JPH0211523A - Immunoadsorbent for remedy of malignant tumor, etc., and remedying method using the same agent - Google Patents

Abstract

PURPOSE:To obtain a composition useful for the remedy of malignant tumor and autoimmune diseases by preparing a specific polypeptide fragment having an Fc bonding region linkable to the Fc region of an immunoglobulin and producible by a gene recombination technique and supporting the obtained polypeptide fragment on an inert carrier. CONSTITUTION:A polypeptide produced by adding cysteine to the N-terminal or C-terminal of a polypeptide fragment of protein A originated from Staphylococcus aureus Cowan I strain and constituting an Fc bonding region linkable to the Fc region of an immunoglobulin is produced by a gene recombination technique and the obtained polypeptide is supported on an inert carrier to obtain the objective immunoadsorbent. The immobilization of the polypeptide on a carrier can be carried out under mild and easy condition by the addition of cysteine. The plasma, serum or whole blood extracted from a living body is made to contact with the immunoadsorbent and the treated plasma, etc., is introduced into the same kind of a living body to effect the remedy of malignant tumor and autoimmune diseases.

Description

DETAILED DESCRIPTION OF THE INVENTION (Industrial Application Field) The present invention relates to an immunoadsorbent useful for treating malignant tumors and autoimmune diseases, a therapeutic method using the same, and a therapeutic composition.

(Prior art) Unexamined Japanese Patent Publication No. 1983-1989 as one of the effective treatment methods for malignant tumors.
Publication No. 86168 describes Staphylococcus aureus 9f 1 strain (Staphylococcus aureus), which is a type of staphylococcus.
h Iococcus aureus Cowan
A method using an immunoadsorbent in which protein A (SPA), a cell membrane component, is supported on an inert carrier in I) is disclosed. Plasma obtained by separating blood from a living body is brought into contact with this adsorbent, and when the plasma after contact is combined with blood solids again to make whole blood and returned to the living body, it has been confirmed that malignant tumor cells become necrotic. ing.

It is known that substances that do not exist in a normal living body usually increase in a living body with malignant 11ijJ&.

Such substances include antibodies produced by the specific antigen on the surface of malignant tumor cells; immune complexes formed by complement binding to the antigen-antibody complex to form a large matrix; and special immunoglobulins. etc. Since these act as factors in serum that inhibit the normal immune system (serum inhibitory factors), their presence further promotes the growth of malignant tumors.

SPA used in the method of the above-mentioned publication has the property of binding to the Pc portion of most mammalian immunoglobulins (Ig; mainly immunoglobulin G (IgG)). Therefore, when plasma is brought into contact with an adsorbent carrying SPA, Ig containing the above-mentioned serum inhibitory factors is adsorbed and removed, and as a result, the normal immune system is restored and III
It is thought that tumor cells are eliminated. In the above method, it has also been reported that tumor-specific antibodies that can specifically react with malignant tumors and cause necrosis of Mm tumor cells increase in plasma after contact with SPA. Furthermore, Shiraki et al. reported that when immune complexes in the serum of patients with malignant tumors come into contact with SPA, they undergo denaturation, and tumor-specific antibodies are released from the denatured immune complexes.5 These nm tumor-specific antibodies cause necrosis of malignant tumors. (Clinical Immunology; April 1985 issue).

In this way, in treatment methods using SPA as an immunoadsorbent, SP
It is thought that A not only adsorbs and removes Ig, but also causes some kind of interaction with Ig, resulting in tumor cell necrosis. Although the detailed mechanism is still unclear, it is thought that the interaction between Ig in the blood and the Fc binding region of SPA is the starting point for the anti-n1m action.

The SPA used in the above method is Staphylococcus
Obtained from the cells of one strain of E. aureus 9fu. SPA is expensive because the purification process is complicated. SPA
1 otg has the ability to bind 1, for example, 8-10 mg of human IgG. For example, 10% of IgG in the blood is combined with SPA and removed to treat malignant tumors. Alternatively, in order to cause an interaction with SPA, several hundreds of SPA are required, which has the drawback that the treatment is very expensive. Furthermore, since SPA is a protein derived from microorganisms, it may cause allergic reactions when used for treatment.

To solve these problems, the inventors proposed Hjelm et al.
chem, 55°395-403 (1975))
By treating SPA with a proteolytic enzyme such as trypsin, five relatively low molecular weight polypeptide fragments A, B, C, D and E, which have the ability to bind to the FC region of IgG, are combined. Get stuff and make this malignant!
Attempted to use it for the treatment of II tumors etc.
721322). It is known that among the above-mentioned polypeptide fragments, A, B, C and D have extremely similar structures and are each composed of about 60 amino acid residues. These have the ability to bind to Ig alone and are known to react with SP/1 antibodies.

In other words, it exhibits reactivity similar to SPA. In this way SPA
By decomposing SPA into each fragment, it has the advantage that its ability to bind to Ig is approximately 2.2 times higher than that of the original SPA. Among the above polypeptide fragments, fragments A, B, C and D all have molecular weights of 1.
It's low, less than 10,000. Therefore, it has the advantage that allergic reactions, which are thought to occur when conventional SPA-supported adsorbents are used because they are bacterial cell-derived proteins, hardly occur. Among the polypeptide fragments, fragment E is approximately 15 minutes from the SP 8 to 0 end.
It is composed of 0 amino acid residues, and this fragment has a mitogenic effect (enhancing cell proliferation) on lymphocytes. Furthermore, it has B cell stimulatory activity that is formed from lymphoid progenitor cells. Thus, polypeptide fragment E is thought to have the function of acting on lymphocytes and improving their immune function. However, this polypeptide fragment E is different from the polypeptide fragments A and B described above.

Because it has a larger molecular weight than C and D, it has higher antigenicity;
May cause allergic reactions.

Therefore, for treatment that does not cause allergic reactions,
It is desirable to remove undesirable fractions such as polypeptide fragment E.

Furthermore, in the above methods for obtaining these polypeptide fragments, trypsin, which has a wide substrate specificity, is used as a proteolytic enzyme. Therefore, depending on the reaction conditions of the enzymatic reaction.

There is a risk that fragments larger or smaller than the desired polypeptide fragment size may be generated. As described above, in order to obtain a polypeptide fragment of the desired size in high yield, it is necessary to use strict reaction conditions, and it is difficult to control these conditions. (Problems to be Solved by the Invention) The present invention solves the above-mentioned conventional drawbacks, and its purpose is to: prepare a highly pure polypeptide constituting the SPA I) Fc-binding region; An object of the present invention is to provide an immunoadsorbent for treating malignant tumors that has high activity and can be supplied at low cost, a treatment method using the same, and a therapeutic composition. Another object of the present invention is to prepare the above-mentioned polypeptide using genetic recombination technology, and to provide an immunoadsorbent for treating malignant tumors having the above-mentioned valuable properties, a therapeutic method using the same, and a therapeutic composition. It is about providing.

(Means for Solving the Problems) The immunoadsorbent for the treatment of malignant tumors, etc. of the present invention is obtained from Staphylococcus aureus Cowan 1 strain (Sta h 1o
Coccus aureus Cowan I)-derived protein A (SPA), immunoglobulin (Tg
) A polypeptide with cysteine added to the N-terminus or C-terminus of the polypeptide fragment constituting the Fc-binding region capable of binding to the FcjJ region of The above-mentioned object is achieved.

The method for treating malignant tumors, etc. of the present invention includes a step of bringing plasma, serum, or whole blood from a living body into contact with the immunoadsorbent;
and injecting the plasma, serum, or whole blood after the contact into the living body or a similar living body, thereby achieving the above object.

The composition for treating malignant tumors, etc. of the present invention is a treated plasma or serum obtained by bringing plasma, serum, or whole blood from a living body into contact with the immunoadsorbent.

Alternatively, the main component is whole blood, thereby achieving the above purpose.

The polypeptide used in the present invention is an immunoglobulin (
The N-terminus or C
Polypeptide with cysteine added to the end (hereinafter referred to as S
PA active fragment).

It is prepared using recombinant genetic technology. less than,
The preparation of this SPA active fragment using genetic recombination technology will be explained in detail in the order of steps.

The polypeptide fragment constituting the Fc-binding region of SPA (this refers to the region that has binding activity to the Fc region of Ig) is represented by the 9th amino acid sequence.

ADNKFNKE (IQNAFYErLIILPNLN
EE(]RNGFI(ISLKDDPS(IsANLL
AIEAKKLNDA mouth AP
(1)-1 Here, the symbols constituting the above amino acid sequence have the following meanings: A: alanine, D: aspartic acid, E: glutamic acid, F:
Phenylalanine, G; Glycine, H: Histidine, I
: Isoleucine, Ni: Lysine, L: Leucine 1M: Methionine, N: Asparagine, P-nibroline.

Q: Glutamine, R: Arginine, S: Serine.

Y: Tyrosine.

Although this sequence is one of the typical amino acid sequences of polypeptide fragments constituting the Fc binding region of SPA, it is not necessarily limited to this sequence, and similar sequences having similar binding activity to the Fc region of Ig can be used. is included.

By culturing host cells transformed by introducing a recombinant plasmid into which a gene encoding a polypeptide fragment constituting the Fc-binding region of SPA has been inserted,
The B-polypeptide fragment is expressed as a fusion protein in culture. From this fusion protein, the Fc of SPA
In order to obtain only the polypeptide fragments constituting the binding region, taking advantage of the fact that the Fc binding region of SPA is a polypeptide that does not contain methionine2, for example,
Methionine (M
) is preferably added.

When using the polypeptide fragment constituting the Fc-binding region of SPA bound to a solid support, etc., an active hydrogen such as cysteine (C) is added at the N-terminus or C-terminus to facilitate binding under mild conditions. It is preferable to add an amino acid with

This is because even if cysteine is newly added, intramolecular crosslinking does not occur because cysteine does not exist in the original polypeptide fragment, and its three-dimensional structure is presumed to be unaffected.

Therefore, the following sequence was designed as the amino acid sequence of the SPA active fragment used in the present invention:
KFNKEGQNAFYEILIILPNLNEEQI
? NGFIQSLKDDPSQSANLLAEAKKL
ND Hero AIIIKC (1) -2 as a deoxyribonucleotide triplet codon corresponding to such an amino acid sequence.

It goes without saying that codons preferred by the host microorganism are preferable, but the codons are not particularly limited thereto. This deoxyribonucleotide sequence is located at the 5' end of the gene encoding the polypeptide fragment that constitutes the Fc-binding region of SPA.
A methionine initiation codon (ATG) is added to the end, and a cysteine codon (TGY) is added to the 3' end.

Next, a transcription stop codon (TAA and/or TAG) is added to the 3'' end.Furthermore, in order to integrate the gene thus obtained into a plasmid vector, a nucleotide sequence at the 5'' end (further than the above start codon) is added. (upstream side) and the 3° end (further downstream of the above transcription stop codon).For example, an EcoRI recognition site like this is formed on the 5'' side, and an EcoRI recognition site on the 3'' side is formed. An old recognition site is added like this.

As a nucleotide sequence encoding the amino acid sequence of the SPA active fragment used in the present invention.

I designed the following sequence: hehe TTCATGGCXGAYAAYAARTTYAA
YAARGARCARCARAAYGCXTTYTAY
GAL? ATZJJJcAYJJJCCXAAYJJJ
AAYGARGARCARCGXAAYGGXTTYA
TYCARLLLLJJJAARGAYGAYCCXLL
LCARLLGCXAAYJJJJJGCXGAR
GCXAARAARJJJAAYGAXGCXCARG
CXCCXAARTGYTAATAGG
(It) Here, the symbols constituting the above nucleotide sequence have the following meanings: A: Adenine, Gnigeanine, C: Cytosine 5, T: Thymine, R: A or G, Y: C or T.
, Z: A, C or TX: A, G, C or T, JJJ
: Codon corresponding to Leu, LLL: Codon corresponding to Ser.

To synthesize the polynucleotide designed as described above, first, the upper strand 1 as shown in Figure 1 is synthesized.
A total of 25 oligonucleotides, 3 oligonucleotides and 12 lower strands, were synthesized by a method known in the literature (solid phase method). Here, the size of the oligonucleotides was generally about 10 to 20 oligonucleotides synthesized to facilitate purification. Each oligomer was designed with the following precautions taken.

A) E. coli (E. coli) as host
), we prioritized and used the most frequently used codon from the E. coli codon usage table.

B) During synthesis, if the 3′ end is A (adenine), depurination is likely to occur, so the 3′ end should be A (adenine) as much as possible.
I made it so that it was something other than that.

C) Thorough computational sequence analysis was performed to ensure that no undesirable binding occurred when linking the oligomers.

The base sequence of each oligonucleotide fragment thus synthesized was confirmed. Then the second
As shown in the figure, the genes of the two SPA active fragments used in the present invention were chemically synthesized by linking each fragment using ligase to form a double strand according to the base sequence of the SPA active fragment.

The recombinant plasmid used in the present invention contains the gene encoding the SPA active fragment chemically synthesized by the method described above, the promoter of the lactose operon of the λplac5 DNA, and the β-galactosidase region. Obtained by introducing it into a plasmid vector. First, SP
A plasmid vector for incorporating the gene encoding the A active fragment was constructed as follows.

The DNAs of pBR322 and λplac5 are each digested with restriction enzymes, and the resulting digests are linked by a ligation reaction. Examples of restriction enzymes include EcoR
I is preferably used. Furthermore, as the enzyme used for the ligation reaction, T and DNA ligase are preferred.

Using the plasmid DNA thus obtained, E.
Transform E. coli. For example, K-12 strain)
IBIOI is preferred. Next, a plasmid is isolated from the transformant, digested with Hindll, and then the orientation of the promoter and β-galactosidase region is examined by agarose gel electrophoresis to select a plasmid with the desired orientation.

Since this plasmid has two EcoRI cleavage sites, the site close to the β-galactosidase promoter is removed. To do so, convert the plasmid into EcoR
Partial digestion is performed with I, and the target DNA fragment is separated from the digested product by agarose gel electrophoresis. Since this fragment has a single-stranded portion at the end resulting from cleavage with EcoRI, T4 DNA polymerase is applied to this fragment to convert the single-stranded portion into double strands to create a blunt end. Then T,
The circle is closed using DNA ligase to obtain a plasmid with one EcoRI cleavage site. This plasmid is used to transform antrum as described above, and tetracycline-resistant strains are selected. Plasmid DNA was isolated from colonies of this strain, and EcoRl and Hin
Digested with dI[I.

The size of the resulting DNA fragment is examined by agarose gel electrophoresis to determine which of the two EcoRI cleavage sites has been removed. A plasmid with one desired cleavage site removed, ie, a cleavage site near the β-galactosidase promoter, is selected.

The plasmid thus obtained is completely digested with EcoRI and BamH1, and the larger DNA fragment is obtained by agarose gel electrophoresis. to this fragment.

A recombinant plasmid used in the present invention is constructed by ligating the above chemically synthesized SPA active fragment genes through a ligation reaction. Preferably, the ligation reaction is carried out using T, DN^ligase and ATP.

The transformant used in the present invention using a recombinant plasmid is a recombinant plasmid constructed by the method described above (a plasmid into which a gene encoding a SPA active fragment has been integrated), for example, Lc.
olt K-12 stock 1! It is obtained by transforming a strain of the genus Escherichia such as B I Q 1 as a host. The host cell is not particularly limited to strains of the genus Ethelicia, but may also be, for example, strains of the genus Bacillus or Pseudomonas, yeast and other true cones, cultured cells of humans and other animals, or cultured cells of plants.

First, the recombinant plasmid used in the present invention is introduced into a Lcoat tube that has been previously treated with CaClz.

Here, in the recombinant plasmid used in the present invention, a gene encoding a SPA active fragment is integrated into its tetracycline resistance gene, so that the strain transformed with this plasmid has tetracycline sensitivity (Tc'). It is. However, since the ampicillin resistance gene is not divided by the foreign gene, the transformed strain becomes ampicillin resistant (Ap'). Therefore, transformed strains expressing genes encoding SPA active fragments were screened using an ampicillin-containing medium followed by a tetracycline-containing medium.
Select some of these colonies and digest the plasmid DNA obtained from them with EcoRI and Bam1ll, and examine the size and base sequence of the generated DNA fragment. rlf: was found to correspond to the gene encoding the SPA activity fragment for all the genes tested.The obtained transformed strain was named E. coli K225PA-Fc.

When the above-mentioned transformed strain of SPA fugumen is cultured, SPA active fragments are produced within the bacterial cells. This SP^ active fragment is expressed as a fusion protein with β-galactosidase because its gene is inserted into the structural gene of β-galactosidase. However, since the nucleotide sequence of the above SPA active fragment has a methionine codon (ATG) added to the 5' end, 2-expressed S
A methionine is inserted at the N-terminus of the PA active fragment.

Therefore, the SP^ active fragment can be separated from this fusion protein by treatment with, for example, cyanogen bromide (CNBr). For example, first, the above-mentioned transformed strain is cultured in broth containing ampicillin, and the cells obtained by centrifuging the culture are treated with cyanogen bromide. next.

SPA active fragments can be separated and purified by purifying the lyophilized product of the treated solution using an IgG-immobilized affinity column.

The SPA active fragment thus obtained is 5
OS-polyacrylamide electrophoresis (SDS-PAGE
) molecular weight (approximately 7,000), Ig in mouse serum
Analysis of G-binding ability, amino acid composition, and amino acid sequence all show data consistent with theoretical values.

Also, the yield is 3 x 10' molecules per cell.

The SPA active fragment obtained by the above method is.

Since cysteine is inserted at the N-terminus or C-terminus of the amino acid sequence, it can be immobilized on a carrier under mild and easy conditions by utilizing the reactivity of its thiol group. Furthermore,
By utilizing the exchange reaction of thiol groups, the column can be easily regenerated, providing a major advantage. Also,
When immobilized on a carrier using a thiol group (Example 1
(11)), when a group other than a thiol group 2, such as the amino group of lysine, is bonded to a cyanogen bromide-activated carrier, the activity of the SPA active fragment is significantly reduced. It was also found that

In this way, SPA active fragments are prepared that can be stably immobilized on carriers with higher IgG binding activity than conventional SPA products.

To obtain the immunoadsorbent used in the present invention, the above-mentioned SPA
The active fragment is supported on an inert carrier. Examples of inert carriers include activated carbon, silica gel, glass, cellulose, agarose, collodion, and plastics such as polyaminostyrene. In order to support SPA + active fragments on these inert carriers, for example, a method of physically adsorbing (non-covalently supporting);
There is a method of chemically bonding (non-covalently supporting) to a carrier such as agarose activated with cyanogen bromide.

The immunoadsorbent thus obtained is effective in treating malignant tumors; autoimmune diseases thought to be caused by specific antigens, specific antibodies, and immune complexes; and the like.

To carry out treatment using the above immunoadsorbent, the patient's body fluid (
For example, blood or ascites) may be brought into contact with the immunoadsorbent and then returned to the patient's body. When using blood,
If whole blood is used, blood cells may be damaged when they come into contact with the immunoadsorbent.

It is recommended to use plasma or serum. Blood is continuously drawn from a living body's veins or arteries through a tube, etc., and then passed through a plasma separation membrane to obtain plasma.

This plasma is introduced into a column filled with the above immunoadsorbent,
A perfusion method is preferably used in which the plasma that has passed through this column is combined with blood cell components again to form whole blood and injected into the veins of the living body. A therapeutic composition is prepared in advance by adding other drugs as necessary to the treated body fluid (e.g., treated plasma, serum, whole blood, etc.) obtained by bringing the above-mentioned immunoadsorbent into contact with the body fluid. It is also possible to keep it. Such therapeutic compositions are administered intravenously, as described above. The amount of SPA active fragment contained in the immunoadsorbent used for treatment varies depending on the degree of the disease, etc.5, but is usually 0.1 to long per 1 kg of the patient's body weight. The treatment is repeated once or every few days (for example, about 10 times) depending on the severity of the disease. With such treatment, if the tumor is malignant, necrosis or shrinkage of the tumor tissue is observed.

According to the present invention, malignant RrJ. Effective treatments can be provided for cancers and autoimmune diseases. The SPA active fragment used has approximately 3.5 times the Ig binding ability per weight compared to SPA itself. Excellent effects can be obtained even with a small amount of support. Furthermore, the molecular weight of the SPA active fragment is as small as approximately 7,000. Traditional SPA
Almost no allergic reactions occur when using adsorbents that carry . Therefore. It is possible to safely perform treatment using the immunoadsorbent and composition of the present invention.

(Example) The invention will be explained below with reference to examples.

Purified SPA active fragments were prepared as follows according to the method for producing SPA-like substances described in JP-A-62-111688 (Preparation of SPA active fragment immobilization column).

The amino acid sequence of this SPA active fragment consists of the four polypeptide fragments A, B, and C of SP8.
and D, it is composed of a sequence corresponding to polypeptide fragment B, which is considered to have the strongest activity. The amino acid sequence of this polypeptide fragment B has cysteine (C) at the C-terminus and methionine (M
) was added to the following sequence: MADNKFNKEQ(INAFYEILIILPNL
NEEQRNGFIQSLκDDPSQSANLLAE
AKKLNDAQAPKC
(1)-2Here. The symbols that make up the above amino acid sequence are. Each has the following meaning: A: Alanine, D = Aspartic acid, E: Glutamic acid, F: Phenylalanine, G: Glycine, H:
histidine, I: isoleucine, K: lysine, L: leucine, M: methionine, N: asparagine, P: proline, Q: glutamine. R: arginine. S: Serin, Y
: Tyrosine.

The following base sequence was designed as the nucleotide sequence encoding the above amino acid sequence (N-2: AATTCATG
GCTGACAACAAAAATTCAACAAGGAAC
AGCAG^^TGCTTTCTATGAAATCTT
GCATCTGCCTAACTTG88CGAAGAG
CAGCGTAACGGCTTCATCCAGTCCC
TT88GGACGACCCTAGCCCAATCCGC
TAACCTCCTCGCGGAGGCTAAGAAG
CTGAACGATGCTCAGGCTCCGAAGT
GCTAATAGG
(II) ``Here, the symbols constituting the above nucleotide sequence have the following meanings: A: adenine, G: guanine, C: cytosine, T: thymine.

Each fragment has 25 base sequences (13 upper strands ([1-013), 12 lower strands] as shown in Figure 1.
Each oligonucleotide consisting of this (Ll-L12) was synthesized by a solid phase method. As the condensation method, for example, a triester method or a phosphite method can be adopted. This time, the following triester method was used.

As a carrier for solid phase method. Polystyrene resin containing 1% divinylbenzene (Miyoshi K. et al.
Nucleic Acids Res. 8,5507
(1980)) or silica gel (MaLteucci
M. D. , Caruthers M. l+. , J
Am. Chem. Soc. , 103.3185 (
1981)) is preferred, and polystyrene resin was used in this example.

first. Four types of deoxyribonucleotides. That is,
Deoxycytidine, deoxyadenosine, deoxyguanosine, and deoxythymidine were each made into 3°-succinate esters by a conventional method (Broka C. et al.
l. , Nucleic Acids Res.
8.5461 (1980)) bonded to the amino group of the above-mentioned carrier (nucleoside carrier) was used at the 3'' end of the oligonucleotide.Next, the desired nucleoside carrier was attached to these 3'' end nucleoside carriers. Nucleotides were sequentially bonded in the 5' direction using a condensing agent.The condensing agents included mesitylenesulfonyl-3-nitrotriazolide (?ISNT), 2, 4.6-triisobrobylbenzenesulfonyl-3- Suitable examples include nitrotriazolide (TPSNT), mesitylenesulfonyltetrazolide (MSTe), and 24.61-lyisopropylbenzenesulfonyltetrazolide (TPSTe).

Sixteen types of dinucleotides are required to be used in the above method, depending on the permutation of the four types of nucleosides. The synthesis method can be, for example, the method shown in FIG.

In FIG. 3, DMTr is 4'.

4"-dimethoxytrityl group. B and B' are 6
-N-benzoyladenine-9-yl group, 4N-hendiylcytosin-1-yl group, 2-N iso-butyrylguanine-9-yl group and thymine-1-yl group, and are the same may be different. M.S.
NT represents mesitylenesulfonyl-3-nitrotriazolide.

This method was applied to oligonucleotide Lll (5'CTTC
GGAGCCTGAGCATCGTT3°) will be specifically explained using an example. First, a deoxycytidine carrier (deoxycytidine supported on a polystyrene resin carrier) was allowed to stand in pyridine at room temperature and then reacted by the following operation.

(1) Wash the deoxycytidine carrier with dichloromethane-methanol.

(2) After adding 2% Hensensulfonic acid (dichloromethane methanol) solution, wash with the same solvent.

Repeat the operation until the color stops appearing.

(3) After washing with pyridine, a dinucleotide solution in pyridine is added, the solvent is distilled off under reduced pressure, a pyridine solution of mesitylenesulfonyl-3-nitrotriazolide (condensing agent) is added, and the mixture is left to stand, followed by washing with pyridine.

(4) Add 0.1M dimethylaminopyridine solution and acetic anhydride, leave to stand, and then wash with pyridine.

After repeating this operation 10 times for each dinucleotide, the resulting resin was treated with 0.5 M trimethylsilylguanidium-pyridine-2-aldoximate (Reere C, B, et al., Tet
rahedron Lett, 2727 (1978
)) in a dioxane-water solution. Furthermore, this resin was washed with pyridine water, the filtrate and washing liquid were combined and concentrated under reduced pressure, concentrated ammonia water was added to the residue, and the mixture was heated.

Ammonia was distilled off, a pyridinyl type 12 resin such as Dowex 50 was added, the resin was washed with pyridine-water, and the filtrate and washings were combined and concentrated. A small amount of water was added to the concentrated solution, and the oxime was extracted and removed with ethyl acetate. The aqueous layer was diluted to a certain amount, and a portion thereof was used to quantify dimethoxymethyltrityl groups to estimate the total amount.

Next, the aqueous layer was dried under reduced pressure, 80% acetic acid was added to the residue, the solvent was distilled off, the residue was dissolved in water and ethyl acetate, and the aqueous layer was concentrated.
Ion-exchange chromatography was performed using a method such as earl).

Elute with a phosphate gradient in an appropriate buffer.

U, ν, after detecting the oligonucleotide by absorption.

Desalting was performed by Sephadex G-25 column chromatography. IIPLC (high performance liquid chromatography:
Purity was determined by homochromatography (Cz+ silica gel support) and -dimensional homochromatography.

By performing the same operation, 111-013, Ll-L
Oligonucleotides ll and L12 were synthesized.

: SF4 live fragment code Unteiha 9j
Basically, the sequence analysis of each oligonucleotide obtained in the (+) section was carried out by two-dimensional homochromatography.
This was done by the method of Hambara et al. (Bambara,
J.E., et al., Nucleic
Ac1ds Res, + 1 + 331 (197
4)). An example of the results of two-dimensional homochromatography of oligonucleotide Lll is shown in FIG.

The oligodeoxyribonucleotide fragments whose nucleotide sequences were confirmed in Section (2) were ligated using T4 DNA nogase according to the following method according to FIG.

First, for each fragment other than ul and L12, its 5'
The -OH termini were each phosphorylated separately with T4 polynucleotide kinase as follows.

1 nmol of DN 8-heligomeric fragment was combined with 1 unit of T4 polynucleotide kinase and (r-”p) ATP.
(7400Ci/mM) 20 u Ci and all! 1t
lOμffi 50mM) Lis-HCl buffer (pH 8,
0), lomM MgCh, 10mM dithiothreitol (DTT) for 30 minutes at 37°C.

Next, in order to phosphorylate all 5''-〇〇 ends, ATP was added to the reaction solution in an amount of 50 nmol, and 37
The reaction was further allowed to proceed at 1 hour at 90°C, and then the reaction was stopped by heating at 90°C for 5 minutes. The execution of phosphorylation.

-Dimension homochromatography was followed by radioautography. The 5''-011 end of the (2) and L12 fragments was not phosphorylated to prevent binding at the 5'' end sticky site (EcoRI and Bamll) from the gene of interest during the primary ligation reaction.

The thus obtained phosphorylated oligonucleotides U2-013, Ll-Lll and non-phosphorylated oligonucleotide 11. L12 was ligated using T4 DNA ligase according to FIG. First, the genes corresponding to the SP^ active fragments (01-[113 and Ll-L12) were divided into appropriate groups, for example, the following three groups, and the following ligation reaction was performed. (Figure 5).

Group 1, Group 2, Group 3 (blank below) 5 μP each of the oligonucleotides obtained under the above conditions (
0.5 nmol), add ligase buffer, 70 mM Tris-HCl buffer (pH 7.5),
7mM MgC1z, 10mM DTT, 70u
The mixture was prepared 8 times in M ATP, the total volume was adjusted to 50 μl using 2 units of T4 DNA ligase, and the ligation reaction was performed by incubating overnight at 15°C. After heating the reaction solution at 65°C for 5 minutes to stop the reaction.

It was precipitated with ethanol and purified by gel electrophoresis.

The obtained fragments of groups 1 to 3 were ligated using ligase in the same manner as above to obtain a structural gene (196ffi nucleotides) encoding the SPA active fragment.
I got it. Yield is about 50 pmo+, yield is about 10%
Met.

A plasmid hector containing the promoter and β-galactosidase region of the λplac5 DNA lactose operon for incorporating the gene encoding the SPA active fragment of the niblasmid vector was constructed as follows.

pBR322DNA O, 5pg and λplac
5 DNA 1. 100 ug of 30ul each
) Liss hydrochloric acid mild iJi solution (pH 7,3) 5 mM
MgCh and 50mM NaCl? 37 using 4 units of restriction endonuclease EcoRI in iJ solution.
Digested for 60 minutes at °C. The enzymes were inactivated by heating the reactions at 65°C for 30 minutes, and 2.5 volumes of ethanol was added to each reaction to precipitate the DNA. Add each precipitate to T4DN^ligase buffer [20ff 1M Tris-HCl buffer (PI+7.6) 10mM MgC1z] 20u
After dissolving each lysate in 100ml, each solution was mixed and ATP and DTT were added to a final concentration of 0.4mM.

Add to 10mM, T, DNA ligase 2
The unit was reacted for 20 hours at 14°C. then 2
．． DNA was precipitated by adding 5 times the volume of ethanol, and the resulting DNA precipitate was added to 100 mM Tris-HCl buffer (
pH7,3) 50mM NaCl, 5mM MgCl
After dissolving in 102 μf of a solution consisting of 2, 10 μf of the solution
E, coli K-12 strain 118 IOI
was used for transformation (Note). Transformation was performed using [MB lactose medium (8 g polypeptone, 1.0 g yeast extract, N
aC15g, KzlIPO42.5g, Eosin 360
Colonies with a deep metallic color were selected by culturing on 10,100 mg of methylene blue, 10 g of lactose, and 10,100 O of water. Plasmid DNA was isolated from these colonies and the orientation of the promoter and β-galactosidase region was examined. That is, approximately 0.5μg
The plasmid DNA was dissolved in 11011I Tris-HCl buffer (
pH 7,0).

The DNA was dissolved in 20ul of an aqueous solution containing 50mM NaCl and 10+nM MgCh, and 5 units of the restriction enzyme old ndul was added to digest the DNA. The obtained DNA fragment is
．． The orientation of the λplac5 promoter and β-galactosidase region inserted into the EcoR1 site of the pBR322 plasmid was investigated by analysis using 7% agarose gel electrophoresis. As a result, those in which transcription of the β-galactosidase region proceeds in the desired direction, that is, in the direction of inheriting tetracycline resistance, were used in subsequent experiments.

(Note) Transformation method ξ vomiting strain of L-pros (polypeptone 10g.

Yeast extract 5g, NaC 15g, glycose 5g
and water 1000IIIL, pH 7,2) and ODa at 37°C. . = 0.7, 0
Bacteria were collected by centrifugation at 6,000 rpm for 10 minutes at °C. The bacterial cells were suspended in 30 ml of 0.1 M MgCIz and further centrifuged for 10 minutes at 6.00 rpm at O''C.The collected bacterial cells were suspended in 15 ml of 0.1 M CaCl and left in water for 1 hour. , 6 at 0°C
,000rpm.

Centrifuge for 10 minutes and remove the microbial cells to 0.0%. IM CaC
It was suspended in 1.5 ml of Iz. An appropriate amount of DNA was added to 0.2 ml of this CaCIz-treated bacterial cell suspension.
Reaction buffer (100mM Tris-HCl, 50mM N
aC1, 5mM MgCIz, pH7,3) 100μ
m was added and left at 0°C for 60 minutes. This CaC1z
0.3all of the mixture containing treated bacterial cells and DNA was added to 2.5ml of the above 1□-pros, and cultured with shaking at 37°C for 90 minutes. The obtained culture was diluted and pre-coated on a selective medium, and cultured at 37°C for 1 day to obtain transformed colonies. The selection medium was L-pros nutrient agar 1.5% with ampicillin and tetracycline at a final concentration of 40% each, unless otherwise specified.
ug/ml and 10 ug/rtrl were used. Ampicillin-resistant strains and tetracycline-resistant strains were selected using this selection medium.

Since the plasmid obtained by the above method had two EcoRI cleavage sites, the site close to the β-galactosidase promoter was removed as follows.

Add 10ug of plasmid DNA to restriction enzyme EcoRI 1
．． After partial digestion using 6 units, one reaction solution was subjected to 0.7% agarose gel electrophoresis to separate partially digested DNA fragments. DNA fragments were confirmed by staining with ethidium furomite (0.5 gg/Id). Is the desired DNA fragment extracted from the gel by electrophoresis? 8
Then, ethidium bromide was extracted and removed using phenol. The desired DNA fragment was obtained as a precipitate from the aqueous phase using an ethanol precipitation method.

Add T to this DNA precipitate, DNA polymerase buffer [1
00mM) Lis-HCl buffer (pl+8.8), 10+w
M MgC1z, 25mM (NH4) zS04,11
01I EDTA 25. 40μ2 of bovine serum albumin (Oug/m”) was added and dissolved. Then, to this solution were added dATP, dTTP, dCTP, dGT.
P, 5μ each from 4mM solution! Forever, 100
After adding 5 μl of mM β-mercaptoethanol, T
Add 4 l units of DNA polymerase for 30 minutes at 37"C.
Allowed to react for minutes. Next.

The reaction solution was heated at 65°C for 10 minutes, and 2.5 times the volume of ethanol was added to precipitate the DNA. Obtained DN
A, precipitate, DNA ligase buffer (20mM), Lis-HCl buffer (pH 7,6), 10mM MgC1z
) ATP dissolved in 40ul.

DTT was added to a final concentration of 0.4 mM and 10 mM, respectively, and 2 units of Ta DNA ligase was added.
The reaction was carried out at 4°C for 20 hours. After precipitating the DNA with ethanol, it was used to transform 112 strain 11B (Ol) into -C9Li-. 10 μl of tetracycline
/ml was cultured on a nutrient agar medium to obtain 1ltff of tetracycline-resistant colonies.

Plasmid DNA was isolated from the colonies that appeared.

After digestion with the restriction enzymes EcoRT and Hindnl, the size of the resulting DNA fragment is examined by agarose gel electrophoresis to determine which of the two EcoR1 sites in the fragment has been lost. I was able to do that. As a result, the desired EcoR1 site, namely β
-EcoR1 close to the galactosidase promoter
A plasmid in which it was confirmed that one site had been deleted was used as a plasmid vector for cloning a gene encoding a SPA active fragment.

This plasmid vector contains EcoRI and Bam1l
Each has one restriction enzyme cleavage site. Therefore, genes with sticky ends of EcoRT and Bam obtained by chemical synthesis or from plasmids can be easily introduced into this plasmid vector using a ligation reaction. Furthermore, with this recombinant plasmid, E.
When E. coli is transformed with IBIOI, the desired clone can be easily obtained by selecting colonies that are Apr and Tc'.

A recombinant plasmid in which the DNA sequence encoding the SPA active fragment obtained in section (3) was incorporated into the plasmid vector obtained in section (4) was constructed as follows (see Figure 6).

First, 1.0 μg of the DNA encoding the SPA active fragment obtained in section (3) was added to 23 μg of a solution consisting of 20 mM Tris-HCl buffer (pH, 7,6) and 10 mM MgCIz. After heating at 95°C for 2 minutes in a tube and cooling in ice water, 1.2 nmol of ATP, 5 units of T4 polynucleotide kinase, and 10 mM of DTT were added.
The reaction was carried out at 7°C for 20 minutes to phosphorylate the 5°-011 end of the DNA. One reaction was reheated at 95°C for 2 minutes to phosphorylate all 5''-011 ends.

After cooling in water, 100mM in 1/10 volume of 1 reaction solution volume
Add DTT and 5 units of T4 polynucleotide kinase and incubate for 20 minutes at 37"C.
After heating at °C for 2 minutes, the mixture was slowly returned to room temperature.

Next, the plasmid vector DNA obtained in section (4) 5
μg was completely digested using 10 units each of restriction enzymes EcoRI and BamHI, and the resulting product was separated by 0.7% agarose gel electrophoresis, and large ON^ fragments were recovered by electrophoresis.

EcoRI/ of the plasmid vector thus obtained
1 μg of BamHT fragment oNA and the previously obtained 5°-OH
25 ng of DNA encoding a terminally phosphorylated SPA active fragment was added to 20 mM Tris-HCl buffer (p
H7,6), 10mM MgCh, 10mM DTT
, dissolved in 30 με of a solution consisting of 0.4 mM ATP and incubated at 5 °C using 1 unit of T, DNA ligase.
The reaction was allowed to proceed for 6 hours. Twice the volume of ethanol was added to the reaction solution to obtain one recombinant plasmid DNA as a precipitate.

The precipitate of recombinant plasmid DNA obtained in section (5) was
00mM Tris-HCl buffer (pH 7,6), 6mM
Consists of MgCl2, 66mM NaCl? 8 liquid 100
To μg? I made them understand 8.

On the other hand, a fresh overnight culture of 112 strains of 11 BIOI was diluted into L-broth 1:100 and cultured with shaking at 37°C. . . -0,1-0,15. Collect the bacterial cells into a pellet (500 ml for 5 minutes at 5°C using an RPRW90-ter of a Hitachi CR26+1 centrifuge)
(by centrifugation at 0 rpm), half the original volume of water-cooled 50mM
MgC1,; 10mM NaCzH+Oz+ pH5
, 6 and left at O'C for 20 minutes. Collect into pellets in the same manner as above, and add ice-cold 100mM
gC1z; 75mM CaC1z; 10mM
NaCzHzOz.

Resuspend in pl+5.6.

In this way, CaC1, treated E. coli
K-12 strain 118101 and previously obtained recombinant plasmid D
After mixing with the NA solution at O″C (total amount 200μi),
After leaving at 0°C for 10 minutes, heat shock at 42°C for 1 minute, and then leaving at 25°C for 20 minutes.
1-L-broth (1% Bacto-tryptone
, 0.5% yeast extract.

1% NaCl) was added and shaken for 1 hour. This solution was inoculated onto 1.5% agar broth containing 50 μg/all ampicillin and incubated overnight at 37°C. A transformation efficiency of 8XIO5 colonies/μg DNA was consistently observed.

The transformed strain obtained by the above method is ampicillin 40
Cultured overnight at 37°C on nutrient agar medium containing μg/ml and 0.5% glucose, and the resulting colonies were divided into 15μ
Colonies of TcS were replicated onto a nutrient agar medium containing g/ml of tetracycline. 85 out of 100 4pr colonies were Tc''.

: To plasmid ON, add a culture solution containing 10 μg/ml of ampicillin and precultured overnight in broth to 1% to 9 medium, and incubate in a rotary incubator (25 or
pm) at 37°C until 0D600 reached 0.6. Then 25% of chloramphenicol
0/1 was added, and the culture solution was further shaken at 37°C overnight to continue culturing. The bacterial cells were centrifuged (5, OOOrpm10
The pellet was washed with water-cooled TE buffer and centrifuged again (5.000 rpm, 10 minutes, 4°C, 8 Hitachi CR26H).
R26H).

The pellet was cooled with water and mixed with lysis buffer (20mM Tris-HCl buffer (pl+8.0), 2mM EDTA).
, suspend in 20d of 25% water, add 20m to this
2 g/d of lysozyme was added and the cells were lysed for 10 minutes under water cooling. Next, add 1 ml of 500mMEDTA,
After standing for 10 minutes, add 1 In of 1% Triton X-100.
1 was added, and the bacteria were further lysed for 1 hour under water cooling. The lysate was ultracentrifuged at 40,000 rpm for 1 hour at 4°C, and the supernatant was decanted into a graduated cylinder. Ethidium bromide 100ug 7
mM and CsC12 were added at 0.95 g to 7 mM, and the mixture was ultracentrifuged at 25°C and 40,000 rpm for 16 hours to collect the plasmid fraction. Ethidium bromide was removed by extraction with isoamyl alcohol three times. The plasmid was recovered by dialysis against T buffer and ethanol precipitation.

(8: DN8) The DNA sequence was determined using the method of Maxam-Gilbert et al. (M
axam, A.M., et al., Proc.N.
atl, acad, sci.

11, S. A., 74.560 (1977)).

First, some Aρ' and Tc' colonies were arbitrarily selected, and the plasmid DNA obtained from them was transformed into EcoR.
The smaller...P produced by digestion with I and Bamtll
By examining the size and base sequence of the I/BamHI DNA fragments, it was found that all of the tested fragments matched the DNA encoding the SP^ active fragment.

The resulting transformed strain, which retains the gene encoding the SPAP fragment, was transformed into E. coli K125P.
It was named A-Fc.

E,co dan 12 harboring a recombinant plasmid into which DNA encoding the SP octopartite active fragment has been integrated.
5PA-Fc, excluding glucose, 50gg 7m
5X10' cells/in L-broth containing ampicillin of M.
It was grown to ml. Next, isopropyl β-lowthiogalactopyranoside ([PTG) was added to 1 mM, and proliferation was continued for an additional 2 hours. Centrifugation (5
, 00 Orpm for 10 min at 4'C), the resulting bacterial cells were suspended in 70% formic acid containing 5 mg/ml cyanogen bromide and 0.1 M mercaptoethanol, and left in the dark at room temperature for 24 h. did.

After freeze-drying the reaction solution, 251mM phosphate buffer (pH
7,0) to dissolve the residue, and this solution was diluted to 10mM
25mM phosphate buffer containing mercaptoethanol (
Dialyzed against pH 7.0). The resulting solution was IgG
- Added to a Sepharose column (20 ml of Betupolyneem per 1 ml of protein) and added the column to Ih&. 0 until no more protein flows out of the column when measured at
．． Washed with 1M phosphate buffer (ρ) 17.0).

SPAP fragments were eluted with 0.1M glycine-hydrochloric acid buffer. The recovered protein was precipitated and concentrated with 80% saturated ammonium sulfate, dialyzed against 10 mM phosphate buffer (pH 7.0) containing 10 mM mercaptoethanol, and then lyophilized.

Table 1 shows the yield of the SPAP fragment obtained from E. codan K125PA-Fc at each purification step. Calculating from this result, ξ coli K125P
It can be seen that A-Pc produces at least 3×10 5 molecules of SPAP fragments per cell.

(Margins below) The obtained SP octahedral fragment has a molecular weight (approximately 7
．． 000), the analysis of the IgG binding ability, amino acid composition, and amino acid sequence in mouse serum all showed data that were in direct agreement with the theoretical values.

・(10): SP8 Fragment tllll of Column I + SPA active fragment immobilized column I was prepared using the SPA active fragment purified product thus obtained. First, freeze-dried powder CNB
15 g of r-linked Sepharose CL-4B was swollen for 1 hour using 200 g of In+M hydrochloric acid. activated CN
Br Sepharose CL-48 was added to coupling buffer (0.5 M
NaCl, 0.1M sodium bicarbonate) at 4°C.
The SP obtained in the above (9) was added to this suspension overnight.
A active fragment was ligated. CNBr-bound Sepharose CL- to which no SPA active fragment was bound
To remove the remaining active groups on 4B, 100 d of 1M ethanolamine was added and treated for 4 hours. This gel was then soaked in 500 mj of coupling buffer! and 0.5M
001M acetate buffer (pH 4.0) containing NaCl
) A SPA active fragment-immobilized inert carrier was prepared by washing with 500 tails. This SPA
10 ml of active fragment immobilized inert support (SP
Approximately 10 A-active active fragments were used to prepare SPA active fragment-immobilized column I.

(11): SPA active fragment immobilization column ■ was prepared using the purified St”A active fragment obtained in section (9) of SPA fragment column H. First, 10 g of lyophilized powder of Thiol Sepharose 48 was diluted with 10 mM Phosphate buffer (pH 5.0) 2
00ml was used to swell for 1 hour. Activated thiol Sepharose 4B was added to coupling buffer (0.5 M NaCl) containing 20 mg of SPA active fragment.
．． Suspended in 0.1 M sodium bicarbonate) at 4°C overnight.

The SPA active fragment obtained in section (9) above was conjugated. This gel was then soaked in coupling buffer 500%
0.1 containing tnl and 0.5 M NaCl
M acetate buffer (p) 14.0) 500m! Prepare a SPA active fragment-immobilized inert carrier by washing with water, and use 5 mf (approximately 2.5 μ of SPA active fragments bound) of this SPA active fragment-immobilized inert carrier to apply a SPA active fragment-immobilized column. Created.

Tip I (Treatment using perfusion method) Approximately 5 x 10' tumor cells (VX2) were each implanted into the dorsal skin of two domestic rabbits (New Zealand White) to generate tumors. Example 1 10 days after tumor cell transplantation
As shown in Figure 7, using the SPA active fragment-immobilized column 1 prepared in 1, the SP 8 active fragment-immobilized column I6 was connected to one rabbit via tube 1 to allow extracorporeal perfusion of blood. I went for an hour. Blood from the femoral vein of the rabbit 10 reaches the plasma separation membrane 4 via the pump 3, and the plasma obtained by separation by the separation membrane 4 is supplied via the pump 5 to the SPA active fragment immobilization column 6. Ru.

The plasma that has passed through the column 6 is combined with the solid components of the blood separated by the plasma separation membrane 4 to become whole blood and injected into the femoral vein of the rabbit. The blood flow rate was 5 tul/l1in, and the rabbits were pre-treated with 5 tul/l1in of heparin to prevent blood coagulation.
00U was injected into the auricular vein. In addition, heparin was added to IO
It was administered to the perfusion system at a rate of U/min at position 2 and neutralized by adding protamine at position 7 just before blood was returned to the rabbit. When the state of the tumor was observed after 20 days, it was clear that the tumors in the rabbits that received blood perfusion were significantly smaller than the tumors in rabbits that did not receive blood perfusion.

Implementation ±1 (Batch Processing Method) N-methyl-N-nitrosourea was administered to female SD rats by tail vein injection at a rate of 3.0 μm per 100 g of body weight, and mammary adenocarcinoma was obtained 3 months later. Blood was collected from the tail vein of this rat I, and plasma 1#l12 was separated and obtained. About 1 II dl of this plasma was poured into a column prepared using 1.5 ml of the SPA active fragment-immobilized inert carrier obtained in Section (10) of Example 1, and 1.5 ml of non-adsorbed plasma was added. r
I got dl. This therapeutic composition was administered into the tail vein of the rats. This treatment was performed once a week for 4 weeks. As a result, the tumor was observed to gradually shrink.

7JJ Neurosurgery (Treatment by perfusion method using SPA active fragment immobilization column)
A activity using an active fragment immobilized column.

Treatment by perfusion method was performed in the same manner as in Example 2.

When the state of the tumor was observed after 20 days, it was found that, similar to the results of Example 2, the tumors in the rabbits that received blood perfusion were significantly smaller than those in the rabbits that did not receive blood perfusion. It was obvious.

Treatment using the perfusion method using the SI'A active fragment immobilized column in Example 2 was carried out on 7 domestic rabbits with 5 different types of solid tumors. Treatment is to increase the flow rate of blood perfusion to 2~
This was performed by extracorporeal perfusion for 1 hour at a flow rate of 10 l/min.

When the state of the tumor was observed after 3 days, necrosis and shrinkage of the tumor tissue were observed in all treated rabbits, indicating that this treatment is effective against various solid cancers. The results are summarized in Table 2.

(Leaving space below) Table 2 Breast cancer Breast cancer Breast cancer Fibrosarcoma Fibrosarcoma Angiosarcoma Angiosarcoma +: Mild, ++: Moderate, +++: Severe (effects of the invention) Seven therapeutically effective immunoadsorbent compositions and therapeutic methods using the same are provided. The SPA active fragment used in this immunoadsorbent is obtained by genetic recombination technology and has a high ability to bind Ig per unit weight. Therefore, even if the supported amount is small, a sufficient therapeutic effect can be obtained and treatment can be performed at low cost.

The SPA active fragment used in the present invention is produced in Escherichia coli using genetic recombination technology.
It does not contain allergic components thought to be derived from microorganisms (staphylococci) in which PA is contained, and has a much lower molecular weight and higher purity than SPA, so allergic reactions hardly occur.

Figure 1 shows oligonucleotides (13 upper strands (01-013)) used when chemically synthesizing the SP^ active fragment gene used in the present invention.

A sequence diagram showing the base sequence of the 12 lower strands (Ll-L12); Figure 2 is a sequence diagram showing the base sequence of the double-stranded polynucleotide containing the gene of the SPA active fragment used in the present invention; Figure 3 is a sequence diagram showing the base sequence of the double-stranded polynucleotide containing the gene of the SPA active fragment used in the present invention; An explanatory diagram showing an example of a synthesis reaction of dinucleotides used for oligonucleotide synthesis;
Figure 4 is an electrophoresis diagram showing the results of two-dimensional homochromatography of oligonucleotide Lll; Figure 5 is an explanatory diagram showing how to combine each oligonucleotide to obtain a structural gene encoding an SPA active fragment; Figure 6 is SP
An explanatory diagram showing the construction of a recombinant plasmid having the gene of the A active fragment; Fig. 7 is an explanatory diagram showing the treatment of malignant tumors by perfusing blood from the body of a rabbit through the immunoadsorbent used in the present invention. .

4... Plasma separation membrane, 6... SPA active fragment immobilized column, 10... Domestic rabbit.

that's all

Claims (1)

[Scope of Claims] 1. Staphylococcus aureus Scowan I strain (\Staphylococcus\\aur
Genetic recombination technology produces a polypeptide in which cysteine is added to the N-terminus or C-terminus of a polypeptide fragment that constitutes an Fc-binding region that can bind to the Fc region of immunoglobulin (Ig) of protein A derived from Eus\Cowan I). An immunoadsorbent for the treatment of malignant tumors, etc., produced by and covalently or non-covalently supported on an inert carrier. 2. A step of bringing plasma, serum, or whole blood from a living body into contact with the immunoadsorbent according to claim 1; A method for treating malignant tumors, etc., comprising: a step of injecting into the body; 3. Processed plasma, serum, or whole blood obtained by contacting the immunoadsorbent described in claim 1 with treated plasma, serum, or whole blood, or treatment with malignant tumors, etc., whose main component is plasma, serum, or whole blood. Therapeutic composition.