Schleicher & 5chue 11). This DNA fragment was dissolved in 90d Y-150 buffer, and restriction enzyme Dpn I (Boehring
er Mannheim) was added thereto, and a digestion reaction was carried out at 37°C for 15 minutes. About 300 bp DNA fragment (Hindl [[-Dpnl
Fragment) Approximately 1. I got it.

Separately, add 10g of pcfT82 (18) to 100Jdl of Y-
100 buffer, added 10 units of restriction enzyme Ava I, and performed a digestion reaction at 37°C for 1 hour.

DNA was recovered by phenol-chloroform extraction and ethanol precipitation, dissolved in 30 d of Klenow buffer, and
Add 2 units of NA polymerase ■/Klenow fragment, 17
The reaction was carried out at ℃ for 30 minutes. Treated at 68℃ for 10 minutes
NA polymerase!・Deactivate the Klenow fragment and add NaC
Add restriction enzyme BglU10 to 100mM.
Units were added and the digestion reaction was carried out at 37°C for 1 hour.

From the reaction solution, a DNA fragment of approximately 4 aobp containing a portion of the terminator [Aval (flat end)] was obtained using the LGT method.
-Bgj! I[]about 0.3■ was obtained.

HindIII-B derived from pCfTL38 obtained above
gjII fragment (approximately 2.6 Kb) approximately 0.1. .

Hind[[[-Dpnl fragment (
approx. aoobp) approx. 0.2■, Av derived from pcfTB20
al (flat end)-Bgl■ fragment (about 480 bp) about 0
．． ．． Dissolve 15 ug in 30 d of T4 DNA ligase buffer, add 4 units of T4 DNA ligase, and incubate at 4°C for 18 µg.
A time binding reaction was performed. Using the reaction solution, E. coli 881
01 strain was transformed to obtain a colony of Apr, and from this colony, plasmid D was obtained by the method of Birnboim et al.
NA was collected and 19 was obtained in pCfT95 shown in FIG.

(5) Creation of pCf A A 1 (see Figure 43)
: Add 195■ to pcfT95 obtained in the previous section and add 50〃Y
-100 buffer, 7 units of restriction enzyme BanI [I (manufactured by Toyobo Co., Ltd.) and BgJ! Two units of I (manufactured by Nippon Gene Co., Ltd.) were added, and the digestion reaction was carried out at 37°C for 1 hour. From the reaction solution, an approximately 0.6-inch DNA fragment of approximately IKb (Bannl-Bgj!I fragment) containing a portion of a tryptophan promoter and a DNA fragment of approximately 1.8 Kb (BglE-Bgl 1 fragment) containing a portion of a 1pp terminator were obtained using the LGT method. )
Approximately Ig was obtained.

Separately, dissolve 15μ of pcf795 and 19 in 150d of Y-100 buffer and add the restriction enzyme Bgj! Add 6 units of I (manufactured by Nippon Gene Co., Ltd.) and 110 units of 5au3A to make 37
Digestion reaction was carried out at ℃ for 1 hour. A DNA fragment of approximately 350 bp containing hG-CSF cDNA portion (Bgll-3au
3AI fragment) about 0.3. I got it.

Separately, the following clinker was synthesized.

First, -wooden strip DNA, 39-mar and 41-mar, were synthesized by the usual triester method. 20 picomole each of 39-mar and 41-mar in a total amount of 40 d T
4 kinase buffer, 6 units of T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.) were added, and a phosphorylation reaction was performed at 37°C for 60 minutes.

Next, Ban1[I derived from pcf795K19 obtained above
-Bgl l fragment (approximately IKb) 0.1q.

Bgll-Bgl! 0.05 g of fragment (approximately 1.8 Kb),
Bgi! l-3au3AI fragment (approximately 350 bp) 0
, 1. was dissolved in T4 DNA ligase buffer 25AII, and the above DNA! was added to this mixture. Approximately 2 pmol of J-linker was added. Furthermore, 6 units of T4 DNA ligase were added, and the binding reaction was carried out at 4°C for 18 hours.

E. coli strain 88101 was transformed using the reaction solution, and A
A colony of p' was obtained, and plasmid DNA was recovered from this colony by the method of Bernpoim et al. to obtain pcfAAl shown in FIG. 43. DNA of pc f AA 1 using the Deideoxy Seafence method! When the base sequence of a portion of the linker was determined, it was found that the third base of the codon encoding the fourth amino acid, Leu, was A. In this pc f AA 1, hG-CS
14 from the 10th Pro to the 23rd Lys of F
The DNA fflS, which encodes an amino acid, is deleted. In addition, a mutation has been introduced in which the 6th Ala of hG-CSF is changed to Asn, resulting in the creation of a new hol site.

(6) Creation of pCf A B 5 (see No. 431!j): Convert pcfAAl 3 obtained in the previous section to 30d Y-
100 buffer, added 5 units of restriction enzyme (ho I), and performed a digestion reaction at 37°C for 1 hour.

After confirming that the Xho I cleavage had been completed by agarose gel electrophoresis, the restriction enzyme Bgi! I(
One unit of Nippon Gene Co., Ltd.) was added, and a partial digestion reaction was carried out at 37°C for 25 minutes. From the reaction solution, a DNA fragment of about 3 to 10 cm containing a portion of the tryptophan promoter and a portion of the 1pp terminator (Xho I-BgJ
I fragment) About 1■ was obtained. Apart from this, the following DNA
A linker was synthesized.

(N is G, A, T or C) This linker DNA is hG-CSFcD of pcfAAl
D encodes 14 amino acids from Pro at position 10 to Lys at position 23 of hG-C5F that was deleted in NA.
Contains NAR.

First, - real alDNAs 2? -mar and 25-ma
r (2 types) and 23-mar were synthesized by the usual triester method. 27-mar and 25-m are complementary to each other
A total amount of 20 pmol each of ar right, 25-mer, and 23-mar DNA was 40 Jd each! was dissolved in T4 kinase buffer, 6 units of T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.) was added, and a phosphorylation reaction was performed at 37°C for 60 minutes.

Next, Xhol-BglI derived from pcfAA1 obtained above
The Bgl l-5au3AI fragment (approximately 350 b) derived from 19 was added to pcFT95 obtained in the previous section.
p) Add 0.1μ to T4 DNA ligase buffer 30JdI
The above DNA linker was added to the mixture in an amount of 2 pmol each. Furthermore, 6 units of T4 DNA ligase were added, and the binding reaction was carried out at 4°C for 18 hours.

E. coli strain 88101 was transformed using the reaction solution, and A
A colony of pr was obtained, and plasmid DNA was recovered from this colony by the method of Birnboim et al. to obtain pCfAB5 shown in FIG. 43. When the base sequence of a part of the DNA IJ linker of pcfAB5 was determined using the deideoxy-Siefens method, the first base of the codon encoding the 17th amino acid is 8 in pCfAB5, and the 17th base of the codon encoding the 17th amino acid is Cys is pCfA
It was found that B5 was substituted with Ser.

(η Construction of pCfBA8 (see Figure 44): Dissolve pCfAB5.3R obtained in the previous section in 40d of Y-100 buffer, add 5 units of restriction enzyme AvaI and 115 units of Bgj!, and perform a digestion reaction at 37°C for 1 hour. L from the reaction solution
By the GT method, a part of the tryptophan promoter and 1p
Approximately 2.8 kb of DNA containing part of p9-minator
Approximately 1 inch of fragment (Aval-BgIU fragment) was obtained.

Separately, add 6 shoulders of pcfWDl to 50d Y-IQ
Dissolve in Q buffer, add 5 units of restriction enzyme Bg1M, and add 3
Digestion reaction was carried out at 7°C for 1 hour. After confirming that Bgin cleavage was completed by agarose gel electrophoresis, 3 units of restriction enzyme Aval were added, and the mixture was incubated at 37°C for 20
Partial cleavage reactions were performed for minutes. Approximately 1.3 K containing most of the hG-CSF cDNA was extracted from the reaction solution by the LGT method.
The DNA fragment of b (BgJII-AvaI fragment) was added to 0.
I got Aug.

Next, Aval-BgIU derived from pCfAB5 obtained above
0.1■ of the fragment (approximately 2.8 Kb) and 0.3J1 of the 8g1■-AVaI fragment (approximately 1.3 Kb) derived from pCfWDI.
g was dissolved in 25ml of T4 DNA ligase buffer, 3 units of T4 DNA ligase was added, and a ligation reaction was performed at 4°C for 18 hours.

E. coli strain 88101 was transformed using the reaction solution, and A
A colony of pr was obtained, and plasmid DNA was recovered from this colony by the method of Birnboim et al. to obtain pCfBA8 shown in FIG. 44.

The amino acid sequence of the hG-CSF derivative encoded by pcfBA8 shows that the sixth Ala of mature hG-CSF is As.
n, the 177th Cys is replaced with Set.

(8) Construction of pCfBD2g (see figure 'i!J44): First, the following DNA IJ anchor was synthesized.

The four bases in this DNA linker are G and A.

Either T or C, totaling 256 types of D
NA! It is obtained as a mixture of I-linkers.

As a result, hG-CS encoded by this DNA linker
The N-terminal amino acid sequence of F has four possible amino acid sequences at four positions, and is designed to have a total of 256 possible amino acid sequences.

First, -terminal strand DNAs, 31-mar and 33-mar, were synthesized by a conventional triester method. 2 μg each of 31-mer and 33-mer were dissolved in a total volume of 40 d of T4 kinase buffer, 30 units of T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.) was added, and a phosphorylation reaction was performed at 37° C. for 60 minutes.

Next, BanI[[-Bglln fragment (approximately 2.7 Kb fragment) 0.1■ derived from pcfBA8, the same < pCf
BA8-derived (7) XhoI-Bg1m fragment (approximately 1.4
K b fragment) 0.1ug was added to T4 DNA ligase buffer 2
5, and add about 2 of the above DNA linkers to this mixture.
Added picomole. Furthermore, 6 units of T4 DNA ligase were added, and the binding reaction was carried out at 4°C for 18 hours.

Using the mixture of recombinant plasmids obtained, E. coli 8
8101 strain was transformed and Apr colonies were obtained. Plasmids were collected from the cultured cells of this colony, and pc
f BD2 B was obtained.

When the base sequence of a portion of the DNA linker was determined by the Deideoxy Seefens method, the base sequence of the N-terminal side of the hG-CSF derivative was found to be as follows.

The hG-CSF derivatives encoded by pCfBD28 each have the following amino acid residue substitutions compared to the mature hG-CSF.

The hG-CSF derivative encoded by pCfBD2B was
G-CSF CND28].

The E. coli strain containing pCfBD28 is Bscheric
h iacoliEcfBD28 (FERMBP-14
79) and has been deposited with the Institute of Fine Technology.

Reference Example 17 Construction of recombinant plasmid pTkSR18: (1)
Construction of recombinant plasmid pTksJl: Approximately 2 cm of pTA4 plasmid DNA obtained in Reference Example 8 was transformed into a 30 d Y-
0 buffer, 10 units of EcoRI and 30 units of Bbel were added, and a digestion reaction was performed at 37°C for 2 hours. 6
After heat treatment at 5°C for 10 minutes, approximately 2.8
The BbeI-EcoRI fragment of b was purified.

Separately, about 3 μm of pTA4 DNA was dissolved in 30 d of YO buffer, 12 units of KpnI was added, and a digestion reaction was carried out at 37° C. for 2 hours. Subsequently, 1.5 g of 2M NaCj and 1 unit of EcoRI were added, and the digestion reaction was further performed at 37° C. for 1 hour. This reaction resulted in DNA being completely digested with KpnI and partially with EcoRI. 65℃, 10
After heat treatment for a minute, using the AFT method, the Ec of b was approximately 1.4.
The oRI-Kpnl fragment was purified. In addition, the following two types of synthetic NAs (16 bases and 24 bases) were synthesized using an Applied Biosystems 380A-DNA synthesizer, and 5' - Phosphorylated.

5'-CTCCTGCCTCCCCATGG-3'3
' -CGCGGAGGACGGAGGGGTACCTT
^^-5' Approximately 2 from pTA4 thus obtained
．． BbeI-EcoRf fragment (approximately 0.1 g) of b in 8.
An approximately 1.4 b EcoRI-Kpnl fragment derived from pTA4 (approximately 0.05 μm) and two 5'-phosphorylated synthetic NAs (1 pmole each) were added to 20 rhino T4 ligase buffer. 50 units of T 4 D
NA! J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA, pTkSJ 1, was isolated from this transformed strain, and pTk
It was confirmed that SJl has the desired structure (50th
(see figure).

(2) Construction of recombinant plasmid pTksR18: Approximately 3 cm of pTksJ1 plasmid DNA obtained above was
of Y-100 buffer, 10 units of Xhol and 1
5 units of Scal were added and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 0.5 Kb was purified using the AFT method. Separately, approximately 2 tbsp of pTrS33 plasmid DNA obtained in Reference Example 5-(2) was dissolved in Y-0 buffer containing 150 mM KCI, 8 units of PvuI and 15 units of Saj■ were added, and 3
Digestion reaction was carried out at 7°C for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 1.
A DNA fragment of 0.b was purified. In addition, about 2 blocks of pTerm2 plasmid DNA obtained in Reference Example 6 were dissolved in 30 d of Y-15011 solution, and 8 units of Pvu I and 8
Unit of Ns i I (NewI!ngland B
iolabs) was added thereto, and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65° C. for 10 minutes, a DNA fragment of approximately 1.85 Kb was purified using the AFT method. In addition, the following two types of synthetic NAs (35 bases and 31 bases) were synthesized using an Applied Biosystems 380A-DNA synthesizer, and each was separately synthesized using the same method as described above. '-phosphorylated.

5'-^CTGTGACGTCCCCAGCTGTT
TG^^GGAAATGCA -3'3'-TG^CA
CTGCAGGGGTCGAC^^GACTTCCTT
T-5' Xhol-5eal fragment (about 0.05 g
), approximately 1.0 from pTrS33. OKb Pvu 1-
5iI1 fragment (approximately 0.14), an approximately 1.85 Kb N5iI-Pvul fragment from pTerm2 (approximately 0.1
), and two types of 5'7 phosphorylated synthetic NA (
1 pmo16 each) in 20 m T4 ligase buffer and 50 units of T4 DNA! I gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the mixture of recombinant plasmids thus obtained, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA, pTk, was obtained from this transformed strain.
sRl 8 was isolated, and it was confirmed that pTkSR18 had the desired structure by structural analysis by restriction enzyme digestion and the deideoxy-Siefens method using M13 phage (see Figure 51).

Reference Example 18 Construction of pTKss4: (1) Construction of recombinant plasmid pTkSD217: Approximately 10 pTA4 plasmid DNA obtained in Reference Example 8
g was dissolved in 100 d of Y-100 buffer, approximately 30 units of Xhol was added, and a digestion reaction was performed at 37°C for 2 hours.

Subsequently, after performing phenol extraction and chloroform extraction, DNA fragments were collected by ethanol precipitation, and 5
0d TE buffer [10mM Tri 5-HCI
(pH 7.5, 0.5mM EDTA).

1 OJJi of this DNA solution was added with 5 concentrations of BAL31 buffer [100mM Tri 5-HCj! (pH
8,0), 3M NaCl, 60mM CaCl
x, 60mM MgC15, 5mM EDTA) at 1(
ld, add 304 ml of water, further add 0.5 unit of exonuclease BAL31 (manufactured by Takara Shuzo Co., Ltd.), and incubate at 30°C for 50 min.
The reaction was carried out for minutes. These reaction conditions are such that DNA b can be removed by about 0.5 from the Xhol end. This reaction was stopped by phenol extraction, and after further chloroform extraction, DNA fragments were recovered by ethanol precipitation. This DNA fragment was dissolved in 30 Makoto's Y-100 buffer, 10 units of BamHI was added, and a digestion reaction was performed at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, a DNA fragment of approximately 1.5 Kb was purified using the AFT method.

Separately, about 2 Jig of pTrS33 plasmid DNA (Reference Example 5) was added with about 12 units of 5 acl in 30 d of Y-0 buffer, and a digestion reaction was performed at 37°C for 2 hours.

After phenol extraction and chloroform extraction, DNA fragments were recovered by ethanol precipitation, and the total amount of 404 was 50mM.
Tris-HCj! (pH 7,8), 7mM
MgC1z, 6mM 2-mercaptoethanol, 0
．． 25mM dATPo, 25mM dcTP, 0
．． 25mM dGTP and 0.25mM dTT
Dissolve in a buffer containing P (hereinafter abbreviated as "polymerase buffer") and add 6 units of Klenow fragment (to
Pal I) (manufactured by Takara Shuzo Co., Ltd.) and incubated at 15°C.
After reacting for some time, the Sac■ protruding end was shaved off and changed to a flat end. The reaction was stopped by phenol extraction, followed by chloroform extraction, and then DNA fragments were recovered by ethanol precipitation. Dissolve this DNA fragment in 30 d of Y-100 buffer, add 10 units of BamHI, and incubate at 37°C for 2
A time digestion reaction was performed. After heat treatment at 65℃ for 10 minutes,
The DNA fragment of approximately 2.8 b was purified using the AFT method.

The approximately 1.5 Kb DNA fragment (approximately 0.2 Kb) derived from pTA4 and the approximately 2.0 Kb DNA fragment derived from pTr333 thus obtained.
In step 8, dissolve the DNA fragment b (approximately 0.1 g) in a total amount of 20 d of T4'l gauze buffer, and add 50 units of T4D.
NA! J gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNApTksD217 was isolated from this transformed strain, and its structure was analyzed by restriction enzyme digestion, and the nucleotide sequence downstream of the E. coli tryptophan promoter (Ptrp) was determined by the dideoxy 5 sequence method using M13 phage. Decided. As a result, it was confirmed that pTkSD217 had the desired structure and the base sequence was (see Figure 52).

) Construction of recombinant plasmid pTksL11: pTksD21 obtained above? Dissolve approximately 3 μ of plasmid DNA in 30 d of Y-100 buffer and add 10 units of Hin.
dI[[ and 15 units of 5eaI were added, and the digestion reaction was carried out at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 0.
A 23 Kb DNA fragment was purified. Next, about 2 μg of pTerm2 plasmid DNA obtained in Reference Example 5 was added for 30 d
of Y-1oo buffer and 10 units of HindI[
[ and 10 units of N5il (manufactured by Niney England Biolabs) were added, and the digestion reaction was carried out at 37°C for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 2.
An 8 Kb DNA fragment was purified. In addition, the following two types of synthetic NAs (35 bases and 31 bases) were synthesized using an Applied Biosystems 380A-DNA synthesizer,
Each was separately 5'-phosphorylated using the method described above.

5'-^CTGTGACGTCCC["AG[:TGT
TCTGAAGG^^ATGCA -3'3'-TGA
CACTGCAGGGGTCGACAAGACTTCC
TTT-5'pTkSD21 thus obtained
? About 0.23 Kb DNA fragment (about 0.01
g), an approximately 2.8 Kb DNA fragment derived from pTerm2 (approximately 0.14 g), and two types of 5'-phosphorylated synthetic NA (1 pmol each) were added to a total amount of 20 μM of T4.
Dissolve 300 units of T4DNAIJ in ligase buffer.
Gauze was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA, pTksLl 1, was isolated from this transformed strain, and structural analysis by restriction enzyme digestion and nucleotide sequence determination by the M13 deideoxy-Siefens method confirmed that pTksLll had the desired structure (No. (See Figure 53).

(3) Construction of recombinant plasmid pTk SS 4: ptPA? obtained in Reference Example 1? Approximately 2 g of plasmid DNA was dissolved in 304 Y-100 buffer, 12 units of restriction enzyme Sca I was added, and a digestion reaction was performed at 37° C. for 2 hours. After heat treatment at 65℃ for 10 minutes, approximately 2
．． The OKb DNA fragment was purified. On the other hand, approximately 2.0% of the pTksLl 1 plasmid DNA obtained above. was subjected to the same reaction as above, and after heat treatment at 65°C for 10 minutes, a DNA fragment of approximately 2.0 OKb was purified using the AFT method.

The ptPA thus obtained? About 2, OK
The DNA fragment of b (about 0.1■) and the DNA fragment of b (about 0.14) of about 2.0 derived from pTkSL11 were added to 204 T.
4 ligase buffer, T4 DNA ligase 300
The units were added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an AI) resistant strain. Plasmid DNA% pTkSS4 was isolated from this transformed strain, and structural analysis by restriction enzyme digestion revealed that pT
It was confirmed that kSS4 had the desired structure (see Figure 54).

Reference Example 19 Construction of recombinant plasmid pTG3: pTk SS 4 plasmid D obtained in Reference Example 18
Approximately 2 ug of NA was dissolved in 304 Y-0 buffer, 10 units of restriction enzyme NarIJ (manufactured by Nikol England Biolabs) was added, and a digestion reaction was performed at 37°C for 2 hours.

followed by 1.0 d of 2M NaC, 1 and 12 units of B
amHI was added, and the digestion reaction was further carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, a DNA fragment of approximately 3.3 Kb was purified using the AFT method. On the other hand, reference example 1
Approximately 3 cm of pTksR18 plasmid DNA obtained in step 7 was subjected to the same reaction as above, and after heat treatment at 65°C for 10 minutes,
A DNA fragment of approximately 0.2 Kb was purified using the AFT method.

The pTk SS obtained in this way derived from approximately 3
．． 3 Kb DNA fragment (approximately 0.IJig) and pTk
Approximately 0.2b DNA fragment derived from 5R18 (approximately 0.01
gg) in 204 T41J gauze buffer, T4
100 units of DNA ligase was added and the binding reaction was carried out at 4°C for 18 hours.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA%pTG3 was isolated from this transformed strain, and structural analysis by restriction enzyme digestion revealed that pT'G3
was confirmed to have the desired structure (see Figure 55).
.

Reference Example 20 Construction of recombinant plasmid phPA2: Approximately 2㎜ pTG3 plasmid DNA obtained in Reference Example 19
was dissolved in 30 m of Y, -100 buffer, and 10 units of Ec
oRI and pvul were added, and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65°C for 10 minutes, a DNA fragment of approximately 1.7 Kb was purified using the ATF method.

In addition, about 2 g of pUKB 101 plasmid DNA obtained in Reference Example 12 was dissolved in Y-100 buffer 304, and l
O units of Ncol and pvul were added, and the digestion reaction was carried out at 37°C for 2 hours. After heat treatment at 65℃ for 10 minutes, ATF
A DNA fragment of approximately 3.0 b was purified using the method.

Furthermore, about 2 gg of pTksR18 plasmid DNA obtained in Reference Example 17 was dissolved in 30 ml of Y-100 buffer,
Add 10 units of iindDI and Aatll and heat to 37°C.
Digestion reaction was carried out for 2 hours.

After heat treatment at 65°C for 10 minutes, approximately 0.0% was measured using the ATF method.
55, the DNA fragment b was purified.

In addition, the following four types of synthetic NAs (37 bases, 41 bases, 41 bases, and 45 bases) were synthesized using an Applied Biosystems 380A-DNA synthesizer.

20 pmoles of these synthetic NAs were separately added to 5 units of 7 in 204 T4 kinase buffer.
Add 4 DNA Kinase (manufactured by Takara Shuzo Co., Ltd.) and incubate at 37℃ for 30 minutes.
By reacting for minutes, the 5' end of the synthetic NA was phosphorylated.

Approximately 1.7 Kb derived from pTG3 thus obtained
DNA fragment (approximately 0.05 gg>), approximately 3.0 b DNA fragment (approximately 0.05 ■) derived from pUKB101, pT
Approximately 0.55 Kb DNA fragment derived from ksR18 (approximately 0
．． 05g), and four 5'-phosphorylated synthetic N
Dissolve A (1 pmol each) in a total volume of 20 d of T41J gauze buffer, add 300 units of T41J gauze, and add 300 units of T41J gauze.
The binding reaction was carried out for 18 hours at °C.

Using the obtained mixture of recombinant plasmids, E. coli strain MM294 was transformed to obtain an Ap-resistant strain. Plasmid DNA, phPA2, was isolated from this transformed strain,
Structural analysis by restriction enzyme digestion and base sequence determination by the M13 deideoxy-Siefens method revealed that
phPA2 confirmed that it has the desired structure (5th
(See Figure 6).

Effects of the Invention According to the present invention, polypeptides endowed with properties such as protease resistance and thermostability can be industrially supplied using recombinant DNA techniques.

[Brief explanation of the drawing]

FIG. 1 shows the classification of N-glycoside-linked sugar chains. The symbols in the figure indicate the following substances (the same applies below). Glc nigercose, Man: Mannose, GIcNA
c: N-acetylglucosamine, Ga1 nigalactose, sia nidialic acid, Fuc: fucose Figure 2 shows the structure of the libido intermediate. In the figure, PP indicates pyrophosphoric acid. Figure 3 shows the dolichol phosphate cycle. The symbols in the figure indicate the following substances. PAM nidricholic acid, P-P-nidricol pyrophosphate, GDP: guanidine diphosphoric acid, LJDP: uridine diphosphoric acid, ◆nigelcose,: mannose, .: N-
Acetylglucosamine Figure 4 shows the biosynthesis system of N-glycoside-linked sugar chains. The symbols in the figure indicate the following substances. -2N-acetylglucosamine, ○: Mannose, Nigalactose, ◆ Nidialic acid, Mu: Glucose, Δ: Fucose Figure 5 shows the construction process of plasmid pA52g. FIG. 6 shows the construction process of plasmid pASN6. Figure 7 (1) shows plasmid pt1981)281'~
145 is shown. FIG. 7(2) shows the construction process of plasmid pAsN145. Figure 8(1) shows hc-cSF produced and purified in E. coli.
and hG-C5F CND28] and hG-CSF produced in CHO cells, hG-C5F CND28],
hc-CSF (NO38N6) right and hG-CSF
[NO38N145] was subjected to 5DS-polyacrylamide electrophoresis and then silver stained. FIG. 8(2) shows the protein on the gel shown in FIG. 8(1) being transferred to a nitrocellulose membrane and then subjected to enzyme antibody staining using an anti-hG-CSF monoclonal antibody. FIG. 8(3) is a schematic diagram of FIG. 8(2). Figure 8 (4) shows the results of 5DS-polyacrylamide gel electrophoresis when examining the chymotrypsin resistance of hG-CSF CND28) with and without newly added O-glycoside-linked 11iiJl. and its schematic diagram are shown. Figure 8 (5) shows the 5DS-polyacrylamide gel electrophoresis when examining the chymotrypsin resistance of hG-CSF l:ND28N6] with and without newly added N-glycoside-linked sugar chains. The results of electrophoresis and its schematic diagram are shown. Figure 8 (6) shows hG-CSF [NO38N145]
For, 0-glycosidic bond type 11iwA or N
- Shows the results of 5DS-polyacrylamide gel electrophoresis and its schematic diagram when chymotrypsin resistance was examined for those with and without newly added glycoside-linked sugar chains. FIG. 8(7) shows a comparison of the thermostability of hG-CSF CND28N6] with newly added N-glycoside-linked sugar chain and with that removed. Mark 0 indicates N-glycanase treatment (N-glycoside-linked sugar chain removal hG-CSF (ND2BN6)).
・The mark is a control (N-glycoside-linked glycosylated hG-CS
F CND28N6]. FIG. 9 shows the construction process of 1-wood pUKmps1. Figure 1O shows the construction process of plasmid pUKs1. FIG. 11 shows the construction process of plasmid psEIUKsl-1d. Figure 12 shows natural prO-UK (!: UK derivative UK-
The results of 5DS-polyacrylamide gel electrophoresis comparing the thrombin sensitivities of 31 samples are shown. Figure 13 shows the natural pro-UK and UK derivative UK-
Fig. 9 is a graph showing the results of comparing the thrombin sensitivity of No. 91 with amidolytic activity. Figures 14 (1) and (2) show the steps of cDNA synthesis by the Okayama-Barb method and the construction of a recombinant plasmid containing the DNA. FIG. 15 shows the construction process of plasmid pccK1. Figure 16 shows the steps for constructing plasmid pCCK2. Figure 17 shows the construction steps of plasmid pUK11 carrying human pro-UK cDNA. Figure 18 shows the steps for constructing plasmid pTrs2 (18). FIG. 19 shows the construction process of plasmid pTrS33. FIG. 20 shows the construction process of plasmid pTerm2. Figure 21 shows the steps for constructing plasmid pTSF 1 (18). Figure 22 shows the steps for constructing plasmid pTA4. FIG. 23 shows the construction process of plasmid pΔGE105M. FIG. 24 shows the step of constructing plasmid pAGE 106. FIG. 25 shows the construction process of plasmid psEIPAl-5. FIG. 26 shows the construction process of plasmid psEIPAI-9. Figure 27 shows the construction process of plasmid pUc19H. 28th rllJ Bapura Xmi)' psEIPAI-9A construction process is shown. Figure 29 shows plasmid psBIPA1sB1dhfrl
-9^ construction process is shown. FIG. 30 shows the construction process of plasmid psEIGc3-3. FIG. 31 shows the construction process of plasmid pAS3-3. Figure 32 shows the steps for constructing plasmid pUKA2. Figure 33 shows the construction process of plasmid pUKB101. Figure 34 shows the steps for constructing plasmid pUKF2. Figure 35 shows the steps for constructing plasmid pUKFpro. FIG. 36 shows the construction process of plasmid psEIUKprol-IA. Figure 37 shows the steps for constructing plasmid pLA1. Figure 38 shows the steps for constructing plasmid pLSA1. Figure 39 shows the steps for constructing plasmid pcfTA1. Figure 40 shows the steps for constructing plasmid pc fTB2 (18). Figure 41 shows the steps for constructing plasmid pCfTL38. Figure 42 shows the steps for constructing plasmid pcfWDl. Figure 43 shows 19, pcf in plasmid pcfT95.
The construction steps of AA1 and pCfAB5 are shown. Figure 44 shows plasmids pCfBA8 and pCfBD2.
8 is shown. Figure 45 shows natural pro-UK and glycosylated modified U.
Figure 2 shows temporal changes in the level of systemic fibrinolytic factors during continuous infusion of K-SL. Figure 46 shows natural pro-UK and glycosylated modified U.
Figure 2 shows temporal changes in the level of systemic fibrinolytic factors during rapid intravenous injection of K-51. FIG. 47 shows the construction process of plasmid pUKS3. Figure 48 shows the construction process of plasmid pSEUKS3. Figure 49 shows natural pro-UK and glycosylated modified U.
The heat inactivation curve of K-53 at 70°C is shown. Figure 50 shows the steps for constructing plasmid pTksJ1. Figure 51 shows the steps for constructing plasmid pTksR18. Figure 52 shows the steps for constructing plasmid pTkSD217. Figure 53 shows the steps for constructing plasmid pTksL11. Figure 54 shows the steps for constructing plasmid pTkss4. Figure 55 shows the steps for constructing plasmid pTG3. Figure 56 shows the steps for constructing plasmid phPA2. Cleaning of the drawings a (with changes in content Rokujoku CHα Anehi 5KD - 8 pages of engravings (no changes in content) ■ (h) Figure 9 omHI st I ↓ Heat Rei Figure 13 Han 几 - i1M (Intermediate) Fig. 14 (2) DNA Riga-Pi Fig. 14 (1) Fig. 15 EcoRl Fig. 16 Fig. 18 Fig. 20 Fig. 21 bgtn Fig. 27 Fig. 29 Section CON1 Fig. 32 EcoRI Fig. 36 Figure 37 Figure 39 Figure 38 Figure 40 Figure 47 GGCCAA AAG ACT: ATTCGA AC
G CGT m AAG ATr ATT GGG G
GA GTT TTCTGA TAA GCT TGC
GCA AAA TTCTAA TAA CCCCCT
CTT AA Fig. 49 Protein concentration 10 J, l (J / m 1 70'C. h Incubation time (Gin) BamHl Fig. 5θ Fig. 52 Fig. 5q Fig.!!Fig.

Claims (28)

[Claims] (1) A novel polypeptide having an amino acid sequence to which at least one new sugar chain can be added. (2) The novel polypeptide according to claim 1, wherein addition of a sugar chain is made possible by performing amino acid substitution, amino acid deletion, or amino acid insertion in the polypeptide. (3) Claim 1, wherein the amino acid sequence is an N-glycosylation binding site (asparagine residue-X residue-threonine residue or serine residue, where the X residue is an amino acid other than proline). A novel polypeptide. (4) A glycosylated polypeptide obtained by adding at least one sugar chain to the polypeptide according to any one of claims 1 to 3. (5) The added sugar chain is an N-glycoside-linked sugar chain, an O
- The glycosylated polypeptide according to claim 4, which is a glycoside-linked sugar chain or a chemically synthesized sugar chain. (6) The polypeptide according to any one of claims 1 to 5, wherein the sugar chain addition site is located near the protease cleavage site (within 8 amino acid residues from the cleavage site) of the polypeptide; Glycosylated polypeptides. (7) The polypeptide or glycosylated polypeptide according to claims 1 to 5, wherein the sugar chain addition site is located on the surface of the polypeptide. (8) The polypeptide or glycosylated polypeptide according to any one of claims 1 to 7 is a colony stimulating factor (
Granulocyte/macrophage colony stimulating factor, granulocyte colony stimulating factor, macrophage colony stimulating factor), tissue plasminogen activator (hereinafter abbreviated as t-PA), urokinase (hereinafter abbreviated as UK), interferon- α, interferon-β, interferon-γ, lymphotoxin, lipocortin, superoxide dismutase, erythropoietin or interleukin-1, -2, -3, -4, -5, -6 or -7. The polypeptide or glycosylated polypeptide according to claims 1 to 7. (9) The polypeptide or glycosylated polypeptide according to any one of claims 1 to 7 is human granulocyte colony stimulating factor (hereinafter abbreviated as hG-CSF),
The threonine residue (1st from the N-terminus) of hG-CSF is an alanine residue, the leucine residue (3rd from the N-terminus) is a threonine residue, and the glycine residue (4th from the N-terminus)
is a tyrosine residue, and a proline residue (5th from the N-terminus)
is an arginine residue, and a cysteine residue (17 from the N-terminus)
8. The polypeptide or glycosylated polypeptide according to any one of claims 1 to 7, wherein the polypeptide or glycosylated polypeptide according to any one of claims 1 to 7, wherein each of the positions (th) and 3) is substituted with a serine residue. (10) The polypeptide or glycosylated polypeptide according to claim 9, wherein the alanine residue (sixth from the N-terminus) of the polypeptide or glycosylated polypeptide is replaced with an asparagine residue. polypeptide. (11) The glutamine residue (145th from the N-terminus) of the polypeptide or glycosylated polypeptide according to claim 9 is replaced with an asparagine residue, and the arginine residue (147th from the N-terminus) is replaced with a serine residue. The polypeptide or glycosylated polypeptide according to claim 9, characterized in that: (12) The polypeptide or glycosylated polypeptide according to claim 9, which has an amino acid sequence selected from the amino acid sequences shown in Tables 2, 3, and 4. (13) The polypeptide or glycosylated polypeptide according to any one of claims 1 to 7 is UK, and the sugar chain addition site is near the thrombin cleavage site of mature UK [
The polypeptide or glycosylation according to any one of claims 1 to 7, characterized in that the polypeptide is present between a glycine residue (149th from the N-terminus) to a phenylalanine residue (164th from the N-terminus). polypeptide. (14) The polypeptide or glycosylated polypeptide according to claim 13, wherein the phenylalanine residue (164th from the N-terminus) of the mature UK is replaced with an asparagine residue. (15) Leucine residue of mature UK (153 from the N-terminus)
14. The polypeptide or glycosylated polypeptide according to claim 13, wherein the proline residue (155th from the N-terminus) is replaced with an asparagine residue and the proline residue (155th from the N-terminus) is replaced with a threonine residue. (16) The polypeptide or glycosylated polypeptide according to claim 13, which has an amino acid sequence selected from the amino acid sequences shown in Tables 6 and 7. (17) Deoxyribonucleic acid (DNA) encoding the polypeptide or the polypeptide portion of the glycosylated polypeptide according to any one of claims 1 to 16. (18) A recombinant plasmid incorporating the DNA according to claim 17. (19) The recombinant plasmid according to claim 18, wherein a plasmid DNA having an E. coli tryptophan promoter or an SV40 early promoter is used as the plasmid DNA, and the DNA is integrated downstream of the promoter of the plasmid DNA. (20) pAS28, pASN6, pASN145, p
The recombinant plasmid according to claim 18 or 19, selected from SE1UKS1-1d and pSEUKS3. (21) A microorganism or animal cell containing the recombinant plasmid according to any one of claims 18 to 20. (22) The microorganism according to claim 21, wherein the microorganism belongs to Escherichia coli. (23) The animal cells are CHO (Chinese Ham)
22. The animal cell according to claim 21, which is a ster Ovary cell or a Namalva cell. (24) Cultivating the microorganism or animal cell according to claim 21 in a medium, accumulating the polypeptide or glycosylated polypeptide in the culture, and collecting the polypeptide or the glycosylated polypeptide from the culture. A method for producing a polypeptide or glycosylated polypeptide characterized by: (25) The microorganism or animal cell according to claim 21,
- The structure of the sugar chain to be added is changed by culturing in a medium containing an inhibitor of enzymes related to the biosynthesis or processing of sugar chains of deoxynojirimycin, 1-deoxymannojirimycin, or swainsonine. The manufacturing method according to claim 24. (26) The production method according to claim 24 or 25, wherein the microorganism belongs to Escherichia coli, yeast, or mold. (27) The animal cells are CHO (Chinese Ham)
26. The production method according to claim 24 or 25, wherein the cells are ster Ovary cells or Namalva cells. (28) The glycosylated polypeptide collected by the production method according to any one of claims 24 to 27 is processed using a glycosidase selected from sialidase, β-galactosidase, β-N-acetylglucosaminidase, β-mannosidase, and endoglycosidase. A method for producing a glycosylated polypeptide, which comprises changing the structure of a sugar chain to be added by treatment with an acid transferase.