JPH01502076A - Cloned Streptococcal Genes Encoding Protein G and Applications for Construction of Recombinant Microorganisms to Produce Protein G - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] For constructing A. microorganisms to produce coccoid genes and protein G. Purpose Technical field This invention is based on the cloning of a gene that controls the biosynthesis of protein G in streptococci. of the cloned gene and the protein of the organism transformed with this cloned gene. The present invention relates to uses for producing protein G and protein G-like polypeptides.

Recently, molecules that bind to antibodies by non-immune mechanisms. bacterial F, receptor Interest in is increasing. This binding occurs due to the presence of antibodies located in the Fab portion of the antibody molecule. F, which is not directed against the original recognition site, but against the F portion of the antibody; This region is common to many types of antibodies.

Bacterial Fc receptors can therefore bind many types of antibodies. this sex This quality makes the bacterial F receptor useful in many immunochemical applications.

Bacterial F, receptors are mainly used for antibody detection, antibody purification and disease treatment. It has many useful or potentially useful uses. Antibody detection is biprid - Whether the macro clone secretes specific monoclonal antibodies or not. Antigen screening, measurement of immune responses in immunized animals and competitive binding analysis quantitative inclusion. Necessary in several aspects of laboratory research in immunology. Become. The method for detecting antibodies using bacterial Fc receptors is different from other detection methods. It has been found that the sensors are also highly sensitive and resistant to interference and high background signals. (Boyle, M. D. P., Biotechniques 2:334-: 140 (1984)).

Fe receptors also. Used for purification of protein drugs or used as medicine Useful for antibody purification. Many methods are known, but the common method is immobilization Application of affinity chromatography on bacterial Fe receptor columns . This method allows columns to be reused many times, reducing purification costs. It is preferable because it can be used.

Many potential uses of bacterial Fe receptors are currently being investigated. They are, Plasma was processed by flowing plasma over an immobilized Fe receptor column in vitro. 0, which includes putting Ma back into the body, such as Tenan D. Nis et al., N. See Eng-J, Med, 305:1195-1200 (1981). and.

The best known bacterial Fc receptor binds to the Fe region of immunoglobulin G. , Staphylococcus aureus This is Ting A. Other bacterial FCs have also been identified. One of these is It is known as protein G of group G Strephbutococcus. proty protein G is similar to protein A, but protein G has several important advantages. For example, protein G binds to all human IgG subclasses, but only one On the other hand, protein A is specific for the 1gG3 subclass; does not cross-react with IgA or 1gM type antibodies (Maile EB and Clone Bar Gee, “Immunoglobulin 5 specifics” of Defined Types of 5treptococcal Ig Receptors''■n: edited by Red Book Limited, Chartsy , Surrey; pp. 209-210 (1983)), and Proti Protein A binds to certain animal IgGs to which protein A binds weakly or not at all. Join. These include bovine, ovine and goat IgG and some equine IgG. (Reis K. J. et al., supra), protein G Ta. in binding to several subclasses of murine monoclonal antibodies. It has been found to be superior to protein A (Bjok-El and Clos Nbar G, J. Immunol, 133: 969-974 (1 984)).

For these reasons, protein G is a bacterial Fc receptor of choice for a variety of applications. It is likely to become a puta.

Currently, protein G has been purified from the streptococcal strains that naturally produce it. Therefore, for example, Streptococcus spp. Cells are treated with proteolytic enzymes (e.g. papain or trypsin) to protease the cells. Protein G (which is a cell wall protein) is solubilized and then a known protein is added. Purification operations (e.g. ion exchange chromatography, gel filtration and affinity Protein G is further purified by chromatography (European patent application, publication). Opening number 0131142).

Given the advantages and potential uses of protein G, this protein It is desirable to produce this using recombinant DNA methods. Therefore, the purpose of this invention is The gene encoding protein G was cloned, and this cloned gene was used to By transforming a fungal host and culturing it under protein G-producing conditions. It is to produce protein G.

Disclosure of invention This expression encodes the Fe receptor, which has the IgG binding properties of protein G. Provides a cloned gene. This gene is Streptococcus Sp. Lancefield Fist Glove G (Streptococcus Sp+*La ncefield Group G) strain, and the cloning vector A prokaryote stably transformed by a recombinant vector inserted into cells have been disclosed. One transformed strain has protein G properties. A first vector carrying a gene encoding a protein, and a first vector that does not contain this gene. Eryptic help for stably maintaining a vector in a host strain Other transformed strains contain a second vector that acts as a par plasmid. So that you don't need the Luper plasmid.

A modified vector containing a DNA insert containing the gene encoding protein G protein has a vector. The transformed strain is cultured under protein G producing conditions.

The invention also provides the nucleotide and amino acid sequences of the active binding site of this molecule. One gene cloned by the inventor provides the identification of two activities. It has parts. The second cloned gene has three active sites.

The invention further provides for the production of protein G-like polypeptides using recombinant Victor. I will provide a. Protein G-like polypeptides enhance the IgG-binding properties of protein G. It contains one or more amino acid sequences shown below.

Brief description of the drawing Figure 1 shows a sample used to clone a DNA insert encoding protein G. Figure 2 shows the salient features of plasmid pGX1066, a suitable vector.

Figure 2 shows a recombinant plasmid vector containing a DNA fragment encoding protein G. A partial restriction enzyme map of plasmid pGX4533 is shown.

Figure 3 shows the DNA sequence of the protein G gene and the amino acids encoded by the gene. The amino acid sequence is shown.

Figure 4 shows the restriction of the cloned protein G gene, M map and IgG binding. The repeating structure of the protein product responsible for the synthesis is shown.

Figure 5 shows a bacteriophage vector containing a protein G-encoding fragment. A partial restriction enzyme map of GX4S47 is shown.

Figure 6 shows all the structures between Bl and B2 from the end containing two complete copies of the B structure. The amino acid sequence of each bacteriophage ■GX7880 partial restriction enzyme site Show the diagram.

Figure 7 shows transformation of Bacillus subtilis containing a protein G-encoding fragment. Plasmid pGX458, a recombinant plasmid vector used to The restriction enzyme map of No. 2 is shown.

Figure 8 shows the cloned protein G gene derived from Streptococcus. Positions of active sites Bl and B2 on protein G encoded by the genes shows.

Figure 9 shows the cloned protein G gene derived from Streptococcus. Showing the DNA and amino acid sequences of the gene, this gene contains three active sites Codes protein G.

Figure 1O shows protein G genes derived from GX805 and GX7809 strains. shows the relationship between repeating structures.

This invention relates to a cloned protein G gene. Protein G genetics The DNA fragment containing the offspring is Streptococcus sp., Lancefield glue. Streptococcus Sp, Lancefield Gro G) strain and inserted into a cloning vector. Others of this invention An aspect of the present invention is to use a recombinant vector containing the cloned protein G gene in a host cell. Transforming cells and culturing the transformed cells under protein-producing conditions. By causing cells to produce protein G. Regarding protein G production do.

Another aspect of this invention is that the number of protein G-binding sites per molecule is between 1 and 20. This invention relates to the production of protein G-like substances containing protein G. This protein G-like substance is It is expressed by the formula.

-(-B-b-)ゎ- Here, B is Bl shown in FIG. 9, or Bl and B shown as B2 or B3. 2, b is as shown in FIG. 8, and n is 1 It is between 20 and 20.

The term "hybrid array" refers to the parts of the array corresponding to B1 and B2. a DNA sequence or amino acid sequence comprising a protein G immunoglobulin Intended to maintain connectivity. Such a hybrid arrangement is shown in Figure 9. It is labeled B3. This hybrid sequence is the 245-282 sequence of B1. containing the portion of B1 corresponding to the amino acid sequence 298-314 of B2 fused with the sequence , therefore, all such molecules that retained the immunoglobulin binding properties of protein G Hybrid sequences are intended to fall within the scope of this invention.

The protein G gene has been cloned and purified in bacterial hosts such as E. coli and Bacillus subtilis. The method of the present invention for producing lotin G differs from the current methods for obtaining this protein. It has many advantages over methods. According to the method of this invention, relatively high concentration of fine particles can be obtained. Fungal protein G production can be obtained under conditions where the protein is more easily isolated. and the protein can be produced in a non-pathogenic host.

The cloned gene is inserted into various multicopy expression vectors and recombinantly developed. This valuable IgG-binding protein is present in cultured E. coli transformed with the current vector. can be obtained in increased concentration. Protein G was added to E. coli or Bacillus subtilis bacteria. What happens inside the cells is a common pathogenic strain of protein G-producing streptobacterium. It is preferred over culturing Coccus strains.

Furthermore, in order to release protein G from the cell wall of streptococcal cells, The proteolytic enzymes used, such as papain and trypsin, are Therefore, proteases from streptococcal cells may degrade G-products. Known methods for isolating protein G are known methods for isolating protein G in a low molecular weight degraded form It might happen.

In this invention, the first step in cloning the protein G gene is to The purpose of the present invention is to isolate a Streptococcus strain that produces Tin G. This is good Determine IgG binding activity for various bacterial strains using any suitable immunoassay technique. This can be done by reading. The method adopted by the applicant is as follows: The colony immunoassay method is described in detail in the Examples section of . IgG knot Regarding the strains found to have synthetic activity, next 1gG3 and unfractionated 1gG (unfractioned IgG) was investigated. Because 1gG3 This is because binding to protein G is a desirable property associated with protein G. 1 Hemagglutination analysis using red blood cells coated with gG3 or unfractionated 1gG ( (described in detail in the Examples below) is a convenient method for identifying protein G-producing bacterial strains. be. As a control, a known protein A-producing strain such as Aobu (1977)] was used as a control. Can be used. This is because protein A binds to unfractionated IgG, but 1g This is because it does not bind to G3.

Isolation of chromosomal DNA from strains found to produce protein G can be The strain is cultivated in nutrient medium to a cell density of Lysing the cells by any conventional chemical, mechanical and/or enzymatic method It is done by Conventional extraction and precipitation procedures isolate chromosomal DNA used for DNA fragments of an appropriate size for cloning can be obtained using ultrasound. by known mechanical methods such as disintegration or high-speed agitation in a brogue, or Partial digestion or specific sites with DNA5eI giving random fragments obtained by enzymatic methods such as restriction endonuclease cleavage.

The chromosomal DNA is then inserted into a cloning vector. Any suitable plastic Smids or bacteriophages can also be used. is a suitable vector In order to do so, it should have some useful properties. vector intends The vector should have an origin of replication that is functional in the bacterial host cell. Selectable markers (such as antibiotic resistance) that help identify host cells transformed with ). The vector can accept the inserted DNA fragment. and should still be able to successfully replicate.

Preferably, the vector is capable of inserting a DNA fragment without destroying its replication capacity. have one or more unique restriction endonuclease recognition positions that can There is.

A suitable loning vector is Lambda gtl1M13■p9 (Bethesda Research). Various phage M13 vectors, such as (commercially available from Search Laboratories) -, plasmids such as pBR322 and many others [01d andPr imrose, Pr1ciples of Gene Manipulat ion, 2nd.

Ed, Univ, of Calif, Press, pgs, 23- 35 and 46-47 (1981)]. The applicant has provided p as shown in Figure 1. The BR322-derived plasmid pGX1066 was used.

Streptococcal DNA is homopolymeric. eric tailing) or linker molecules (01d and Prim rose, supra, p. 92) into a cloning vector. It will be done. Linearize the vector with restriction endonucleases to remove the chromosomal DNA. straight Restriction endonuces that provide NA fragments that can be ligated to the ends of linearized vector molecules. Digestion with rease is advantageous. This is the streptococcus-induced DNA fragment. Cloning vectors are prepared in a standard reaction using T4 DNA ligase enzyme as follows: inserted into the vector.

Bacterial cells are transformed using standard methods with recombinant cloning vectors, Bacterial colonies are cloned to see if they are producing protein G. under The colony immunoassay and hemagglutination analysis described in the examples below are performed using protein This method is suitable for identifying recombinant strains that produce In-G. In Example I below As explained in detail, the first identified positive colony is unstable. This horn Purification, which involves re-streaking the lawn several times, produces stable protein G. A derivative of this resulting clone was obtained. This strain was named E. coli GX7820. did.

Plasmid DNA from this strain was isolated and subjected to restriction enzyme analysis and gel electrophoresis. I did this. This strain was found to contain two plasmids. pGX10 One plasmid, named 66X, is the 9GX1066 cloning vector. The other plasmid, which is approximately the same size and was named PGX4530, is pGX 1066 appears to contain an 11 kilobase pair (kbp) insert. applicant does not wish to be bound by any particular theory, but is illustrated in more detail in the Examples. As shown in pGX1066X, the ampicillin resistance gene is no longer intact. A derivative of pGX1066 that is no longer a “cryptic” The original transformant strain, which appears to be a "luper plasmid", is probably <pGX 1066 and pGX4530, and due to the presence of pGX1066 pGX4530 due to the lack of selection pressure based on ambicidin resistance conferred by The ampicillin resistance gene, which was probably unstable due to the loss of Once pGX1066X with an inactivating mutation is present, pGX4 Only host cells that harbored s30 (with an intact ampicillin resistance gene) can survive on ampicillin plates. Plasmid pGX1066X is retained in cells containing both plasmids. This is probably pGX10 This is probably because 66X acts to limit the number of copies of pGX4530 within cells. However, if only plasmid pGX4530 is present, the host dies (see Example I#). ), but the presence of pGX1066X allows the copy number of pGX45:10 in the host. suppressed to an acceptable extent. These plasmids belong to the same “incompatible group” , meaning that these plasmids are maintained in cells. compete with each other, so that each plasmid outgrows the other plasmids in the host cell. limit the number of copies. E. coli strain GX7820 from Rockville, Maryland. Deposited with the American Type Culture Collection, its accession number is 5. It is 3460.

E. B. strain was transformed with a mixture of plasmids isolated from strain GX7820. . The transformation yielded a large number of small strongly positive colonies, of which A few (about 20%) were similar to GX7820. These little positive colo from the original GX7820, without helper plasmid, Two stable mutants were isolated that showed stronger positivity for . GX7823 One strain, named It has a plasmid pGX4s33) in which a base pair (kbp) fragment has been deleted.

Large II @ GX7823 strain is American type from Rockville, Maryland. -Deposited with the Culture Collection, its accession number is 53461. G The other, named X7822, is a plasmid carried by strain GX7823. Insert the 3 kbp insert DNA into the original site very close to the end of the deletion site in the It had been acquired during the fragment. The protein G gene is a streptoblast of pGX4533. 1.9 kilobase pairs (kbp) on the coccal DNA insert. It was decided.

In order to increase the production level of protein G, the prodin G gene was cloned. 0 Expression vectors that allow genes to be inserted into a variety of expression vectors include Expression, that is, the transcription of DNA into mRNA and the genes that lead to it, The "regulatory region" containing the NA sequence is necessary for translation into the protein encoded by the gene. The protein G gene may contain its natural expression signals, including or remove these signals and create a cloned protein G gene. The structural part of the child (i.e., the protein-coding part of the gene) is Accordingly, the protein G gene can be controlled in the selected host organism. , can be operatively fused with other expression signals contained in the expression vector. 0 For example, if the host microorganism is E. coli, 1 the expression vector -/Operator, Promoter/Operator, Bacteriophage Lambda Contains known regulatory regions such as Pt, promoter/operator and many others. It's okay to stay there.

In one embodiment of this invention, the expression vector further comprises a chromosome of the host microorganism. This construction allows the vector to contain a DNA sequence similar to one region of the host infection. It becomes possible to linearly integrate into regions with color body homology. this One advantage of the method is that due to the favorable negative selection for vector-free cells, There is a low possibility that the protein G sequence will disappear from the host.

The transformed cell containing the cloned protein G gene is Therefore, the cells are cultured under conditions in which protein G is produced. Including large-scale fermentation operations Culture conditions are well known in the art. cells are physiologically compatible Assimilable carbon sources, nitrogen sources and essential culture in any suitable nutrient medium that supports cell growth, including essential minerals. be able to. The protein production culture conditions are the same as those used to transform host cells. For example, some expression vectors cells at a certain temperature to initiate expression and result in the production of protein G. or require proliferation.

Alternatively, it may require the addition of certain chemicals to the cell growth medium. Therefore, “ The term ``protein production conditions'' means that it is limited to any one culture condition. It is not used in

The cloned gene is first applied to the gene encoding protein A. No. 4,617,266 (1985 ) (which is incorporated into this specification in its entirety) It is more advantageous to transfer to Bacillus subtilis. According to these methods, protein G can be synthesized in Bacillus subtilis.

The functionally active portion of protein G is a modified form of the cloned protein. IgG binding activity of protein produced by E. coli strain carrying TinG gene By examining their properties, it was discovered that they exist in a repeating structure. follow Therefore, the present invention also provides a protein G that encodes one or more functionally active portions of protein G. cloned genes encoding protein G and immunoglobulin binding properties of protein G. have It also relates to proteins produced in this way. Protein G activity Identification and isolation of the gene encoding the site is described in detail in Example m below. . Two genes encoding the two and three active sites in protein G, respectively The DNA sequence and the amino acid sequence coated by it are shown in Figures 8 and 9. It is shown. This information allows proteins with multiple sites of protein G activity to be It has become possible to produce molecules similar to InG. Using known synthetic methods, one a synthetic gene encoding one to twenty or more active sites in the amino acid sequence of It is also possible to construct a child, thereby giving a higher binding efficiency and the resulting substance can improve their abilities. A preferred protein G analog is 1 to 10 More preferred materials have 1 to 5 active sites.

It also has the immunoglobulin-binding properties of protein G, and has amino acid deletions or Substituted or additional amino acids added to the amino or carboxyl terminus Also within the scope of this invention are proteins that are

To recover and purify protein G from host cells, any known protein Purification methods can also be used. If necessary, cells can be treated with known chemical and physical treatments. and/or can be lysed using enzymatic means.

Protein G was then published by Sujoquist in U.S. Patent No. 3,850,798. (1974), ion exchange or gel chromatography, precipitation (e.g. ammonium sulfate) or Can be purified from cell lysates using standard methods, such as a combination of methods. Ru.

The following examples are illustrative of this invention and are not intended to limit the scope of this invention. Not interpreted.

Example■ Cloning of Streptococcus G gene into E. coli Lancefield glue G. Streptococcus was obtained from a hospital and 11 independent isolates from clinical isolates. I got the stock. For each strain, use the following colony immunoassay method to We investigated the binding ability of The strain was transferred to a nitrocellulose sheet and (upper layer) an acetate cell. L-Broth agar pre-agar plate with loin sheets layered on top did. Plate until bacterial colonies are visible on the cellulose acetate sheet. The plates were incubated at 37°C.

Next, remove the nitrocellulose sheet from the plate and remove the IgG-binding binding protein. It was detected on the sheet using the following immunochemical method. First, the sheet was soaked with bovine serum a Lubumi: / (0,01M Tris-HCI, pH8,0 and 0.15M 3, Ow/v Zr) containing NaCl) in nitrous salt water). The rulose site is blocked and the antibody is applied to nitrocellulose in the following steps. Minimizes heterogeneous binding. Next, apply this sheet to normal rabbit serum (3w/ diluted 1:1000 in Tris saline containing v$ bovine serum albumin) at 23 °C. Treated for 1 hour, then treated with peroxidase-conjugated goat anti-rabbit IgG (same dilution). Finally, 4-chloro-1-naphthol (0.6 mg/■l) and water peroxide (0.06 w/v z Tris brine containing 0.2 volumes of methanol) The sheets were washed with Tris saline between incubation steps. nitrocellulose The blue spot on the sheet indicates the presence of IgG-binding protein, and the blue spot The regions correspond to bacterial colonies that produced IgG binding binding proteins.

Nine of the strains were found to be positive, ie binding to IgG. most of all The degree of was different. Several strains were ligated to 1gG3 using the following hemagglutination assay. I tested a matching tanto. Sheep red blood cells (RBC) (Kappel Laboratories) , Malvern, Pennsylvania) as described by Adler and Adler. [Meth, Enzy o1.70=455-466 (1980)] coated with immunoglobulin according to the target. RBCs in phosphate buffer (PB) S, 8.4 g/l NaCl, 1, 1 g/l Na, HPO, and 0.27 g/I of NaHtPOn) and 2.5 g/+sl of stannic acid in PBS. solution for 15 minutes at 37°C. Cells were collected by centrifugation, and Ca) Epiglobulin G (Sigma Chemical Company, St. Louis, Missouri) ), (b) or 1 g G3 myeloma protein or (c) in PBS. The cells were resuspended in PBS at a concentration of 0.26/ml. Incubate for 30 minutes at 37°C. After incubation, RBCs were collected by centrifugation and washed with PBS. for aggregation analysis 50 IL+ of a 1% suspension of coated RBC was mixed with 50.1 of the test cell extract, Reduced dilutions were made in PBS in conical wells of multi-well dishes. RB that did not aggregate C settle to the bottom of the well and form a small pellet, while the aggregated RBC Forms a more diffuse precipitate on the walls of the well.

Positive group G streptococcal strains are erythrocytes coated with unfractionated IgG. The red blood cells coated with 1gG3 were efficiently agglutinated in the same manner as in the above. This is protein This is to be expected for a G-producing strain. In contrast, it produces protein A Staphylococcus aureus Cowan ■ cells are red, coated with unfractionated IgG, as expected. Agglutinated blood cells but showed no activity against cells coated with 1gG3 . All cells were erythrocytes incubated with PBS only, i.e. coated. It did not agglutinate red blood cells that were not present.

The same hemagglutination test was performed on supernatant fractions from isolated streptococcal cultures and When performed on cell extracts, these isolates showed IgG binding at different locations. It seemed to have some activity. In some strains, activity is primarily in the cells. In some strains, activity is mainly found in the culture supernatant; Some strains were in between. 3 with IgG binding activity at different positions Two bacterial strains were selected as DNA sources for cloning of the protein G gene. .

Cells of each strain were treated with 2501 top solution containing 20mM glue and L-threonine. Todd-Hewitt broth (Fisher - Commercially available from Scientific, Suchmond, VA). . After 4 hours of culture, glycine was added to the medium to a concentration of 5% (w/v). Ta. After 5 hours of culture, cells were collected by centrifugation. At this time, the cell density was 600 The absorbance at nm reached approximately 0.5 to 1.0. Wash the cell pellet with PBS. The samples were frozen in liquid nitrogen and stored at -70°C. After thawing, 5■ of 200 ILl g/ml mutanolysin (Sigma Chemical Co., Ltd.) 87 medium of 101 containing 0.511 sucrose, supplemented with (commercially available from Panny) Earth [Basanta and Fries, J, Bacteriology 144:111 9-1125 (1980)] and resuspended in the same medium.

After incubation at 37°C for 45 min, the resulting protoplasts were centrifuged. Bulleted and then 100mM EDTA, pH 8.0, 150aM N aC1 and Q, 5 B/+ml (7) Resuspend in solution containing proteinase K Lyse cells osmotically by incubating at 37 °C for 55 min. After that, alpha toluenesulfonyl fluoride (phenylmethanesulfonyl fluoride) (also called loride or PMSF, commercially available, e.g. from Sigma) to a final concentration of 21. The mixture was incubated at 70°C for 1.5 minutes to remove the protein. -ase K was inactivated. Cell lysate was purified using chloroform/isoamyl alcohol (2 4: Extract 3 times with I) and further remove proteins and add 1 equal volume of isopropanol. The DNA was added to the aqueous layer to precipitate it. The precipitated DNA can be wound onto a spool. , washed with 70% ethanol, and dried in vacuo.

DNA pellets (from each of the three strains) were added to 0.5 + 0 il of ．． 0I Ml-Lis-○CI (p)l 8.0) C1 EDTA/B1 mouth SM Resuspended in NaCl solution. 100mM Tris-HCl, pl 7. 8.100 ml buffer containing 150 ml NaCI and 10 mM MgCIz Add 2 units of restriction endonuclease M to 25AL1 of the suspension suspended in JLL. By adding bol (commercially available), a part of the isolated chromosomal DNA is The digested 0 reaction mixture was incubated at 37°C for 13 minutes, then at 70°C. Incubated for 10 minutes. Digested DNA on 0.8$ agarose gel Electrophoresis was performed for 15 hours at 0.35 volts/C. Approximately 4 to 9 km Liaoji pair (kbp) of the gel containing the DNA fragment was cut out from the gel and crushed to remove the DNA. made collection easier. Gel part crushed with the same volume of phenol saturated with H2O The mixture was frozen at -70°C for 1 hour. Refrigerate the mixture without pre-thawing. Centrifuge for 15 minutes in an Oppendorf 7 microcentrifuge and dilute the aqueous layer with an equal volume of phenol. twice with the same volume of phenol/chloroform/isoamyl alcohol (25:24 :l) was extracted once. DNA from the aqueous layer was collected in 2.5 volumes of 95% ethanol and 30. as a carrier. The mixture was precipitated by adding 5 g of glycogen.

The cloning vector into which the chromosomal DNA fragment has been inserted is the plasmid shown in Figure 1. It was pGXI066. This plasmid is used for the DNA Ali piece to be cloned. Contains a contiguous row of restriction endonuclease recognition sites useful for insertion.

The array of cloning sites is separated by two transcription terminators. P E. coli constituting strain GX1170 transformed with lasmid pGX1066 Strain GX1186 has been deposited with the ATCC and its accession number is 39955. :3 The endonuclease Bam [( (commercially available and used according to the manufacturer's instructions). digested plus Mid DNA is then added to one unit of calf intestine alkaline phosphatase (Boehringer). (obtained from Mannheim and used in accordance with the manufacturer's instructions) for 30 minutes at 37°C. The treated reaction mixture was diluted with phenol/chloroform/isoamyl alcohol (25 :24=1), then 1 volume of 2M acetic acid to thorium, 10mM EDTA, 2.5 volumes of 95% ethanol-J and 10 pg as carrier The DNA was precipitated by adding 500 g of glycogen. 0.5μg pGX 1066 vector DNA (BamHI digestion, 7 osphatase treatment) #Lg was partially digested with Mbol. Strain prepared as above ligated to leptococcal chromosomal DNA.

The reaction mixture for 10JLI was 1 unit of 74 DNA ligase (commercially available, manufactured by (used according to the manufacturer's instructions) and incubated at 4°C for 20 hours. did.

Escherichia coli 5K2267 (F-gili-thi TlhsdR4endAgbc Bls, Escherichia S. Genetic Stock Center, Yale University, Connectica Cells (obtained from Nihon Barben, Germany) were transformed by standard calcium chloride treatment. Competent for transformation was achieved using standard transformation procedures [Leder berg and Cohen, J. Bacteriol, 119:1072-1 074 (1974), add 0-25 ml of compatible cells to 20p+ ligation mixture. The cells are then pelleted by centrifugation, Resuspend in 0.31 L broth. 100 pg/ml ampicilli containing a nitrocellulose sheet and (top layer) a cellulose acetate sheet thereon. Cells were placed on three L broth agar plates (immunoassay plates) stacked on top of each other. 0.11 each was plated. The plate consists of m bacterial colonies on a cellulose acetate sheet. The cells were incubated at 37°C until visible.

The nitrocellulose sheet was then removed from the plate and subjected to immunochemical manipulation as described above. IgG binding proteins on the sheet were detected using The sheet was first soaked with bovine serum a Nitrocellulose sites were removed by treatment with rubumin (3.0$ w/v in Tris saline). Block the antibody to non-specifically bind to nitrocellulose in the following steps. This minimized the Next, add 3.0$ w/v bovine serum albumin to the sheet. Normal rabbit serum diluted 1=1000 with Tris saline containing and then treated with peroxidase-conjugated goat anti-rabbit IgG (same dilution). and finally 4-chloro-1-naphthol (0.6Ig/ml) and aqueous peroxide ( Treated in Tris brine containing 0,2 volume methanol (0,000 g/v) and injected. Washes were made with Tris brine between incubation steps.

One positive colony was identified, which was Streptococcus strain GX7809. (Of the three streptococcal strains from which DNA for cloning was isolated) 1) was confirmed to be located on the plate containing the transformed strain derived from Ta. This positive colony was immunoanalyzed at a grade (100 thg/■l as described above). (containing ampicillin) to obtain a purified transformant. Nitroce When a rulose sheet is processed as described above, there will be a gap between six negative colonies. The original transformant strain in which only a few positive colonies were found seems to be unstable. When I repeated the streak culture, the colonies were not mixed in with the negative colonies from No. 6. Only one positive colony was found. Most other re-streaking culture series A derivative that is clearly more stable than the original positive transformant, which colonies were positive. One positive colony was isolated and named E. coli strain GX7820. Escherichia coli GX7820 stock is American Type Culture, Rockville, Maryland. ・It has been deposited in a collection, and its accession number is ATCC No.

It is 53460.

Could not be associated with any colony in addition to the original positive colony , several small but strongly positive spots were observed. These spots did not give positive daughter cells in re-streaking cultures.

Plasmid DNA was isolated from E. coli GX7820 using standard methods and the plasmid Restriction enzyme analysis of Sumid DNA.

Next, it was subjected to electrophoresis. The strain was found to contain two types of plasmids. . One plasmid (named pGX1066X) is the same size as pGX1066. , whereas the other one (pGX453 (designated l) clearly contains a 1 lkbp insertion. I) GX1066 containing the input fragment. Combi-tent E. coli 5K2267 was then retransformed with a mixture of plasmids isolated from GX7820 and transformed into Transformants were selected on immunoassay plates containing 100 pg/ml ampicillin.

Two types of positive transformants were obtained. The majority is a small strong positive formed colonies, most of which did not multiply. Minority things are normal It is similar in size to GX7820 and can grow more easily. came. In order to clarify the cause of these results, we tested compatible Escherichia coli S. 2267 was transformed with the gel-purified plasmid as follows.

Transformation A: pGX4530 (D Mi) Transformation B: 2 pGX1066X (7 ) Mi-transformation C: The mixture results of pGX4530 and pGX1066X are as follows. It was on the street.

Transformation A: Small, strongly positive colonies, most of which failed to grow.

Transformation B: No transformed strain Transformation C: Many small, strongly positive, non-growing colonies (same as transformation A) However, about 20% of the positive colonies were similar to GX7820, i.e. It had a normal size and was able to proliferate.

Select a few small, strongly positive colonies from the above retransformation plate. That is, from strain GX782D, which contains a mixture of pGX1066X and pGX453°. obtained from E. coli transformed with induced unfractionated plasmids (transformed strain), and a strain capable of growth was isolated by re-streaking. Plasmid DN A was isolated from two strains, both of which were pGX1066X helper plus. It was found that Mido had disappeared. One strain (named E. coli GX7823) About 2 kbp is deleted from the 1 kbp insert found in pGX453G. It contained the lost plasmid pGX4533. The sample of E. coli GX7823 was Contributed to the American Type Culture Collection, Rockville, Leland. The accession number is ATCC No. 53461. The second strain (colon bacterium (named GX7822) contained pGX4533 in the original 1lkbp insert. An additional 3 kbp of unidentified DN was found in close proximity to one end of the deletion. It contained pGX4532, a plasmid into which A was inserted.

E. coli GX7B23 (including pGX4s33) and E. coli GX782G (pG X4s30) were cultured in L broth + ampicillin. Centrifuge cells 50mM EDT^.

0.5 g/ml glue in a buffer containing pH 8, 0 and 2 all PMSF. Lysed by incubating for 30 minutes at 37°C in the presence of team.

The buffer described by Stabier [J, Mo1. Biol, 79: 237-248 (1973) I by heating at 100°C for 5 minutes. A sample of the extract was prepared for electrophoresis using the method described by Stabier. Samples were electrophoresed on a 12.5% acrylamide SDS gel as described above. The proteins were separated by overlapping. Standard electrophoresis techniques (Western blotting) Proteins were transferred from the gel to nitrocellulose paper using a 100% nitrocellulose paper. nitro cell The loin was then serially treated with BSA, normal rabbit serum, peroxidase-conjugated goat anti- Rabbit IgG and 4-chloro-1-naphthol were incubated with HxOx. (Same nitrocellulose treatment as the immunochemical procedure described above) 0 1 min for both strains Identical particles having a mobility corresponding to a molecular weight of about 90,000 to about 30,000, mainly 57,000 IgG-binding binding protein bands were detected.

The 1.9 kbp old ndm fragment in the insert was subcloned into pGX1066. The resulting recombinant plasmid (pGX4547) was transformed into E. coli. . Regarding the protein produced by this transformed strain (E. coli GX7841), When Western blotting was performed as described above, the main 57,000 Identical IgG binding binding protein bands were present, including the 0 band. transformed strain Again. Hemagglutination analysis was performed as described above. Extract from transformed strain is 1gG3 (human miniloma protein tiger) coated (tanned) human We agglutinated sheep red blood cells and sheep red blood cells coated with unfractionated human IgG, but Unagglutinated red blood cells were not agglutinated. from protein A-producing E. coli strains. The extract agglutinated red blood cells coated with unfractionated 1gG, but not those coated with 1gG3. Red blood cells and uncoated red blood cells were not agglutinated. Protein A is also A control E. coli strain that also does not produce rotin G did not agglutinate any red blood cell samples. Ta.

cholera no result is E. coli strain GX711141. GX7820 and GX7823 are This shows that it is an IgG-binding protein with properties characteristic of protein G. There is.

Example■ DNA and amino acid sequence data The DNA sequence of the cloned gene was determined.

This sequence is shown in Figure 3 along with the amino acid sequence coated by the DNA sequence. It is. The data shown in Figure 3 is based on the protein cloned as described above. This is the entire 1.9 kb old ndm fragment including the G gene.

Because of the degeneracy of the genetic code, the nucleotide sequences of genes vary substantially1 e.g. , if the correct codon-amino acid assignment is observed, differs from that shown in Figure 3. Part or all of a gene that has a nucleotide sequence but gives the same amino acid sequence can be chemically synthesized. Nucleotide sequence of protein G gene and Having established the amino acid sequence of the protein, the gene of this invention Not limited to octide sequences, but encompasses all variations allowed by the genetic code .

The protein G protein of this invention has exactly the same amino acid as shown in FIG. Deletion or M substitution in the sequence shown in Figure 3 is not limited to proteins with acid sequences. The protein also has an additional protein at the amino or carboxyl terminus of the protein. Proteins having amino acids such as It is included in this invention as long as it has quality. Variations in the amino acid sequence of Kowara, for example, are caused by genetics. This can be achieved by chemical synthesis of offspring or by known in vitro mutagenesis procedures. can.

The following abbreviations are used in FIG.

A = niboxyadeni le thymidil G=niboxyguani le; deoxycytosyl GLY=Glycine CYS=Cystine ALA=Alanine MET=Methionine VAL=valine ASP=aspartic acid LEU=leucine GLU=glutami acid ILE = isolein LYS = lysine 5ER=serine ARG=arginine THR = threonine HIS = histidine PHE = phenylalanine PRO = protein Lorin TYR=Tyrosine GLN=Glutamine TRP=)-Ributophane AS N = Asparagine Example ■ Identification of the protein G molecule portion responsible for IgG binding activity Produced by E. coli strains containing deleted or modified forms of the InG gene By examining the IgG binding activity of a protein that is It was found that it has a repeating structure between 228 and 352 (Figure 8). The amino acid sequences of the Bl and B2 regions are 4 out of 55 corresponding positions, respectively. 9 were the same. This repeating structure is shown in Figure 4, where Bl and B2 are It is shown.

Originally isolated from Streptococcus GX7809 and encodes protein G The 1.9 kbp old ndmlli fragment shown in Figure 2, which contains the entire sequence, was injected into bacteria. Phage M1:l+p9 [Messing, J, Methods En zy+so1.101=20 (1983)). plus MidopGX4547 was digested with endonuclease old ndm and bacteriophore The double-stranded replicative DNA of Jirei 13■p9 was also digested in the same manner. The latter is also known as calf Lucari phosphatase (2 units of 15!1) is present during digestion by old ndm. The vector was then treated with the following methods to prevent recircularization of the vector. Extract with phenol and ethanol After precipitation, the two digested DNA EI products are combined and DNA ligated under ligation conditions. Ink and ebate were applied along with gauze.

Connected DNA tone f! The Il product was E. coli GX1210 strain (F'traD35p roA+B+ Iaclq/delta-1acZ15 delta-(lae-pro ) supEthizig:TnlOhsdR2) It was used for. Colony immunization for transfected cells from plaques Protein G production was examined by analysis. Those with a positive analysis result are mG It was named X4547, and its partial restriction enzyme map is shown in FIG.

■ Double-stranded replicating form D isolated from E. coli transfected with GX4547 NA was digested with endonuclease pSTI. Extracted with phenol and ethanol After precipitation, the digested DNA is diluted with DNA ligase under ligation conditions. (approximately 11 sgg of digested DNA). Reconnected D The NA preparation was used to transfect E. coli cxtzio. a few pullers Prepare replicative DNA from infected cells from the same infected cells and perform colony immunotherapy on the same infected cells. The production of IgG binding proteins was examined by epidemiology assay. Restricting the replicative DNA 21 shown in Figures 5 and 6 by analysis with donuclease Pstl. It was found that both 0 bp and 415 bp Pstl fragments were lost.

These clones were shown to produce active IgG binding proteins by colony immunoassay. It was shown that this does not occur. Excised proteins produced by these clones The protein contains only part of the structure Bl, and contains the entire amino acid sequence from the end to Bl. It seems to be lacking.

One clone obtained by the above transfection was gave a positive result in the analysis. Restriction enzymes for replicating DNA from this clone Analysis revealed that this phage DNA lacked a 415 bp PstI fragment but a 210 bp PstI fragment. It was found that the bp fragment was retained. In addition, ethidium bromide stained aga From the relative intensity of the 2tObp Pstl band on low gel electrophoresis, this D NA was found to contain two copies of a 210 bp fragment. This phage D It was confirmed that the structure of N A (mGX7880) is shown in Figure 6. It was done. coated by the protein G gene carried on this phage DNA. The resulting protein has two complete structural copies, with an intact B1 sequence and its Following this, it seems to have a chimera of Bl and B2. This is from the end to 82 This structure, which would lack all amino acid sequences of 210 bp! Define the lr piece a Pst1 site that specifies is present in the B repeat structure at a position corresponding to a homologous sequence, This is due to the fact that it has the same relationship as the reading frame of the protein.

By polyacrylamide gel electrophoresis analysis, a large number of proteins containing this DNA were identified. It was found that this substance produces dark texture.

These results suggest that the presence of the B repeat structure is due to the IgG binding activity of protein G. This indicates that this is a necessary and sufficient condition for Therefore, the Ba repeating structure It is concluded that this is the IgG binding active site in the molecule.

Example IV Expression of protein G gene in Bacillus subtilis Contains a sequence similar to the transcription terminator. A synthetic oligonucleotide was first inserted into 5iGX4547. Oligonuku The sequence of leotide was as follows.

5'-pTCGAAA^^AGAGAC(:GGATATCCGGTCTCTT TTT-3゜It is self-complementary and when made into double strands endonuclease 5a gives a single-stranded end of the same sequence as that formed by il. mGX4s Phage DNA was digested with endonuclease 5all for insertion into 47. This synthesized oligonucleotide was then extracted with phenol and precipitated with ethanol. (heated to 70°C, denatured and slowly cooled to 23°C) and DNA Incubated under ligation conditions with gauze. E. coli using the ligated DNA GX1210 was transfected, and clones were cloned with deletion of the 5a11 site and 1 Obtaining the EcoRV site, which is a recognition sequence present on the synthetic oligonucleotide, Screened. One clone Gx7872 with the desired structure Name Shita.

Next, the sequence from the end to the 82 repeat sequence was removed from GX7872. this was performed using oligonucleotide-induced in vitro mutagenesis. Synthesized nucleotides.

5'-pCGTTTTGAAGCGACCGGAACCTCTGTAACC- 3゜Half of this sequence is from the very end to the B2 sequence in GX4S47 The other half is complementary to the sequence that coats the C-terminus of protein G. It is true. This oligonucleotide is prepared according to standard methods. ■GX4547D Used as a primer for in vitro synthesis of double-stranded replicative DNA using NA as a template. I used it. E. coli GX1210 was transfected using this DNA. P For the phage DNA produced by Lark, a radioactive acid complementary to the desired deletion sequence is added. oligonucleotide 5°-(32P)^GCGACCGGAACCTC-3’ and Screened to see if it would be appropriated. One clip with the desired structure The loan was identified and named ■GX7877. Its structure was determined by DNA sequence analysis. It was confirmed. The deletion occurred between 1651-1896 of the sequence in Figure 3.

To perform the fusion of protein G-encoding sequences with expression and secretion vectors , in the sequence of mGX7877 by oligonucleotide-guided in vitro mutagenesis. Primer oligonucleotide with 0th order sequence created with Ram) 11 sites. Convert mGX7877 single-stranded DNA into two-stranded fiDNA in vitro using promoted that.

5’-pG GTATCTTCGATTGGATCCGGTGAATCAA CAGCGAATAACCG -3゜This oligonucleotide is in GX7877 is complementary to the sequence that coats protein G in mature protein G (secretion sequence). The endonuclease Contains 6 additional nucleotides GGATCC, which is the recognition sequence for BamHI, E. coli GX1210 was transfected using the obtained double-stranded DNA. P Regarding the replicative DNA recovered from infected cells obtained from Lark, Ba We screened for the presence of one with the desired structure mGX840 2. Named L/ta.

Bacillus amyloliquefaciens (B) coated with subtilisin (APR) acillus amyloliquefaciens) A secretion vector containing a promoter and a secretion signal sequence was produced in Basantha and Thompso [J, Bacteriol, 165=837-8 42 (1984); and U.S. Patent Application No. 618,902 (June 1984); (filed on the 8th) and part of it! Patent Application No. 717,800 (19 There are 11 sites near the end of the sequence encoding the 85 signal sequence, and here to promote expression in the bacteria and secretion of the protein product from the cells. Sex genes can be fused. This vector contains the sequence encoding protein G. pGX2134DNA was fused with the endonuclease Ram Digested with old and Pvu II. ■Endonucleate the replicative DNA from GX8402. Digested with crease Ram old and 5eal. Extracted with phenol and ethanol After performing the precipitation, the digested DNA preparations are mixed and the DNA ligation is performed under ligation conditions. The ligated DNA is then incubated using standard methods. Grass fungus GX8008 (apr deletion, npr deletion, 5poOA677) protope The last was transformed. Select transformants based on chloramphenicol resistance and screened for protein G production by colony immunoassay. one A positive transformant was identified and named GX8408 (pGX4582). Group LaXmid pGX4582 has the structure shown in Figure 7 by restriction enzyme analysis. It was shown that This is between the BamHI and Pvu11 sites of pGX2134. -Bag old fragment having the protein G coding sequence of GX8402 and mGX A small H1-5eal fragment at the end of the coding sequence in 8402 was inserted. It is thought that it was formed by

Strain GX8408 produces a protein with protein G IgG binding activity. Rukoto has been shown. Appropriate medium (Fahnestoek and Fisher, J. , Baeteriol, 1:796-804 (1984)] After culturing, the supernatant and cell fractions were collected and treated with dodecyl sulfate. 1 and subjected to polyacrylamide gel electrophoresis analysis. After electrophoresis, the protein The cells were transferred to a high-quality Nitrocellulose and immunochemically stained in the same manner as in Example I. Ta. Substances that exhibit IgG binding activity were found in both culture 1 to supernatant and cell-associated fractions. It was done.

Example■ Similar to Example I, the Group G2 was named GX780S. Chromosome f) NA from a Coccus clinical slander Ntonu! Digested with 21/ase 11indm and 1% agar under standard conditions. 4. After electrophoresis, the DNA fragments were analyzed by Southern gel. It is described as 1 this way [heto λL Yujio-1,! -Mato 503 (1975)l It was then transferred to nitrocellulose. Approximately 2. containing the prodin G-coating sequence. 4 kbp of Han l- isolated from the original S. levtococcus GX7809. A radioactive globe consisting of a piece of old ndmllfi of 1-x, q kbp is shown in Figure 2. 1. Positioning by pipe rendition using Ta. 1°9kbp fragment The probe was purified by agarose gel electrophoresis and as described in Example I. As eluted from the gel, Lifby et al. 237 (1977) 1, based on the method described in 32P Radiolabeled by Lance Rage, N. Hybridization to Wahl et al. Therefore, the lignically described method [Proe-Nati Aead, Sci. USA 76:36113-:1687 (1979). Yes After hybridization and removal of non-hybridized probes, irradiation Place the band at the position corresponding to the length of 2.4 kbp in the radiography section. I was able to pinpoint the location.

A larger sample of chromosomal DNA of the same GX7BO5 (6μ, 1) Rease old ndllI digestion and fragments were electrophoresed in a 1% agarose gel (0% , 35 volts/cya for 16 hours). Stained with ethidium bromide After that, a 2-3 kb U-shaped band (endonucle/ase old ndm digested bacterium) Lyopha-Sillamda DNA (located at 17) corresponds to the control consisting of the gel. It was cut out and harvested to aid in DNA recovery. Describe the DNA in Example 1. It is recovered after extraction with phenol.

Plasmid Heku9-pGX1066 DNA (1ulg) was endonucleated. Digested with old nd nails. The reaction mixture is phenol/chloroporum/isoamyl After extraction with alcohol (25:24=1), 0.1 volume of 4M LiCl, 111 mM EDTA, 2037-g glycogen carrier, and 2.5 volumes The DNA was precipitated by adding 95% ethanol. 0.4 ug disappearance The converted vector DNA was transferred to the recovered GX7805DNA m fragment (90% of the material recovered from the chromosomal DNA of pLg), along with the production Incubate for 16 hours at 15°C in 20μ41 under coupling conditions recommended by -17.

E. coli 5K2 as described in Example I with the ligated DNA of 15JLl. 267 and plate the transformed cells on colony immunoassay plates 1/-L. and produced immunoglobulin binding proteins as described in Example I. I investigated whether or not it was possible. 1′″) positive colonies were identified. From this transformed strain, The isolated plasmid DNA contains a 2.4 kbp (1) DNA insert fragment. It was found that it consists of pGX1066. Endonuc containing this insert subcloning the old ndm fragment into the bacteriophage M13 p9 vector. -ning. The DNA sequence of the 2.4 kbp old ndm fragment was determined, and this is shown in FIG.

Plasmid〆; To r + - 4 0 0 dimension n to PC) (71 stomach).

of 0 (00 tototo 2nd item 8.

international search report 1pa”1°0”°“1°”””””’ PCT/11587700329

Claims (39)

[Claims] 1. Cloned protein G gene. 2. The protein according to claim 1, comprising the following deoxyribonucleotide sequence: InG gene. [There is an array] However, it is a 5' to 3' chain, starting from the amino terminus, and each triplet. The amino acids encoded by the triplet are also shown, and each triplet has Leave it behind. X is A, T, C or G Y is T or C When Y is C, Z is A, T, C or G When Y is T, Z is A or G H is A, T or C Q is T or A When Q is T, R is C and S is A, T, C or when GQ is A, R is G and S is T or is C M is A or G L is A or C When L is A, N is A or G When L is C, N is A, T, C or G. 3. The broth according to claim 2, which has the following deoxyribonucleotide sequence: InG gene. [There is an array] 4. The nucleotide sequence encoding protein G and the replication starter that functions in E. coli. a first vector comprising a starting point and a gene encoding antibiotic resistance; Antibiotic resistance containing an origin of replication in E. coli carried by the first vector a second vector lacking a gene encoding sex, said second vector lacking a gene encoding sex; The vector competes with the first vector for retention in the host. transformed with said first and second vectors by limiting the copy number of The transformed E. coli host strain is stabilized, and the transformed host strain is treated with the antibiotic. Combinations of vectors that can be identified by their ability to survive in the presence of quality. 5. The first vector has the identifying characteristics of pGX4530 and the second vector has the identifying characteristics of pGX4530. Combination of vectors according to claim 4 having the identifying characteristics of pGX1066X . 6. Transformed with the vector according to claim 4, E. coli host strain with specific characteristics. 7. Deoxyribonucle encoding protein G with immunoglobulin binding properties a potential helper plasmid containing the cleotide sequence or a functionally active portion thereof; the ability to replicate in a prokaryotic microorganism that can be stably maintained in the prokaryotic microorganism in the absence of A vector with 8. The protein having immunoglobulin binding properties of protein G is InG amino acids are deleted or substituted, or the amino terminal or carbo Claim 7, wherein an additional amino acid is added to the xyl terminus. vector. 9. The protein having the immunoglobulin binding properties of protein G has the following properties. The vector according to claim 7, which has a amino acid sequence. [There is an array] 10. Deoxyribonucleotide sequence according to claim 2 or 3 and is stably retained in prokaryotic microorganisms in the absence of potential helper plasmids. A vector that has the ability to replicate in prokaryotic microorganisms. 11. Claim 7, 8, 9 or 10, wherein the prokaryotic microorganism is Escherichia coli. vector. 11. Vector with identifying characteristics of pGX4533. 12. Vector with identifying characteristics of pGX4547. 13. A large intestine transformed with the vector of claim 11 or 12. Bacterial strain. 14. The vector according to claim 4, 5 or 6, wherein the first The vector contains an expression signal recognized by the host strain and contains protein G. further comprising those governing the expression of deoxyribonucleotide sequences encoding The E. coli host strain transformed with production of protein G, comprising culturing in Method. 15. The transformed E. coli host strain is ATCC No. Submit as 53460 15. The method of claim 14, having the GX7820 identifying features deposited. 16. The vector according to claim 7, 8, 9 or 10, The first vector contains an expression signal recognized by the host strain and contains a protein. A deoxyribonucleotide encoding a protein with immunoglobulin binding properties of InG. further includes those that direct the expression of the nucleotide sequence or a functionally active portion thereof. The E. coli host strain transformed with E. coli is grown in aqueous nutrient culture under protein G production conditions. The nature of protein G, including culturing it underground and recovering the produced protein. A method for producing quality protein. 17. The protein with immunoglobulin binding properties of protein G is protein The amino acid of Tein G is deleted or substituted, or its amino terminal or cartilage Claim 16: The tongue has an additional amino acid added to the boxyl terminal. Method described. 18. Claim 16: The produced protein has the following amino acid sequence: Method described. [There is an array] 19. Claim 16: The produced protein has the following amino acid sequence: Method described. [There is an array] 20. Claim 16: The produced protein has the following amino acid sequence: Method described. [There is an array] 21. The vector contains the deoxyribonucleonucleotide encoding protein G. 17. The method according to claim 16, which facilitates integration of the code sequence into the chromosome of the bacterial host. the method of. 22. 17. The method of claim 16, wherein the bacterial host is E. coli. 23. 17. The method of claim 16, wherein the host is Bacillus subtilis. 24. The transformed E. coli host strain is ATCC No. Submitted as 53461 17. The method of claim 16, having the identifying characteristics of GX7823 deposited. 25. The transformed E. coli host has the identifying characteristics of GX7841. The method according to scope item 22. 26. The transformed Bacillus subtilis strain has the identifying characteristics of GX8408. The method according to scope item 23. 27. Protein G produced by the method according to claim 14. 28. Protein G produced by the method according to claim 15. 29. Protein G produced by the method according to claim 16. 30. Protein G produced by the method according to claim 18. 31. Protein G produced by the method according to claim 19. 32. Protein G produced by the method according to claim 20. 33. The DNA sequence shown in Figure 9 or its protein G analog transcoding portion A recombinant vector containing 34. The amino acid sequence shown in Figure 9 or those having the IgG binding properties of protein G. A protein G analog having the following parts. 35. formula -(-B-b-)n- (However, B is B1, B2 or B3, n is 1 to 20, B1, B2 and B3 are below) The following nucleotide sequence, B3 is a hybrid DNA of B1 and B2, and b is the following DNA sequence. A recombinant DNA vector represented by [There is an array] [There is an array] [There is an array] 36. Claim 35: The hybrid DNA sequence B3 has the following sequence: Recombinant DNA described in Section. [There is an array] 37. formula -(-B-b-)n- (However, B is B1, B2 or B3, n is 1 to 20, B1, B2 and B3 are below) The following nucleotide sequence, B3 is a hybrid DNA of B1 and B2, and b is the following DNA sequence. A protein G-like substance represented by ). [There is an array] [There is an array] [There is an array] 38. Claim 37: The hybrid amino acid has the following sequence: A substance similar to protein G. [There is an array] 39. The protein has amino acids deleted or substituted, or its amino terminal It has an additional amino acid added to the end or carboxyl terminus, and is Claim 37, which has the immunoglobulin binding properties of Tein G. A substance similar to protein G.