JP7477886B2 - Nucleic acid aptamers - Google Patents

Description

The present invention relates to a nucleic acid aptamer. This application claims priority based on Japanese Patent Application No. 2019-096035, filed in Japan on May 22, 2019, the contents of which are incorporated herein by reference.

In recent years, antibody drugs have flourished as cancer treatment drugs, but in addition to their high drug prices, the number of disease-related proteins that can be treated has reached a plateau, and the limitations of antibody drugs are becoming apparent. For this reason, there is a strong demand for the development of post-antibody drugs with a matrix structure different from that of antibodies. DNA/RNA aptamers, which are formed from single-stranded DNA or RNA and have high binding ability and selectivity for biomolecules including proteins, can be synthesized inexpensively and have low antigenicity, so they are attracting attention as target recognition molecules to replace antibodies. One of the aptamer drugs that has been approved so far is pegaptanib (trade name "Macugen", approved in the United States in 2004 and in Japan in 2008), a treatment for age-related macular degeneration (see, for example, Patent Document 1).

However, antibody drugs and nucleic acid aptamer drugs approved to date cannot penetrate cell membranes, and therefore their targets are limited to the extracellular space. Therefore, there is a need to develop molecular targeted drugs that can penetrate cell membranes while maintaining the high molecular recognition and binding abilities of antibodies and nucleic acid aptamers.

In addition, methods for introducing proteins such as antibodies into cells include methods that utilize uptake into the cells by fusing or mixing with membrane-permeable peptides, and intracellular introduction using liposomes, etc. However, these have not yet been put to practical use due to problems such as aggregation of target molecules and the difficulty of introducing only specific molecules into cells.

U.S. Pat. No. 6,011,020

The present invention has been made in consideration of the above circumstances, and provides a nucleic acid aptamer whose binding ability to any target molecule within a cell and its cell membrane permeability can be controlled spatiotemporally.

As a result of extensive research to achieve the above-mentioned objective, the inventors focused on the fact that guanine-rich DNA molecules form quadruplex structures in response to cations, and discovered a nucleic acid aptamer that has high specificity and selectivity for any target molecule within a cell, and whose binding ability to any target molecule within a cell and cell membrane permeability can be spatiotemporally controlled by cation stimulation, thereby completing the present invention.

That is, the present invention includes the following aspects.
A method according to a first aspect of the present invention is a method for permeating a cell membrane with a nucleic acid aptamer, the nucleic acid aptamer forming a G-quadruplex structure in the presence of a cation and having cell membrane permeability, comprising contacting the nucleic acid aptamer with a cell in the presence of a cation without using an introduction agent, the method comprising:
The nucleic acid aptamer is
a first region, a second region, a third region and a fourth region which form a G-quadruplex structure;
a connecting region A, a connecting region B, and a connecting region C between the first region, the second region, the third region, and the fourth region, respectively;
The first region comprises the base sequence shown in SEQ ID NO:1,
the second region, the third region, and the fourth region each have a base sequence as shown in SEQ ID NO:2,
At least one region selected from the group consisting of linking region A, linking region B, and linking region C has a specific binding ability to a target molecule in the presence of a cation.
The cation may be a specific type of cation.
In the method according to the first aspect, the nucleic acid aptamer may further have a 3′-end additional sequence downstream of the fourth region, and the 3′-end additional sequence may consist of the base sequence shown in SEQ ID NO:3.
In the method according to the first aspect, the nucleic acid aptamer may comprise a polynucleotide consisting of the base sequence shown in SEQ ID NO:4.
In the method according to the first aspect, the nucleic acid aptamer may comprise a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5 to 7.
A nucleic acid aptamer according to a second aspect of the present invention is a nucleic acid aptamer that forms a G-quadruplex structure in the presence of a cation and has a cell membrane permeability,
a first region, a second region, a third region and a fourth region which form a G-quadruplex structure;
a connecting region A, a connecting region B, and a connecting region C between the first region, the second region, the third region, and the fourth region, respectively;
The first region comprises the base sequence shown in SEQ ID NO:1,
the second region, the third region, and the fourth region each have a base sequence as shown in SEQ ID NO:2,
at least one region selected from the group consisting of the linking region A, the linking region B, and the linking region C has a specific binding ability to a target molecule in the presence of a cation;
It includes a polynucleotide consisting of the base sequence shown in any one of SEQ ID NOs: 5 to 7.

According to the nucleic acid aptamer of the above aspect, it is possible to provide a nucleic acid aptamer whose binding ability to any target molecule within a cell and cell membrane permeability can be controlled in time and space.

FIG. 1 shows classification types of G-quadruplex structures. FIG. 1 is a schematic diagram showing a nucleic acid aptamer according to one embodiment of the present invention. FIG. 2 is a schematic diagram showing a nucleic acid aptamer according to another embodiment of the present invention. FIG. 2 is a diagram showing a schematic representation of the base sequence of each DNA aptamer in Example 1. 1 is a graph showing the inhibition curve of PPM1D by each DNA aptamer in Example 1. 1 is a graph showing the circular dichroism (CD) spectra of each DNA aptamer in the presence of different concentrations of potassium ions in Example 1. 6 is a graph showing an analysis of the change due to differences in potassium ion concentration at the peak wavelength (M1D-Q5F: 267 nm, M1D-Q5M and M1D-Q5: 265 nm) in the CD spectrum shown in FIG. 5. 1 shows images depicting the results of Western blotting analysis of the protein expression levels of p53 and β-actin in MCF7 cells administered with M1D-Q5F or M1D-Q5M by the auto-penetration method in Example 1. 8 is a graph showing the quantification of the signals of the bands shown in FIG. 7. 1 is a graph showing the change in cell proliferation rate of MCF7 cells to which different concentrations of M1D-Q5F or M1D-Q5M were administered by the auto-penetration method in Example 1. 1 shows fluorescent staining images of MCF7 cells to which Cy3-labeled M1D-Q5M or 5'primer was administered by the auto-penetration method in Example 1. This is a stained image obtained by analyzing the fluorescent stained image of MCF7 cells to which Cy3-labeled M1D-Q5M shown in FIG. 10 was administered by the auto-penetration method, sliced along the X-axis and Y-axis. 1 shows fluorescent staining images of MCF7 cells to which Cy3-labeled M1D-Q5F, M1D-Q5M, or 5'primer was administered by the auto-penetration method in Example 1. 13 is an image showing the results of polyacrylamide gel electrophoresis analysis of the resistance of M1D-Q5M or M1D-Q5M Scrambled to degradation by DNase I in the presence or absence of a cation (sodium chloride or potassium chloride) in Example 2. 14 is a graph showing the quantification of the signals of the bands shown in FIG. 13. 13 is an image showing the results of polyacrylamide gel electrophoresis analysis of the stability of M1D-Q5M or M1D-Q5M Scrambled to serum in the presence of cations (sodium chloride and potassium chloride) in Example 2. 16 is a graph showing the quantification of the signals of the bands shown in FIG. 15. 1 shows a fluorescent staining image of MCF7 cells into which M1D-Q5M was introduced by lipofection in Reference Example 1. 1 shows a fluorescent staining image of MCF7 cells administered with M1D-Q5 in Example 3. 13 is a fluorescent staining image of MCF7 cells administered with Cy3-labeled M1D-Q5M in Example 4. 13 is a fluorescent staining image of MCF7 cells administered with TAMRA-labeled M1D-Q5M in Example 4. 1 shows a fluorescent staining image of MCF7 cells administered with M1D-Q5M in Example 4. 13 is a fluorescent staining image of MCF7 cells administered with G4CAA1 in Example 5. 13 is a fluorescent staining image of MCF7 cells administered with G4CAA2 in Example 5. 13 is a graph showing the binding amount of Sp1-G4-6 to PPM1A, PPM1D, hScp1, hScp3, Fcp1 full-M/H, and Fcp1 Δins in Example 6. 13 is a graph showing a competitive test of each DNA aptamer for the binding of Scp1 to biotinylated Sp1-G4-6 in Example 6. 13 is a graph showing the amount of Sp1-G4-6 binding to full-length Scp1 and a deletion of 76 amino acid residues in the N-terminal region of Scp1 in Example 6. 1 is a graph showing the CD spectrum of Sp1-G4-6 in the presence of potassium ions in Example 6. 28 is a graph showing an analysis of the change in the maximum value at 265.5 nm of Sp1-G4-6 in the CD spectrum shown in FIG. 27 due to differences in potassium ion concentration. 1 is a graph showing the degradation resistance of Sp1-G4-6 to DNase I in the presence or absence of potassium chloride in Example 6. 1 is a graph showing the serum stability of Sp1-G4-6 in the presence or absence of potassium chloride in Example 6. 13 is a fluorescent staining image of MCF7 cells administered with TAMRA-labeled Sp1-G4-6 in Example 6. 1 is a graph showing the CD spectrum of MnG4C1 in the presence of manganese ions in Example 7. 13 is a graph showing the results of measuring manganese ion responsiveness using MnG4C1 labeled with FAM and TAMRA in Example 7. 13 is a graph showing the results of detecting structural changes in MnG4C1 using Thioflavin T in Example 7. 13 is a fluorescent staining image of MCF7 cells administered with MnG4C1 labeled with FAM and TAMRA in Example 7.

<G-quadruplex structure>
The G-quadruplex (also called "G-quadruplex", "G4", or "G-quartet") structure is one of the higher-order structures of DNA, and is a specific three-dimensional structure formed by four pairs of guanine sequences. Guanine-rich DNA molecules respond to cations to form a G-quadruplex structure. Focusing on this, the inventors independently designed a library of DNA aptamers (hereinafter sometimes referred to as "ion-responsive DNA aptamers (IRDAptamer)") with a diversity of 2.8 x 10 ¹¹ types and based on a backbone that changes its three-dimensional structure in response to cation stimulation to form a G-quadruplex structure. From the library, they screened and identified nucleic acid aptamers that can spatiotemporally control the binding ability to any target molecule in a cell and the cell membrane permeability.

As shown in the examples described later, the nucleic acid aptamer of this embodiment does not form a G-quadruplex structure in an environment with a low cation concentration of less than 5 mM, and has low binding ability to intracellular target molecules and cell membrane permeability. However, in a range of in vivo cation concentrations of 5 mM to 140 mM, the three-dimensional structure changes and forms a G-quadruplex structure, allowing it to permeate the cell membrane. Furthermore, after permeating the cell membrane, it can specifically bind to any target molecule in the cell. The cation concentration that forms the G-quadruplex structure varies depending on the type of nucleic acid aptamer and the type of cation, and is not limited to the above concentration range. Specifically, when the nucleic acid aptamer of this embodiment has responsiveness to sodium ions, potassium ions, and calcium ions that are relatively abundant in the body, it can form a G-quadruplex structure in the above range of in vivo concentration changes. On the other hand, when the nucleic acid aptamer of this embodiment is responsive to metal ions present in extremely small amounts in the body (e.g., zinc ions, cobalt ions, nickel ions, manganese ions, iron ions, and other cofactors essential for enzyme activity), it can form a G-quadruplex structure at a concentration lower than the above concentration range (e.g., less than 5 mM).

Based on their topology, G-quadruplex structures are classified into propeller type, basket type, and a hybrid type that combines the propeller and basket types (see Figure 1) (Reference 1: Zhou J et al., "The NEIL glycosylases remove oxidized guanine lesions from telomeric and promoter quadruplex DNA structures.", Nucleic Acids Res., Vol. 43, No. 8, p4039-4054, 2015.).
As shown in the Examples described below, the nucleic acid aptamer of this embodiment forms a propeller-type G-quadruplex structure.

It should be noted that whether or not the nucleic acid aptamer of this embodiment forms a G-quadruplex structure can be confirmed by using a known method. The presence of a propeller-type G-quadruplex structure can be confirmed, for example, by detecting a negative peak near 245 nm and a positive peak near 265 nm by circular dichroism (CD) spectrum measurement. In addition, since the G-quadruplex structure is formed in the presence of cations, as shown in the examples described below, for example, the presence of the G-quadruplex structure can be confirmed with higher reliability by comparing the CD spectrum of a nucleic acid aptamer in a solution containing cations such as potassium ions and sodium ions with the CD spectrum of a nucleic acid aptamer in a solution not containing cations.

The cations used to form the G-quadruplex structure are not particularly limited as long as they are cations present in the living body, and may be, for example, monovalent cations such as sodium ions and potassium ions, divalent cations such as magnesium ions, calcium ions, and manganese ions, or trivalent or higher cations. The nucleic acid aptamer of this embodiment may form a G-quadruplex structure in the presence of a specific type of cation, but may not form a G-quadruplex structure in the presence of other cations. In this case, the nucleic acid aptamer of this embodiment can be used as a nucleic acid aptamer for detecting the specific type of cation.

<Nucleic acid aptamer>
An aptamer is generally a molecule that specifically binds to a target molecule, and known examples include nucleic acid aptamers and peptide aptamers.

The nucleic acid aptamer of this embodiment is a nucleic acid aptamer that forms a G-quadruplex structure in the presence of cations and has cell membrane permeability. Specifically, when the cation is a sodium ion, potassium ion, or calcium ion that is relatively abundant in the body, the G-quadruplex structure is not formed at a low concentration of the cation less than 5 mM, while the three-dimensional structure changes and the G-quadruplex structure is formed at a concentration change range in the body of the cation between 5 mM and 140 mM, allowing the nucleic acid aptamer to permeate the cell membrane. Therefore, by controlling the location and time of applying the cation stimulus, the cell membrane permeability of the nucleic acid aptamer of this embodiment can be controlled spatiotemporally. Furthermore, in the nucleic acid aptamer of this embodiment, the binding ability to any target molecule in the cell can be expressed in the presence of cations. For example, when a molecule that is overexpressed in a cancer cell is targeted, the nucleic acid aptamer can be used as a nucleic acid aptamer that specifically exerts anticancer activity on cancer cells without affecting normal cells by applying the cation stimulus only at the site where the cancer cell is present.

In this specification, the nucleic acid may be a natural nucleic acid such as DNA or RNA, or an artificial nucleic acid such as LNA (locked nucleic acid) or BNA (bridged nucleic acid), or may be a nucleic acid derivative such as a peptide nucleic acid such as PNA (peptide nucleic acid) as long as it has a function similar to that of a nucleic acid. The nucleic acid constituting the aptamer of this embodiment may be a combination of two or more types of nucleic acid, for example, a combination of DNA and LNA.

Fig. 2A is a schematic diagram of a nucleic acid aptamer according to one embodiment of the present invention. Note that the cation 4 shown in Fig. 2A is represented by "M ⁺ " and is an example of a monovalent cation, but may be a divalent cation, and its valence is not limited.
The nucleic acid aptamer 10 has a first region 1a, a second region 1b, a third region 1c, and a fourth region 1d that form a G-quadruplex structure. The first region consists of the base sequence shown in SEQ ID NO: 1. The second region, the third region, and the fourth region each consist of the base sequence shown in SEQ ID NO: 2. The first region 1a, the second region 1b, the third region 1c, and the fourth region 1d form a G-quadruplex structure in the presence of a cation 4, as shown in FIG. 2A.
In recent years, the DNA aptamer drug AS1411, which has a G-quadruplex structure and is at the Ph. 2 level of clinical trials, is known to bind to the protein nucleolin localized in the cell membrane and migrate into the cell (Reference 1: "Cheng Y et al., "AS1411-Induced Growth Inhibition of Glioma Cells by Up-Regulation of p53 and Down-Regulation of Bcl-2 and Akt1 via Nucleolin," PLoS One, Vol. 11, No. 12, e0167094, 2016.").
However, the present inventors have found for the first time that the nucleic acid aptamer 10 forming a G-quadruplex structure can permeate cell membranes.

The nucleic acid aptamer 10 further has a linking region A (2a), a linking region B (2b) and a linking region C (2c) between the first region 1a, the second region 1b, the third region 1c and the fourth region 1d, respectively. At least one region selected from the group consisting of the linking region A (2a), the linking region B (2b) and the linking region C (2c) has a specific binding ability to the target molecule in the presence of a cation 4, and two of these regions may have a specific binding ability to the target molecule in the presence of a cation 4, or all of these three regions may have a specific binding ability to the target molecule in the presence of a cation 4. It is preferable that all of the linking region A (2a), the linking region B (2b) and the linking region C (2c) have a specific binding ability to the target molecule in the presence of a cation 4, since this makes the specific binding ability to the target molecule more stable and strong. In each region, the site having a specific binding ability to the target molecule may be a part of the region or may be the whole region. The base sequences of these regions can be appropriately selected according to the type of the target molecule.

FIG. 2B is a schematic diagram showing a nucleic acid aptamer according to another embodiment of the present invention.
2A in that the nucleic acid aptamer 20 further has a 3'-end additional sequence 3 downstream of the fourth region 1d, but otherwise is the same as the nucleic acid aptamer 10. Therefore, the same reference numerals are used for the same points as the nucleic acid aptamer 10, and the description thereof will be omitted.

The 3'-end additional sequence 3 consists of the base sequence shown in SEQ ID NO: 3. In addition to forming a G-quadruplex structure, the nucleic acid aptamer of this embodiment has a sequence consisting of the base sequence shown in SEQ ID NO: 3, and as shown in the examples described later, it can exhibit superior cell membrane permeability in the presence of cations.

Specific examples of the nucleic acid aptamer of this embodiment include a nucleic acid aptamer containing a polynucleotide consisting of the base sequence shown in SEQ ID NO: 4. The nucleic acid aptamer of this embodiment may consist only of a polynucleotide consisting of the base sequence shown in SEQ ID NO: 4. In the following base sequences, "-" represents a nucleotide bond, and the same applies to the subsequent base sequences.

5'-N-RGG-NNNNNN-TTAGGG-NNNNNN-TTAGGG-NNNNNN-TTAGGG-3' (SEQ ID NO: 4)

In the base sequence shown in SEQ ID NO:4, the nucleic acid has a sequence containing four pairs of guanines consisting of "RGG" (SEQ ID NO:1; R is A or G) and three "TTAGGG" (SEQ ID NO:2) (corresponding to the above-mentioned first region, second region, third region, and fourth region, respectively), which allows the nucleic acid to form a G-quadruplex structure in the presence of cations, thereby enabling the nucleic acid to exhibit excellent cell membrane permeability in the presence of cations.
In addition, a nucleic acid aptamer containing a polynucleotide consisting of the base sequence shown in SEQ ID NO: 4 may further have a 10-base region "TCAGACTGTG" (SEQ ID NO: 3) (corresponding to the above-mentioned 3'-terminal additional sequence) at the 3'-end of the polynucleotide consisting of SEQ ID NO: 4.

In this specification, "cell membrane permeability" refers to the ability to permeate the lipid membrane that separates the outside and inside of a cell. Whether a nucleic acid has cell membrane permeability can be confirmed by adding a nucleic acid to which a fluorescent substance has been linked to the nucleic acid to a cell, observing the cell with a confocal laser microscope or the like, and checking whether the fluorescent substance can be detected inside the cell. In addition, cell membrane permeability can be quantitatively confirmed by disrupting the cells that have taken up the nucleic acid to which a fluorescent substance has been linked, and measuring the fluorescence intensity of the disrupted solution using a spectrophotometer.

In addition, in the base sequence shown in SEQ ID NO: 4, N is any base, and is any one of the bases adenine, guanine, cytosine, and thymine. By appropriately selecting a region consisting of any base (N) in the base sequence shown in SEQ ID NO: 4 (corresponding to the above linking region A, linking region B, and linking region C) according to the type of target molecule, it is possible to exert binding ability to any target molecule within a cell.

There are no particular limitations on the target molecule as long as it is a molecule present within a cell, but it is preferable to use a molecule that is expressed due to the onset of various diseases (e.g., cancer) or that is overexpressed when various diseases are onset as the target molecule.

For example, when the target molecule is the dephosphorylation enzyme protein phosphatase magnesium-dependent 1 Delta (PPM1D), a polynucleotide consisting of the base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17 is preferably exemplified as a nucleic acid aptamer capable of controlling the binding ability to PPM1D and the cell membrane permeability in a spatiotemporal manner.

5'-G-AGG-TAATTG-TTAGGG-GCGTTG-TTAGGG-TGGGAC-TTAGGG-TCAGACTGTG-3' (SEQ ID NO: 5)
5'-G-AGG-TAATTG-TTAGGG-GCGTTG-TTAGGG-TGGGAC-TTAGGG-3' (SEQ ID NO: 10)
5'-C-AGG-GGTGGG-TTAGGG-AGGGGT-TTAGGG-TGACTG-TTAGGG-3' (SEQ ID NO: 16)
5'-T-AGG-GGGGGT-TTAGGG-GGGGGC-TTAGGG-CTGCTT-TTAGGG-3' (SEQ ID NO: 17)

＜PPM1D＞
PPM1D is a PP2C-type Ser/Thr phosphatase consisting of 605 amino acid residues and classified as a PPM family member. Genetic amplification and overexpression of PPM1D have been reported in various cancer cells, including breast cancer and ovarian cancer, and it has attracted attention as a target for anticancer drugs. A characteristic feature of the structure of PPM1D is that it has a loop structure region rich in basic amino acid residues (basic-residue-rich loop; B-loop), which is located near the active center of the enzyme. The amino acid sequence of the B-loop is "VWKRPRLTHNGPVRRSTVIDQIPF" (SEQ ID NO: 8). This B-loop does not exist in other phosphatases classified into the PPM family (e.g., PPM1A, etc.), and it is thought that the B-loop contributes to substrate recognition and intracellular localization of PPM1D. For these reasons, as shown in the examples described below, a nucleic acid aptamer that specifically binds to PPM1D can be developed by searching for a DNA aptamer that targets the B-loop of PPM1D. Here, "specifically binds to the B-loop of PPM1D" means that it does not bind to phosphatases other than PPM1D, and further does not bind to sites other than the B-loop of PPM1D, but binds only to the B-loop of PPM1D. A polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17 is a PPM1D-specific inhibitor that has enzyme selectivity, targets the B-loop of PPM1D, and has cell membrane permeability.

In addition, information on the nucleotide sequence of the human PPM1D gene and the amino acid sequence of PPM1D can be obtained from databases such as Genbank. The amino acid sequence of human PPM1D is disclosed, for example, under Genbank accession number NP_003611.

As shown in the Examples below, a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17 does not form a G-quadruplex structure and has low inhibitory activity against PPM1D in an environment with a low cation concentration of less than 5 mM, but changes its three-dimensional structure and forms a G-quadruplex structure in a range of in vivo cation concentrations of 5 mM to 140 mM, allowing it to permeate the cell membrane and specifically bind to the B-loop of PPM1D. Note that the "inhibitory activity against PPM1D" here means the activity of inhibiting the enzymatic activity of PPM1D. The enzymatic activity of PPM1D can be confirmed by analyzing the dephosphorylation activity of PPM1D against a substrate, as shown in the Examples below. The nucleic acid aptamer has the inhibitory activity against PPM1D, for example, by comparing the enzyme activity of PPM1D in the absence of nucleic acid aptamer with the enzyme activity of PPM1D in the presence of nucleic acid aptamer, when the enzyme activity of PPM1D in the presence of nucleic acid aptamer is lower than the enzyme activity of PPM1D in the absence of nucleic acid aptamer, the nucleic acid aptamer can be judged to have the inhibitory activity against PPM1D.In addition, the inhibitory activity against PPM1D can be quantified by the following formula:

(Inhibitory activity against PPM1D)
= (enzyme activity of PPM1D in the presence of nucleic acid aptamer) / (enzyme activity of PPM1D in the absence of nucleic acid aptamer) × 100

The binding ability of a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17 to PPM1D can be confirmed using a known binding measurement method. For example, a sample solution containing a labeled nucleic acid aptamer is contacted with PPM1D immobilized on a solid phase. After a certain period of contact, the sample solution is removed from the solid phase by washing or the like, and the presence of the aptamer on the solid phase is detected to confirm the binding ability. If the label is detected, the nucleic acid aptamer is bound to PPM1D, and it can be determined that the nucleic acid aptamer has the binding ability to PPM1D.
In addition, the binding ability of the nucleic acid aptamer to the B-loop of PPM1D can be confirmed by carrying out the above-mentioned measurement method using wild-type PPM1D and PPM1D B-loop deletion. Specifically, when the label is detected in wild-type PPM1D, while the label is not detected in PPM1D B-loop deletion, it can be determined that the nucleic acid aptamer binds to the B-loop of PPM1D and has the binding ability to the B-loop of PPM1D.

Furthermore, for example, when the target molecule is the dephosphorylation enzyme Small CTD phosphatase 1 (Scp1), a polynucleotide having the base sequence shown in SEQ ID NO: 6 is a preferred example of a nucleic acid aptamer whose binding ability to Scp1 and cell membrane permeability can be spatiotemporally controlled.

5'-T-AGG-GGGGTA-TTAGGG-AGGGTC-TTAGGG-GTGGGC-TTAGGG-3' (SEQ ID NO: 6)

＜Scp1＞
Scp1 is an FCP/SCP type Ser/Thr phosphatase that consists of 261 amino acid residues and is classified into the small C-terminal domain phosphatase (SCP) family. Scp1 has been reported to be involved in tumor suppression in kidney cancer and liver cancer, and has attracted attention as a target for anticancer drugs. As shown in the Examples below, a nucleic acid aptamer that specifically binds to Scp1 can be developed by searching for a DNA aptamer that targets Scp1. Note that "specifically binds to Scp1" here means that it does not bind to phosphatases other than Scp1 and only binds to Scp1. As shown in the Examples below, a polynucleotide consisting of the base sequence shown in SEQ ID NO: 6 is an Scp1-specific nucleic acid aptamer that has enzyme selectivity, targets Scp1, and has cell membrane permeability.

In addition, information on the nucleotide sequence of the human Scp1 gene and the amino acid sequence of Scp1 can be obtained from databases such as Genbank. The amino acid sequence of human Scp1 is disclosed, for example, under Genbank accession numbers NP_001193807.1, NP_067021.1, NP_872580.1, XP_011509871.1, XP_011509872.1, XP_016860104.1, XP_016860105.1, XP_016860106.1, and XP_016860107.1.

As shown in the Examples described below, a polynucleotide consisting of the base sequence shown in SEQ ID NO:6 changes its three-dimensional structure and forms a G-quadruplex structure when the cation concentration in the body changes from 5 mM to 140 mM, thereby allowing it to permeate the cell membrane and bind specifically to Scp1 (in particular, the 76 amino acid residues in the N-terminal region of Scp1).

The binding ability of a polynucleotide consisting of the base sequence shown in SEQ ID NO:6 to Scp1 can be confirmed using a known binding measurement method. For example, a sample solution containing a labeled nucleic acid aptamer is contacted with Scp1 immobilized on a solid phase. After a certain period of contact, the sample solution is removed from the solid phase by washing or the like, and the presence of the aptamer on the solid phase is detected to confirm the binding ability. If a label is detected, it can be determined that the nucleic acid aptamer is bound to Scp1 and that the nucleic acid aptamer has the binding ability to Scp1.

Furthermore, for example, when a specific cation in the body, specifically manganese ion (Mn ²⁺ ), is used as a target molecule, a polynucleotide consisting of the base sequence shown in SEQ ID NO: 7 is preferably exemplified as a nucleic acid aptamer whose recognition ability for Mn ²⁺ and cell membrane permeability can be controlled in a spatiotemporal manner.

5'-A-GGG-GGGGAG-TTAGGG-CGCACG-TTAGGG-GTGCTA-TTAGGG-3' (SEQ ID NO: 7)

<Manganese ion (Mn2 ⁺ )>
Manganese ions (Mn ²⁺ ) are known to have specific and non-specific effects on many enzyme activities. As shown in the examples below, a nucleic acid aptamer that changes structure depending on the concentration of Mn ²⁺ can be developed by searching for a DNA aptamer that targets Mn ^{2+. In addition, the term "changing structure depending on the concentration of Mn 2+ "} means that a G-quadruplex structure is not formed in the presence of cations other than Mn ²⁺ , but a G-quadruplex structure is formed in the presence of Mn ²⁺ . As shown in the examples below, the polynucleotide consisting of the base sequence shown in SEQ ID NO: 7 is a nucleic acid aptamer for detecting Mn ²⁺ that has Mn ²⁺ selectivity and cell membrane permeability.

As shown in the Examples described below, a polynucleotide consisting of the base sequence shown in SEQ ID NO: 7 does not form a G-quadruplex structure and has low recognition ability for Mn ²⁺ in an environment with a low Mn ²⁺ concentration of less than 0.05 mM, but when the Mn ²⁺ concentration changes in the biological range of approximately 0.05 mM or more and 1 mM or less, it changes its three-dimensional structure and forms a G-quadruplex structure, which allows it to permeate the cell membrane and selectively detect Mn ²⁺ .
In addition, it has been reported that K ⁺ ions and the like electrostatically interact with oxygen in DNA (Reference 2: "Bhattacharyya D et al., "Metal Cations in G-Quadruplex Folding and Stability," Front Chem., Vol. 4, Issue 38, doi: 10.3389/fchem.2016.00038, 2016.") and based on the structural changes based on the CD spectrum data shown in the Examples below, it is believed that ^Mn2+ interacts with the negative charge of the polynucleotide consisting of the base sequence shown in SEQ ID NO:7 to form a parallel G-quadruplex structure in which Mn2 ⁺ is coordinated at the center of the G-quadruplex structure.

The Mn ²⁺ recognition ability of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 7 can be confirmed, for example, by using the method shown below. First, a solution containing Mn ²⁺ is added to a sample solution containing a labeled nucleic acid aptamer to contact the labeled nucleic acid aptamer with Mn ²⁺ . At this time, it is preferable to label the 5'-end and 3'-end of the nucleic acid aptamer by binding them in advance with a combination of labeling substances that can cause FRET (Fluorescence (Foerster) Resonance Energy Transfer). Examples of combinations of labeling substances that may cause FRET include a fluorescent dye with an excitation wavelength of about 490 nm (e.g., FAM, FITC, rhodamine green, Alexa (registered trademark) fluor 488, BODIPY FL, etc.) and a fluorescent dye with an excitation wavelength of about 540 nm (e.g., TAMRA, tetramethylrhodamine, Cy3), or a combination of a fluorescent dye with an excitation wavelength of about 540 nm (the same as above) and a fluorescent dye with an excitation wavelength of about 630 nm (e.g., Cy5, etc.). As a result, when a G-quadruplex structure is formed in the presence of Mn ²⁺ , the distance between the labeling substances bound to the 5' end and the 3' end of the nucleic acid aptamer is reduced, causing FRET and detecting fluorescence. Therefore, when the fluorescence is detected, it can be determined that the nucleic acid aptamer has formed a G-quadruplex structure and that the nucleic acid aptamer has the ability to recognize Mn ²⁺ .

Also, for example, a solution containing Mn ²⁺ is added to a sample solution containing a nucleic acid aptamer to contact the nucleic acid aptamer with Mn ²⁺ . At this time, thioflavin T is added simultaneously with or after the contact. It has been reported that thioflavin T binds to DNA that has formed a G-quadruplex structure and emits fluorescence. Therefore, when the fluorescence of thioflavin T is detected, it can be determined that the nucleic acid aptamer has formed a G-quadruplex structure and has the ability to recognize Mn ²⁺ .

The nucleic acid aptamer of this embodiment may have a protein, lipid, sugar chain, low molecular weight compound, polyethylene glycol chain, fluorescent molecule, etc. attached to at least one of the 5' end and 3' end of the polynucleotide, as long as the binding ability to the target molecule and the cell membrane permeability are not impaired.

In addition, since the nucleic acid aptamer of this embodiment has its cell membrane permeability and binding ability to a target molecule controlled spatiotemporally by cationic stimulation, it is preferable to use it in combination with a cation channel acting agent. The "cation channel acting agent" referred to here is an agent configured to increase the concentration of at least one type of cation selected from the group consisting of sodium ions, potassium ions, calcium ions, and magnesium ions in the cells. For example, when the potassium ions in the cells are increased by the agent, the concentrations of other cations such as sodium ions may also increase, decrease, or remain unchanged. Specific examples of cation channel acting agents include ouabain and tetraethylammonium. The nucleic acid aptamer and the cation channel acting agent may be administered by the same administration route or by different administration routes. Furthermore, the nucleic acid aptamer and the cation channel acting agent may be administered simultaneously, sequentially, or separately with a certain time or period in between. In one embodiment, the nucleic acid aptamer and the cation channel acting agent may be a kit that includes them.

<Method for producing nucleic acid aptamer>
The nucleic acid aptamer of this embodiment can be produced, for example, by the following method.
When designing a cell-permeable nucleic acid aptamer that targets a specific molecule within a cell, first, a library is constructed consisting of a plurality of nucleic acid aptamers in which a region consisting of an arbitrary base (N) (corresponding to linkage region A, linkage region B, and linkage region C) differs in a polynucleotide consisting of the base sequence shown in SEQ ID NO: 4 as shown below, and which have a common primer sequence for amplifying the nucleic acid aptamer at the 5' end and 3' end.

5'-(primer sequence 1)-N-RGG- _N6 -TTAGGG- _N6 -TTAGGG-N6 _- TTAGGG-(primer sequence 2)-3'

Next, the constructed nucleic acid aptamer library is used to screen for nucleic acid aptamers that specifically bind to target molecules in the presence of cations by the SELEX method. After screening, the nucleic acid aptamers are cloned by PCR or other methods, and the sequences can be identified by sequencing.

When designing a cell-penetrating nucleic acid aptamer capable of recognizing a specific type of intracellular cation, a nucleic acid aptamer library constructed by the same method as above is used to screen for a nucleic acid aptamer that forms a G-quadruplex structure in the presence of a specific type of cation. It is also confirmed that the screened nucleic acid aptamer does not form a G-quadruplex structure in the presence of other cations. As a method for confirming whether or not a G-quadruplex structure is formed, a method similar to the method exemplified in the method for confirming the above-mentioned "recognition ability for Mn ²⁺ " can be used. After screening, the nucleic acid aptamer is cloned by PCR or the like, and the sequence can be identified by sequencing.

<Anti-cancer drugs>
In the case where the target molecule of the nucleic acid aptamer of this embodiment is a molecule that is expressed in cancer cells due to the onset of cancer, or a molecule that is overexpressed when cancer is onset, it is useful as an anticancer drug. That is, in one embodiment, the present invention provides an anticancer drug that contains the above-mentioned nucleic acid aptamer as an active ingredient. Among them, the nucleic acid aptamer is preferably one that includes a polynucleotide consisting of the base sequence shown in any one of SEQ ID NOs: 5, 6, 10, 16, and 17, and more preferably one that consists only of the polynucleotide consisting of the base sequence shown in SEQ ID NOs: 5, 6, 10, 16, and 17.

By administering the above-mentioned nucleic acid aptamer to a living body, the activity of a target molecule that is specifically expressed in cancer cells can be controlled under the control of cationic stimulation. As a result, the cell proliferation of cancer cells that overexpress the target molecule can be suppressed. In other words, the above-mentioned nucleic acid aptamer can treat or prevent cancer.

The anticancer agent of this embodiment may be administered to a living body alone, or may be mixed with a pharma- ceutical acceptable carrier and administered as a pharmaceutical composition for the treatment or prevention of cancer.

The pharmaceutical composition may be in a dosage form for oral use or a dosage form for parenteral use, but a dosage form for parenteral use is preferred. Dosage forms for oral use include, for example, tablets, capsules, elixirs, microcapsules, etc. Dosage forms for parenteral use include, for example, injections, inhalants, suppositories, patches, etc.

As the pharma- ceutically acceptable carrier, those usually used in the preparation of pharmaceutical compositions can be used without any particular restrictions. More specifically, examples of such carriers include binders such as gelatin, corn starch, gum tragacanth, and gum arabic; excipients such as starch and crystalline cellulose; leavening agents such as alginic acid; and solvents for injections such as water, ethanol, and glycerin.

The pharmaceutical composition may contain additives. Examples of additives include lubricants such as calcium stearate and magnesium stearate; sweeteners such as sucrose, lactose, saccharin, and maltitol; flavorings such as peppermint and saffron oil; stabilizers such as benzyl alcohol and phenol; buffers such as phosphates and sodium acetate; solubilizers such as benzyl benzoate and benzyl alcohol; antioxidants; and preservatives.

The pharmaceutical composition can be formulated by appropriately combining the above-mentioned anticancer agent with the above-mentioned pharma- ceutical acceptable carriers and additives, and mixing them in a unit dose form required for generally accepted pharmaceutical practice.

The pharmaceutical composition may be used in combination with at least one selected from the group consisting of therapeutic agents having anticancer activity other than the above-mentioned anticancer agents and therapeutic agents for other diseases. The above-mentioned anticancer agents and the other agents may be in the same formulation or in separate formulations. Furthermore, each formulation may be administered by the same administration route or by separate administration routes. Furthermore, each formulation may be administered simultaneously, sequentially, or separately with a certain time or period between them. In one embodiment, the above-mentioned anticancer agents and the other agents may be in the form of a kit including them.

Subjects to which the pharmaceutical composition is administered include, but are not limited to, humans, monkeys, dogs, cows, horses, sheep, pigs, rabbits, mice, rats, guinea pigs, hamsters, and cells thereof. Among these, mammals or mammalian cells are preferred, and humans or human cells are particularly preferred.

Administration to patients or animals can be by methods known to those skilled in the art, such as intrathecal injection, intraperitoneal injection, intraarterial injection, intravenous injection, subcutaneous injection, as well as intranasal, transbronchial, intramuscular, transdermal, or oral administration.

The dosage of the pharmaceutical composition varies depending on the symptoms, body weight, age, sex, etc. of the patient or animal, and cannot be determined in general, but in the case of oral administration, for example, 0.1 mg/kg to 10 mg/kg of active ingredient (nucleic acid aptamer) may be administered per dosage unit. In the case of injection, for example, 0.01 mg/kg to 10 mg/kg of active ingredient (nucleic acid aptamer) may be administered per dosage unit.

In addition, the daily dosage of the pharmaceutical composition varies depending on the symptoms, body weight, age, sex, etc. of the patient or animal, and cannot be determined in general terms; however, for example, an active ingredient of 0.1 mg/kg to 10 mg/kg body weight per day for adults may be administered once or in divided doses of 2 to 4 times a day.

<Other embodiments>
Recently, it has been reported that C-terminal deletions of PPM1D (while maintaining enzyme activity) may cause neurodevelopmental disorders and lead to intellectual disability (ID) (Reference 3: "Jansen S et al., "De Novo Truncating Mutations in the Last and Penultimate Exons of PPM1D Cause an Intellectual Disability Syndrome," Am J Hum Genet., Vol. 100, Issue 4, p650-658, 2017."). Therefore, when PPM1D is used as a target molecule, the nucleic acid aptamer of this embodiment may be developed as a therapeutic agent for neurodevelopmental disorders.
That is, in one embodiment, the present invention provides a therapeutic agent for neurodevelopmental disorders, comprising as an active ingredient a nucleic acid aptamer comprising a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17 above.
The therapeutic agent for neurodevelopmental disorders may be a pharmaceutical composition for treating or preventing neurodevelopmental disorders. The form, composition, administration method, etc. of the pharmaceutical composition may be the same as those exemplified for the anticancer agent.

In addition, the nucleic acid aptamer of this embodiment may be tagged by a known method. In the labeled nucleic acid aptamer, if it is a molecule that is expressed in cancer cells due to the onset of cancer, or a molecule that is overexpressed when cancer is onset, it may be applied as a detection sensor for carcinogenesis risk, if PPM1D is the target molecule, it may be applied as a detection sensor for carcinogenesis or neurodevelopmental disorder onset risk, and if Scp1 is the target molecule, it may be applied as a detection sensor for carcinogenesis onset risk.
That is, in one embodiment, the present invention provides a sensor for detecting the risk of developing a carcinogenic or neurodevelopmental disorder, comprising a nucleic acid aptamer containing a polynucleotide having a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, or 17, and a labeled tag bound to the nucleic acid aptamer.
In addition, in one embodiment, the present invention provides a sensor for detecting the risk of developing carcinogenesis, comprising a nucleic acid aptamer containing a polynucleotide having the base sequence shown in SEQ ID NO: 6, and a labeled tag bound to the nucleic acid aptamer.
Examples of the labeling tag include fluorescent substances, biotin, etc. Examples of the fluorescent substance include Qdot (registered trademark) nanocrystal, Cy dyes (Cy3, Cy5, Cy5.5, Cy7, Cy7.5, Sulfo-Cy5, etc.), Alexa Fluor (registered trademark) 405, 488, 555, 568, 594, 647, 680, 750, 790, FAM, TAMRA, etc.

In one embodiment, the present invention provides a method for treating or preventing cancer, comprising administering an effective amount of the nucleic acid aptamer to a human or animal patient in need of treatment.
In one embodiment, the present invention provides the above-mentioned nucleic acid aptamer for the treatment or prevention of cancer.
In one embodiment, there is provided a use of the above-mentioned nucleic acid aptamer for the manufacture of a pharmaceutical composition for the treatment or prevention of cancer.

In one embodiment, the present invention provides a method for treating or preventing cancer, comprising administering an effective amount of a nucleic acid aptamer comprising a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 6, 10, 16, or 17 to a patient or animal in need of treatment.
In one embodiment, the present invention provides a nucleic acid aptamer comprising a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 6, 10, 16, and 17 above, for treating or preventing cancer.
In one embodiment, there is provided use of a nucleic acid aptamer comprising a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 6, 10, 16, and 17 for the manufacture of a pharmaceutical composition for treating or preventing cancer.

In one embodiment, the present invention provides a method for treating or preventing a neurodevelopmental disorder, comprising administering an effective amount of a nucleic acid aptamer comprising a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, or 17 to a patient or animal in need of treatment.
In one embodiment, the present invention provides a nucleic acid aptamer comprising a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17 above, for treating or preventing a neurodevelopmental disorder.
In one embodiment, there is provided use of a nucleic acid aptamer comprising a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17 for the manufacture of a pharmaceutical composition for treating or preventing a neurodevelopmental disorder.

In one embodiment, the present invention provides a method for detecting the risk of developing a carcinogenic or neurodevelopmental disorder, using a risk detection sensor for developing a carcinogenic or neurodevelopmental disorder, the risk detection sensor comprising a nucleic acid aptamer containing a polynucleotide having a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17, and a labeling tag bound to the nucleic acid aptamer. Examples of the labeling tag include those similar to those exemplified above.

In one embodiment, the present invention provides a method for detecting a risk of developing cancer, using a cancer risk detection sensor comprising a nucleic acid aptamer containing a polynucleotide having the base sequence shown in SEQ ID NO:6 and a labeling tag bound to the nucleic acid aptamer. Examples of the labeling tag include those similar to those exemplified above.

Furthermore, when the nucleic acid aptamer of this embodiment forms a G-quadruplex structure in the presence of a specific type of cation, it can be used as a nucleic acid aptamer for detecting the specific type of cation.

That is, in one embodiment, the present invention provides a labeled nucleic acid aptamer that forms a G-quadruplex structure in the presence of a specific type of cation and has cell membrane permeability, comprising:
a first region, a second region, a third region and a fourth region which form a G-quadruplex structure;
a connecting region A, a connecting region B, and a connecting region C between the first region, the second region, the third region, and the fourth region, respectively;
The first region comprises the base sequence shown in SEQ ID NO:1,
the second region, the third region, and the fourth region each have a base sequence as shown in SEQ ID NO:2,
at least one region selected from the group consisting of the linking region A, the linking region B, and the linking region C has a specific binding ability to the specific type of cation,
a labeling substance is bound to each of the 5'-end and the 3'-end of the nucleic acid aptamer,
A labeling substance at the 5' end and a labeling substance at the 3' end are a combination of labeling substances that can cause FRET, providing a specific type of nucleic acid aptamer for detecting cations.

In one embodiment, the present invention relates to a nucleic acid aptamer that forms a G-quadruplex structure in the presence of a specific type of cation and has cell membrane permeability;
Thioflavin T,
A specific type of cation detection kit comprising:
The nucleic acid aptamer is
a first region, a second region, a third region and a fourth region which form a G-quadruplex structure;
a connecting region A, a connecting region B, and a connecting region C between the first region, the second region, the third region, and the fourth region, respectively;
The first region comprises the base sequence shown in SEQ ID NO:1,
the second region, the third region, and the fourth region each have a base sequence as shown in SEQ ID NO:2,
The kit further comprises at least one region selected from the group consisting of linking region A, linking region B, and linking region C, which has a specific binding ability to the specific type of cation.

In one embodiment, the present invention relates to a labeled nucleic acid aptamer comprising a polynucleotide having the base sequence shown in SEQ ID NO: 7,
a labeling substance is bound to each of the 5'-end and the 3'-end of the nucleic acid aptamer,
The 5'-end label and the 3'-end label are a combination of labeling substances that can cause FRET, providing a nucleic acid aptamer for detecting manganese ions.

In one embodiment, the present invention relates to a nucleic acid aptamer comprising a polynucleotide having the base sequence shown in SEQ ID NO: 7,
Thioflavin T,
A manganese ion detection kit is provided, comprising:

In one embodiment, the present invention provides a method for detecting a specific type of cation using a labeled nucleic acid aptamer that forms a G-quadruplex structure in the presence of a specific type of cation and has cell membrane permeability, comprising:
contacting a sample solution with the labeled nucleic acid aptamer;
measuring the fluorescence in the sample solution after contact;
Including,
The nucleic acid aptamer is
a first region, a second region, a third region and a fourth region which form a G-quadruplex structure;
a connecting region A, a connecting region B, and a connecting region C between the first region, the second region, the third region, and the fourth region, respectively;
The first region comprises the base sequence shown in SEQ ID NO:1,
the second region, the third region, and the fourth region each have a base sequence as shown in SEQ ID NO:2,
at least one region selected from the group consisting of the linking region A, the linking region B, and the linking region C has a specific binding ability to the specific type of cation,
a labeling substance is bound to each of the 5'-end and the 3'-end of the nucleic acid aptamer,
The 5'-end label and the 3'-end label are a combination of labels capable of FRET, providing a detection method.

In one embodiment, the present invention provides a method for detecting a specific type of cation using a nucleic acid aptamer that forms a G-quadruplex structure in the presence of a specific type of cation and has cell membrane permeability, comprising:
Contacting a sample solution with the nucleic acid aptamer;
adding thioflavin T to the sample solution after contact and measuring the fluorescence;
Including,
The nucleic acid aptamer is
a first region, a second region, a third region and a fourth region which form a G-quadruplex structure;
a connecting region A, a connecting region B, and a connecting region C between the first region, the second region, the third region, and the fourth region, respectively;
The first region comprises the base sequence shown in SEQ ID NO:1,
the second region, the third region, and the fourth region each have a base sequence as shown in SEQ ID NO:2,
At least one region selected from the group consisting of linking region A, linking region B, and linking region C has a specific binding ability to the specific type of cation.

In one embodiment, the present invention provides a method for detecting manganese ions using a labeled nucleic acid aptamer comprising a polynucleotide having the base sequence shown in SEQ ID NO:7, comprising:
contacting a sample solution with the labeled nucleic acid aptamer;
measuring the fluorescence in the sample solution after contact;
Including,
a labeling substance is bound to each of the 5'-end and the 3'-end of the nucleic acid aptamer,
The 5'-end label and the 3'-end label are a combination of labeling substances that can cause FRET, providing a nucleic acid aptamer for detecting manganese ions.

In one embodiment, the present invention provides a method for detecting manganese ions using a nucleic acid aptamer comprising a polynucleotide having the base sequence shown in SEQ ID NO:7, comprising:
Contacting a sample solution with the nucleic acid aptamer;
adding thioflavin T to the sample solution after contact and measuring the fluorescence;
The present invention provides a method of detection comprising:

In one embodiment, the present invention provides a method for detecting a specific type of cation in a living body using a labeled nucleic acid aptamer that forms a G-quadruplex structure in the presence of a specific type of cation and has cell membrane permeability, comprising:
Introducing the labeled nucleic acid aptamer into a subject animal (preferably a non-human mammal);
Measuring fluorescence in the body of the test animal after the introduction;
Including,
The nucleic acid aptamer is
a first region, a second region, a third region and a fourth region which form a G-quadruplex structure;
a connecting region A, a connecting region B, and a connecting region C between the first region, the second region, the third region, and the fourth region, respectively;
The first region comprises the base sequence shown in SEQ ID NO:1,
the second region, the third region, and the fourth region each have a base sequence as shown in SEQ ID NO:2,
at least one region selected from the group consisting of the linking region A, the linking region B, and the linking region C has a specific binding ability to the specific type of cation,
a labeling substance is bound to each of the 5'-end and the 3'-end of the nucleic acid aptamer,
The 5'-end label and the 3'-end label are a combination of labels capable of FRET, providing a detection method.

In one embodiment, the present invention provides a method for detecting a specific type of cation in a living body, using a nucleic acid aptamer that forms a G-quadruplex structure in the presence of a specific type of cation and has cell membrane permeability, comprising:
Introducing the labeled nucleic acid aptamer and Thioflavin T into a subject animal (preferably a non-human mammal);
measuring the fluorescence of the Thioflavin T in the body of the subject animal after the introduction;
Including,
The nucleic acid aptamer is
a first region, a second region, a third region and a fourth region which form a G-quadruplex structure;
a connecting region A, a connecting region B, and a connecting region C between the first region, the second region, the third region, and the fourth region, respectively;
The first region comprises the base sequence shown in SEQ ID NO:1,
the second region, the third region, and the fourth region each have a base sequence as shown in SEQ ID NO:2,
At least one region selected from the group consisting of linking region A, linking region B, and linking region C has a specific binding ability to the specific type of cation.

In one embodiment, the present invention provides a method for detecting manganese ions in a living body using a labeled nucleic acid aptamer comprising a polynucleotide having the base sequence shown in SEQ ID NO:7, comprising:
Introducing the labeled nucleic acid aptamer into a subject animal (preferably a non-human mammal);
Measuring fluorescence in the body of the test animal after the introduction;
Including,
a labeling substance is bound to each of the 5'-end and the 3'-end of the nucleic acid aptamer,
The 5'-end label and the 3'-end label are a combination of labeling substances that can cause FRET, providing a nucleic acid aptamer for detecting manganese ions.

In one embodiment, the present invention provides a method for detecting manganese ions in a living body using a nucleic acid aptamer comprising a polynucleotide having the base sequence shown in SEQ ID NO:7, comprising:
Introducing the labeled nucleic acid aptamer and Thioflavin T into a subject animal (preferably a non-human mammal);
measuring the fluorescence of the Thioflavin T in the body of the subject animal after the introduction;
The present invention provides a method of detection comprising:

Combinations of labeling substances that can cause FRET include those exemplified above for "manganese ion (Mn ²⁺ )."

As a method for confirming whether or not a G-quadruplex structure is formed, the same methods as those exemplified in the method for confirming the above-mentioned "Mn ²⁺ recognition ability" can be used.

Fluorescence can be detected using a known detector depending on the type of labeling substance. For example, in the case of thioflavin T, the excitation wavelength is 385 nm to 450 nm, and the fluorescence wavelength is 445 nm to 492 nm. Therefore, the fluorescence can be detected by measuring the fluorescence intensity when irradiated with excitation light within the above wavelength ranges using a spectrophotometer or the like.

There are no particular limitations on the sample solution, and examples of the sample solution include tissue extracts derived from tissues removed from animals or cultured tissues, cell extracts derived from cultured cells, or body fluids. Examples of body fluids include, but are not limited to, blood, serum, plasma, urine (e.g., primary urine, pooled urine, etc.), buffy coat, saliva, bile, cerebrospinal fluid, tears, sputum, mucus, sweat, bladder washings, etc.

The subject animal is preferably a non-human mammal. Specific examples of non-human mammals include monkeys, dogs, cows, horses, sheep, pigs, rabbits, mice, rats, guinea pigs, and hamsters.

Methods for introducing the nucleic acid aptamer into the body of a subject animal (administration form) include methods known to those skilled in the art, such as intra-arterial injection, intravenous injection, subcutaneous injection, intranasal, intraperitoneal, transbronchial, intramuscular, transdermal, or oral administration, with intravenous injection or intraperitoneal administration being preferred.

In one embodiment, a composition for cell culture containing the nucleic acid aptamer is provided. By culturing cells that overexpress a target molecule in a medium (cell culture composition) containing the nucleic acid aptamer, the nucleic acid aptamer can be introduced into the cells and bound to the target molecule.

The cell culture composition may consist of only the nucleic acid aptamer, or may be a composition in which the nucleic acid aptamer is mixed with a known diluent. Examples of diluents include water, buffers, and various media.

The concentration of the above nucleic acid aptamer in the cell culture composition can be, for example, 10 nM or more and 100 μM or less, and is preferably 1 μM or more.

In one embodiment, the present invention provides a method for introducing a nucleic acid aptamer into a cell, comprising culturing a cell expressing a target molecule in a medium containing the nucleic acid aptamer.
The above-mentioned composition for cell culture can be used for culturing cells.

In one embodiment, the present invention provides a cell culture method comprising culturing cancer cells expressing a target molecule in a medium containing the nucleic acid aptamer.
The above-mentioned composition for cell culture can be used for culturing cells.

In one embodiment, the present invention provides a method for inhibiting binding between PPM1D and a substrate of PPM1D, comprising contacting a nucleic acid aptamer comprising a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, or 17 with a cancer cell expressing PPM1D.
A method for confirming inhibition of the binding of PPM1D to a PPM1D substrate (e.g., p53) by a nucleic acid aptamer is, for example, to compare cells contacted with a nucleic acid aptamer with cells not contacted with the nucleic acid aptamer, and if the contacted cells have reduced PPM1D enzymatic activity or a reduced proportion of substrate dephosphorylated by PPM1D, it can be determined that the nucleic acid aptamer inhibits the binding of PPM1D to a PPM1D substrate.

In one embodiment, the present invention provides a method for inhibiting cell proliferation, comprising contacting a nucleic acid aptamer comprising a polynucleotide having a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17 with a cancer cell expressing PPM1D.
One method for confirming the inhibition of cell proliferation by a nucleic acid aptamer is, for example, to compare cells that have been contacted with a nucleic acid aptamer with cells that have not been contacted with a nucleic acid aptamer, and if the contacted cells have a lower cell proliferation rate, it can be determined that the nucleic acid aptamer is inhibiting cell proliferation.

In one embodiment, the present invention provides a method for activating p53, comprising contacting a nucleic acid aptamer comprising a polynucleotide consisting of a base sequence shown in any one of SEQ ID NOs: 5, 10, 16, and 17 with a cancer cell expressing PPM1D.
One method for confirming the activation of p53 by a nucleic acid aptamer is, for example, to compare cells that have been contacted with a nucleic acid aptamer with cells that have not been contacted with the nucleic acid aptamer, and if the contacted cells show an increased level of p53 expression, it can be determined that the nucleic acid aptamer has activated p53.

In one embodiment, the present invention provides a method for inhibiting the binding of Scp1 to a substrate of Scp1, comprising contacting a nucleic acid aptamer comprising a polynucleotide consisting of the base sequence shown in SEQ ID NO: 6 with a cancer cell expressing Scp1.
A method for confirming inhibition of binding between Scp1 and its substrate (e.g., phosphorylated RNA polymerase II (RNA pol II), Twist, c-Myc, RE1-silencing transcription factor (REST), etc.) by a nucleic acid aptamer is, for example, to compare cells that have been contacted with a nucleic acid aptamer with cells that have not been contacted with a nucleic acid aptamer, and if the contacted cells have reduced Scp1 enzymatic activity or a reduced proportion of substrate dephosphorylated by Scp1, it can be determined that the nucleic acid aptamer inhibits binding between Scp1 and its substrate.

In one embodiment, the present invention provides a method for inhibiting cell proliferation, comprising contacting a nucleic acid aptamer comprising a polynucleotide consisting of the base sequence shown in SEQ ID NO:6 with a cancer cell expressing Scp1.
One method for confirming the inhibition of cell proliferation by a nucleic acid aptamer is, for example, to compare cells that have been contacted with a nucleic acid aptamer with cells that have not been contacted with a nucleic acid aptamer, and if the contacted cells have a lower cell proliferation rate, it can be determined that the nucleic acid aptamer is inhibiting cell proliferation.

The present invention will be described below with reference to examples, but the present invention is not limited to the following examples.

[Example 1]
1. Screening of PPM1D-binding DNA aptamers using the SELEX method We independently developed a library of DNA aptamers (hereinafter sometimes referred to as "ion-responsive DNA aptamers (IRDAptamers)") whose conformation changes in response to cation stimulation to form a G-quadruplex structure, and screened for DNA aptamers that specifically bind to the B-loop of PPM1D in the presence of cations using the SELEX method. The ion-responsive DNA aptamer consists of a base sequence shown in the following general formula (I). In general formula (I), N is any base, and is any of adenine, guanine, cytosine, and thymine. "Common seq." is an abbreviation for common sequence, and is the primer sequence used to amplify the DNA aptamer. In addition, in general formula (I), a G-quadruplex structure is formed by a sequence containing four pairs of guanines consisting of "AGG" and three "TTAGGG". The base sequence of the portion other than the "common sequence" is shown in SEQ ID NO:21.

5'-(common sequence)-NAGG- _N6 -TTAGGG- _N6 -TTAGGG- _N6 -TTAGGG-(common sequence)-3' (I)

In addition, the depletion method was performed using a PPM1D B-loop deletion mutant (hereinafter sometimes abbreviated as "PPM1DSubB") as a pretreatment for the first, fourth, eighth, and twelfth SELEX processes. In PPM1DSubB, the B-loop region from the N-terminus 245 to 268 (SEQ ID NO: 8) is replaced with peptide residues consisting of NGS, which is a sequence equivalent to PPM1A. Specifically, a solution containing a DNA aptamer was pumped onto a column on which a PPM1D B-loop deletion mutant was immobilized to remove DNA aptamers adsorbed to sites other than the B-loop of PPM1D, and the flow-through was pumped onto a column on which the wild-type PPM1D was immobilized to bind the DNA aptamer that specifically binds to the B-loop of PPM1D. Then, the DNA aptamer that specifically binds to the B-loop of PPM1D was eluted using an elution solution. The solution used to apply the DNA aptamer to the column was composed of 1x phosphate-buffered saline (PBS), 0.05% Tween, and 1μg/mL bovine serum albumin (BSA), and the elution solution was composed of 0.5M imidazole-HCl (pH 7.4).

The above process was repeated for 12 rounds, and the resulting DNA aptamer was cloned and sequenced to identify the sequence. From the identified DNA aptamers, M1D-Q5F, shown in Table 1 below, was selected as a DNA aptamer with excellent PPM1D binding ability based on an analysis of inhibitory activity against PPM1D. Next, M1D-Q5M and M1D-Q5 were designed in which part or all of the common sequence of M1D-Q5F had been deleted, and the following studies were carried out.

2. Analysis of the inhibitory activity of the identified DNA aptamers against PPM1D Figure 3 is a schematic diagram showing the base sequence of each DNA aptamer. "M1D-Q5F Scrambled" is a DNA aptamer in which the sequence of M1D-Q5F is randomized.
For the analysis of inhibitory activity against PPM1D, p53(15P) was used as a substrate. The amino acid sequence of p53(15P) is "Ac-VEPPLXQETFSDLW-NH ₂ " (SEQ ID NO: 11). "Ac" represents an acetyl group, and X represents a phosphorylated serine residue. p53(15P) (10 μM), PPM1D (4 nM), and each DNA aptamer (10 μM) were added to a buffer solution to prepare a mixed solution, which was then allowed to stand for 10 minutes. The composition of the buffer solution used to prepare the mixed solution was 50 mM Tris-HCl (pH 7.5), 0.02% β-mercaptoethanol, 0.1 mM EGTA (glycol ether diamine tetraacetic acid), 30 mM MgCl ₂ , and 100 mM NaCl. Thereafter, the enzyme activity of PPM1D was quantified by calculating the amount of dephosphorylated p53 (15P) using the free phosphate detection reagent Biomol Green (Enzo Life Sciences, Inc., model number: BML-AK111-1000), and the inhibitory effect of each DNA aptamer on PPM1D was confirmed. The results are shown in Figure 4. The 50% inhibitory concentration ( _IC50 ) calculated from the inhibition curve shown in Figure 4 is shown in Table 2 below.

Figure 4 and Table 2 reveal that M1D-Q5M, which lacks 30 bases, shows a stronger inhibitory effect than M1D-Q5F.

3. Circular dichroism (CD) spectrum of M1D-Q5F Using a circular dichroism spectrometer (JASCO Corporation, model number: JASCO CD J-720WI), CD spectra of M1D-Q5F, M1D-Q5M, and M1D-Q5 in the presence of potassium ions at various concentrations were obtained. The results are shown in Figure 5.

As shown in Figure 5, the three types of DNA aptamers responded to potassium ions and changed to a propeller-shaped G-quadruplex structure, making it clear that the parent structure, M1D-Q5, is responsible for ion responsiveness.

Next, from the graph shown in FIG. 5, a graph analyzing the change due to the difference in potassium ion concentration at the peak wavelength in the CD spectrum (M1D-Q5F: 267 nm, M1D-Q5M and M1D-Q5: 265 nm) is shown in FIG. 6. In FIG. 6, the molar ellipticity in the absence of potassium ions is set to 0%, and the point with the highest molar ellipticity at the peak wavelength is set to 100%, and the range of ion concentrations in which the structure of the aptamer changes is shown. In addition, the apparent dissociation constant (K _D ^obs ) calculated from the structural change of the potassium ion and the aptamer is shown in Table 3 below. The point where the structure changed by 50% from the fitting was taken as the apparent dissociation constant.

Figure 6 and Table 3 reveal that the three types of DNA aptamers show similar potassium ion responsiveness.

4. Inhibitory effect of each DNA aptamer on the proliferation of human breast cancer-derived MCF7 cells
M1D-Q5F or M1D-Q5M at 1, 3, or 10 μM was added to the culture medium of human breast cancer-derived MCF7 cells (2.5×10 ⁴ cells/well), which are known to overexpress PPM1D, and the cells were cultured for 2 days and then transfected into the MCF7 cells (hereinafter, the transfection method using no transfection agent may be referred to as the "auto-penetration method"). The cells were collected and the protein expression level of p53 was detected by Western blotting. Actin protein was also detected as a control. The results are shown in FIG. 7. In FIG. 7, "Ctl" refers to cells to which the DNA aptamer was not added. FIG. 8 is a graph that quantifies the extent to which the expression level of p53 has increased for each concentration of the aptamer by dividing the band intensity of p53 in FIG. 7 by the band intensity of Actin, compared to cells to which the aptamer was not administered.

Figures 7 and 8 show that both M1D-Q5F and M1D-Q5M increased p53 expression in a concentration-dependent manner. When comparing the aptamers, M1D-Q5M increased p53 expression more strongly. This suggests that M1D-Q5M exhibits stronger anticancer activity in correlation with its inhibitory effect on PPM1D.

Next, MCF7 cells (2×10 ³ cells/well) were cultured for 3 days after administration of M1D-Q5F and M1D-Q5M at concentrations of 0, 1, and 5 μM by auto-penetration, and the cell proliferation rate was confirmed by MTT assay. In addition, a group of cells not administered with the aptamer was used as a control group, and the number of cells in the aptamer-administered group relative to the number of cells in the control group was calculated as the cell proliferation rate. The results are shown in Figure 9.

Figure 9 shows that M1D-Q5M showed a stronger cell proliferation inhibitory effect than M1D-Q5F, indicating that M1D-Q5M exhibits high anticancer activity using the auto-penetration method.

5. Intracellular localization of each DNA aptamer
Cy3-labeled M1D-Q5M and 5'Primer (3 μM each) were added to MCF7 cells and cultured for 48 hours (auto-penetration method). After culture, the cells were stained with p53-recognizing antibody, Alexa488-labeled anti-mouse antibody, and DAPI (4',6-diamidino-2-phenylindole) for nuclear staining, and observed under a confocal microscope (Zeiss, LSM800, 63x). In addition, cross sections cut along the X and Y axes were analyzed using Zeiss ZEN 2.6 (Blue Edition) software. The results are shown in Figure 10. The base sequence of the 5'Primer is "5'-ATGACCATGACCCTCCACAC-3'" (SEQ ID NO: 12).

Figure 10 shows that Cy3-5'Primer was hardly introduced into the cells, while M1D-Q5M was strongly introduced into the nucleus. In addition, an increase in the expression of p53 in the nucleus was observed in cells administered M1D-Q5M.

Figure 11 shows the fluorescent stained images of MCF7 cells to which Cy3-labeled M1D-Q5M shown in Figure 10 was administered by the auto-penetration method, sliced along the X-axis and Y-axis, and analyzed. In Figure 11, the left side shows a stained image in which only the localization of the aptamer was analyzed, and the right side shows a superimposition of the localization of p53 and the aptamer.

Figure 11 shows that M1D-Q5M introduced into the nucleus colocalizes with p53 expressed in the nucleus. Slice images show that the aptamer is localized throughout the nucleus, and in areas with high DNA concentration.

6. Intracellular localization of each DNA aptamer 2
Cy3-labeled M1D-Q5F, M1D-Q5M, and 5' Primer (3 μM each) were added to MCF7 cells and cultured for 48 hours (auto-penetration method). After culture, cells were stained with mouse anti-p53 antibody, Alexa488-labeled anti-mouse antibody, and DAPI (4',6-diamidino-2-phenylindole) for nuclear staining, and observed under a confocal microscope (Zeiss, LSM800, 63x magnification). Sections cut along the X and Y axes were analyzed using Zeiss ZEN 2.6 (Blue Edition) software. The results are shown in Figure 12.

Figure 12 shows that the 5' Primer was hardly introduced into the cells, while M1D-Q5F and M1D-Q5M were localized in the nucleus of the cells. Comparing M1D-Q5F and M1D-Q5M, M1D-Q5M was more strongly localized in the nucleus, demonstrating a higher efficiency of introduction into the nucleus. Furthermore, an increase in p53 expression was observed in the nucleus upon administration of M1D-Q5F and M1D-Q5M, suggesting that M1D-Q5F and M1D-Q5M function as PPM1D inhibitors in the nucleus.

[Example 2]
1. Nuclease resistance of M1D-Q5M 10μg/mL of DNase I was added to M1D-Q5M or M1D-Q5M Scrambled (1μM each) in the presence or absence of cations (140mM sodium chloride or potassium chloride), and samples were collected 0, 10, 20, 30, and 60 minutes after addition, and nuclease resistance was confirmed using polyacrylamide gel electrophoresis. Note that "M1D-Q5M Scrambled" is a DNA aptamer in which the sequence of M1D-Q5M is randomized, and is a DNA aptamer consisting of the sequence shown below.

5'-(GTGCGTGTGGATGAGAAGTGTGAGTCAGGTGATGTGTGTGTCAGACTGTG)-3' (SEQ ID NO: 13)

The results are shown in Figure 13. Figure 14 shows a graph quantifying the band signals shown in Figure 13. In Figure 14, the band signals at 0 minutes under each condition are expressed as relative values, with the signal being taken as 100%.

13 and 14, it was revealed that M1D-Q5M in the presence of potassium ions or sodium ions has nuclease resistance. Furthermore, M1D-Q5M in the presence of potassium ions tended to have better nuclease resistance than M1D-Q5M in the presence of sodium ions.
This suggests that the formation of a G-quadruplex structure increases the nuclease resistance of M1D-Q5M.

2. Serum stability of M1D-Q5M
M1D-Q5M (3 μM) or M1D-Q5M Scrambled (3 μM) was added to Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS), 110 mM sodium chloride, and 5 mM potassium chloride, and incubated for 0, 1, 2, 6, and 12 hours. Samples were collected after each time period, and the stability of M1D-Q5M in the presence of serum was confirmed using polyacrylamide gel electrophoresis. The results are shown in FIG. 15. FIG. 16 shows a graph in which the band signals shown in FIG. 15 were quantified. In FIG. 16, the band signals at 0 hours (at the start of incubation) under each condition are expressed as relative values, with the band signals at 100%.

15 and 16 confirm that M1D-Q5M has higher serum stability than M1D-Q5M Scrambled.
These findings suggest that the formation of a G-quadruplex structure confers high stability to M1D-Q5M in vivo.

[Reference Example 1]
(Intracellular localization of M1D-Q5M using the lipofection method)
MCF7 cells (2×10 ⁵ cells/well) were treated with Cy3-labeled M1D-Q5M (50 nM) and unlabeled M1D-Q5F (2.95 μM), or Cy3-labeled 5′Primer (hereinafter sometimes abbreviated as “Cy3-Pri”; the same as that used in “5.” of Example 1 above) (50 nM) and unlabeled M1D-Q5F (2.95 μM) using a lipofection reagent, and cultured for 48 hours (lipofection method). After culture, fluorescent staining was performed using DAPI (4′,6-diamidino-2-phenylindole) for nuclear staining, mouse anti-p53 antibody, and Alexa488-labeled anti-mouse antibody, and the cells were observed with a spinning disk confocal laser microscope (Olympus, model number: BX50) at a magnification of 40 times (overall image). The results are shown in FIG. 17. In FIG. 17, the bottom fluorescent image is an enlarged image (180x) of the area enclosed by a square in the fluorescent image in the middle row (50 nM Cy3-Q5M+2.95 μM Q5M).

As shown in Figure 17, M1D-Q5M was present in dots around the cell nucleus, with little introduction into the nucleus. This confirmed that the intracellular localization was clearly different from that observed with the auto-penetration method, which does not use an introduction agent.

[Example 3]
(Cell membrane permeability of M1D-Q5)
TAMRA-labeled M1D-Q5 (3 μM) was added to MCF7 cells and cultured for 48 hours (auto-penetration method). After culture, the cells were stained with DAPI (4',6-diamidino-2-phenylindole) for nuclear staining, and observed with two types of confocal laser microscopes as shown below.

Spectroscopic confocal laser scanning microscope (Olympus, model number: FV1700), magnification: (overall image) 100x Spinning disk confocal laser microscope (Olympus, model number: SpinSR10), magnification: (overall image) 100x

The results are shown in Figure 18. In Figure 18, the top row is an image observed with the FV1200. The bottom row is an image observed with the SpinSR10. "DIC" in the top row stands for Differential interference contrast, and indicates a differential interference observation image. The rightmost fluorescent image (Z-Stack) is a cross section cut on the X-axis (horizontal axis) and Y-axis (vertical axis) centered on the localization point of M1D-Q5 inside the DAPI stained image in the second fluorescent image from the right (Merge), analyzed with Olympus FV31S-SW software. The results are shown on the bottom (X-axis) and right (Y-axis), respectively.

Figure 18 confirms that M1D-Q5, which does not have a 3'-terminal additional sequence, can also penetrate the cell membrane by forming a G-quadruplex structure, similar to M1D-Q5M, using the auto-penetration method without the use of an introducing agent.

[Example 4]
1. Time course of cell membrane permeability of M1D-Q5M
Cy3-labeled M1D-Q5M or TAMRA-labeled M1D-Q5M (3 μM each) was added to MCF7 cells and cultured for 10 minutes, 30 minutes, 2 hours, or 24 hours (auto-penetration method). After culture, fluorescent staining was performed using DAPI (4',6-diamidino-2-phenylindole) for nuclear staining, and the cells were observed under a spectroscopic confocal laser scanning microscope (Olympus, model number: FV1200) at a magnification of 20 times (overall image). The results are shown in Figure 19 (Cy3-labeled M1D-Q5M) and Figure 20 (TAMRA-labeled M1D-Q5M). In Figures 19 and 20, "No treatment" refers to cells that have not been transfected with Cy3-labeled M1D-Q5M or TAMRA-labeled M1D-Q5M.

Figures 19 and 20 show that M1D-Q5M begins to enter (permeate) the cells 30 minutes after administration, and is present in the nucleus 24 hours later.

2. Localization of M1D-Q5M after cell membrane permeation
Cy3-labeled M1D-Q5M (3 μM) was added to MCF7 cells and cultured for 48 hours (auto-penetration method). After culture, fluorescent staining was performed using DAPI (4',6-diamidino-2-phenylindole) for nuclear staining, and the cells were observed with a spectroscopic confocal laser scanning microscope (Zeiss, model number: LSM800) at a magnification of 63 times (overall image). The results are shown in Figure 21. In Figure 21, the bottom fluorescent image is the cross section cut on the X axis (horizontal axis) and Y axis (vertical axis) at the center of the localization point of M1D-Q5M inside the DAPI stained image in the rightmost fluorescent image (M1D-Q5M), and analyzed with Zeiss ZEN 2.6 (Blue Edition) software. The results are shown on the upper side (X axis) and the right side (Y axis), respectively.

Figure 21 and previously known intracellular localization of PPM1D revealed that the localization of M1D-Q5M coincides with that of PPM1D, and that both are localized in the nucleus.

[Example 5]
1. Screening of PPM1D-binding DNA aptamers using the SELEX method Using the same method as in "1." of Example 1 (the depletion method was also performed using PPM1DSubB as a pretreatment for the first, fourth, and eighth SELEX processes), DNA aptamers that bind to PPM1D were screened in the presence of potassium ions in a solution of 10 mM HEPES-KOH, 140 mM KCl, 0.05% Tween, and 1 μg/mL BSA (pH 7.5). Note that a library with a different common sequence was used compared to the library used in "1." of Example 1. The 5'-end primer sequence is shown in SEQ ID NO: 14, and the 3'-end primer sequence is shown in SEQ ID NO: 15.

As a result, the two types of DNA aptamers obtained were cloned and sequenced to identify their sequences. The sequences are shown in Table 4 below. These identified DNA aptamers were selected as candidates for potassium ion-responsive PPM1D-binding DNA aptamers.

2. Intracellular localization of each DNA aptamer
TAMRA-labeled G4CAA1 or TAMRA-labeled G4CAA2 (3 μM each) was added to MCF7 cells and cultured for 48 hours (auto-penetration method). After culture, fluorescent staining was performed using DAPI (4',6-diamidino-2-phenylindole) for nuclear staining. For cells administered with TAMRA-labeled G4CAA2, fluorescent staining was also performed using mouse anti-nucleolin antibody and Alexa488-labeled anti-mouse antibody. For cells administered with G4CAA1, the cells after fluorescent staining were observed with a spinning disk confocal laser microscope (Olympus, model number: SpinSR10) at a magnification of 100x (overall image). For cells administered with G4CAA2, the cells were observed with a spectroscopic confocal laser scanning microscope (Olympus, model number: FV1700) at a magnification of 100x (overall image). The results are shown in Figure 22 (TAMRA-labeled G4CAA1) and Figure 23 (TAMRA-labeled G4CAA2). In Figure 23, "Nucleolin (Enhanced)" increases both the brightness and contrast of the image.

22 and 23, it was confirmed that both G4CAA1 and G4CAA2, like M1D-Q5M, form G-quadruplex structures and thereby penetrate the cell membrane by the auto-penetration method without using any introducing agent.
23, it was revealed that G4CAA2 was colocalized with Nucleolin in the nucleus and on the cell membrane. This suggests that cell membrane-permeable nucleic acid aptamers such as G4CAA2 may be taken up into cells and nuclei by the shuttle mechanism of Nucleolin between the cell surface, cytoplasm, and nucleus.

[Example 6]
1. Screening of Scp1-binding DNA aptamers using the SELEX method A library of ion-stimulus-responsive DNA aptamers developed independently was screened for DNA aptamers that specifically bind to Scp1 in the presence of cations using the SELEX method. The ion-stimulus-responsive DNA aptamer consists of a base sequence shown in the following general formula (I). In general formula (I), N is any base, and is any of adenine, guanine, cytosine, and thymine. "Common seq." is an abbreviation for common sequence, and is a primer sequence used for amplifying the DNA aptamer. In addition, a guanine quadruplex structure is formed by a sequence containing four pairs of guanines consisting of "AGG" and three "TTAGGG" in general formula (I). The base sequence of the portion other than "common seq." is shown in SEQ ID NO: 21.

5'-(common sequence)-NAGG- _N6 -TTAGGG- _N6 -TTAGGG- _N6 -TTAGGG-(common sequence)-3' (I)

Specifically, a solution containing a DNA aptamer was pumped onto the column on which Scp1 was immobilized, and the DNA aptamer that specifically binds to Scp1 was bound. The DNA aptamer that specifically binds to Scp1 was then eluted using an elution solution. The composition of the solution used to apply the DNA aptamer to the column was maleate buffer (pH 5.5, 10 mM maleate-KOH, 140 mM KCl, 0.05% Tween, and 1 μg/mL BSA). The composition of the elution solution was 0.5 M imidazole-HCl (pH 7.4).

The above process was repeated eight rounds, and the resulting DNA aptamers were cloned and sequenced to identify the sequences. Among the identified DNA aptamers, Sp1-G4-6, shown below, was selected as a DNA aptamer with superior Scp1 binding ability based on an analysis of its inhibitory activity against Scp1.

Sp1-G4-6: 5'-T-AGG-GGGGTA-TTAGGG-AGGGTC-TTAGGG-GTGGGC-TTAGGG-3' (SEQ ID NO: 6)

2. Scp1 specificity of Sp1-G4-6
To confirm that Sp1-G4-6 specifically binds to Scp1, we performed a binding test between human Scp1, human Scp3, PPM1A, PPM1D, Fcp1 (hereinafter sometimes referred to as "Fcp1full-M/H"), or a partially deleted form of Fcp1 (hereinafter sometimes referred to as "Fcp1Δins.") and Sp1-G4-6. 25 ng of human Scp1, human Scp3, PPM1A, PPM1D, Fcp1full-M/H, or Fcp1Δins was coated on a substrate. Then, a maleate buffer (pH 5.5, 10 mM maleate-KOH, and 140 mM KCl) solution containing 10 nM of Sp1-G4-6 and M1D-Q5F with biotin added to the 5' end was dropped on the substrate, and the substrate was washed after standing for 120 minutes. Streptavidin-conjugated horseradish peroxidase (HRP) was then added and allowed to stand for 60 minutes, after which the substrate was washed. 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) substrate was then added. This substrate is oxidized by HRP to produce a blue-green color. The absorbance (OD405) of the solution after the addition of the substrate was measured at 405 nm using a plate reader. The results are shown in Figure 24.

Figure 24 confirms that Sp1-G4-6 specifically binds to Scp1.

3. Binding test of Sp1-G4-6 to Scp1
To confirm that the binding ability of Sp1-G4-6 to Scp1 is sequence-specific, ELISA analysis was performed using Sp1-G4-6 and the DNA aptamers shown in Table 5 below.

Specifically, the procedure was as follows: 25 ng of human Scp1 was coated on the substrate. Then, 10 nM of Sp1-G4-6 with biotin added to the 5' end and 0, 0.1, 1, 5, 10, 50, and 100 nM of non-biotinylated aptamers (Sp1-G4-6, Sp1-G4-6A, Sp1-G4-7, M1D-Q4) were dropped onto the substrate in maleate buffer (pH 5.5, 10 mM maleate-KOH, 140 mM KCl, and 0.05% Tween) and left for 120 minutes, after which the substrate was washed. Next, streptavidin-bound horseradish peroxidase (HRP) was added, left for 60 minutes, and then the substrate was washed. Next, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) substrate was added. This substrate is oxidized by HRP to produce a blue-green color. After the addition of the substrate, the absorbance at 405 nm (OD405) of the solution was measured using a plate reader. The measurement results are shown in FIG.

Figure 25 confirms that the binding of Sp1-G4-6 to Scp1 is sequence-specific.

4. Identification of the binding site of Sp1-G4-6 for Scp1
To identify the binding site of Sp1-G4-6 to Scp1, we performed a binding test between full-length human Scp1 (hereinafter sometimes referred to as "hScp1 full") and a deletion of 76 amino acid residues in the N-terminal region of human Scp1 (hereinafter sometimes referred to as "hScp1 ΔN") and Sp1-G4-6. 25 ng of hScp1 full and hScp1 ΔN were coated on a substrate, and a maleate buffer (pH 5.5, 10 mM maleate-KOH, and 140 mM KCl) solution containing 10 nM Sp1-G4-6 with biotin added to the 5' end was dropped, and the substrate was washed after leaving it for 120 minutes. Next, streptavidin-bound horseradish peroxidase (HRP) was added, and the substrate was washed after leaving it for 60 minutes. Next, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) substrate was added. This substrate is oxidized by HRP to produce a blue-green color. After addition of the substrate, the absorbance at 405 nm (OD405) of the solution was measured using a plate reader. The results are shown in FIG.

Figure 26 reveals that Sp1-G4-6 binds to and recognizes 76 amino acid residues in the N-terminal region of Scp1.

5. CD spectrum of Sp1-G4-6 The CD spectrum of Sp1-G4-6 in the presence of potassium ions at various concentrations was obtained using a circular dichroism spectrometer (JASCO Corporation, model number: JASCO CD J-720WI). The results are shown in FIG.

Figure 27 reveals that Sp1-G4-6 changes to a propeller-type G-quadruplex structure in response to potassium ions.

Next, Figure 28 shows a graph analyzing the change due to different potassium ion concentrations at the peak wavelengths in the CD spectrum (M1D-Q5F: 267 nm, G4CAA1 and G4CAA2: 267 nm, Sp1-G4-6: 265.5 nm) from the graph shown in Figure 27. Figure 28 shows the range of ion concentrations over which the structure of the aptamer changes when the molar ellipticity in the absence of potassium ions is set to 0% and the point with the highest molar ellipticity at the peak wavelength is set to 100%.

Figure 28 reveals that the induction of G-quadruplex structure in Sp1-G4-6 is induced at a lower potassium ion concentration than in M1D-Q5F, but at a higher potassium ion concentration than in G4CAA1 and G4CAA2.

6. Nuclease resistance of Sp1-G4-6
10 μg/mL DNase I was added to Sp1-G4-6 (3 μM: fluorescently labeled 0.5 μM and unlabeled 2.5 μM) in the presence or absence of 75 mM potassium chloride, and samples were collected 0, 10, 20, 30, and 60 minutes after addition, and nuclease resistance was confirmed using polyacrylamide gel electrophoresis.

A graph quantifying the band signals from polyacrylamide gel electrophoresis is shown in Figure 29. In Figure 29, the band signals at 0 minutes under each condition are expressed as relative values, with the signal being 100%.

FIG. 29 reveals that Sp1-G4-6 in the presence of potassium ions has nuclease resistance.
This suggests that the formation of a G-quadruplex structure increases the nuclease resistance of Sp1-G4-6.

7. Serum stability of Sp1-G4-6
Sp1-G4-6 (3 μM: fluorescently labeled 0.5 μM and fluorescently unlabeled 2.5 μM) was added to Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS), 110 mM sodium chloride, and 5 mM potassium chloride, and incubated for 0, 1, 2, 3, and 5 days. Samples were collected after each time period, and the stability of Sp1-G4-6 in the presence of serum was confirmed using polyacrylamide gel electrophoresis. A graph of the quantification of the band signals in polyacrylamide gel electrophoresis is shown in FIG. 30. In FIG. 30, the band signals at 0 hours (at the start of incubation) under each condition are expressed as relative values relative to 100%.

FIG. 30 confirms that Sp1-G4-6 has serum stability in the presence of potassium ions.
These findings suggest that the formation of a G-quadruplex structure confers high stability to Sp1-G4-6 in vivo.

8. Cell membrane permeability of Sp1-G4-6
TAMRA-labeled Sp1-G4-6 (3 μM) was added to MCF7 cells and cultured for 48 hours (auto-penetration method). After culture, fluorescent staining was performed using DAPI (4',6-diamidino-2-phenylindole) for nuclear staining, and the cells were observed with a spectroscopic confocal laser scanning microscope (Olympus, model number: FV1200) at a magnification of 40 times (overall image). The results are shown in Figure 31. In Figure 31, the upper, middle, and lower rows are all images observed with FV1200, and are images observed in different fields of view of the same sample. "DIC" is an abbreviation for Differential interference contrast, and indicates a differential interference observation image. The rightmost fluorescent image (Z-Stack) was analyzed using Olympus FV31S-SW software on a cross section cut along the X-axis (horizontal axis) and Y-axis (vertical axis) at the center of the Sp1-G4-6 localization point within the DAPI stained image in the second fluorescent image from the right (Merge). The results are shown on the lower (X-axis) and right (Y-axis), respectively.

As shown in Figure 31, Sp1-G4-6 was confirmed to penetrate the cell membrane by forming a G-quadruplex structure using the auto-penetration method without the use of an introducing agent. In addition, it was revealed that Sp1-G4-6 introduced into cells was localized in the nucleus and in the cytoplasm around the nuclear membrane in dots, and also localized in the cell membrane.
It has been reported that Scp1 is localized in the nucleus and cytoplasm (especially the Golgi apparatus) in a dot-like manner, and that palmitoylation leads to localization in the cytoplasm. Therefore, it was confirmed that Sp1-G4-6 shows a similar localization to Scp1.

[Example 7]
1. Screening of manganese ion-binding DNA aptamers using the SELEX method A library of ion-stimulus-responsive DNA aptamers developed independently was screened for DNA aptamers that form a guanine quadruplex structure in the presence of manganese ions and specifically bind to manganese ions using the SELEX method. The ion-stimulus-responsive DNA aptamer is composed of a base sequence shown in the following general formula (II). In general formula (II), N is any base, and is any of adenine, guanine, cytosine, and thymine. "Common seq." is an abbreviation for common sequence, and is a primer sequence used for amplifying the DNA aptamer. In addition, in general formula (I), a guanine quadruplex structure is formed by a sequence containing four pairs of guanines consisting of "AGGG" and three "TTAGGG". In addition, the base sequence of the part other than "common seq." is shown in SEQ ID NO: 22.

5'-(common sequence)-AGGG- _N6 -TTAGGG- _N6 -TTAGGG- _N6 -TTAGGG-(common sequence)-3' (II)

The above IRD Adaptamer library was incubated at 5 μM and Mn ²⁺ 10 mM for 10 minutes, and the precipitates of Mn ²⁺ and IRD Adaptamer were collected by centrifugation. After washing twice with 10 mM Mn ²⁺ solution to remove non-specifically bound molecules, 50 μL of H ₂ O was added to the precipitate and dissolved at 95°C for 10 minutes.

The above process was repeated eight rounds, and the resulting DNA aptamers were cloned and sequenced to identify the sequences. Among the identified DNA aptamers, MnG4C1, shown below, was selected as a manganese ion-responsive DNA aptamer.

MnG4C1: 5'-A-GGG-GGGGAG-TTAGGG-CGCACG-TTAGGG-GTGCTA-TTAGGG-3' (SEQ ID NO: 7)

2. CD spectrum of MnG4C1 Using a circular dichroism spectrometer (JASCO Corporation, model number: JASCO CD J-720WI), CD spectra of MnG4C1 in the presence of manganese ions at various concentrations (0 (H ₂ O), 0.05, 0.1, 0.5, 1, and 10 mM) were obtained. The results are shown in FIG.

Figure 32 reveals that MnG4C1 responds to manganese ions and undergoes a concentration-dependent structural change. Figure 32 also reveals that MnG4C1 responds to manganese ions and changes to a propeller-type G-quadruplex-like structure.

3. Detection of manganese ion concentration using MnG4C1
MnG4C1 was labeled by binding FAM to the 5' end and TAMRA to the 3' end. FAM and TAMRA are a combination of labeling substances that can cause FRET. When MnG4C1 forms a G-quadruplex structure, the distance between the labeling substances approaches, causing FRET and emitting fluorescence. MnG4C1 (0.2 μM) labeled with FAM and TAMRA was added to a solution containing manganese ions at various concentrations (0, 0.1, 0.25, 0.5, 0.75, 1, 2, 3, 5, 10, 20 μM). The fluorescence spectrum was measured using a spectrophotometer. The results are shown in Figure 33.

Figure 33 confirms that manganese ion concentration can be observed by labeling the 5' and 3' ends of MnG4C1 with a labeling substance capable of causing FRET.

4. Detection of G-quadruplex structure of MnG4C1 using Thioflavin T
Manganese ions (0, 0.1, 1, 10, 100 μM) were added to a 50 mM Tris-HCl (pH 7.5) solution containing 1 μM MnG4C1 and 3 μM thioflavin T. The fluorescence spectrum was measured using a spectrophotometer. The results are shown in FIG.

Figure 34 confirms that the structural changes of MnG4C1 can be observed using thioflavin T, a fluorescent molecule that has the ability to bind to G-quadruplex structures.

5. Cell membrane permeability of MnG4C1
MnG4C1 (3 μM) labeled with FAM and TAMRA was added to MCF7 cells and cultured for 48 hours (auto-penetration method). After culture, fluorescent staining was performed using DAPI (4',6-diamidino-2-phenylindole) for nuclear staining. The fluorescently stained cells were observed with a spinning disk confocal laser microscope (Olympus, model number: SpinSR10) at a magnification of 100 times (overall image). The results are shown in Figure 35.

Figure 35 confirms that MnG4C1, like M1D-Q5M, G4CAA1 and G4CAA2, is able to penetrate cell membranes by forming a G-quadruplex structure using the auto-penetration method without the use of any introducing agent.

From the above, it has become clear that a DNA aptamer having a structure consisting of the base sequence shown in sequence number 4 below can exhibit cell membrane permeability in the presence of cations.

5'-N-RGG-NNNNNN-TTAGGG-NNNNNN-TTAGGG-NNNNNN-TTAGGG-3' (SEQ ID NO: 4)

According to the nucleic acid aptamer of this embodiment, it is possible to provide a nucleic acid aptamer whose binding ability to any target molecule within a cell and cell membrane permeability can be controlled in time and space.

1a: First region 1b: Second region 1c: Third region 1d: Fourth region 2a: Connecting region A
2b: Linking region B
2c: Linking region C
3: 3'-terminal additional sequence 4: Cation (M ⁺ )
10, 20: Nucleic acid aptamer

Claims (8)

A nucleic acid aptamer that forms a G-quadruplex structure in the presence of cations and has a cell membrane permeability, the nucleic acid aptamer having a first region, a second region, a third region, and a fourth region that form a G-quadruplex structure, and a linking region A, a linking region B, and a linking region C between the first region, the second region, the third region, and the fourth region, respectively, wherein the first region has a base sequence shown in SEQ ID NO: 1, and the second region, the third region, and the fourth region each have a base sequence shown in SEQ ID NO: 2, and at least one region selected from the group consisting of the linking region A, the linking region B, and the linking region C has a specific binding ability to a target molecule in the presence of cations, and comprises a polynucleotide having a base sequence shown in any of SEQ ID NOs: 5 to 7. The nucleic acid aptamer of claim 1 , wherein the cation is a specific type of cation. Further comprising a 3'-terminal additional sequence downstream of the fourth region,
The nucleic acid aptamer according to claim 1 or 2, wherein the 3'-terminal additional sequence consists of the base sequence shown in SEQ ID NO:3. The nucleic acid aptamer according to any one of claims 1 to 3, comprising a polynucleotide consisting of the base sequence shown in SEQ ID NO:4. A pharmaceutical comprising the nucleic acid aptamer according to any one of claims 1 to 4. A therapeutic agent comprising the nucleic acid aptamer according to any one of claims 1 to 4. A nucleic acid aptamer drug comprising the nucleic acid aptamer according to any one of claims 1 to 4. A method for designing a stimuli-responsive aptamer that forms a G-quadruplex structure in the presence of a cation and has cell membrane permeability, comprising the steps of:
a first region, a second region, a third region and a fourth region which form a G-quadruplex structure;
a connecting region A, a connecting region B, and a connecting region C between the first region, the second region, the third region, and the fourth region, respectively;
The first region consists of the base sequence shown in SEQ ID NO:1,
the second region, the third region, and the fourth region each have a base sequence as shown in SEQ ID NO:2,
A method for designing a stimuli-responsive aptamer, wherein at least one region selected from the group consisting of linking region A, linking region B and linking region C is selected from those that have specific binding ability to a target molecule in the presence of cations.

Images