JPH01156999A - Human tumor necrotic factor - Google Patents

Abstract

NEW MATERIAL:A polypeptide containing a human tumor necrotic factor consisting of an amino acid sequence expressed by the formula or active central part thereof. USE:An antitumor agent. PREPARATION:For example, a human macrophage is collected and cultivated and an endotoxin, etc., of Gram-negative bacteria is added to induce production of a human necrotic factor mRNA. RNA is then wholly extracted and treated with an oligo(dT)cellulose, etc., to afford an mRNA fraction, which is subsequently used as a template to prepare a cDNA. The obtained cDNA is then integrated into a plasmid and inserted into Escherichia coli, etc., to provide a cDNA library, which is subsequently screened with a probe to select a clone capable of coding a human tumor necrotic factor. The cloned DNA is then inserted into a host, such as Escherichia coli, which is subsequently transformed and cultivated to provide the aimed human tumor nectoric factor expressed by the formula.

Description

[Detailed description of the invention]

The present invention provides human cancer necrosis factor polypeptides, cloned DNAs encoding them, and cloned DNAs thereof.
This invention relates to vectors that have integrated the vectors and hosts transformed with these vectors. In this specification! [! The following abbreviations are used for simplification. A Adenine C Cytosine G Guanine T Thymine Ala Alanine Arg Argini/ Asn Asparagine Asp Aspartic acid Cys Cystine Gin Glutamine Glu Glutamate Gly Glycy/ His Histidine 11e Inleucine Leu Leucine Lys Lys/ Met Methionine Phe Phenylalani/ Pro Proline S et Serin Thr Threo/ -7 TrP) Liptophan Tyr Tyrosine Vat Valine DNA Deoxyribonucleic acid c DNA Complementary DNA RNA Ribonucleic acid mRNA Messenger RNA dATP Deoxyasunosine triphosphate dCT
I' deoxycytidine triphosphate dGTP
Deoxyguanosine triphosphate dTTP
Deoxythymidine triphosphate oligo(dC) Oligodeoxygualic acid oligo(dG) Oligodeoxyguanylic acid oligo(dT) Oligodeoxythymidylic acid poly(A) Polyadenylic acid poly(U) Polyuridylic acid poly(dA) Polydeoxyadenylic acid poly(d
C) poly(dG) polydeoxycytidylate
Polydeoxyguanylate poly(dT) Polydeoxythymidylate EDTA Ethylenediaminetetraacetic acid bp Base pair Carswe II et al.
They discovered that the serum of mice infected with Calmette-cu6r+n (l3CG) and then treated with endotoxin contained a substance that caused necrosis of transplanted Meth^sarcoma cancers, and named this substance necrosis factor. [Proc, Nat, ^cad, sc
i, tlSA, 72.31300 (1975)]. Cancer necrosis factor is considered to be a physiologically active substance released from macrophages, and its characteristics include (1) when administered to tumor-bearing animals, it causes necrosis and healing of certain cancers (
ii) It damages certain types of cancer cells (e.g., mouse cancer L cells, human cancer-derived PC-10 cells) in vHro, but has almost no residual effect on normal cells, and ( ii+) It is known that its effects are not species-specific. Because of these characteristics, necrosis factors are highly anticipated for clinical application as a new type of anticancer agent. However, the conventional necrosis factor production method is to inject BCG or Propton 1bac into animals such as mice and rabbits.
Because the method involves injecting tertiary acnes, then administering endotoxin, and then isolating and purifying the necrosis factor from the blood and body fluids, it is difficult to stably obtain a large amount of necrosis factor at a low cost. there were. Further, in order to use the necrosis factor as a medicine, human-derived necrosis factor is more preferable from the viewpoint of antigenicity, etc. However, the above method cannot be adopted for producing human-derived necrosis prisoners. Previously, as a cancer cytotoxic factor derived from human macrophages, a factor produced by sentinel monocytic cells or myeloid monocytic leukemia cells of normal humans (^nu-tumor cytotoxin) [:■■
1unology. 44, +35 (1981)] and Reed et al. [J,
rssunol, 115, 395 (1975) 1, etc. are known. In addition, W■th λ1sOn et al.
A substance with a molecular weight of approximately 70,000 Daltons produced from established cell lines has been reported as a human cancer necrosis factor [Proc, Na
t, ^cad, sci, UsA, 80,5397 (19
83>]. However, in each case, the substance as a substance was unknown. In order to establish a method for mass production of human-derived necrosis factor, the present inventors conducted intensive research focusing on genetic recombination technology, and first cloned D, which encodes rabbit cancer necrosis factor.
NA was successfully isolated (see Japanese Patent Application No. 58-228790 (Japanese Unexamined Patent Publication No. 00-120990)). As a result of further research, we succeeded in cloning cDNA encoding human cancer necrosis factor using this cloned DNA as a probe, and furthermore, microorganisms transformed with a plasmid incorporating this cloned DNA were successfully cloned. The present invention was completed by confirming that human cancer necrosis factor was produced. As used herein, human cancer necrosis factor is a protein produced by human-derived cells, and has the ability to injure at least L cells in inv+tro, and the ability to necrotize at least transplanted cancer caused by Meth^sarcoma in +n vtvo. necrotic cell activity means such biological activity. The present invention provides polypeptides containing the amino acid sequence of human cancer necrosis factor or its active center portion, and cloned DNA encoding them. In particular, the following amino acid sequence (I) Ser Ser Ser Arg Thr Pro S
er AsP Lys Pr. Val Ala Hls Vil Vtl Ali A
sn Pro Gln AlaGlu Gly Gln
Leu Gln Trp Leu Asn Arg
ArgAla Asn Ala Leu Leu Al
a Asn Gly Vil GluLeu Arg
As1) Asn Gln Leu Vat Vil
Pro 5er Glu Gly Leu Tyr Le
u Ile Tyr Ser Gln ValLeu
Phe Lys Gly Gin Gly Cys P
ro Ser ThrHls Val Leu Leu
Thr Hls Thr rle Ser ArgI
Is Ala Vat Ser Tyr Gln Th
r Lys Vat AsnLau Leu Ser
Ala Ile Lys Ser Pro Cys G
lnArg Glu Thr Pro Glu Gly
Ali Glu Ali LyiPro Trp T
yr Glu Pro Ile Tyr Leu Gl
y GlyVat Phe Gln Leu Glu
Lys Gly Asp Arz LeuSer Al
a Glu IICAsn Arg Pro Asp
Tyr LeuAsP Phe Ala Glu
Ser Gly Gln Vil Tyr
PheGly Ile Ile Ala
Human cancer necrosis factor having Leu (I) [hereinafter referred to as polypeptide (I)], the following amino acid sequence (II) is further added to the N-terminus of polypeptide (I): Met Ser Thr Glu Ser Met I
le Arg AspValGlu Leu Ala
Glu Glu Ali Leu Pro Lys L
ysThr Gly Gly Pro Gln Gly
Ser Arg Arg CysLeu Phe
Lcu Ser Leu Phe Ser
Phe Leu l1eVat Ala Gly
Ala Thr Thr Leu Phe Cys
LeuLeu His Phe Gly Vat Il
e Gly Pro Gln ArgGlu Glu
Phe Pro Arg Asp Leu Ser L
eu 1ieSer Pro Leu Ali Gln
A polypeptide having Ala Vat Arg (II) [hereinafter referred to as polypeptide (I+■)], a polypeptide having Met at the N-terminus of polypeptide (I), and the following base sequence (Ill) (5') -TCA TCT TCT CGA ACCC
CG AGT GACAAGCCT GTA GC
CCAT GTT GTA GCA AACC
CT CAAGCT GAG GGG CAG CT
CCAG TGG CTG AACCGCCGG G
CCAAT GCCCTCCTG GCCAAT
GGCGTGGAG CTG AGA GAT
AACCAG CTG GTG GTG
CCATCA GAG GGCCTG TACC
TCATCTACTCCCCAGGTCCTCTTCAA
G GGCCAA GGCTGCCCCTCCAC
CCAT GTG CTCCTCACCCACAC
CATCAGCCGCATCGCCGTCTCCTAC
CAG ACCAAG GTCAAACCTCCTC
TCT GCCATCAAG AGCCCCCTGC
CAG AGG GAG ACCCCA GA
G GGG GCT GAG GCCAAG
CCCTGG TAT GAG CCCATC
TAT CTG GGAGGG GTCTTCC
AG CTG GAG AAG GGT G
ACCGACTCAGCGCT GAG ATCA
AT CGG CCCGACTATCTCGACT
TT GCCGAG TCT GGG CAG
GTCTΔCTTT GGG ATCΔTT
GCCCTG-(3') (III')
Cloned DNA encoding polypeptide (I) [hereinafter referred to as DNA (Ill)] and DNA
The following salt Jλ sequence (TV) is further added to the 5' end of A(III).
(5')-ATG AGCACT GAA AGCAT
G ATCCGG GACGTG GAG CTG G
CCGAG GAG GCG CTCCCCAAGAA
G ACA GGG GGG CCCCAG GGCT
CCAGG CGGTGCTTG TTCCTCAG
CTCTTCTCCTTCCTGATCGTG GC
A GGCGCCACCACCGCTCTTCTG
CCTG CTG CACTTT GGA G
TG ATCGGCCCCAGAGG GAA
GAG TTCCCCAGG GACCTCTC
T CTAATCAGCCCT CTG GCC
Cloned DNA encoding polypeptide (I+■) having CAG GCA GTCAGA-(3')(IV) [hereinafter referred to as DNA (Ill-+lV)]
, and the start cod 7 AT at the 5' end of DNA (III)
It provides the DNA that supports G. As used herein, the polypeptide containing the amino acid sequence of human cancer necrosis factor is polypeptide (I). Or a polypeptide with an amino acid or peptide bonded to its N-terminus or C-terminus, which itself or is produced by being cleaved with an enzyme etc., is 1! It means a drug that exhibits human necrosis activity similar to that of Ribepuzid (I). Furthermore, the polypeptide containing the active center portion of the amino acid sequence of human cancer necrosis factor is polypeptide (1).
Among the amino acid sequences of
A polypeptide comprising an essential amino acid sequence for,
It means a compound that exhibits the same human cancer necrosis factor activity as polypeptide (I). The present invention includes not only polypeptides containing the amino acid sequence of human cancer necrosis factor or its active center, DNA encoding them, vectors incorporating these DNAs, and hosts transformed with these vectors, but also As long as the obtained polypeptide has high homology with the polypeptide (I) of the present invention, exhibits similar human cancer necrosis factor activity, and is immunologically cross-reactive, such polypeptides and the DNA that codes for them
. Also included are vectors incorporating those DNAs and hosts transformed with those vectors. For example, human cancers containing allelic variants of human cancer necrosis factor DNA and degenerate or partially modified genetic codes. Necrosis factor DNA: 4
Also included in the invention are conductors and polypeptides obtained therefrom. In addition, human cancer necrosis factor DN containing some modifications
The derivative A refers to a derivative in which a portion of human cancer necrosis factor DNA is deleted and a derivative in which another DNA fragment is added to human cancer necrosis factor DNA. The DNA containing the base sequence encoding the human cancer necrosis factor of the present invention can be produced, for example, as follows: (1) Cloned DNA encoding the rabbit cancer necrosis factor
Preparation of 49 m rXl 5B-228'? No. 80 (special rj
n N 6 (112099 (No. 1 > k [tl) Rabbit necrotic convict c DNA is obtained according to the method shown (for example, the method of Reference Example 2). The base sequence of this cloned DNA is as shown in Table 1. The region encoding the polypeptide of rabbit cancer necrosis factor is Nos. 277 to 738. This rabbit necrosis factor c DNA is injected with an appropriate length of DNA.
A restriction enzyme is used to cut out the DNA fragment to give the A fragment, which is used as a probe for cloning human cancer necrosis factor c DNA described below. Examples of restriction enzymes include ^vaI, HaelI
, BstNI. Examples include old ncI[, RsaI. It is preferable to use two or more types of DNA fragments originating from different regions. Table 1 lists ^VλI and Hae as restriction enzymes.
299 bp and 88 bp cD using U
The cleavage site for cutting out DNA fragments is shown. (Margin below) E-< (, l(, l QaOQ
<E-00 <h Q(,l <← (1)(,l QO0(1) <E-4Qa Qa ao Qa aQEku QOku← oQ (:)Q Q(,1Qa
aQ <← 00 00 to=< ao a. Toku 00 ←< ←kuQ(,l <E-1(,1(:) (1
) QOa ao au (,
IQ ← E-< OQ E-<<E-
4t, >C:) E-< (, l(, IE-
1<E-4< oa auo
o E-1< oa o. <E-4oa <← ←ku<E-aO←ku← aQ<E-I CDU <E-(,I
Q Qa <h a. <E-E-<<←←ku<E-oa
E-1< ”ao oa ←ku(,10aQ
Qa less oO<E-o. oO(:)Q <← し ao ao oa(,)C:)
<E-10a a. UC:) E-1<: <← ku←Qa
oo <← ku←oa aQ
＜← 0a OQ ト＜ OCD UCDop
<E-4oQ a. <x> Qa <II:E-1aQE
-4< QO←ku ←kuaOao (:) (, I CX:)
aOaOoa Q(1) (, IIQ E-(II: (:E-
10a<E-I L)t) QC:)
CDL)oo E-1<oo
o. (:E-(:E-E-4< QaOa
<E-4Q(:) aQcpo oo
←ku ←ku←＜ E−1＜ Q
a (,l(,IQ(:) aQ
oa oaoO<E-4L)L) (,
IQ←<E-<<E-<←va
Qa <E-40aoo (,+
(, l oo oa○ (1)
oo (1)(,l QC
)00 <← ku← kutoE-1<<E-40Q 00Q0 00
←＜ ←くOQ＜←oo （、IQao＜
E-10Q aQoo oo oo
E-4＜←＜ oa aQ 0
aE-<E-<oQE-4<OQE
−<uCD aQoo t,>a
oa Qaku← oo <E-oQ E<<<← Oa 00 ←< LX) 00 QO aQ Oa <E-<← Qo 00 Qo 00 00 ト0ku←ku Qo <h u. Oo 00 Qa UL) ■Preparation of human cancer necrosis factor mRNA Human macrophages were collected in the alveoli, blood, peritoneal cavity, and placenta. Collected from viscera and other tissues. For example, from the alveoli, the method of 5ane et al. [J, lm5uno1. ．． 129.1
313 (+982)]. From blood, Matthews' method [11r, J, Ca
ncer, 48,405 (+983)], W from the placenta
Ilson et al.'s method [J, Itwunological
Methods, 50, 305 (+983)]. Incubate this Makumitsu 1-ji! Approximately 2× 104 to 106 cells are sown per d, and precultured at 35 to 38°C, preferably about 37°C, in air with about 5 to 10% carbon dioxide gas, and at a humidity of 80 to 100% for about 30 minutes to 2 μm. Next, endotoxin obtained from Durham-negative bacteria, such as Escherichia coli, Pseudomonas aeruginosa, and Noribo bolisubcharide derived from Salmonella typhi, was added, and the culture was continued for 3 to 8 hours to induce human cancer necrosis factor m.
Produce RNA: fgJQ. At this time, human cancer necrosis factor mRNA can be accumulated by adding a protein synthesis inhibitor (eg, cycloheximide). Note that the pre-culture may be omitted. The amount of endotoxin added is generally about 0.1 to 1000 μg11 (final concentration,
(the same applies hereinafter), preferably about 1 to 100 μg/l. At this time, about 2 to 2000 ng/mNU of phorbol esters such as phorbol-12-myristate-13-acetate, phorbol-12,13-didecanoate, and phorbol-12,13-dibenzoate may be added. . The amount of protein synthesis inhibitor added varies depending on the type of compound, etc., but for example, in the case of cycloheximide, it is 0.1
~50 μg/if. As the medium, various synthetic media suitable for culturing high-level animal cells are used, such as RP.
MI-IEi40. Eagle's MEM medium and Dulbecco's modified MEM medium (the composition of the above medium is described, for example, in "Cell Culture Manual" edited by Kosuke Munemura, Kodansha, 1982). It is preferable to add animal serum (eg, fetal bovine serum, calf serum) to the culture medium in an amount of about 1 to 20% of the total volume of the culture solution. After culturing, the cells are harvested using a conventional method such as the method of Chirgwin et al. [[1, iochemistry, 18+5294(
+979>], and then subjected to post-tube column chromatography using oligo(dT) cellulose or poly(U) Sepharose (Pharmacia) according to a conventional method, or by a batch method.
y(8) Separate the mRNA fraction. This poly(^)
Human cancer necrosis factor mRNA'kK5m can be purified by subjecting the mRNA fraction to acid urea agarose gel electrophoresis or CyM density gradient centrifugation F11. In order to confirm that the mRNA fraction obtained here co-produces mRNA encoding the desired human cancer necrosis factor, it is sufficient to translate the mRNA into protein and examine its biological activity. For example, Africa's 7-mega frog (Xeno
The mRNA is injected or added to a combination of protein synthesis systems such as P. pus 1aevis oocytes, reticulocyte lysate, and wheat germ, and translated into protein, and the protein has cytotoxic activity against mouse L-929 cells. This is done by confirming that the Note that the method using African frog oocytes is carried out, for example, as follows. Approximately 50 ng of mRNA per oocyte was injected using the microinjection method, and 10 of them were injected into 100
μl of Perth culture [Gurdon, J.B., J.E.
mbryol, Exp, Morphol,. 24-72 at 22°C in 20.401 (19138>)
After culturing for an hour and homogenizing, the centrifuged supernatant (1
0,OOOrpm, 10 minutes) as the sample, L-9
Measuring necrotic cell activity using L-029 cytotoxic activity as an indicator [Measurement method for L-029 cytotoxic activity is described in RuffJ,
R,,et al,,J,1mmuno1. . 125, 1671 (1980)]. (3) Cloning of human cancer necrosis factor c DNA (2)
The mRNA obtained in step 1 was used as a template, and oligo (dT) was used as a primer according to the method of Gubler et al. [Gene, 25.2G3 (1983>1), dATI',
dGTI', dcTr'. Single-stranded cDNA complementary to the mRNA is synthesized by reverse transcriptase (e.g., reverse transcriptase from avian myeloid leukemia virus) in the presence of dTTI', and then double-stranded cDNA is synthesized using E. coli ribonuclease II' and E. coli DNA polymerase ■. Synthesize strand c DNA. The obtained DNA was converted into poly(dG)-poly(dC) or poly(dA)-poly(d
r＞Homopolymer extension method (Noda, M, et at
,. Nature, 295, 202 (1982); Ne1
son, T.S., “Methods in Enzy
mology,” 08, 41 (1979), Aca
demic Press Inc. For example, it is integrated into the restriction enzyme Pst I cleavage site of plasmid pl[322] according to a conventional method such as [Ncw York]. The obtained recombinant plasmid is, for example, Coh
The method of en et al. [I'roc, Nat, ^cad, sci
, UsA, 09, 2110 (1972), for example, by introducing the E. coli strain into a host such as 1776 strain, transforming it, selecting a tetracycline-resistant strain, and c.
Create a DNA library. For this cDNA library, 12 pieces of the DNA fragment encoding rabbit cancer necrosis factor obtained in step (1) were added.
Colony hybridization test [11anahan, D., a.
tal,. Gana, 10, 03 (1980)],
Screen for clones that hybridize with the rabbit necroptosis cDNA fragment. For example, the Maxam-Gilbcrt method [r'r
oc, Nat, ^cad. Sci, 1ISA, 74,500 (1977)], and searched for a nucleotide sequence homologous to the already known nucleotide sequence of rabbit cancer necrosis factor, and finally determined the sequence of human cancer necrosis factor. By selecting a cDNA containing a base sequence corresponding to the entire translated region, a cloned DNA having a base sequence encoding the human necrosis convict polypeptide can be obtained. The recombinant plasmid containing the cloned DNA thus obtained is introduced into a host such as the E. coliformes 11 old 01 strain to obtain a transformant, which is then cultured and L-
Human necrotic prisoner polypeptide can be obtained by separating and purifying the protein using 9213 cytotoxic activity as an indicator. In order to further increase the expression efficiency, the human cancer necrosis factor-encoding region of the cloned DNA of the present invention is cut out using an appropriate restriction enzyme, and then inserted into a expression vector having an appropriate promoter. A vector for producing a child polypeptide may be prepared, and examples of promoters include lac promoter, trp promoter, and tac promoter. Examples include PL promoter and SV40 early promoter. Any vector that can be used to propagate in the host to be transformed can be used. For example, plasmids (pBR322, I) DR5/10, etc.),
Phages (such as lambda phage derivatives). Examples include viruses (SV40, etc.). These may be used alone or in combination, e.g. f) 13 R32
It may also be used in the form of a 2-SV40 hybrid plasmid or the like. A vector incorporating the cloned DNA thus obtained is allowed to act on a suitable host for transformation using a conventional method to obtain a host for expression. As a host used for transformation, for example, the large intestine orifice. Examples include microorganisms such as Bacillus subtilis and yeast, cultured animal cells such as COS onkey cells, and cultured plant cells. The human cancer necrosis factor of the present invention has an amino acid sequence that is extremely homologous to that of the rabbit cancer necrosis factor, and high homology is also observed in the DNA base sequence. Table 2 shows the homology of the amino acid sequences of the precursors of human cancer necrosis factor and rabbit cancer necrosis factor, and Table 3 shows the homology of the base sequences of DNA encoding the precursors of human cancer necrosis factor and rabbit cancer necrosis factor. As explained in Japanese Patent Application No. 58-228790 (Japanese Unexamined Patent Publication No. 60-120990), rabbit cancer necrosis factor exists in the form of aggregates in the absence of urea, and is shown in Table 2. It is believed that the basic structural unit is a polypeptide consisting of 154 amino acids starting from the 82nd Set and ending with the 236th Leu. That is, it is thought that the N-terminal portion of the precursor polypeptide is cleaved and activated by an appropriate enzyme in vivo. In the case of human cancer necrosis factor, m 82nd Se
A polypeptide consisting of 155 amino acids starting from t and ending with Leu at position 236 is considered to be the basic building block of human cancer necrosis factor. As is clear from Tables 2 and 3, the homology between the amino acid sequences of the human and rabbit light necrosis factor polypeptides is 81%, and the homology between the DNA base sequences encoding each is 85%. In addition, high homology was observed between the human necrotic prisoner precursor and the rabbit lamp necrotic prisoner precursor, with 78% polypeptide amino acid sequence homology and 8% base sequence homology.
It is 4%. This high degree of homology between human and rabbit cancer necrosis factors leads us to infer that both cancer necrosis factors are phylogenetically derived from a common molecule, and that necrosis factors are found in regions of extremely high homology. This suggests that there is a region essential for the expression of biological activity of necrosis factor, and that it is the active center of necrosis factor. AGA TCA GCT TCT CGGAC
CCCG AGT GACAAGGCCCTG
AGT GACAAGGGCGTCTTCCAG
TTG °480 GAG AAG GGT GACCGG (***
) indicates a stop codon. As shown in the test examples below, human cancer necrosis factor is a polypeptide that does not immunologically cross-react with rabbit cancer necrosis factor and is immunologically distinguishable from rabbit cancer necrosis factor. Although human and rabbit cancer necrosis factors show high overall homology, there are clear differences in their polypeptide properties. (If the amino acid sequence of the part constituting the active center is the same, even if the amino acid sequence of other parts changes slightly and the properties of the polypeptide change accordingly, the activity of the necrosis factor remains unchanged.) Based on the knowledge of the amino acid sequence and DNA base sequence of the human cancer necrosis factor polypeptide revealed by the present invention, human cancer necrosis factor was DNA encoding a polypeptide comprising the amino acid sequence of or a polypeptide comprising the active center portion of human cancer necrosis factor
Alternatively, partially modified variants of human cancer necrosis factor DNA can be obtained, and using them, polypeptides having human cancer necrosis factor activity can be easily produced. In addition, by chemically synthesizing a part of the DNA base sequence revealed by the present invention and using it as a probe, human cancer necrosis factor DNA with allelic gene mutations and degenerate gene codes can be easily detected. are available and can be used to produce polypeptides with human cancer necrosis factor activity. Furthermore, based on the amino acid sequence of human cancer necrosis factor polypeptide, it is also possible to totally synthesize the DNA of the base sequence encoding it. All of these are included within the scope of this invention. Since the human cancer necrosis factor polypeptide of the present invention has excellent anti-ulcer effects, it can be used as an anti-tumor agent in the treatment of malignant HID. The present invention will be explained in more detail below with reference to Examples and Reference Examples, but the present invention is not limited to these Examples. Example (Ivy) Probe for detecting cloned DNA encoding human cancer necrosis factor: J4 Japanese Patent Application No. 1987-228790
No. 0) (for example, the method of Reference Example 2)
Accordingly, cloned DNA encoding rabbit cancer necrosis factor shown in Table 1 (already listed) was obtained. This DNA was excised using restriction enzymes 11aarl and ^vaI to obtain a DNA fragment consisting of 88 bp from number 33 to 120 and a DNA fragment consisting of 299 bp from number 285 to 583, respectively. The 299 bp DNA fragment excised with vaI into the restriction enzyme cord corresponds to the region encoding rabbit tumor necrosis factor, and the 88 bp DNA fragment excised with 1 laell corresponds to the region encoding rabbit necrosis prisoner precursor. be. These two types of DNA fragments were labeled with 32p and used as probes for cloning human cancer necrosis factor c DNA,
Used in section (8). (2) Interpretation of mRNA fraction from human alveolar macrophages 6.3>107 alveolar macrophages were collected from human lungs using phosphate buffered saline. The alveolar macrophages were treated with RPMI-containing Iθ% tallow blood 1i17.
If) Suspend in 40 medium
= s) so that each seedling has 9 x 106 seeds, and grown at 37°C in air containing 5% carbon dioxide gas at a humidity of 90~90°C.
Precultured at 100%. After 1 hour of pre-incubation, E. coli/todoxy/(Nori boboli subcharide derived from E. coli). TI'A (phorbol-12-myristate-13-
Acetate) and cycloheximide were added and mixed to a final concentration of 1 μg/it, IOng/it, and 1 μg/11, respectively, and the culture was continued. 4-4.
After 5 hours (5 to 5.5 hours in total), the culture medium was removed by suction, and the macrophages remaining on the dates were treated with a 5M guanidyl thiocyanate solution containing 0.6% sodium lauroyl sarcosate and 6mM sodium citrate. Dissolve in
Homogenized. Add this homogenate to 0.1MEDT
The total RNA was superimposed on a 5.1 M cesium chloride aqueous solution containing A, and centrifuged at 20,500 rpm for 20 hours using an ultracentrifugal +m machine (RPS27-20-1 Hitachi, Ltd.).
The fractions were obtained as pellets. Add this to 0.35M NaC
1°20mM Tris and 20mM EDTA
It was dissolved in a small amount of 7M urea solution containing 100% urea and recovered as an ethanol precipitate. Total RNA of <159 μzh was obtained. This total RNA fraction was dissolved in IOmM containing 1mM EDTA.
Tris-HCNU street solution (pH 7,4> (hereinafter referred to as T
(referred to as Solution E) was dissolved in 1 part of the solution and heated at 65°C for 5 minutes. After adding NaCl solution to 0.5M, the adsorbed p
By eluating oly(A) mRNA with TE solution,
9ugf) poly(A) mRNA was obtained. This poly(A) mRNA was dissolved in distilled water at 1.9 ng/nl at 0 degrees, and 50 nl of this was injected per African frog oocyte, and the oocytes were cultured according to the method described above. The L-929 cytotoxic activity of the translated protein was measured. As a result, an activity of 6.6 units/ml was observed in 0.1 ml of homocyne of 10 oocytes.
It was confirmed that this Poly(A) mRNA preparation contained human cancer+s death factor mRNA. (3) Synthesis of cDNA Using the poly(^) mRNA obtained in section (■) as a template, G
The method of Ubler et al. [Gene, 25, 283 (198
cDN, A was synthesized according to [3)]. Reaction liquid volume: 40μ! 50mM Tris-HCI buffer (pH 8,3);
10mM MgC12; 10mM dithiothreitol; 4mM pyrophosphate thorium; 1.25mM dGTP, dATP,
dTTP; 0.5mM dCTP: 0.107μ
M a-”P-dCTP (specific activity 3000C+/mmo
le); 4 μg oligo(dT) 12-Ill;
6 μg poly(^) mRNA; 120 units avian osteogenic leukemia virus-derived reverse transcriptase. After reacting at 43°C for 30 minutes, EDTA was added to stop the reaction, and a phenol-chloroform mixture (1:1
), and ammonium acetate was added to the aqueous layer to a final concentration of 2.
．． The reaction product (single-stranded cDNA-RNA complex) was precipitated with ethanol. This single-stranded cDNA-RNA complex was mixed with reaction buffer 1 having the following composition.
00 μl. Reaction buffer composition: 20mM Tris-HC1mm liquid pH 7,
5); 5mM MgC12; 10mM (N)1
4) 2sOa; 100mM KC1; 0.15
mM β-==+tinamide adeni/dinucleotide; 50 ng/■1 bovine serum alpumi/; 40 nM dG
TP, dATP, dTTP. dCTP; 0.9 units colonic ribonuclease I-1
; 23 units of large intestine DNA polymerase 10 After reacting at 12°C for 60 minutes and then at 22°C for GO minutes, EDTA was added to stop the reaction, extracted with a phenol-chloroform mixture in the same manner as above, and precipitated with ethanol. Double-stranded cDNA was obtained. (4) Preparation of oligo(dC) tailed c DNA (3
100 μl of a reaction buffer having the following composition was added to the double-stranded cDNA obtained in section 2.) and reacted at 37° C. for 30 minutes to add an oligo (dC) tail to the double-stranded cDNA. Reaction buffer; 2mM COCl2.0.2mM dithiothreitol, 0.1mM a-"I'-dcTI' (specific activity 3C
i/mmole) and 10!11. 100 containing terminal deoxy7 nucleotidyl transferase
mM sodium cacodylate (pH 7.2). The reaction was stopped by adding an aqueous EDTA solution. It was extracted with a mixture of alcohol and chloroform, and the oligo(dC) tailed cDNA was precipitated with ethanol and recovered. This was mixed with 10mM Tris-11CH8f) liquid (
pl+7.4>. Add 2 μg of oligo(dC) tail per 11 c to an aqueous solution containing 1 mM EDTA and 100 mM NaCl.
It was dissolved to contain the DNA. ■Oligo (dG) tailed plasmid pIIR322
Preparation of DNA 20mM Tris-HCI) 1 buffer (pH 7,4)
, 10mM MgC12゜50mM (NHa) 2
304 and 1 ■ 0.1 per 1. 100μj of an aqueous solution containing 1n of bovine blood! 108g of pHR322
The mixture was dissolved, 15 units of restriction enzyme Pst I endonuclease was added, and the mixture was reacted at 37°C for 1 hour. After the reaction was completed, the reaction solution was extracted with a mixture of 7 enol and chloroform, and DNA was recovered from the aqueous layer by ethanol precipitation. The obtained DNA was added to the aqueous solution used for the oligo(dC) tail addition described above (however, 'I(-dGTr' was used instead of 'P-dCTP').
(including) 200μ! at 37°C using 80 units of terminal deoxynucleodedyl transferase.
About 10-15 dG residues were incorporated. The reaction solution was extracted with a phenol-chloroform mixture, and oligo(dC) was extracted from the aqueous layer by ethanol precipitation.
Tailed plasmid pnR322 DNA was recovered. This was added to 20 μg of oligo(dC) per 111 in the same buffer as for oligo(dC)-tailed cDNA.
The tailed plasmid 1R3221)NA was lysed to contain it. (6) Preparation of recombinant plasmid Oligo (dC) tailed cDNA obtained in section (4)
120μp of dissolved a, oligo (dC) tailed flR322DNA 1B solution obtained in section 5) + 20μff,
! -'KA combination L, 5 minutes at 65°C, 120°C at 57°C
Annealing was performed by incubating for a minute, and a recombinant plasmid solution was prepared. (Selection of transformants Using the recombinant plasmid solution obtained in section (6),
, coli χ1776 strain was transformed. That is, E,
coli χ1776 strain (8TCC No. 31244)
, diaminopimelic acid 100μg11 and Dimidi/4
Culture in L-Pros 201 supplemented with 0 μg 1m+ at 37°C until the absorbance (00Onen) reached 0.5, collect the bacterial cells by centrifugation at 4°C, and collect 50mMCaC+2-containing fT l0.
mM Tris-11CI buffer (pH 7,3)
It was dispersed in 10w1 and centrifuged again at 4°C to precipitate it. The collected bacterial cells were dispersed in the same buffer solution 21 and allowed to stand at 0°C for 5 minutes. Add 0.1 x 1 of the recombinant plasmid solution obtained in section (6) to 0.2 ml of this dispersion, mix, and heat at 0°C.
After being left at 42° C. for 15 minutes and further kept at 42° C. for 2 minutes, 0.51 g of Shiichi broth having the same composition as that used in the previous culture was added and shaken culture was performed for 1 hour. A portion of this culture solution was strained and spread on an L-broth agar plate containing 15 μg/ml of tetracytalin in addition to the above-mentioned ingredients, and cultured at 37°C for about 12 hours to select tetracycline-resistant bacteria and extract cDNA. A library was created. (8) Chroma; 7g (for the cDNA library obtained in Section 7, in order to screen for transformants having a plasmid containing cDNA encoding human tumor necrosis factor, The 32p fragment (299 bp) of the DNA encoding rabbit tumor necrosis factor was excised with the restriction enzyme ^vaI.
Using a labeled substance as a probe, a colony hybridization zeta 3 test was performed using the method of Anahan et al. [Gene, I
on03 (1980>). From about 20,000 colonies, 43 transformants having a recombinant plasmid containing a base sequence that strongly binds to this labeled probe were selected. Furthermore, these 43 colonies were For restriction enzyme 11a
Secondary screening was performed using an ff2p-labeled DNA fragment (88 bp) corresponding to the second stream of the rabbit necrosis prisoner coding region excised with cll as a probe, and six colonies that strongly hybridized with this probe were selected. Through these two rounds of screening, DNA containing a DNA base sequence encoding rabbit cancer necrosis factor and a base sequence highly homologous to its upstream portion was obtained. (9) Character expression The six clones selected in (8) (plasmid number 1
) TITNF-1, -4, -5, -13, -22, -2
6), remove each recombinant plasmid from
E, col+1111101 strain (ATCC No. 33
094) was used as a host to obtain a transformant. For each transformant, the method of Nagata et al.
e, 284.310 (1980)]. Ln Pross was used as a medium. Absorbance (Go
culture until the concentration (on soybean) is about 0.8, and about 3 to 5 x 10
1θ bacterial cells were collected. 50 containing 0.1% lysozyme
mM Tris-TICI buffer (pl+8.0
The cells were suspended in 1 I of a solution consisting of
The cells were repeatedly destroyed and centrifuged to obtain a cell extract. As a result of measuring the L-929 cytotoxic activity of the extract obtained from each transformant, it was found that the extract of the transformant with plasmid pl-ITNF-13
An activity of 80.1 units and 11 was observed. (II) Determination of the base sequence of cloned DNA The transformant using the recombinant plasmid PIITNF-13 selected in section (9) was cultured in LI3 gloss to obtain bacterial cells. This bacterial cell was prepared using the method of WNkie et al. [Nucleic^c+d
s Ras, 7, 859 (1979)] to obtain plasmid DNA. This plasmid DNA was digested with restriction enzyme Pst I, separated and purified to obtain cloned DNA. The cloned DNA fragments were digested with various restriction enzymes, and the base sequences of each of the 10 restriction enzyme fragments were dephosphorylated using the Maxam-Gilbert method, end-labeled with P, base-specific chemical decomposition reaction, and gel electrolysis. It was determined by electrophoresis and autoradiography. The figure shows the cleavage site of the restriction enzyme used to determine the base sequence and the direction and range (indicated by arrows) where the base sequence was determined. The logo 3 portion indicates the region encoding the human cancer necrosis factor precursor polypeptide. The base sequence and the amino acid sequence translated from this base sequence are shown in Table 4. The region encoding the polypeptide of human cancer necrosis factor was estimated based on the homology with the nucleotide sequence encoding rabbit cancer necrosis factor shown in Table 1. That is, the human necrosis convict polypeptide starts from TCA codons 235-237 (corresponding to Set) in Table 4, ends with CTG (corresponding to Leu) 697-699, and consists of 155 residues. Consists of amino acids. There is a TGA stop codon following the loin/codon at the C-terminus. Base sequences 1 to 234 are considered to be sequences necessary to encode the precursor of human cancer necrosis factor. Table 4 CTCCACCCTCTCTC GACCCACGG -10-I CCCTGGAAAGGACACC TCTCGAACCCCGA( SerArgThrPros(1' ) 1s01- CATGTTGTAGCAAAC Hi 5ValValA1 aAsn (”':T(”:CTCACCCACACCCCCTCA
AGCTGAGGGG ProGl nA1 aGl uGl yAACCGC
CGGGCCAAT AsnArgArgAl aAsn GGCGTGGAGCTGAGA GlyValGl uLeuArg GTGCCATCAGAGGGC Val ProSe rGl uGl yATCAGC
CGCATCGCC LeuLeuThrHi 5Thr I I eSe rArgI l eAla'GACC
GACTCAGCGCT AspArgLeuSerA1 a GAGATCAATCGGCI GluI 1eAsnArgP GCCGAGTCTGGGC AlaGluSerGlyG ATTGCCCTGTGAG( I l eAI aLeu*zero* C TTCCCAAACGCC' (***) is the stop codon p. CCGACTATCTCGACTTT roAspTyrLeuAspPh, eCAGGACG
AACATCCAAC rCCCCTGC Indicates death. (Leaving space below) Reference Example 1 Preparation of anti-Japanese heron thick necrosis antibody
No. 0) (for example, the method of Reference Example 3)
Purified rabbit necrotic prisoners 1.9X 105 obtained according to
The fg solution containing the unit was emulsified with an equal volume of Freund's complete adjuvant and injected subcutaneously at several points on the back of guinea pigs. Thereafter, immunization was carried out in the same manner after 3, 3 and 6 weeks. After 8 days, the same J+t purified rabbit cancer necrosis factor was intraperitoneally injected together with aluminum hydroxide gel. Nine weeks after the first immunization, whole blood was collected from the heart, and the serum was separated by centrifugation to obtain anti-blood 1'i7 containing anti-heron necrosis antibody. This anti-blood t? 7 was repeatedly passed through a Sephas 411 (Pharmacia) column coupled with normal rabbit serum components three times to obtain rabbit blood 1? ? Antibodies against the components were completely removed to obtain purified anti-blood ln containing only specific antibodies against rabbit cancer necrosis factor. This antiserum formed a single sedimentation line only with purified rabbit cancer necrosis factor by immunoelectrophoresis and in-gel double diffusion. This purified antiserum was diluted approximately 0 to 10 times, and the L-029 cytotoxic activity of rabbit cancer necrosis factor was 500 times more diluted.
Impair the ability to neutralize units by 50%. Reference Example 2 (1) Isolation and purification of mRNA fraction from rabbit alveolar macrophages A rabbit (2.5 kg in weight) was infected with Propionibacterium acnes 7, (Propion+bacterium
The dead bacteria (acnes) were injected intravenously at a dose of 100 μm per bird, and sacrificed 80 days later. Immediately, a thoracic tracheotomy was performed, and lung lavage was repeated using phosphate-warmed saline through a tube inserted into the trachea to collect alveolar macrophages. Approximately 3 x 10' alveolar macrophages were obtained from 12 rabbits. These alveolar macrophages were suspended in R1'' Ml-1640 medium containing 10% tallow serum, plated on Vetri dishes (diameter 8 cs) at 2 x 107 cells per plate, and incubated at 37°C with 5%
Preculture was performed in carbon dioxide-containing air at a humidity of 90 to 100%. After 1 hour pre-incubation, endotoxin (Nori bobo saccharide from E. coli). TI'A (phorbol-12-myristate-13-acetate) and ncroheximide were each added to h% C
The degree is 10 tt g/*I, IOng/w
The mixture was added and mixed at a concentration of I and lμg/ml, and the culture was continued. After 4-4.5 hours (total 5-5.5 hours)
The culture solution was removed by suction, and the macrotage remaining on the dish was dissolved and homogenized in a 5M guanidylgoocyanate solution containing 0.0% sodium lauroyl sarcosinate and 6mM sodium citrate. This homogenate was mixed with 0. r3. on a 5.7 M aqueous cesium chloride solution containing IM EDTA. Layer and ultracentrifuge (RI) S
20,500
The whole RNA was centrifuged at rp- for 20 hours to obtain a total RNA fraction as a pellet. This was mixed with 0.35M NaCI, 20mM T
It was dissolved in 7M urea solution containing riS and 20mM EDTA and collected as an ethanol precipitate. 12
5.2 Mg of total RNA was obtained from feathered rabbit. This total RNA fraction was dissolved in 10mM containing 1mM EDTA.
Tris-11cIIW street liquid (all 7.4) (
(hereinafter referred to as TE solution) 2-1 and heated at 65° C. for 5 minutes. After adding NaCl solution to 0.5M, it was applied to an oligo(dT) cellulose column equilibrated with TE solution containing 0.5M NaCl, and the adsorbed poly(^) mRNA was extracted with TE solution. By elution, 31 Aug of poly(^) mRNA was obtained. 200 μg of the poly(^) mRNA obtained here was subjected to agarose gel electrophoresis (gel concentration 1%, in the presence of 8M urea,
pH 4), divided into seven fractions according to their molecular size, melted the gel (70°C for 110 minutes), extracted with water-saturated phenol and chloroform, and precipitated with ethanol to separate both fractions. More poly
(^) mRNA was collected. poly(^)m of each fraction
Regarding RNA, rabbit cancer necrosis factor mRNA fl was measured using a method using African frog oocytes, and rabbit cancer necrosis factor mRNA fl was recovered at a high concentration in both portions, which corresponded to a molecular size of 1.6 to 2.7 kb. did. This purified p
The specific activity of oly(^) mRNA is approximately 1,230 units/
pg RNA, unpurified poly(^) mRNA
The specific activity of the UR product was about 320 units/μg RNA, which was reduced by about 4 times. The essence obtained here! i! ! Poly(^) mRNA was used in the following experiments. Synthesis of cDNA cDNA was synthesized using f+'i's poly(8) mRNA 4 ttH under the conditions shown below. Reaction liquid volume: 100μ! 50mM Tris-Ilc IG buffer solution p
H8,3) ; IOmMMHCI 2 near 0mM K
CI: 1mM dithiothreitol; 0.5mM
Labeled with dTTP, dCTP, dATr', dGT, r' (however, dCTP is 32■), specific activity 4.4X 10'
cps/nmole): 3μg oligo(dT)
12-+g, 80 units avian osteogenic leukemia virus-derived reverse transcriptase. After reacting at 43°C for 80 minutes, the reaction was stopped with an aqueous EDTA solution. Phenol-chloroborum mixture m (1
:1), the cDNA-mRNA complex was extracted, precipitated with ethanol, and collected. Furthermore, after the mRNA was decomposed and removed by alkaline heating treatment, the synthesized single-stranded CDNA was precipitated with ethanol and recovered. This single-stranded cDNA precipitate was mixed with a reaction buffer of the following composition:
Dissolved in μl. Reaction buffer; 0.5mM dATr', dTTI', dGT1'
, dCTP; 5mM MgCI2; 70mM
KCI; 1.5mM β-mercaptoethanol; 8
0, 1 M Hepes (ll0PQs) buffer G containing unit E. coli DNA polymerase I (large fragment)
(pHO, 9). Double-stranded cDNA was synthesized by reacting at 15°C for 20 hours. The reaction was stopped by adding an aqueous solution of sodium dodecyl sulfate to the reaction solution, and the double-stranded cDNA was extracted with a phenol-chloroform mixture, precipitated with ethanol, and recovered. The resulting double-stranded cDNA precipitate was mixed with 50mM sodium acetate (PI-14,5), 1mM
ZnSO4, 200mM NaC+. 100μ of an aqueous solution containing 0.5% glycerol and 0.5 units of S1 nuclease! The hairpin structure was cleaved by reacting at 37°C for 20 minutes. The reaction is EDT
The mixture was stopped by adding an aqueous solution of A, extracted with a phenol-chloroform mixture, and re-extracted with ether, and then precipitated with ethanol to recover cDNA. (3) Preparation of oligo(dC) tailed c-DNA Add 100μ of the following reaction buffer to the double-stranded c-DNA obtained above. was added and reacted at 37°C for 20 minutes to add an oligo(dC) tail to the double-stranded cDNA. Reaction buffer; 1mM COCl2.0.1mM dithiothreitol. 0.2uy poly(^), O, ImM 'II-dc
Tr' (specific activity 5400cp*#+■of) and 10!
l', 130mM sodium cacodylate-30mM Tris-11CI buffer containing terminal deoxynucleotidyl transferase (pI
IO, 8). The reaction was stopped by adding an aqueous EDTA solution, extracted with a phenol-chloroform mixture, and re-extracted with ether, and then the oligo(dC) tailed cDNA was precipitated with ethanol and recovered. This was added to 10mM Tris-HC1 buffer (PH7
,4>, 1mM EDTA and 100mM NaCl
0.2 μg of oligo(dC) per 1×1 in an aqueous solution containing
lysed to contain the tailed cDNA. (4) Oligo(da) tailed plasmid pI3R3
Preparation of 22DNA 20mM Tris-HC1mm liquid pII
7.4), 10mM MgC12, 50mM (Nl
(4) Add 100 μl of pnR322 to 100 μl of an aqueous solution containing 2304 and 0.1 μ/ml of bovine serum Alpumi/ml.
Dissolve az and add restriction enzyme 1'5t (z7 donuclease 1
5 units were added and reacted at 37°C for 1 hour. After the reaction was completed, the reaction solution was extracted with phenol, and DNA was recovered from the water injection by ethanol precipitation. The obtained DNA was used in the aqueous solution used for the oligo(dC) tail addition described above (however, '14-
200μ containing 'H-dGTP instead of dcTI'
! and reacted with 80 units of terminal deoxynucleotidral transferase at 37°C for 20 minutes to incorporate approximately 10-15 dG residues. The reaction solution was extracted with a water-saturated phenol-chloroform mixture, and the oligo(dC) tailed plasmid pBR322 DNA was recovered from the aqueous layer by ethanol precipitation. This was dissolved in the same buffer as in the case of the oligo(dC) tailed cDNA so that each tablet contained 2 μg of the oligo(dC) tailed plasmid 1R322 DNA. 6) Preparation of recombinant plasmid Add 50 μl of oligo (dC) tailed c DNA solution to oligo (dc) tailed p11 R322 DNA solution 5
0 μl and 120 min at 65 °C and 120 min at 57 °C.
Annealing was performed by incubating at 45°C for 60 minutes, at 35°C for 60 minutes, and in a chamber press for 60 minutes to prepare a recombinant plasmid solution. (6) Selection of transformants Using the recombinant plasmid solution obtained above, E.
E. coli χ1776 strain was transformed. That is, E, c
oliχ1776 strain was treated with diaminopimelic acid + 00uH.
/-1 and L-BrJ supplemented with 40μg/■1 of thymidine
The cells were cultured at 37°C in 201° C. until the absorbance (Coons) reached 0.5, and the cells were collected using a centrifugal tt machine equipped with a condenser.
It was dispersed in 10 ml of 1CI tilt solution (Liquid 7.3) and centrifuged again at 0°C to precipitate. The collected bacterial cells were dispersed in the same buffer solution 21 and allowed to stand at 0°C for 5 minutes. Add 0.1 ml of the above recombinant plasmid solution to 0.2 ml of this dispersion.
After adding and mixing L.
- 0.5 x 1 broth was added and cultured with shaking for 1 hour. A portion of this culture solution containing 15 μg/-1 of tetracycline in addition to the above-mentioned components was spread on a broth agar plate, incubated at 37°C for about 12 hours, and tetracycline-resistant mutants were selected to generate a cDNA library. Created. ■ HyplidyE 2g/Test Regarding the above-mentioned cDNA library, 22 p-labeled cDNA was used to screen for transformants carrying a plasmid containing cDNA encoding rabbit tumor necrosis factor.
A colony hybridization test using a probe was performed using the method of Hanahan et al. [Ge.
ne, 10.03 (1980)]. The 32P M'3 recognition cDNA probe was synthesized by the method described in section (2) using the mRNA obtained from induced plus and minus alveolar macrophages by the method described in section (1) above as a template. However, "P-dCTP was used with high radioactivity specific activity and was labeled at a high concentration. In this test, dJfJ
We selected transformants carrying recombinant plasmids containing a base sequence that strongly binds to the plus probe and does not hybridize to the induced minus probe. 50 colonies were selected from approximately 20,000 colonies. These selected strains were then subjected to hybridization and translation tests (Maniatis, et al., (cd) “Molecular Translation”).
Cloning”, 329 (1982) + Col.
It was carried out according to the method described in Spring 1 Labor Lab, ). Plasmid DNA was extracted from each transformant, heat-denatured and fixed on a nitrocellulose filter, and the above (1)
Poly(
^) The mRNA fraction was added and reacted at 50°C for 180 minutes to perform /1 hybridization/. bound mR
After elution and recovery of NA, it was injected into African frog oocytes, and the recovered mRNA was found to be rabbit necrotic prisoner mRNA.
It was tested whether it was A or not. Through this test, rabbit necrotic convict mR was obtained from the 20 transformants selected above.
Three strains were found that had plasmids containing cDNA that strongly hybridized with NA. The longest cD
NA (approximately 750 bp) from the Lyr t Z plasmid, restriction yeast de I 1? The DNA fragment was cut out and used as a probe for secondary screening. This DNA fragment was labeled with 32p, and the cDNA library obtained in section (6) above was subjected to a colony hybridization test again to determine which cDNA strongly binds to the labeled probe.
Transformants carrying a plasmid containing A were selected. c D
Of approximately 60,000 colonies in the NA library, 98 were positive colonies. The cDNA was excised from these using the restriction enzyme Pst I, and its size was examined by polyacrylamide gel electrophoresis, and 17 clones with a size of 1 kbp or more were selected. body (bacterial cell number: RTNF
802, cloned DNA number: f) RTNF80
Regarding 2), the cloned DNA was 'F-nt'ed and the base sequence was determined by the method described below. (8) Ri

[J-7 1) Determination of the nucleotide sequence of NA (The strain selected in Section 9 (RTNP802) was cultured in broth to which diami7pimelic acid and dimidyl/diamide were added to obtain bacterial cells. The bacterial cells were collected using the method of Wilkia et al. [Nucle+c Ac1ds Ras, 7, 8
59 (+979>1) and plasmid DNA
I got it. This plasmid DNA was digested with restriction enzyme Pst I and purified and separated to obtain cloned DNA. This cloned DNA fragment was digested with various restriction enzymes, and the respective salt Jλ sequences of the appropriate restriction enzyme fragments were dephosphorylated by the Maxam-Gilbert (Ma & ■-Gilbert) method, end-labeled with P, and base Determined from specific chemical decomposition reactions, gel electrophoresis and autoradiography. Table 1 shows the salt product line for one person. Reference Example 3 Qj Isolation and Purification of Rabbit Cancer Necrosis Factor Rabbits (body weight 2.5-3.0 kg) were treated with Propionibacterium acnes (Propionibactertu
50 g of dead bacteria (acnes) was injected into the ear vein. Eight days later, 100 μg of endotoxin (Escherichia coli derived paste) was injected into the ear vein, and 2 hours later, whole blood was collected from the heart. +00 for collected blood ■1 per 1
After adding 00 units of heparin sodium, 5,0OO
A refrigerated centrifugation operation was performed at RP■ for 30 minutes to remove blood cells and undissolved solids. 3,00011 from 400 rabbits
A blood stain 241 having a titer of 1-1 was obtained. To this plasma 241, EDTA 24g and Celite 240g
After adding and stirring for 1 hour, the pore sizes were 3μ, 1μ and 0.2μ.
It was sequentially filtered through the following filters. '/2 liquid 24! to 0.04M T r i s -11
After adding CI buffer (f) II 7.8) + 21', 0.04M Tri containing O, IM NaCI
The mixture was gradually applied to a DEAE-Sepharose CL-6B (Pharmacia) column (27X 45cm) fully equilibrated with 5-TIC+buffer (f) 87.8). Then column equilibration buffer 751 and 0.15M NaC
+0.04M Tris-11CI buffer Z (
After sequential washing with PI (7,8>501, 0.18M Na
Elution was performed using 0.04M Tris-HC1 buffer (pH 7,2) containing CI. The eluate was fractionated into 81 fractions and active fractions were collected. Add the same volume to this active fraction.
of 0.04M Tris-11CI buffer (pl-1
7, 8) and diluted with DICAE-Sepha 0-
A column of CL-6B (IOX 13CI+) was applied to the column (IOX 13CI+).
After washing with i s -11CI buffer (pTI7.8), 0.0 containing O,18M NaCI
4M Tris-11CI buffer (pH 7,
2) Elution was performed using 51. The eluate was fractionated into 2501 fractions and active fractions were collected. Next, this eluate was transferred to a container, immersed in a 70°C water bath, and heated while stirring until the temperature of the eluate reached 60°C. Thereafter, it was transferred to another water bath at 60°C, heated for 30 minutes, and then quickly cooled to 4°C. The heat-treated solution is
Concentrate by ultrafiltration. 0.005M phosphate buffer 1i containing 0.1M NaC+
Sephacryl S-200 (Pharmacia) column (5X 80c) fully equilibrated with IE (pII 7.4)
(2) was added with a diluted solution and eluted with the same buffer. 40
The active fractions were collected by fractionation and concentrated by ultrafiltration. The active fraction obtained by gel filtration was converted into Zn2
It was applied to Chelate Sepha O-Scolumn. The method of Porath et al. (Nature, 25
Chelate Cepha 0 obtained in 8,598 (1975>)
Column (1 column packed with iminodiacetic acid fixed resin)
. Then O, IM containing 0
．． After sufficient equilibration with 05M phosphate buffer (pH 7, 4), the concentrate obtained in the previous step was applied, and the non-adsorbed fraction eluted with the same buffer was collected. Most of the activity was recovered in both parts. The active components obtained in the pre-purification step were reduced to 0, and Toyovar I was sufficiently equilibrated with a 0.005 M salt/acid solution containing 0.15 M NaCl (pH 7.4).
■W-55 (Toyo Soda Co., Ltd.) column (+, 5X
90cm). The active fraction was collected by elution with the same buffer. Recovery rate of activity through all f+'t'A steps is 60%, what is the degree of purification? , 5X 10' times. The specific activity of the purified rabbit cancer necrosis factor thus obtained was O,OX 10' units/mgfft white matter (
The definition of the active unit is the same as that of JP-A-58-174330). In addition, Meth^meat 1 transplanted into mice
) 3,000~ per animal in biological evaluation using R
5,000! The activity when Ij position is administered intravenously is (
+) or more. Test Example Immunological properties of human cancer necrosis factor Plasmid PIITNF obtained in Section (9) of Example
An equal volume of a 100-fold dilution of the purified anti-Japanese heron necrosis convict anti-11n fit prepared in Reference Example 1 was added to the extract of the transformant obtained by -13. After incubating the mixture at 37°C for 2 hours, the cytotoxic activity against L-920 cells was measured. The results are shown in Table 5. As is clear from Table 5, human cancer necrosis factor does not cross immunologically with rabbit cancer necrosis factor.
90) (method of Reference Example 3) [Brief explanation of the drawings] The drawings show the restriction enzyme cleavage process used for base sequencing of cloned DNA encoding human cancer necrosis factor. The direction and range in which the site and base sequence were determined are shown. Patent applicant Dainippon! ! 8Ia! - Co., Ltd. agent Takashi Minami Daikojima - Kotsubo Iko Four-part drawing C':' L < + No change to δ) Figure 1 Procedure amendment (method) % formula % 1. Indication of the case Showa 1963 Patent Application No. 220749 Address 3-25 Doshomachi, Higashi-ku, Osaka Name (291)
) Dainippon Pharmaceutical Co., Ltd. 4. Agent address: Sogo Daiichi Building, 3-2 Kojimachi, Chiyoda-ku, Tokyo (all date sent: December 20, 1988) 6. Subject of amendment: Brief explanation of drawings in the specification. Column and 7. Contents of amendment

[Brief explanation of the drawing]

In the specification, the description of “Drawings” in the bottom three lines of page 66 has been changed to “First
Corrected to ``Figure''. 1!0 Drawing The attached drawing, Figure 1, will be replaced with the previously submitted drawing. that's all

Claims (5)

[Claims] (1) Polypeptide containing human cancer necrosis factor or its active center consisting of the following amino acid sequence: [There is an amino acid sequence. ] (2) Human cancer necrosis factor precursor consisting of the following amino acid sequence: [There is an amino acid sequence. ] (3) DN encoding human cancer necrosis factor or its precursor
A method for producing a polypeptide having human cancer necrosis factor activity, which comprises constructing a gene expression vector by inserting A into a gene expression vector, introducing the vector into a host cell, and culturing the transformant. . (4) The polypeptide having human cancer necrosis factor activity according to claim (3), wherein the DNA encoding human cancer necrosis factor is a DNA encoding human cancer necrosis factor consisting of an amino acid sequence represented by the following formula. Production method of peptide: [There is an amino acid sequence. ] (5) The manufacturing method according to claim (4), wherein the polypeptide having human cancer necrosis factor activity is a polypeptide consisting of the following amino acid sequence: [There is an amino acid sequence. ]