JPH01247084A - Novel heat-resistant alkaline protease and production thereof - Google Patents

Abstract

PURPOSE:To produce a heat-resistant alkaline protease having specific enzymological properties, by inoculating a bacterial strain belonging to genus Bacillus stearothermophilus in a prescribed medium and culturing under aerobic condition. CONSTITUTION:A bacterial strain belonging to genus Bacillus stearothermophilus and capable of producing protease NCA 1503, preferably Bacillus stearothermophilus NCA 1503 (FERM P-8978) is inoculated in a medium containing a carbon source, a nitrogen source, etc., and subjected to shaking culture under aerobic condition at about 50-60 deg.C. The cultured product is centrifuged and the obtained transparent supernatant is added with ammonium sulfate, etc., to precipitate the objective enzyme. The precipitate is purified e.g., by ion exchange process to obtain the objective protease NCA 1503 in high purity.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention relates to a thermostable alkaline protease and a method for producing the same. For more details, please refer to the moderately hyperthermic bacterium Bacillus stearothermophilus.
The present invention relates to a highly heat-resistant alkaline protease that is extracted from the culture supernatant of a strain belonging to P. thcrmoplti Ius, and a method for producing the same.

[Prior art] Conventionally, as an alkaline protease, Bacillus subtilis (13a
Subtilisin produced by Cillus 5ubtilis is common and is also widely used industrially.

Also, as a type of subtilisin, Carlsberg (C
arlsberg), Novo, BP
N' etc. are known, the molecular weight is 20,000, and the active site residue is Asp32.

11is No. 84, 5cr No. 221. In addition, alkaline proteases other than subtilisin include Aspergillus oryzae (AspergIIIus or
These include aspergilopebutidase B and C of S. yzae), α-lytic protease of Sorangium, and pronase of Streptomyccs grriseus (SLrcptomyccs grlseus).

These alkaline proteases are widely used not only as research reagents but also as additives to detergents and for processing various foods.

[Problem to be solved by invention C] As described above, alkaline protease is a proteolytic enzyme that is widely used industrially, but if its heat resistance increases, it can withstand use at high temperatures and the range of use will expand. , the stability of the enzyme increases even when used at room temperature. The present invention takes these points into consideration and aims to provide an alkaline protease that has higher heat resistance than conventional alkaline proteases.

[Means for Solving the Problems] As a result of intensive studies on the above problems, the present inventors have developed an alkaline protease (hereinafter referred to as Protease NG) which has significantly improved heat resistance than conventional alkaline proteases.
A1503) was discovered, leading to the present invention.

That is, the present invention is a thermostable alkaline protease having the following enzymatic chemical properties.

a) Molecular weight: approximately 28,000 (gel filtration method, SDS-
PAGE) b) 911 Stability After treatment at 37°C for 30 minutes, pH (has 90% or more activity in the range of i to 12 and is stable) Optimum pH: 10.0 to 10.5 d) Temperature stability - Residual activity after heat treatment at 60°C for 30 minutes: 100% Residual activity after heat treatment at 65°C for 30 minutes: 50% C) Inhibitor: Phenylmethylsulfonyl fluoride (
PMSI') Diisopropyl fluorophosphate (DFP) r) Ultraviolet absorption spectrum: around 28 Onm g) Substrate specificity: Gln-111s, 5et-111s, in proteins or peptides such as casein, azocasein, albumin, insulin, polylysine, etc.
Leu-Tyr, Tyr-Lcu, Phe-T
11) Amino acid sequence and composition that specifically resolves the yr portion: lie Asp Pro Ala Gln Val G
lu Ala Ala VatThr Glu Lys
Thr Lys Ala lle Ilc Pro
Vallis Lcu Tyr Gly Gin M
et Ala Asp Met GluAla Ilc
Ala Ala Ile Ala Lys Arg
ll5 GlyLcu Val Val lie G
lu Asp Ala Ala Gln Allalc
Gly Ala Lys Tyr Asn Gly
Lys Cys VatGly Glu Lcu Gl
y Thr Ala Ala Thr Tyr 5er
Phc Phe Pro Thr Lys Asn L
eu Gly Ala TyrGly Asp Gly
Gly Met Ile Thr Asn
AspAsp Glu Lcu Ala Glu Ly
s Cys Arg Val lieArg Val
1lis Gly Ser Lys Pro Lys
Thr ThrIt+s l1is Val Leu
Gly Thr Asn SerΔrg LcuAsp
Glu Met Gln Ala Ala lle
Leu Ser ValLys Phc Pro l1
ls Leu Asp Arg Trp Thr Gl
uGln Arg Arg Lys lll5 Ala
Ala Thr Tyr Thr Arg Lcu L
eu Glu Glu Ala Asp Gly As
p LeuVal Val Thr Pro Lys
Glu Vat Asp Gly ArgTl+r l
ll5 Val Plte ll5 Gln Tyr
Thr lle ArgAla Pro Lys
Arg Asp Glu Lcu Gln
Ala PheLeu Lys Glu
Gln Gly Ilc Ala Thr
Met ValTyr Tyr Pro Lc
u Pro Leu l1is Lcu G
in Pr.

Val Phe Ala Sar Lcu
Gly Tyr Lys Glu GlyGl
n Lcu Pro Glu Ala Gl
u Lys Ala Ala LysGlu
Ala I, cu Ser Leu Pro
Met Phe Pro GluLcu
Lys Glu Glu Gln Gln
Gln Tyr Val Vat Glu Lys
IIeAla Glu Phc Tyr Arg 1
Amino acid composition of lis Phcla consisting of 261 amino acids Ala 32. Arg 12. Asp12, A
sn4, Cys2.

Gln 13. Glu 23. Gly 17. l
1is 11. ll014°Lcu 22. I,y
s19. Met O, Phe 9, Pro 1
3゜Ser G, Thr 12. Trp 1,
Tyr15, Vai 181) Structural gene base sequence ATCGATCCAGCGCAAGTTGAAGCGG
CGGTGACGGAGAAGATAGCTAGGTC
GCGTTCAACTTCGCCGCCACTGCCT
CTTCTCGAAAGCCATCATCCCCGGTG
CATTTGTACGGGCAAATGGCGCTTT
CGGTAGTAGGGCCACGTAAAACATGC
CCGTTTACCG＜← く← Roro ←＜ 0■ <← Roro Roro Roro KU← ■Ro Roro Roro Ro0 <← Mouth■ Roro Rolo Ro0 Ro■ 0ro Roro Ku← Oro ■O Ku← Roro Roro (← ■Rororo Lolo Lolo Lolo Q <← ■Ro Rolo Lolo 0ro ← Kuguchi■ Rolo E-1<<← ←ku OC: 5 Rolo ←ku Rolo Ku← Rolo Rolo Rolo Lolo ■Rororo <← Roro ○Ro ←ku＜← ＜ !-1＜← ←ku ←ku Roro Roro <← RoC: 5＜← ■Ro ←＜ <← ←ku ■Rororo ←ku Roro ←＜00 Mouth Q <← Roro ←ku Ro○ Ku← Roro Roro Ro○ ■0 ←＜ ←＜ <← Ku← ←Kuku← ←KU Roro ←Ku Ku← Mouth■ ←Ku Ku← (jQ ROQ Ku← Ku← (j C) C:5Q＜←＜1−Il−
1<<← RoOl-1< ■Oku← Ku← ←ku Ku← ■Ro Ro■ Ro■ Ku← Ro○ GTTGTGACGCCGAAAGAAGTCGACG
GTCGCTATCATGTGTCAAC8CTGCG
GCTTTCTTCAGCTGCCAGCGATAGT
ACACATCCATCAATACACGATTCGA
GCGCCG8AGCGCGACGAGTTAGGT8GTTATGTGCTA8GCTCGCGGCTTCG
CGCTGCTCAAGCAAGCGTTTTTGAA
AGAACAGGCGATCGCGACGATGGTG
CGTTCGCAAAAAAACTTTCTTGTCCCCC
TAGCGCTGCTACCACTACTATCCGC
TGCCGCTGCATTTGCAGCCGGTGTT
TGCTTATGATAGGCGACGGCGACGT
AAACGTCGGCCACAAAACGAACGCTC
GGGTATAAGGAAGGGGCAGTTGCCGG
AGGCGGAAΔAGCGAGCCCATATTCC
TTCCCGTCAACGGCCTCCGCCTTT
AGCGGCGAAAGAAGCGCTGTCGCTG
CCGATGTTCCC8GΔGTCGCCGCTTT
CTTCGCGACAGCGACGGCTACAAGG
GTCTCCTGAAAGAGGAGCAGCAACA
GTACGTCGTCGAGAAAATCGGACTT
TCTCCTCGTCGTTGTCATGCAGCAG
CTCTTTTAGCCGGAATTTTACCGTC
ATTTCGCTGCCTTAAAATGGCAGTA
pl+ consisting of 783 base pairs of 8 AGCGA and temperature-induced inactivation conditions 2 pl14.0. Approximately 50% of the activity is lost in 30 minutes at 37°C. Furthermore, pllIO. It is almost completely inactivated at 70°C for 30 minutes.

The present invention also relates to a method for producing a heat-stable alkaline protease, and relates to a method for producing a heat-stable alkaline protease.
l! protease NCA 1 5 0
The present invention relates to a method for producing protease NCAl503, which comprises culturing bacteria that produce 3 and collecting protease NCAl503 from the culture supernatant.

The protease NCAl503-producing microorganism used in the present invention is Bacillus stearothermophilus (Bacillus stearothermophilus) capable of producing protease NCAl5Q3.
It includes all strains, mutants, and variants belonging to the genus S. lus stearothermophllus. Among them, a particularly preferable strain is Bacillus stairmouth thermophilus NCA1503.
earthher IIlophilus NCAl50
3) (Feikoken Bibori No. 8978).

To produce the protease NCA1503 of the present invention,
For example, the above Bacillus stearothermophilus N
C1503 (Bacillus staroth)
ermoph IIus NCAJ503) in a medium containing a carbon source, nitrogen source, salts, and other substances, and aerobically maintained at an appropriate temperature, e.g., about 50 to 60°C, for an appropriate period of time until the enzyme titer reaches its maximum. There are methods of production under various conditions, for example, shaking or aerated agitation culture.

After the culture cultured as described above is clarified by a method such as centrifugation or filtration, the enzyme of interest can be collected by adding, for example, ammonium sulfate to the clarified solution. Furthermore, the above precipitate can be further purified using an ion exchange method or a gel filtration method to obtain extremely high protease NCAl503.

The novel protease NCA15 obtained in this way
The physical and chemical properties of 03 are shown below.

(1) Action The preferred pll for proteolytic action at 37°C using casein as a substrate is <, pnq~l1 as shown in Figure 1.
and is an alkaline protease with an optimal pl[Lo~19.5.

(2) Substrate specificity When the B chain was degraded as a substrate at 37°C and pl18.5, as shown in Figure 2, < Ciln-111s, S
er-I11s, Lcu-Tyr, Tyr-L
Decompose the eu and Phe-Tyr parts.

(3) Optimal [)I1 The influence of 11+1 on the proteolytic action at 37° C. using casein as a substrate is shown in FIG. The optimal pll is lO~10,5.

(4) pll stability Figure 3 shows the residual activity after treatment with various pl+ at 37°C for 30 minutes using casein as a substrate. 9 in the pH range of 6-12
It showed residual activity of 0% or more. Moreover, at pl+4.0, about 50% was inactivated.

(5) Method for measuring titer Add 1 ml of each sample to 1 ml of 2% casein solution (50mM Li-HCl, pl18.5), and after a certain period of time add reaction stop solution (0.33M acetic acid, 0.22M)
2 ml of sodium acetate, 0.1 M}lichloroacetic acid) was added, and the mixture was allowed to stand at room temperature for 30 minutes. Whatman NO-
1 filter paper; Separately, a reaction stop solution was added to the casein solution, a sample was added, and the filtered sample was used as a standard to determine A nm using ilPI, and a calibration curve for A was created using the 1,000 rosin solution as the base to determine the protease activity. 4
Dj was established. Position IIi was the amount of enzyme that released 1 μg of a substance equivalent to tyrosine into the trichloroacetic acid soluble fraction per minute at 37°C.

(6) Optimal temperature The temperature dependence of proteolytic action at pl+8.5 using casein as a substrate is shown in FIG. The optimum temperature for the action of this enzyme is approximately 55°C.

(7) Temperature stability Figure 5 shows the temperature stability at pl+8.5 using casein as a substrate. This enzyme has a residual activity of 100% after heat treatment at 60°C for 30 minutes, making it extremely stable as an alkaline protease. The residual activity after heat treatment at 65° C. for 130 minutes is 50%. It is almost completely inactivated by heat treatment at 70°C for 30 minutes.

(8) Effect of inhibitors The effects of inhibitors are shown in Table 1.

Table 1 Effect of inhibitors EDTA: ethylenediaminetetraacetic acid PMSF: phenylmethylsulfonyl fluoride op
Method for purifying p Nidiisopropylfluorophosphate (9) protease A crude enzyme sample obtained from the culture supernatant by ammonium sulfate precipitation, dialysis, etc. can be separated and purified, for example, by the following method. That is, about 1 g of the crude enzyme sample was dissolved in lOm+ 0.1M phosphate buffer pH 8.0 and equilibrated with the same buffer.

Toyopearl-IIW50 (Product name, Tosoh ■
Pour the solution gently onto the top of a column (1.5 x 80 cm) packed with 1.5 x 80 cm, and elute with the same buffer. The active fraction obtained here was further added to TS'Kgel-G2000SW (trade name,
(manufactured by Tosoh Oki) and collect the peak fraction.

The active fraction is concentrated using ammonium sulfate salting out (70% saturation) or an ultrafiltration membrane (UP-10PS, trade name, manufactured by Tosoh Corporation), dialyzed, and then freeze-dried.

(10) Molecular weight The molecular weight measured by gel filtration method and SDS-polyacrylamide gel electrophoresis method is about 28,000, and the molecular weight from the amino acid sequence is 294f30.

(11) Ultraviolet absorption spectrum As shown in Figure 6, the absorption maximum is around 280 nm and the absorption minimum is around 245-255 nm.

(12) Amino acid composition [Problem to be solved by the invention] Column h) Amino acid sequence and composition are not shown < Consisting of 261 amino acids.

(13) Base sequence [Problem to be solved by the invention] column ■) As shown in Base sequence of structural gene, it consists of 783 base pairs.

[Effects of the Invention] The protease NCAl3O3 according to the present invention has higher heat resistance than conventional alkaline proteases, can withstand use at high temperatures, has a wider range of use, and has increased enzyme stability even when used at room temperature. Also protease NCAl3O
3 can be obtained by the method of the present invention.

[Example] Next, an example will be shown. However, the present invention is not limited to these examples.

(Example 1) Table 2 Medium composition 500 ml of a medium having the composition shown in Table 2 was mixed with 2. Place in a 2 volume Sakaro flask and sterilize at 120°C for 15 minutes. Bacillus stearothermophilus cultured in a medium with the same composition
Add 5 ml of NCAl3O3 preculture and incubate at 50°C.
150rpm.

Culture was carried out with shaking for 24 hours. Ammonium sulfate was added to the culture supernatant to saturation of 7,026 ml to precipitate the enzyme active fraction, followed by centrifugation (1 l, 10,000 rpm).

10 minutes) and collected. Collect the collected enzymes into as little amount as possible.
．． The suspension was suspended in 1M phosphate buffer 1) 118.0, packed in a dialysis tube, and dialyzed at 4°C for 24 hours. After dialysis, insoluble matter was removed by centrifugation and freeze-dried, and the resulting powder was used as a crude enzyme sample. Approximately 1 g of the crude enzyme sample was dissolved in 10 ml of 061M phosphate 'ijU buffer, pH 8.0, and equilibrated with the same buffer. Toyopearl-11W50
(Product name.

Column (L, 5 x 80cm) packed with Tosoh Co., Ltd.)
It was poured gently into the upper part and eluted with the same buffer. The active fraction obtained here was further added to TSKgcl-G2000SW (
Product name.

(manufactured by Tosoh ■) and the peak fraction was collected.

The active fraction was filtered through an ultrafiltration membrane (UF-10Ps, trade name).

After concentrating and dialysing using Tosoh Corporation (trade name), it was freeze-dried. 0.05 g of protease NCAl from culture broth of 11
3O3 was obtained.

The purity of the purified enzyme was analyzed by polyacrylamide gel electrophoresis (12.5%) and high performance liquid chromatography (column TSKgel G2000SW), and a single protein band was detected in both cases.

(Example 2) Half-life time δ1 of enzyme activity at each temperature in an alkaline solution of subtilisin callsuberub used in detergents and protease NCA 1503 (halal acid-sodium hydroxide buffer, pi19.O) I made a decision. The results are shown in Table 3.

Table 3 As shown above, subtilisin and
Compared to Carlsberg, protease NCΔ1503 does not lose much t1 in alkaline solution up to 60°C.

[Brief explanation of the drawing]

FIG. 1 is a diagram showing the optimal pl+ of protease NCAl3O3. Figure 2 shows oxidized insulin B of protease NCAl3O3.
FIG. 3 shows chain degradation and demonstrates the substrate specificity of this enzyme. FIG. 3 is a diagram showing the pH stability of protease NOΔ1503. FIG. 4 is a diagram showing the optimum temperature of protease NCAl3O3. FIG. 5 is a diagram showing the temperature stability of protease NCAL503. FIG. 6 is a diagram showing the ultraviolet absorption spectrum of protease NCAl3O3 in an aqueous solution. Patent applicant: Tosoh Corporation 8.0 9.0 10.0 11.0 Figure □ Temperature C) Figure 5 One hour (minute)

Claims (3)

[Claims] (1) A thermostable alkaline protease having the following enzymatic chemical properties. Molecular weight: approximately 28,000 (gel filtration method, SDS-PAGE
) pH stability: pH 6-12 after treatment at 37°C for 30 minutes
Optimal pH: 10.0-10.5 Temperature stability: Residual activity after heat treatment at 60°C for 30 minutes: 1
00% Residual activity after heat treatment at 65°C for 30 minutes: 50% Inhibitor: Phenylmethylsulfonyl fluoride (PM
SF) Diisopropyl fluorophosphate (DFP) Ultraviolet absorption spectrum: around 280 nm Substrate specificity: Gln-His, Sor-His, Leu- in proteins such as casein, azocasein, albumin, insulin, polylysine, or peptides
Amino acid sequence and composition that specifically breaks down Tyr, Tyr-Lou, and Phe-Tyr parts: [There is a gene sequence. ] Amino acid composition consisting of 261 amino acids [There is a gene sequence. ] Structural gene base sequence [There is a gene sequence. Conditions for pH and temperature inactivation: pH 4.0, 37°C, approximately 50% inactivation in 30 minutes. Furthermore, it is almost completely inactivated at pH 10, 70° C., and 30 minutes. (2) Bacillus stearothermop
1. A method for producing a protease, which comprises culturing a strain belonging to P. hilus and collecting the protease according to claim 1 from the culture solution. (3) The strain is Bacillus stearothermophilus NCA
1503(￥Bacillus￥￥stearothe
rmophilus￥NCA1503) (Feikoken Bibori No. 8978).