JP7487040B2 - Kit for evaluating gene mutations associated with myeloproliferative neoplasms - Google Patents

Description

The present invention relates to a probe set capable of evaluating gene mutations useful as a diagnostic item for myeloproliferative neoplasms, and a microarray equipped with the probe set.

Myeloproliferative neoplasms (MPNs) are diseases that develop when myeloid cells become neoplastic. MPNs are characterized by the dramatic proliferation of myeloid cells (granulocytes, blasts, megakaryocytes, mast cells, etc.). MPN includes chronic myelogenous leukemia (CML), chronic neutrophilic leukemia (CNL), polycythemia vera (PV), primary myelofibrosis (PMF), essential thrombocythemia (ET), chronic eosinophilic leukemia (CEL), hypereosinophilic syndrome (HES), mastocytosis, and myeloproliferative neoplasms, unclassifiable (MPN, U).

As described in Non-Patent Document 1, the diagnosis of MPN is based on clinical parameters, bone marrow morphology, and gene mutation data. By combining these, MPN, excluding CML, can be diagnosed in Philadelphia chromosome-negative patients. As gene mutation data, specifically, mutation information on three genes: JAK2, CALR, and MPL, and additionally, mutation information on ASXL1, EZH2, TET2, IDH1/IDH2, SRSF2, and SF3B1, are used. In particular, JAK2, CALR, and MPL are considered to be the molecular basis for the development of MPN, and therefore the presence or absence of mutations in these genes is an important factor in the definitive diagnosis of MPN.

In addition, Non-Patent Document 2 discloses that the JAK2V617F mutation (a substitution mutation of valine at position 617 with phenylalanine) is frequently observed in PV, ET, and PMF, and that a small number of PVs have insertion/deletion type mutations in exon 12 in addition to the above mutations. JAK2 (Janus activating kinase 2) is a gene that encodes a protein that controls the signal of the erythropoietin receptor. In addition, Non-Patent Document 3 discloses that a mutation in exon 12 of JAK2 is associated with polycythemia vera (PV) and idiopathic erythrocytosis (IE). Furthermore, Patent Document 5 discloses that the c2035t mutation (T514M mutation) in exon 12 of the JAK2 gene is detected as a mutation indicating myeloproliferative disease.

Non-patent literature 2 further discloses that MPLW515L/K mutated PMF was found in PMF and ET with respect to MPL. MPL is a gene that encodes the thrombopoietin receptor.

Non-patent literature 2 further discloses that, regarding CALR, type 1 mutations with a 52-base deletion and type 2 mutations with a 5-base insertion are the most frequent, and these mutations are seen in ET and PMF. It is disclosed that type 1 mutations are more frequent in PMF and are associated with the transformation of ET to myelofibrosis. CALR is a gene that encodes calreticulin, a molecular chaperone of the endoplasmic reticulum.

Furthermore, Patent Document 1 discloses a JAK2V617F site-specific fluorescently labeled probe as a method for analyzing mutations in the JAK2 gene. Patent Document 2 discloses a technique for detecting mutations other than the JAK2V617F mutation that are found in patients who are negative for the JAK2V617F mutation and exhibit myeloproliferative tumors.

Furthermore, Patent Document 3 discloses a probe set for detecting the W515K and W515L mutations in MPL as a probe for detecting MPL gene polymorphisms.

Furthermore, Patent Document 4 discloses a technique for identifying mutations in CALR.

Furthermore, Patent Document 5 discloses detection of mutations in JAK2 nucleic acid, and discloses a gene mutation present in exon 12 in JAK2. Furthermore, Patent Document 6 discloses that, in consideration of the above-mentioned circumstances, primers and probes have been designed for each gene mutation as a means for simultaneously and easily detecting multiple gene mutations associated with myeloproliferative tumors, and discloses the V617F mutation in JAK2, type 1 and type 2 mutations in CALR, and W515L and W515K mutations in MPL as gene mutations to be detected (five gene mutations in three genes).

In addition, a method for designing a probe for detecting a target gene mutation involves designing a probe based on the base sequence of the surrounding region including the gene mutation. In this case, as disclosed in Patent Document 7, the probe is designed to have a sequence that completely matches the base sequence of the surrounding region including the gene mutation, or a base sequence that includes one or several unnatural nucleotides. A probe that includes one or several unnatural nucleotides does not hybridize with the surrounding region including the gene mutation at the site of the unnatural nucleotide (mismatch). Patent Document 7 describes that this mismatch makes it possible to detect with high accuracy whether or not a target nucleic acid in a sample has a gene mutation.

Patent Publication No. 2012-034580 WO2009/060804 WO2011/052755 Special table 2016-537012 Patent No. 6017136 WO2019/004334 Special table 2000-511434

Francesco Passamonti and Margherita Maffioli, Hematology 2016, p. 534-542 NCCN Clinical Practice Guidelines in Oncology (NCCN Guidelines), Myeloproliferative Neoplasms, Version 2.2017, October 19, 2016 Linda M. Scott et al., N Engl J Med. 2007 Feb 1;356(5):459-68

The present invention aims to provide a gene mutation evaluation kit that can accurately determine the presence or absence of multiple types of gene mutations in CARL among gene mutations associated with myeloproliferative neoplasms, and can determine the presence or absence of myeloproliferative neoplasms with higher accuracy.

The present invention encompasses the following:
(1) A kit for evaluating a genetic mutation in CALR associated with myeloproliferative neoplasms, comprising a CALR mutant probe corresponding to at least one genetic mutation selected from the group consisting of a type 1 mutation (a 52-base deletion) in which 52 bases at positions 506 to 557 in the base sequence of the wild-type CARL gene shown in SEQ ID NO: 10 are deleted, a type 3 mutation (a 46-base deletion) in which 46 bases at positions 509 to 554 in the base sequence of the wild-type CARL gene shown in SEQ ID NO: 10 are deleted, a type 4 mutation (a 34-base deletion) in which 34 bases at positions 516 to 549 in the base sequence of the wild-type CARL gene shown in SEQ ID NO: 10 are deleted, and a type 5 mutation (a 52-base deletion) in which 52 bases at positions 505 to 556 in the base sequence of the wild-type CARL gene shown in SEQ ID NO: 10 are deleted, wherein the CALR mutant probe has a mismatch due to an artificial deletion.
(2) The CALR mutant-type probe for the above-mentioned type 1 mutation has a base sequence in which one or more bases selected from the range of bases 558 to 564 in SEQ ID NO: 10 are deleted, or a complementary base sequence thereto;
The CALR mutant-type probe for the above-mentioned type 3 mutation has a base sequence in which one or more bases selected from the range of bases 555 to 559 in SEQ ID NO: 10 are deleted, or a complementary base sequence thereto;
The CALR mutant-type probe for the above-mentioned type 4 mutation has a base sequence in which one or more bases selected from the range of bases 550 to 558 in SEQ ID NO: 10 are deleted, or a complementary base sequence thereto;
The gene mutation evaluation kit according to (1), wherein the CALR mutation-type probe for the type 5 mutation has a base sequence in which one or more bases selected from the range of 558th to 564th bases in SEQ ID NO: 10 are deleted, or a complementary base sequence thereto.
(3) A gene mutation evaluation kit according to (1), characterized in that the CALR mutation probe for the type 1 mutation comprises the base sequence shown in SEQ ID NO: 95 or a complementary base sequence thereof, the CALR mutation probe for the type 3 mutation comprises the base sequence shown in SEQ ID NO: 53 or a complementary base sequence thereof, the CALR mutation probe for the type 4 mutation comprises the base sequence shown in SEQ ID NO: 54 or a complementary base sequence thereof, and the CALR mutation probe for the type 5 mutation comprises the base sequence shown in SEQ ID NO: 55 or a complementary base sequence thereof.
(4) The kit for evaluating a gene mutation according to (1), further comprising a CALR mutant probe corresponding to a type 2 mutation in which TTGTC is inserted between the 568th and 569th bases in the base sequence of the wild-type CARL gene shown in SEQ ID NO: 10.
(5) A kit for evaluating a gene mutation according to (1), further comprising a JAK2 mutation probe corresponding to a gene mutation in JAK2 associated with myeloproliferative neoplasms and/or an MPL mutation probe corresponding to a gene mutation in MPL associated with myeloproliferative neoplasms.
(6) A data analysis method for diagnosing myeloproliferative neoplasms, comprising using a gene mutation evaluation kit according to any one of (1) to (5) above to identify at least one gene mutation selected from the group consisting of type 3 mutations, type 4 mutations, and type 5 mutations associated with myeloproliferative neoplasms in CARL in a subject.

According to the present invention, it is possible to accurately determine multiple gene mutations (type 1 mutations, type 3 mutations to type 5 mutations) present in CARL, particularly among gene mutations associated with myeloproliferative neoplasms. Therefore, according to the present invention, it is possible to improve the accuracy of diagnosis of myeloproliferative neoplasms using information on the above gene mutations of a subject.

FIG. 1 is a schematic diagram for explaining the deletion regions in type 1 gene mutation, type 3 gene mutation, type 4 gene mutation, and type 5 gene mutation in CARL. FIG. 13 is a characteristic diagram showing the results of measuring each mutant sample and a wild-type sample using the type 3 mutation probe 5, the type 4 mutation probe 5, and the type 5 mutation probe 4 designed in the examples. FIG. 1 is a schematic diagram illustrating primers designed to amplify a region containing multiple gene mutations contained in exon 12 of JAK2. FIG. 2 is a characteristic diagram showing the results of measuring the fluorescence intensities derived from four amplified fragments obtained using the primer set designed in Example 1. This is a characteristic diagram in which the horizontal axis represents the concentration of the labeled primer (forward primer) in the primer set that amplifies the region containing the V617F mutation site, and the vertical axis represents the fluorescence intensity derived from the four amplified regions. This is a characteristic diagram in which the horizontal axis represents the concentration of the labeled primer (forward primer) in the primer set that amplifies the region containing the V617F mutation site, and the vertical axis represents the fluorescence intensity derived from the four amplified regions. This is a characteristic diagram in which the horizontal axis represents the concentration of the labeled primer (reverse primer) in the primer set that amplifies JAK2 exon 12, and the vertical axis represents the fluorescence intensity derived from the four amplified regions. This is a characteristic diagram in which the horizontal axis represents the concentration of the labeled primer (reverse primer) in the primer set that amplifies JAK2 exon 12, and the vertical axis represents the fluorescence intensity derived from the four amplified regions. This is a characteristic diagram in which the horizontal axis represents the concentration ratio between the labeled primer (reverse primer) in the primer set that amplifies exon 12 and the labeled primer (forward primer) in the primer set that amplifies the region including the V617F mutation site, and the vertical axis represents the fluorescence intensity derived from the four amplified regions. FIG. 1 is a characteristic diagram showing the results of detecting the JAK2 V617F mutation and gene mutations present in exon 12, etc., using a mutation model specimen.

The kit for evaluating gene mutations associated with myeloproliferative neoplasms according to the present invention includes a CALR mutation probe that identifies at least one gene mutation selected from the group consisting of so-called type 3 mutations, type 4 mutations, and type 5 mutations as a gene mutation associated with myeloproliferative neoplasms in CARL.

The main types of CALR gene mutations known are type 1 mutation with a 52-base deletion, type 2 mutation with a 5-base insertion, type 3 mutation with a 46-base deletion, type 4 mutation with a 34-base deletion, and type 5 mutation with a 52-base deletion that is different from type 1 mutation. These types 1 to 5 mutations are located at the C-terminus of the CALR protein. In patients with primary myelofibrosis (PMF) or essential thrombocythemia (ET), any of these mutations is seen at a frequency of 20-25%. Type 2 mutations are mainly associated with essential thrombocythemia (ET), and type 1 mutations are involved in primary myelofibrosis (PMF). CALR gene mutations are also seen in myeloproliferative neoplasms that do not have gene mutations in JAK2, which will be described in detail later.

The base sequence encoding wild-type CALR is shown in SEQ ID NO:10. In the case of a type 1 mutation, 52 bases from positions 506 to 557 in the base sequence shown in SEQ ID NO:10 are deleted. In the case of a type 2 mutation, TTGTC is inserted between positions 568 and 569 in the base sequence shown in SEQ ID NO:10. In the case of a type 3 mutation, 46 bases from positions 509 to 554 in the base sequence shown in SEQ ID NO:10 are deleted. In the case of a type 4 mutation, 34 bases from positions 516 to 549 in the base sequence shown in SEQ ID NO:10 are deleted. In the case of a type 5 mutation, 52 bases from positions 505 to 556 in the base sequence shown in SEQ ID NO:10 are deleted.

Figure 1 shows the deletion regions of type 1, type 3, type 4, and type 5 mutations, which are deletion-type gene mutations, based on a part of the base sequence (SEQ ID NO: 56) that codes for wild-type CALR. As shown in Figure 1, type 1 mutation (SEQ ID NO: 57) in which 52 bases are deleted from wild-type CALR, type 3 mutation (SEQ ID NO: 58) in which 46 bases are deleted from wild-type CALR, type 4 mutation (SEQ ID NO: 59) in which 34 bases are deleted from wild-type CALR, and type 5 mutation (SEQ ID NO: 60) in which 52 bases are deleted from wild-type CALR each have very similar sequences before and after the deletion on the 3' side from the deletion position (arrow in the figure). In the base sequences of type 1, type 3, type 4, and type 5 mutations shown in Figure 1, the sequences that match before and after the deletion are underlined.

The gene mutation evaluation kit according to the present invention includes, as a CALR mutation probe, at least one probe selected from the group consisting of a type 1 mutation probe for detecting a type 1 mutation, a type 3 mutation probe for detecting a type 3 mutation, a type 4 mutation probe for detecting a type 4 mutation, and a type 5 mutation probe for detecting a type 5 mutation. That is, the gene mutation evaluation kit according to the present invention may include all of the type 3 mutation probe, the type 4 mutation probe, and the type 5 mutation probe, or may include one or any two of the type 3 mutation probe, the type 4 mutation probe, and the type 5 mutation probe.

These CALR mutant probes have mismatches due to artificial deletions. That is, the CALR mutant probes are designed as complementary strands with at least one base (one to several bases, for example, one to five bases, preferably one to three bases, more preferably one base) deleted (i.e., artificially deleted) in the sequences after deletion mutation of type 1 mutation, type 3 mutation, type 4 mutation, and type 5 mutation shown in FIG. 1. Here, the bases to be artificially deleted are preferably selected from the regions (underlined parts in FIG. 1) that match the wild-type sequence in the sequences after deletion of each of type 1 mutation, type 3 mutation, type 4 mutation, and type 5 mutation, as shown in FIG. 1. The CALR mutant probes can be designed as complementary strands to a given base sequence, but may also be designed as the same strand as the base sequence.

In other words, the CALR mutant probes corresponding to these type 1, type 3, type 4, or type 5 mutations can be designed as complementary strands in which at least one base is deleted in a region within 10 bases, preferably within 8 bases, and more preferably within 5 bases, on the 3'-end side of the deletion position (arrow in Figure 1).

More specifically, the CALR mutant probe corresponding to type 1 mutation can be designed as a complementary strand in which at least one base has been deleted from the 7-base range (underlined portion in FIG. 1) on the 3'-end side, counting from the deletion position (arrow in FIG. 1). Based on the base sequence shown in SEQ ID NO: 10, the CALR mutant probe corresponding to type 1 mutation can be designed as a complementary strand in which at least one base has been deleted from the 7-base range from 558th to 564th. In particular, the CALR mutant probe corresponding to type 1 mutation is preferably designed as a complementary strand of GACGAGGAGCGGACAAGGAG (SEQ ID NO: 95) in which AGA has been deleted from 560th to 562nd in the base sequence shown in SEQ ID NO: 10 (the base sequence of SEQ ID NO: 95 may also be used).

The CALR mutant probe corresponding to type 3 mutation can be designed as a complementary strand with at least one base deleted from the 5-base range (underlined portion in FIG. 1) on the 3'-end side of the deletion position (arrow in FIG. 1). Based on the base sequence shown in SEQ ID NO: 10, the CALR mutant probe corresponding to type 3 mutation can be designed as a complementary strand with at least one base deleted from the 5-base range from 555th to 559th. In particular, it is preferable that the CALR mutant probe corresponding to type 3 mutation is designed as a complementary strand of GAGGAGCAGAGCAGAGGACAA (SEQ ID NO: 53) with the 558th G deleted in the base sequence shown in SEQ ID NO: 10 (the base sequence of SEQ ID NO: 53 may also be used).

The CALR mutant probe corresponding to type 4 mutation can be designed as a complementary strand with at least one base deleted from the 9-base range (underlined portion in Figure 1) on the 3'-end side counting from the deletion position (arrow in Figure 1). Based on the base sequence shown in SEQ ID NO: 10, the CALR mutant probe corresponding to type 4 mutation can be designed as a complementary strand with at least one base deleted from the 9-base range from the 550th to 558th bases. In particular, the CALR mutant probe corresponding to type 4 mutation is preferably designed as a complementary strand of CAGAGGCTTAGAGGAGGCAGAG (SEQ ID NO: 54) with the 552nd G deleted in the base sequence shown in SEQ ID NO: 10 (the base sequence of SEQ ID NO: 54 may also be used).

The CALR mutant probe corresponding to type 5 mutation can be designed as a complementary strand with at least one base deleted from the 2nd to 8th 7 base range (underlined in Figure 1) on the 3' end side, counting from the deletion position (arrow in Figure 1). Based on the base sequence shown in SEQ ID NO: 10, the CALR mutant probe corresponding to type 5 mutation can be designed as a complementary strand with at least one base deleted from the 558th to 564th 7 base range. In particular, the CALR mutant probe corresponding to type 5 mutation is preferably designed as a complementary strand of GACGAGGGGCGGACAAGGAG (SEQ ID NO: 55) with AGA deleted from the 560th to 562nd AGA in the base sequence shown in SEQ ID NO: 10 (the base sequence of SEQ ID NO: 55 may also be used).

The gene mutation evaluation kit according to the present invention may simultaneously identify gene mutations present in JAK2 and MPL in addition to the gene mutation in the CARL gene described above. These gene mutations in JAK2 and MPL, like the gene mutation in CARL, are gene mutations used in the diagnosis of myeloproliferative neoplasms in the World Health Organization (WHO) classification (e.g., the 2016 version).

Examples of gene mutations in JAK2 associated with myeloproliferative neoplasms include the V617F mutation and a gene mutation in exon 12. That is, the gene mutation evaluation kit may include, as JAK2 mutation probes, a V617F mutation probe corresponding to the V617F mutation, which is a gene mutation associated with myeloproliferative neoplasms in JAK2, and an exon 12 mutation probe corresponding to a gene mutation in exon 12, which is a gene mutation in JAK2 associated with myeloproliferative neoplasms. The gene mutation evaluation kit may also include a V617F mutation primer set that amplifies a region including the V617F mutation in JAK2, and an exon 12 primer set that amplifies a region including a gene mutation in exon 12 of the JAK2 gene.

Specifically, the V617F mutation in the JAK2 gene mutation means that the 617th valine is substituted with phenylalanine. This mutation contributes to the activation of the JAK-STAT pathway and is a prominent feature of polycythemia vera (PV). The V617F mutation is also seen at a frequency of 50-60% in patients with primary myelofibrosis (PMF) or essential thrombocythemia (ET). The base sequence of exon 14, which contains the 617th valine in the wild-type JAK2 gene, is shown in SEQ ID NO:11. When the V617F mutation is present, the 351st G in the base sequence shown in SEQ ID NO:11 is substituted with T.

In addition, the genetic mutation in exon 12 is known as the diagnostic criterion for MPN set by the World Health Organization (WHO), and is a genetic mutation that is particularly detected in polycythemia vera (PV). Examples of gene mutations present in exon 12 of the JAK2 gene include, but are not limited to, a mutation in which the 542nd asparagine and the 543rd glutamic acid are deleted (referred to as N542_E543del mutation), a mutation in which the 543rd glutamic acid and the 544th aspartic acid are deleted (referred to as E543_D544del mutation), a mutation in which the 541st arginine to the 543rd glutamic acid are changed to lysine (referred to as R541_E543>K mutation), a mutation in which the 537th phenylalanine to the 539th lysine are changed to leucine (referred to as F537_K539>L mutation), and a mutation in which the 539th lysine is changed to leucine (referred to as K539L(TT) mutation or K539L(CT) mutation). The K539L(TT) mutation is a mutation in which the codon (AAA) encoding the 539th lysine becomes the codon (TTA) encoding the leucine. The K539L(CT) mutation is a mutation in which the codon (AAA) that codes for lysine at position 539 becomes a codon (CTA) that codes for leucine.

Here, the base sequence encoding exon 12 of the wild-type JAK2 gene is shown in SEQ ID NO: 12. In the case of an N542_E543del mutation, 6 bases from 250 to 255 are deleted in the base sequence shown in SEQ ID NO: 12. In the case of an E543_D544del mutation, 6 bases from 253 to 258 are deleted in the base sequence shown in SEQ ID NO: 12. In the case of an R541_E543>K mutation, 6 bases from 248 to 253 are deleted in the base sequence shown in SEQ ID NO: 12. In the case of an F537_K539>L mutation, 6 bases from 237 to 242 are deleted in the base sequence shown in SEQ ID NO: 12. In the case of a K539L(TT) mutation, the AA at the 241st and 242nd positions in the base sequence shown in SEQ ID NO: 12 are substituted with TT. In the case of a K539L(CT) mutation, the AA at the 241st and 242nd positions in the base sequence shown in SEQ ID NO: 12 are substituted with CT.

Furthermore, examples of gene mutations associated with myeloproliferative neoplasms in MPL include the W515K mutation (a substitution mutation of tryptophan at position 515 to lysine) and the W515L mutation (a substitution mutation of tryptophan at position 515 to leucine). This MPL gene mutation is seen in 3-5% of essential thrombocythemia (ET) patients and in 6-10% of primary myelofibrosis (PMF) patients. The base sequence encoding wild-type MPL is shown in SEQ ID NO: 13. In the case of a W515K mutation, TG at positions 305 and 306 in the base sequence shown in SEQ ID NO: 13 are substituted with AA. In the case of a W515L mutation, G at position 306 in the base sequence shown in SEQ ID NO: 13 is substituted with T.

The gene mutation evaluation kit of the present invention includes a probe set for identifying gene mutations present in each of JAK2, CALR, and MPL.

More specifically, for the V617F mutation in JAK2, an oligonucleotide containing, for example, CTCCACAGAaACATACTCC (SEQ ID NO: 14), which corresponds to the above substitution mutation in SEQ ID NO: 11, can be used as a mutant probe. In the above sequence, the lowercase a corresponds to the substitution mutation from G to T at position 351 in the base sequence shown in SEQ ID NO: 11. In addition, when identifying the V617F mutation in JAK2, a wild-type probe corresponding to wild-type JAK2 (a sequence in which the lowercase a in the above sequence is replaced with c) can also be used. That is, to identify the V617F mutation in JAK2, a mutant probe containing the base sequence of SEQ ID NO: 14 may be used, or a probe set consisting of the mutant probe and the wild-type probe may be used.

For the N542_E543del mutation of JAK2, an oligonucleotide containing CACAAAATCAGA-GATTTGATATTTG (SEQ ID NO: 15) can be used as a mutant probe. In the above sequence, the position of the hyphen corresponds to the 6-base deletion from the 250th to the 255th in the base sequence shown in SEQ ID NO: 12. For the E543_D544del mutation of JAK2, an oligonucleotide containing CACAAAATCAGAAAT-TTGATATTTGT (SEQ ID NO: 16) can be used as a mutant probe. In the above sequence, the position of the hyphen corresponds to the 6-base deletion from the 253rd to the 258th in the base sequence shown in SEQ ID NO: 12. For the R541_E543>K mutation of JAK2, an oligonucleotide containing CACAAAATCA-AAGATTTGATATTTGT (SEQ ID NO: 17) can be used as a mutant probe. In the above sequence, the position of the hyphen corresponds to the 6-base deletion from the 248th to the 253rd in the base sequence shown in SEQ ID NO: 12. For the F537_K539>L mutation of JAK2, an oligonucleotide containing CCAAATGGTG-TTAATCAGAAATGAA (SEQ ID NO: 18) can be used as a mutant probe. In the above sequence, the position of the hyphen corresponds to the 6-base deletion from the 237th to the 242nd bases in the base sequence shown in SEQ ID NO: 12. For the K539L(TT) mutation of JAK2, an oligonucleotide containing GGTGTTTCACttAATCAGAAATGA (SEQ ID NO: 19) can be used as a mutant probe. In the above sequence, the lowercase tt corresponds to the 241st and 242nd AA in the base sequence shown in SEQ ID NO: 12. For the K539L(CT) mutation of JAK2, an oligonucleotide containing GTGTTTCACctAATCAGAAATGA (SEQ ID NO: 20) can be used as a mutant probe. In the above sequence, the lowercase ct corresponds to the 241st and 242nd AA in the base sequence shown in SEQ ID NO: 12.

When identifying each of the above mutations in exon 12 of JAK2, a wild-type probe corresponding to the wild type of each mutation can also be used. Here, since each of the above mutations are very close to each other or partially overlap, one wild-type probe can be used to represent them, or several wild-type probes can be used in combination. In the examples described below, two wild-type probes were used: one with the N542_E543del mutation, the E543_D544del mutation, and the R541_E543＞K mutation as the center, and the other with the F537_K539＞L mutation as the center.

Furthermore, for type 1 mutations of CALR, an oligonucleotide containing, for example, CTCCTTGT-CCGCTCCTCGTC (SEQ ID NO: 21), which corresponds to the above 52-base deletion in SEQ ID NO: 10, can be used as a probe. Note that the position of the hyphen in the above sequence corresponds to the 52-base deletion from the 506th to the 557th bases in the base sequence shown in SEQ ID NO: 10. In addition, when identifying type 1 mutations of CALR, a wild-type probe corresponding to wild-type CALR can also be used. That is, to identify type 1 mutations of CALR, a mutant probe containing the base sequence of SEQ ID NO: 21 may be used, and a probe set consisting of the mutant probe and the wild-type probe may also be used.

Furthermore, for type 2 mutations in CALR, an oligonucleotide containing, for example, ATCCTCCgacaaTTGTCCT (SEQ ID NO: 22), which corresponds to the above 5-base insertion in SEQ ID NO: 10, can be used as a probe. In the above sequence, the lowercase gacaa represents a 5-base insertion. In addition, when identifying type 2 mutations in CALR, a wild-type probe corresponding to wild-type CALR can also be used. That is, to identify type 2 mutations in CALR, a mutant probe containing the base sequence of SEQ ID NO: 22 can be used, and a probe set consisting of the mutant probe and a wild-type probe can also be used.

Furthermore, for the W515K mutation of MPL, an oligonucleotide containing, for example, GAAACTGCttCCTCAGCA (SEQ ID NO: 23), which corresponds to the above substitution mutation in SEQ ID NO: 13, can be used as a mutant probe. In the above sequence, the lowercase tt corresponds to the substitution mutation of TG at the 305th and 306th positions in the base sequence shown in SEQ ID NO: 13 to AA. In addition, when identifying the W515K mutation of MPL, a wild-type probe corresponding to wild-type MPL (a sequence in which the lowercase tt in the above sequence is replaced with ca) can also be used. That is, to identify the W515K mutation of MPL, a mutant probe containing the base sequence of SEQ ID NO: 23 may be used, or a probe set consisting of the mutant probe and the wild-type probe may be used.

Furthermore, for the W515L mutation of MPL, an oligonucleotide containing, for example, GGAAACTGCAaCCTCAG (SEQ ID NO: 24), which corresponds to the above substitution mutation in SEQ ID NO: 13, can be used as a mutant probe. In the above sequence, the lowercase a corresponds to the substitution mutation of G at position 306 in the base sequence shown in SEQ ID NO: 13 with T. In addition, when identifying the W515L mutation of MPL, a wild-type probe corresponding to wild-type MPL (a sequence in which the lowercase a in the above sequence is replaced with c) can also be used. That is, to identify the W515L mutation of MPL, a mutant probe containing the base sequence of SEQ ID NO: 24 may be used, or a probe set consisting of the mutant probe and the wild-type probe may be used.

As described above, SEQ ID NOs: 95, 53, 54, and 55 are shown as examples of CARL mutation probes having mismatches for identifying type 1 mutations, type 3 mutations, type 4 mutations, and/or type 5 mutations present in CALR, respectively. However, the base sequences of the CARL mutation probes are not limited to SEQ ID NOs: 95, 53, 54, and 55, and can be appropriately designed based on the base sequence of the type 1 mutation shown in SEQ ID NO: 57, the base sequence of the type 3 mutation shown in SEQ ID NO: 58, the base sequence of the type 4 mutation shown in SEQ ID NO: 59, and the base sequence of the type 5 mutation shown in SEQ ID NO: 60.

Furthermore, although the mutant probe for identifying gene mutations present in JAK2 has been exemplified, the base sequence of the mutant probe is not limited to SEQ ID NOs: 14 to 20, and can be appropriately designed based on the base sequence of JAK2 shown in SEQ ID NOs: 11 and 12. Although SEQ ID NOs: 21 and 22 have been exemplified as mutant probes for identifying type 1 mutations and type 2 mutations present in CALR, the base sequence of the mutant probe is not limited to SEQ ID NOs: 21 and 22, and can be appropriately designed based on the base sequence of CALR shown in SEQ ID NO: 10. Although SEQ ID NOs: 23 and 24 have been exemplified as mutant probes for identifying gene mutations present in MPL, the base sequence of the mutant probe is not limited to SEQ ID NOs: 23 and 24, and can be appropriately designed based on the base sequence of MPL shown in SEQ ID NO: 13.

The base length of these probes is not particularly limited, but may be, for example, 10 to 30 bases long, and preferably 15 to 25 bases long. As described above, the probe may be, for example, 10 to 30 bases long, and preferably 15 to 25 bases long, by combining the base sequence designed based on the region containing the genetic mutation in the base sequence of SEQ ID NOs: 10 to 13 and the base sequence added to one or both ends of the base sequence.

The probe designed as described above is preferably a nucleic acid, more preferably DNA. DNA may be double-stranded or single-stranded, but is preferably single-stranded DNA. The probe can be obtained, for example, by chemical synthesis using a nucleic acid synthesizer. As the nucleic acid synthesizer, a device called a DNA synthesizer, a fully automated nucleic acid synthesizer, an automated nucleic acid synthesizer, etc. can be used.

The probe designed as described above is preferably used in the form of a microarray (a DNA chip, for example) by immobilizing its 5' end on a carrier. In this case, the microarray preferably has a mutant probe and a wild-type probe for each of the gene mutations described above. By using the mutant probe and the wild-type probe for each gene mutation, it is possible to accurately determine not only the presence or absence of a mutation but also the proportion of mutations. Here, the mutant probe and the wild-type probe preferably differ in length by no more than 2 bases, and more preferably have the same length.

The microarray according to the present invention can be produced by immobilizing the above-mentioned probes on a carrier.

The carrier material may be any material known in the art, and is not particularly limited. For example, precious metals such as platinum, platinum black, gold, palladium, rhodium, silver, mercury, tungsten, and compounds thereof, and conductive materials such as carbon, represented by graphite and carbon fiber; silicon materials, represented by single crystal silicon, amorphous silicon, silicon carbide, silicon oxide, silicon nitride, and composite materials of these silicon materials, represented by SOI (silicon-on-insulator); inorganic materials, such as glass, quartz glass, alumina, sapphire, ceramics, forsterite, and photosensitive glass; polyethylene, ethylene, polypropylene, etc. , cyclic polyolefins, polyisobutylene, polyethylene terephthalate, unsaturated polyesters, fluorine-containing resins, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resins, polyacrylonitrile, polystyrene, acetal resins, polycarbonate, polyamide, phenolic resins, urea resins, epoxy resins, melamine resins, styrene-acrylonitrile copolymers, acrylonitrile-butadiene styrene copolymers, polyphenylene oxide, polysulfone, and other organic materials. The shape of the carrier is not particularly limited, but is preferably flat.

In the present invention, a carrier having a carbon layer and a chemically modified group on its surface is preferably used as the carrier. Carriers having a carbon layer and a chemically modified group on their surface include those having a carbon layer and a chemically modified group on the surface of a substrate, and those having a chemically modified group on the surface of a substrate made of a carbon layer. Materials known in the art can be used as the substrate material, and there are no particular limitations, and the same materials as those listed above as carrier materials can be used.

In the microarray of the present invention, a carrier having a fine plate-like structure is preferably used. The shape is not limited to rectangular, square, or round, but usually, a carrier having a square of 1 to 75 mm, preferably 1 to 10 mm, and more preferably 3 to 5 mm is used. Since carriers having a fine plate-like structure are easy to manufacture, it is preferable to use a substrate made of a silicon material or a resin material, and in particular, a carrier having a carbon layer and a chemically modified group on the surface of a substrate made of single crystal silicon is more preferable. Single crystal silicon includes those in which the orientation of the crystal axis changes very slightly in parts (sometimes called mosaic crystals) and those containing disorder on an atomic scale (lattice defects).

In the present invention, the carbon layer formed on the substrate is not particularly limited, but it is preferable to use any of synthetic diamond, high-pressure synthetic diamond, natural diamond, soft diamond (e.g., diamond-like carbon), amorphous carbon, carbon-based materials (e.g., graphite, fullerene, carbon nanotubes), mixtures thereof, or laminates thereof. In addition, carbides such as hafnium carbide, niobium carbide, silicon carbide, tantalum carbide, thorium carbide, titanium carbide, uranium carbide, tungsten carbide, zirconium carbide, molybdenum carbide, chromium carbide, and vanadium carbide may be used. Here, soft diamond is a general term for incomplete diamond structures that are mixtures of diamond and carbon, such as so-called diamond-like carbon (DLC), and the mixture ratio is not particularly limited. The carbon layer is advantageous in that it has excellent chemical stability and can withstand subsequent introduction of chemical modification groups and reactions in binding with the analyte, that the binding with the analyte is flexible because it is electrostatically bonded, that it is transparent to the UV of the detection system because it does not absorb UV, and that it can be electrified during electroblotting. It is also advantageous in that there is little nonspecific adsorption in the binding reaction with the analyte. As mentioned above, a carrier in which the substrate itself is made of a carbon layer may be used.

In the present invention, the carbon layer can be formed by a known method. Examples include microwave plasma CVD (chemical vapor deposition), ECRCVD (electric cyclotron resonance chemical vapor deposition), ICP (inductive coupled plasma), DC sputtering, ECR (electric cyclotron resonance) sputtering, ionization deposition, arc deposition, laser deposition, EB (electron beam) deposition, and resistance heating deposition.

In the radio-frequency plasma CVD method, the source gas (methane) is decomposed by glow discharge generated between electrodes by radio frequency waves, and a carbon layer is synthesized on the substrate. In the ionization deposition method, the source gas (benzene) is decomposed and ionized using thermal electrons generated by a tungsten filament, and a carbon layer is formed on the substrate using a bias voltage. The carbon layer may also be formed by the ionization deposition method in a mixed gas consisting of 1-99% by volume of hydrogen gas and the remaining 99-1% by volume of methane gas.

In the arc deposition method, a direct current voltage is applied between a solid graphite material (cathode evaporation source) and a vacuum vessel (anode), causing an arc discharge in a vacuum to generate a plasma of carbon atoms from the cathode, and a bias voltage more negative than that of the evaporation source is applied to the substrate to accelerate the carbon ions in the plasma toward the substrate, forming a carbon layer.

In the laser deposition method, for example, a Nd:YAG laser (pulsed oscillation) is irradiated onto a graphite target plate to melt it, and the carbon atoms are deposited onto a glass substrate to form a carbon layer.

When forming a carbon layer on the surface of a substrate, the thickness of the carbon layer is usually about a monolayer to 100 μm. If the carbon layer is too thin, the surface of the underlying substrate may be locally exposed, and conversely, if it is too thick, productivity decreases, so the thickness is preferably 2 nm to 1 μm, and more preferably 5 nm to 500 nm.

By introducing a chemical modification group onto the surface of the substrate on which the carbon layer is formed, the oligonucleotide probe can be firmly immobilized onto the carrier. The chemical modification group to be introduced can be appropriately selected by a person skilled in the art, and is not particularly limited, but examples thereof include amino groups, carboxyl groups, epoxy groups, formyl groups, hydroxyl groups, and active ester groups.

The introduction of amino groups can be carried out, for example, by irradiating the carbon layer with ultraviolet light in ammonia gas or by subjecting it to plasma treatment. Alternatively, the carbon layer can be chlorinated by irradiating it with ultraviolet light in chlorine gas, and then irradiating it with ultraviolet light in ammonia gas. Alternatively, the introduction can be carried out by reacting the chlorinated carbon layer with a polyamine gas such as methylenediamine or ethylenediamine.

Introduction of carboxyl groups can be carried out, for example, by reacting the aminated carbon layer as described above with a suitable compound. Compounds used to introduce carboxyl groups include, for example, halocarboxylic acids represented by the formula: X-R1-COOH (wherein X represents a halogen atom and R1 represents a divalent hydrocarbon group having 10 to 12 carbon atoms), such as chloroacetic acid, fluoroacetic acid, bromoacetic acid, iodoacetic acid, 2-chloropropionic acid, 3-chloropropionic acid, 3-chloroacrylic acid, and 4-chlorobenzoic acid; dicarboxylic acids represented by the formula: HOOC-R2-COOH (wherein R2 represents a single bond or a divalent hydrocarbon group having 1 to 12 carbon atoms), such as oxalic acid, malonic acid, succinic acid, maleic acid, fumaric acid, and phthalic acid; polyacrylic acid, and polymethacrylic acid. , trimellitic acid, butanetetracarboxylic acid, and other polyvalent carboxylic acids; keto acids or aldehyde acids represented by the formula: R3-CO-R4-COOH (wherein R3 represents a hydrogen atom or a divalent hydrocarbon group having 1 to 12 carbon atoms, and R4 represents a divalent hydrocarbon group having 1 to 12 carbon atoms); monohalides of dicarboxylic acids represented by the formula: X-OC-R5-COOH (wherein X represents a halogen atom, and R5 represents a single bond or a divalent hydrocarbon group having 1 to 12 carbon atoms), such as succinic acid monochloride and malonic acid monochloride; and acid anhydrides such as phthalic anhydride, succinic anhydride, oxalic anhydride, maleic anhydride, and butanetetracarboxylic anhydride.

The introduction of epoxy groups can be carried out, for example, by reacting the aminated carbon layer as described above with a suitable polyfunctional epoxy compound. Alternatively, it can be obtained by reacting the carbon=carbon double bonds contained in the carbon layer with an organic peracid. Examples of organic peracids include peracetic acid, perbenzoic acid, diperoxyphthalic acid, performic acid, and trifluoroperacetic acid.

The introduction of formyl groups can be carried out, for example, by reacting the aminated carbon layer as described above with glutaraldehyde.

Hydroxyl groups can be introduced, for example, by reacting the chlorinated carbon layer with water as described above.

The term "active ester group" refers to an ester group that has a highly acidic electron-withdrawing group on the alcohol side of the ester group and activates nucleophilic reactions, i.e., an ester group with high reactivity. The ester group has an electron-withdrawing group on the alcohol side of the ester group, and is more activated than alkyl esters. The active ester group has reactivity with groups such as amino groups, thiol groups, and hydroxyl groups. More specifically, phenol esters, thiophenol esters, N-hydroxyamine esters, cyanomethyl esters, and esters of heterocyclic hydroxy compounds are known as active ester groups that have much higher activity than alkyl esters. More specifically, examples of active ester groups include p-nitrophenyl groups, N-hydroxysuccinimide groups, succinimide groups, phthalimide groups, and 5-norbornene-2,3-dicarboximide groups, with the N-hydroxysuccinimide group being particularly preferred.

The introduction of an active ester group can be carried out, for example, by converting the carboxyl group introduced as described above into an active ester using a dehydrating condensation agent such as cyanamide or a carbodiimide (e.g., 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide) and a compound such as N-hydroxysuccinimide. This treatment makes it possible to form a group in which an active ester group such as an N-hydroxysuccinimide group is bonded to the end of a hydrocarbon group via an amide bond (JP Patent Publication 2001-139532).

The probes are dissolved in a spotting buffer to prepare a spotting solution, which is dispensed into a 96-well or 384-well plastic plate, and the dispensed solution is spotted onto the carrier using a spotter device or the like to produce a microarray in which the probes are immobilized on the carrier. Alternatively, the spotting solution may be spotted manually using a micropipette.

After spotting, incubation is preferably performed to promote the reaction of binding of the probe to the carrier. Incubation is usually performed at a temperature of -20 to 100°C, preferably 0 to 90°C, for a period of usually 0.5 to 16 hours, preferably 1 to 2 hours. It is desirable to perform incubation in a high humidity atmosphere, for example, under conditions of humidity of 50 to 90%. Following incubation, washing is preferably performed using a washing solution (e.g., 50 mM TBS/0.05% Tween 20, 2xSSC/0.2% SDS solution, ultrapure water, etc.) to remove DNA that is not bound to the carrier.

By using the microarray configured as described above, the presence or absence of each of the above gene mutations present in JAK2, CALR, and MPL in a subject can be determined simultaneously.

Specifically, when determining the presence or absence of the above-mentioned gene mutations present in JAK2, CALR, and MPL, the method includes the steps of extracting DNA from a sample derived from a subject to be diagnosed, using the extracted DNA as a template to amplify the regions containing the above-mentioned gene mutations in JAK2 (the region containing the V617F mutation site of JAK2 and the region containing the gene mutation contained in exon 12), the region containing the above-mentioned gene mutations in CALR, and the region containing the above-mentioned gene mutations in MPL, and detecting the presence or absence of the above-mentioned gene mutations present in JAK2, CALR, and MPL contained in the amplified nucleic acid using the above-mentioned microarray.

The subject to be diagnosed is usually a human, and although there are no particular limitations on race, the subject is preferably a person of Asian race, more preferably an East Asian race, and most preferably a Japanese person. The subject to be diagnosed may also be a patient suspected of having a myeloproliferative neoplasm.

The sample derived from the subject to be diagnosed is not particularly limited. Examples include blood-related samples (blood, serum, plasma, etc.), lymph, feces, cancer cells, tissue or organ homogenates and extracts, etc.

First, DNA is extracted from a sample taken from a subject. There are no particular limitations on the extraction method. For example, DNA extraction methods using phenol/chloroform, ethanol, sodium hydroxide, CTAB, etc. can be used.

Next, the obtained DNA is used as a template to carry out an amplification reaction to amplify the region containing JAK2 (the region containing the V617F mutation site of JAK2, the region containing the gene mutation contained in exon 12), the region containing CALR, and the region containing MPL. As the amplification reaction, the polymerase chain reaction (PCR), the loop-mediated isothermal amplification (LAMP), the isothermal and chimeric primer-initiated amplification of nucleic acids (ICAN), etc. can be applied. In the amplification reaction, it is desirable to add a label so that the region after amplification can be identified. In this case, the method of labeling the amplified nucleic acid is not particularly limited, but for example, a method in which the primer used in the amplification reaction is labeled in advance may be used, or a method in which a labeled nucleotide is used as a substrate in the amplification reaction may be used. As the labeling substance, it is not particularly limited, but a radioisotope, a fluorescent dye, or an organic compound such as digoxigenin (DIG) or biotin may be used.

This reaction system also contains a buffer necessary for nucleic acid amplification and labeling, a heat-stable DNA polymerase, a primer specific to the amplified region, a labeled nucleotide triphosphate (specifically, a nucleotide triphosphate to which a fluorescent label or the like has been added), a nucleotide triphosphate, magnesium chloride, etc.

The gene mutation evaluation kit according to the present invention may include a primer set for amplifying a region containing type 1, type 3, type 4, and type 5 mutations present in CALR, i.e., a region containing a deletion site (arrow in FIG. 1). Here, the primer set refers to a pair of primers consisting of a forward primer and a reverse primer.

The region containing the deletion site amplified using the primer set is detected by the CARL mutant probe having the mismatch described above (e.g., SEQ ID NOs: 95, 53, 54, and 55). As shown in Figure 1, type 1 mutation, type 3 mutation, type 4 mutation, and type 5 mutation have the same sequence as the wild type on the 3' side of the deletion site (underlined part in Figure 1). Therefore, if a probe designed to be a perfect match including the deletion site is used for type 1 mutation, type 3 mutation, type 4 mutation, and type 5 mutation, there is a possibility that it will hybridize nonspecifically even to a wild type sample.

In contrast, when a CARL mutant probe (e.g., SEQ ID NOs: 95, 53, 54, and 55) is used as described above, the mismatch reduces the possibility of nonspecific hybridization with the wild type. Therefore, by using the gene mutation evaluation kit of the present invention, it is possible to reliably distinguish and detect a wild type specimen from a specimen having a type 1 mutation. In addition, by using the gene mutation evaluation kit of the present invention, it is possible to reliably distinguish and detect a wild type specimen from a specimen having a type 3 mutation. In addition, by using the gene mutation evaluation kit of the present invention, it is possible to reliably distinguish and detect a wild type specimen from a specimen having a type 4 mutation. In addition, by using the gene mutation evaluation kit of the present invention, it is possible to reliably distinguish and detect a wild type specimen from a specimen having a type 5 mutation.

In the above explanation, the design of CARL mutant probes having mismatches for detecting type 1, type 3, type 4, and type 5 mutations present in CALR has been described, but mutant probes can be designed similarly for other mutations other than the CALR gene. For example, for a deletion mutation exceeding a certain length, in which the sequence after the deletion mutation is similar to the wild-type sequence, a mutant probe can be designed similarly. More specifically, for a deletion mutation of 5 bases or more, preferably 10 bases or more, or a deletion mutation longer than the base length suitable for a probe, in which a sequence that matches the sequence after the deletion by 2 bases or more within 10 bases including the deletion position in the wild-type base sequence, a mutant probe can be designed so that part of the matching sequence is a mismatch.

In addition, in the case of CARL mutant probes with mismatches for detecting type 1, type 3, type 4, and type 5 mutations present in CALR, since there was a sequence on the 5' side of the deletion site in the wild-type base sequence that matched the sequence after the deletion, a mutant probe was designed with a mismatch on the 3' side of the deletion site. Conversely, in the case of mutants where there is a sequence on the 3' side of the deletion site in the wild-type base sequence that matches the sequence after the deletion, a mutant probe can be designed with a mismatch on the 5' side of the deletion site.

The gene mutation evaluation kit according to the present invention may include, as a primer set for amplifying a region containing a gene mutation in JAK2, a primer set for V617F mutation that amplifies a region containing the V617F mutation, and a primer set for exon 12 that amplifies a region containing a gene mutation present in exon 12 of the JAK2 gene.

The primer set for V617F mutation is not particularly limited as long as it can specifically amplify the region encoding the amino acid corresponding to the 617th valine in the wild type, and can be appropriately designed by a person skilled in the art. For example,
An example of such a set is the forward primer JAK2-F: 5'-GAGCAAGCTTTCTCACAAGCATTTGG-3' (sequence number 25) and the reverse primer JAK2-R: 5'-CTGACACCTAGCTGTGATCCTGAAACTG-3' (sequence number 26).

Here, when amplifying a region containing the V617F mutation using a primer set for V617F mutation, it is preferable to set the concentration of one of the primer sets for V617F mutation, for example the fluorescently labeled primer (for example the forward primer), to 1.0 μM or more. By setting the concentration of the primer in this range, the region containing the V617F mutation and the region containing the gene mutation present in exon 12 can be successfully amplified. The upper limit of the primer concentration is not particularly limited, and can be set to the upper limit of the primer concentration in a normal nucleic acid amplification reaction (for example, 10 μM).

On the other hand, it is preferable to design a primer set for exon 12 so that at least two, preferably three, more preferably four, even more preferably five, and most preferably all six of the multiple gene mutations contained in exon 12 described above can be amplified at once. More specifically, as shown in FIG. 3, the primer set for exon 12 can be a forward primer for exon 12 having a length of 10 or more consecutive bases selected from the base sequence shown in SEQ ID NO: 1, and a reverse primer for exon 12 having a length of 10 or more consecutive bases selected from the base sequence shown in SEQ ID NO: 2. Here, SEQ ID NO: 1 is the 178th to 228th bases of the base sequence encoding exon 12, and SEQ ID NO: 2 is the 399th to 435th bases, both of which are partial sequences of SEQ ID NO: 12, and all of the above-mentioned six gene mutations are included between the two.

More specifically, the forward primer for exon 12 can be one primer selected from the group consisting of forward primer F1 for exon 12 consisting of the base sequence shown in SEQ ID NO: 3, forward primer F3 for exon 12 consisting of the base sequence shown in SEQ ID NO: 4, forward primer F4 for exon 12 consisting of the base sequence shown in SEQ ID NO: 5, and forward primer F5 for exon 12 consisting of the base sequence shown in SEQ ID NO: 6.

Specifically, the reverse primer for exon 12 can be one primer selected from the group consisting of reverse primer R1 for exon 12 consisting of the base sequence shown in SEQ ID NO: 7, reverse primer R2 for exon 12 consisting of the base sequence shown in SEQ ID NO: 8, and reverse primer R3 for exon 12 consisting of the base sequence shown in SEQ ID NO: 9.

In particular, it is more preferable that the primer set for exon 12 is a combination of a forward primer for exon 12, F5, consisting of the base sequence shown in SEQ ID NO: 6, and a reverse primer for exon 12, R2, consisting of the base sequence shown in SEQ ID NO: 8.

The base sequences of the forward primers F1, F3 to F5 and reverse primers R1 to R3 are shown according to the corresponding positions on the base sequence encoding exon 12. Therefore, either the forward or reverse primer constituting the primer set is a complementary strand to the base sequence shown in the SEQ ID NO. In all of the examples described below, the reverse side is made as a complementary strand.

Here, when amplifying a region containing a genetic mutation in exon 12 using a primer set for exon 12, it is preferable to set the concentration of one of the primer sets for exon 12, for example the fluorescently labeled primer (e.g. the reverse primer), to 2.5 μM or more. By setting the concentration of the primer in this range, the region containing the V617F mutation and the region containing a genetic mutation present in exon 12 can be successfully amplified. The upper limit of the primer concentration is not particularly limited, and can be set to the upper limit of the primer concentration in a normal nucleic acid amplification reaction (e.g. 10 μM).

Not limited to exon 12, the forward and reverse concentrations in a primer set may be the same or different. If they are different, it is sufficient that one of them satisfies the above concentration conditions. In the examples described below, the primer concentration on the fluorescently labeled side is set higher in all primer sets for JAK2 V617F, exon 12, CALR, and MPL.

In addition, it is preferable that the concentration ratio of the labeled primer in the primer set for V617F mutation to the labeled primer in the primer set for exon 12, [primer concentration for exon 12]/[primer concentration for V617F mutation], is 1.0 to 5.5. By setting the concentration ratio in this range, the region containing the V617F mutation and the region containing the gene mutation present in exon 12 can be effectively amplified.

The primers used in the amplification reaction of the region containing the gene mutation in CALR are not particularly limited as long as they can specifically amplify the region containing the gene mutation, and can be appropriately designed by a person skilled in the art. For example,
An example of such a primer set is the primer CALR-F: 5'-CGTAACAAAGGTGAGGCCTGGT-3' (SEQ ID NO: 27) and the primer CALR-R: 5'-GGCCTCTCTACAGCTCGTCCTTG-3' (SEQ ID NO: 28).

The primers used in the amplification reaction of the region containing the gene mutation in MPL are not particularly limited as long as they can specifically amplify the region containing the gene mutation, and can be appropriately designed by a person skilled in the art. For example,
An example of such a primer set is the primer set consisting of primer MPL-F: 5'-CTCCTAGCCTGGATCTCCTTGG-3' (sequence number 29) and primer MPL-R: 5'-ACAGAGCGAACCAAGAATGCCTGTTTAC-3' (sequence number 30).

The nucleic acid fragment amplified by the primers is not particularly limited as long as it contains a region corresponding to the designed probe, and is preferably 1 kbp or less, more preferably 800 bp or less, even more preferably 500 bp or less, and particularly preferably 350 bp or less.

The presence or absence of the above-mentioned genetic mutation in the subject can be evaluated by carrying out a hybridization reaction between the amplified nucleic acid obtained as described above and a probe fixed to a carrier, and detecting hybridization of the amplified nucleic acid to the mutant probe. In other words, hybridization of the amplified nucleic acid to the mutant probe can be measured, for example, by detecting a label.

For example, when a fluorescent label is used, the signal from the label can be detected using a fluorescent scanner, and the signal intensity can be quantified by analyzing the signal using image analysis software. The hybridization reaction is preferably performed under stringent conditions. Stringent conditions refer to conditions under which specific hybrids are formed and non-specific hybrids are not formed, such as conditions in which the hybridization reaction is performed at 50°C for 16 hours, followed by washing at 2×SSC/0.2% SDS at 25°C for 10 minutes and 2×SSC at 25°C for 5 minutes. Alternatively, the hybridization temperature can be 45 to 60°C when the salt concentration is 0.5×SSC. If the probe chain length is short, it is more preferable to set the hybridization temperature lower than this, and if the probe chain length is long, it is more preferable to set the hybridization temperature higher than this. It goes without saying that the higher the salt concentration, the higher the hybridization temperature with specificity, and conversely, the lower the salt concentration, the lower the hybridization temperature with specificity.

In addition, when a microarray having a mutant probe and a wild-type probe for each of the above-mentioned gene mutations is used, the presence or absence of the above-mentioned gene mutations can be evaluated using the signal intensities from these mutant probes and wild-type probes. Specifically, the signal intensities in the wild-type probe and the mutant probe are each measured, and a judgment value for evaluating the signal intensity derived from the mutant probe is calculated. An example of calculating the judgment value is a method using the formula: [signal intensity derived from mutant probe]/([signal intensity derived from wild-type probe]+[signal intensity derived from mutant probe]).

Then, the judgment value calculated by the above formula is compared with a predetermined threshold value (cutoff value), and if the judgment value exceeds the threshold value, it is judged that the amplified nucleic acid contains the above gene mutation, and if the judgment value is below the threshold value, it is judged that the amplified nucleic acid does not contain the above gene mutation. By using the judgment value in this way, the presence or absence of each of the above-mentioned gene mutations in JAK2, CALR, and MPL can be judged.

Here, the threshold value is not particularly limited, but can be determined, for example, based on the judgment value calculated by the above formula using a specimen in which each of the above-mentioned gene mutations present in JAK2, CALR, and MPL has been confirmed to be wild type. More specifically, multiple judgment values can be calculated using multiple specimens in which each of the above-mentioned gene mutations present in JAK2, CALR, and MPL has been confirmed to be wild type, and the average value + 3σ (σ: standard deviation) can be set as the threshold. Note that the average value + 2σ or the average value + σ can also be set as the threshold.

As described above, by using a microarray equipped with a mutant probe for identifying each gene mutation present in JAK2, CALR, and MPL, each gene mutation present in JAK2, CALR, and MPL can be simultaneously identified. Information on each gene mutation present in JAK2, CALR, and MPL can be used, for example, in the diagnosis of myeloproliferative neoplasms in the WHO classification (2016 version). In detail, in the WHO classification, one of the requirements for the diagnosis of polycythemia vera or polycythemia vera (PV) is the presence of the above gene mutation in JAK2. In addition, in the WHO classification, one of the requirements for the diagnosis of essential thrombocythemia (ET) is the presence of any of the gene mutations present in JAK2, CALR, and MPL. Furthermore, according to the WHO classification, one of the requirements for a diagnosis of prefibrotic/early primary myelofibrosis (prefibrotic/early PMF) or primary myelofibrosis (PMF) is the presence of any of the gene mutations present in JAK2, CALR, or MPL.

Thus, for example, microarrays equipped with mutation probes for identifying each gene mutation present in JAK2, CALR, and MPL can be used to diagnose myeloproliferative neoplasms using the WHO classification (2016 version).

The present invention will be described in more detail below with reference to examples, but the technical scope of the present invention is not limited to these examples.

[Example 1]
1. Sample Preparation In this example, genomic DNA derived from peripheral blood of healthy subjects (manufactured by Biochain) was used as a wild-type sample.
In this example, in order to detect the gene mutations shown in Table 1, target regions (four regions) containing the gene mutations were amplified.

In this example, the primers shown in Table 2 were designed to amplify the four target regions shown in Table 1. Note that exon12-F is F5, and exon12-R is the complementary strand of R2.

Using the DNA samples prepared as described above, the four target regions of the JAK2 gene, CALR gene, and MPL gene were amplified by PCR. The template genomic DNA for PCR was 8 or 16 ng/μL. The composition of the reaction solution is shown in Table 3.

The PCR thermal cycle consisted of 5 minutes at 95°C, followed by 40 cycles of 95°C for 30 seconds, 59°C for 30 seconds, and 72°C for 45 seconds, followed by 10 minutes at 72°C, and finally a temperature of 4°C.

2. Microarray In this example, mutant probes corresponding to the V617F mutation in the JAK2 gene, six gene mutations contained in exon 12, type 1 to type 5 mutations in the CALR gene, and the W515L/K mutation in the MPL gene, and corresponding wild-type probes were designed. The base sequences of each probe are summarized in Table 4.

3. Identification of gene mutations Hybridization was performed using the chip having the above probe as follows. First, a wet box was placed in a chamber set to a specified temperature (52°C), and the chamber and wet box were fully preheated. 4 μL of PCR reaction solution was mixed with 2 μL of hybridization buffer (2.25×SSC/0.23% SDS/0.2 nM IC5-labeled oligo DNA (Life Technologies Japan)), 3 μL of this solution was taken and dropped onto the central convex part of the hybridization cover, which was then placed on the chip, and reacted for 1 hour in a hybridization chamber device (Toyo Kohan Co., Ltd.) set to 52°C. After the hybridization reaction was completed, the chip with the hybridization cover removed was set in the holder, and the stainless steel holder for washing was immersed in a 0.1×SSC/0.1% SDS solution. After shaking up and down several times, the holder was immersed in a 1×SSC solution (room temperature) until the fluorescence intensity of the chip was detected.

Just before detection, the chip was covered with a cover film, and the fluorescence intensity of the chip was detected using a BIOSHOT (manufactured by Toyo Kohan Co., Ltd.). Using the fluorescence intensities of the wild-type and mutant probes measured as described above, the judgement values for JAK2 gene mutations (V617F mutation and six gene mutations contained in exon 12), CALR gene mutations, and MPL gene mutations were calculated using the following formula.
Judgment value = [fluorescence intensity of mutant probe]/([fluorescence intensity of wild-type probe]+[fluorescence intensity of mutant probe])

[Experimental Example 1-1]
In this experimental example, multiple CARL mutant probes were designed and evaluated to detect type 3, type 4, or type 5 mutations, which are deletion-type gene mutations present in CARL. That is, multiple CARL mutant probes that perfectly match the region including the deletion position (arrow in Figure 1) and multiple CARL mutant probes that have mismatches in the region were designed for each of type 3, type 4, and type 5 mutations (Table 5). The probes actually prepared had a linker (a continuous T portion) bound to the 5'-side of the complementary strand of the designed sequence.

In this experimental example, the probes shown in Table 5 were used to measure the fluorescence intensity for the mutant model sample (100% mutant plasmid) and the fluorescence intensity for the wild-type model sample (plasmid). The results are shown in Table 6. In Table 6, "specific fluorescence intensity*1" is the fluorescence intensity for the mutant model sample, and "non-specific fluorescence intensity*2" is the fluorescence intensity for the wild-type model sample.

As shown in Table 6, it was revealed that a probe having a deletion-type mismatch at a specific position can specifically hybridize to a mutant sample with high specific fluorescence intensity*1 and low nonspecific fluorescence intensity*2. As shown in Table 6, it was possible to design a probe that can hybridize very specifically to a mutant sample with a specific fluorescence intensity*1 of 10,000 or more and a nonspecific fluorescence intensity*2 of 1,000 or less. Furthermore, among the designed mutant probes, it was possible to design a probe that can hybridize very specifically to a mutant sample with a specific fluorescence intensity*1 of 15,000 or more and a nonspecific fluorescence intensity*2 of 500 or less (for example, type 3 mutant probe 5, type 4 mutant probe 5, type 4 mutant probe 7, type 5 mutant probe 4, and type 5 mutant probe 5). It can be said that type 4 mutant probe 5 and type 4 mutant probe 7, which are probes for identifying type 4 mutations, are more preferable than type 4 mutant probe 5 because of their high specific fluorescence intensity*1. In addition, of the type 5 mutation probes 4 and 5, which are probes for identifying type 5 mutations, it can be said that the type 5 mutation probe 4 is more preferable due to its high specific fluorescence intensity*1.

In addition, using each of the probes shown in Table 5, the fluorescence intensity for each mutant model sample (type 1 mutant model plasmid, type 2 mutant model plasmid, type 3 mutant model plasmid, type 4 mutant model plasmid, and type 5 mutant model plasmid) and the fluorescence intensity for the wild-type model sample (plasmid) were measured. The results are shown in Table 7.

As shown in Table 7, it was revealed that probes having deletion-type mismatches at specific positions can specifically detect each mutation type. Among the results shown in Table 7, the results of measurements using type 3 mutation probe 5, type 4 mutation probe 5, and type 5 mutation probe 4 are summarized in Figure 2. The probe sequences actually prepared for type 3 mutation probe 5, type 4 mutation probe 5, and type 5 mutation probe 4 are as shown in Table 4. Figure 2 also shows the results of measurements using type 1 mutation probe 7 (the probe sequence actually prepared is in Table 4) among the results shown in Experimental Example 1-2 described below.

[Experimental Example 1-2]
In this experimental example, we designed and evaluated several CARL mutant probes to detect type 1 mutations, which are deletion-type gene mutations present in CARL. Specifically, for type 1 mutations, several CARL mutant probes were designed that perfectly matched the region including the deletion site (arrow in Figure 1) and several CARL mutant probes that had mismatches in the region (Table 8). The probes actually prepared had a linker (a continuous T) attached to the 5'-side of the complementary strand of the designed sequence.

In this experimental example, the fluorescence intensity for the mutant model sample (5% mutant plasmid) and the fluorescence intensity for the wild-type model sample (plasmid) were measured using each of the probes shown in Table 8. The results are shown in Table 9. In Table 9, "specific fluorescence intensity*1" is the fluorescence intensity for the mutant model sample, and "non-specific fluorescence intensity*2" is the fluorescence intensity for the wild-type model sample.

As shown in Table 9, it was revealed that a probe having a deletion-type mismatch at a specific position can specifically hybridize to a mutant sample with high specific fluorescence intensity*1 and low nonspecific fluorescence intensity*2. As shown in Table 9, we were able to design a probe that can hybridize very specifically to a mutant sample with a specific fluorescence intensity*1 of 15,000 or more and a nonspecific fluorescence intensity*2 of 3,000 or less (type 1 mutant probe 7).

[Experimental Example 2]
In this experimental example, multiple primer sets for amplifying a region containing six gene mutations contained in exon 12 of JAK2 were designed and evaluated. The designed primer sets are as shown in FIG. 3. In this example, the primer sets shown in Table 10 below were evaluated. F1 to F5 and R1 to R3 in Table 10 correspond to FIG. 1. As shown in FIG. 3, forward primers F1, F3 to F5 were included in the range of the base sequence shown in SEQ ID NO: 1, and forward primer F2 was designed to be outside the range (SEQ ID NO: 52). In Experimental Example 1 and Experimental Example 2 described later, wild-type peripheral blood genomic DNA derived from healthy subjects was used as a sample, and evaluation was performed based on the fluorescence intensity of the wild-type probe.

The results are shown in Figure 4. As can be seen from Figure 4, it was clear that when using any of the primer sets designed in this example other than primer set 2 using F2, excellent fluorescence intensity could be achieved for all amplified fragments. Of these sets, primer sets 1, 4, and 5, which have high overall fluorescence intensity, are preferable, and primer sets 1 and 5, which have relatively small differences in intensity between the regions analyzed, are more preferable. In the following evaluation, primer set 5 (combination of F5 and R2) was used, as shown in Table 2.

[Experimental Example 3]
Figures 5 and 6 show characteristic diagrams in which the horizontal axis indicates the primer concentration in the primer mix mixed in the PCR reaction solution, the concentration of the labeled primer (forward primer) in the primer set that amplifies the region including the V617F mutation site, and the vertical axis indicates the fluorescence intensity derived from the four amplified regions. Figures 7 and 8 show characteristic diagrams in which the horizontal axis indicates the primer concentration in the primer mix mixed in the PCR reaction solution, the concentration of the labeled primer (reverse primer) in the primer set that amplifies JAK2 exon 12, and the vertical axis indicates the fluorescence intensity derived from the four amplified regions.

As can be seen from Figure 5, when the concentration of one of the labeled primers in the primer set amplifying the region containing the V617F mutation site was 0.5 μM, a fluorescence intensity of 12,000 or more could not be achieved. Also, as can be seen from Figure 6, when the concentration of one of the labeled primers in the primer set amplifying the region containing the V617F mutation site was 2.5 μM, a fluorescence intensity of 12,000 or more could not be achieved when the concentration of one of the labeled primers in the primer set amplifying exon 12 was 2.0 μM.

On the other hand, as can be seen from Figure 7, even when the concentration of one of the labeled primers in the primer set amplifying exon 12 was 3.0-4.0 μM, a fluorescence intensity of 12,000 or more could not be achieved when the concentration of one of the labeled primers in the primer set amplifying the region containing the V617F mutation site was 0.5 μM. Also, as can be seen from Figure 8, a fluorescence intensity of 12,000 or more could be achieved when the concentration of one of the labeled primers in the primer set amplifying the region containing the V617F mutation site was 1.0 μM or more and the concentration of one of the labeled primers in the primer set amplifying exon 12 was 2.5 μM or more.

Figure 9 shows a characteristic diagram in which the horizontal axis represents the primer concentration in the primer mix mixed into the PCR reaction solution, the concentration ratio between the labeled primer (reverse primer) in the primer set that amplifies exon 12 and the labeled primer (forward primer) in the primer set that amplifies the region containing the V617F mutation site, and the vertical axis represents the fluorescence intensity derived from the four amplified regions. As can be seen from Figure 9, when the concentration ratio was in the range of 1.0 to 5.5, a fluorescence intensity of 12,000 or more was achieved for all amplified fragments.

[Example 2]
In this example, an artificial gene (plasmid) carrying a wild-type or mutant-type sequence of the region to be analyzed was constructed as the mutant model sample, and an arbitrary mixture of the wild-type artificial gene and the mutant-type artificial gene was used, and PCR for detecting mutations was performed with the reaction solution composition shown in Table 11.

In this example, the blocker oligo DNA shown in Table 12 was added to the PCR reaction solution. The blocker is added to suppress non-specific hybridization of the mutation detection probe so that sufficient detection sensitivity can be obtained even when the mutation rate of the gene to be analyzed is small, and is designed to specifically hybridize with the amplified product derived from the wild type.

In this example, wild-type samples (n=9) in which all the gene regions to be analyzed were of the wild type, and mutant model samples (n=3) in which some of the gene regions to be analyzed were of the mutant type were used, and the proportion of mutant model samples was 1% or 5%. The results are shown in Figure 10. The error bars in Figure 10 are 5σ.

As shown in Figure 10, it became clear that all gene mutations of 1% or 5% could be identified.

Claims (4)

A gene mutation associated with myeloproliferative neoplasms in CALR,
A type 1 mutation of 52 bases deleted, in which 52 bases from 506 to 557 in the base sequence of the wild-type CARL gene shown in SEQ ID NO:10 are deleted;
Type 3 mutation, which is a 46-base deletion in which 46 bases from 509 to 554 in the same base sequence are deleted;
a type 4 mutation in which 34 bases at positions 516 to 549 in the base sequence are deleted, and a type 5 mutation in which 52 bases at positions 505 to 556 in the base sequence are deleted,
The CALR mutant probe is characterized by having a mismatch due to an artificial deletion ,
The CALR mutant probe for the above-mentioned type 1 mutation comprises any one of the base sequences selected from the group consisting of the base sequences shown in SEQ ID NOs: 90 to 91, and 93 to 95, or a complementary base sequence thereof;
The CALR mutant probe for the above-mentioned type 3 mutation comprises any one of the base sequences selected from the group consisting of the base sequences shown in SEQ ID NOs: 53 , and 67 to 69 , or a complementary base sequence thereof;
The CALR mutant probe for the above-mentioned type 4 mutation comprises any one of the base sequences selected from the group consisting of the base sequences shown in SEQ ID NOs: 54 and 73 to 81 , or a complementary base sequence thereof;
A gene mutation evaluation kit, characterized in that the CALR mutation probe for the above-mentioned type 5 mutation comprises any one of the base sequences selected from the group consisting of the base sequences shown in SEQ ID NO: 55 , and 85 to 88, or a complementary base sequence thereof. The kit for evaluating gene mutations according to claim 1, further comprising a CALR mutant probe corresponding to a type 2 mutation in which TTGTC is inserted between the 568th and 569th bases in the base sequence of the wild-type CARL gene shown in SEQ ID NO: 10. The kit for evaluating gene mutations according to claim 1, further comprising a JAK2 mutation probe corresponding to a gene mutation in JAK2 associated with myeloproliferative neoplasms and/or an MPL mutation probe corresponding to a gene mutation in MPL associated with myeloproliferative neoplasms. A data analysis method for diagnosing myeloproliferative neoplasms, comprising using the gene mutation evaluation kit according to any one of claims 1 to 3 to identify at least one gene mutation selected from the group consisting of type 3 mutations, type 4 mutations, and type 5 mutations associated with myeloproliferative neoplasms in CARL in a subject to be diagnosed.

Images