JP7469761B2 - Method for detecting oligonucleotides with reduced cross-reactivity - Google Patents

Description

The present invention relates to a method for detecting or quantifying oligonucleotides with high sensitivity, specificity, and quantitative performance.

Nucleic acid drugs induce sequence-specific gene silencing and have attracted much attention in recent years as novel therapeutic agents for a variety of diseases that have been difficult to treat until now, including genetic diseases and intractable diseases (Non-Patent Document 1, Ando 2012).

Drug concentrations are measured in animal or human biological samples administered with a drug in pharmacokinetic and pharmacodynamic (PK/PD) screening studies during the exploratory stage of drug development, in safety studies, pharmacology studies, and pharmacokinetic studies during the non-clinical stage, and during the clinical stage. In addition, when a new drug is approved, data on drug concentrations in biological samples must be obtained and documents on safety and pharmacokinetics must be submitted in accordance with guidelines set out in a Ministry of Health, Labor, and Welfare ordinance.

Ando et al. have reported that nucleic acid drugs can be labeled with positron-emitting nuclides to perform noninvasive, real-time, three-dimensional analysis of their behavior in vivo (Non-Patent Document 1, Ando 2012). In addition, Healey et al. have reported that they achieved a lower limit of quantification of 0.01 pg/μL using stem-loop RT-PCR (Non-Patent Document 3, Chen 2005) (Non-Patent Document 2, Healey 2014).

However, in recent years, the development of artificial nucleic acids and delivery materials has made it possible to administer treatment at low doses. As a result, drug concentrations in biological samples have become lower than before, and more sensitive measurement systems are now required to detect these low concentrations of drugs. Furthermore, in order to comply with the guidelines set out by the Ministry of Health, Labor and Welfare ordinance, the measurement system must have high quantitativeness that is independent of the operator, so measurement using the PCR method, which is a semi-quantitative method, was not suitable for detecting these low concentrations of drugs.

In addition, conventional measurement systems have the problem that when oligonucleotides used in nucleic acid drugs are metabolized and degraded from the 5' or 3' end, they cannot be distinguished from intact oligonucleotides (hereinafter simply referred to as "intact") that are the subject of measurement and have not been degraded from the 5' or 3' end by metabolism, making it impossible to measure accurate drug concentrations.

In order to distinguish between intact oligonucleotides to be measured and their metabolites and to specifically measure nucleic acid drugs having biological activity, Yu et al. developed a hybridization-ligation ELISA method (Yu 2002, Non-Patent Document 4). In this method, a "template" oligonucleotide containing a sequence complementary to the oligonucleotide to be measured and a "ligation probe" are used. The "template" oligonucleotide has an additional 9-mer nucleotide adjacent to the 5'-terminal nucleotide of the complementary sequence and has biotin at the 3'-terminal. The "ligation probe" is a 9-mer oligonucleotide having a sequence complementary to the additional 9-mer nucleotide, has phosphate at the 5'-terminal and digoxigenin at the 3'-terminal. Therefore, when the oligonucleotide to be measured is intact, the intact oligonucleotide and the ligation probe hybridize without any gaps on the template oligonucleotide. The product of this hybridization is treated with ligase to link the intact oligonucleotide and the ligation probe. On the other hand, if the oligonucleotide to be measured is metabolized and lacks a nucleotide at the 3' end, this ligation does not occur. The ligation product is bound to a solid phase using biotin, unreacted ligation probes are removed by washing, and digoxigenin at the 3' end of the immobilized ligation product is detected by ELISA (see Non-Patent Document 4, Figure 1 in Yu 2002).
Wei et al. have disclosed that in order to improve the specificity of the hybridization-ligation ELISA method, S1 nuclease treatment is carried out after ligase treatment (Wei 2006).
However, the hybridization ligation ELISA method requires the design of an optimal ligation probe sequence taking into consideration the sequence of the oligonucleotide to be measured, making it complicated and unsuitable for multiplexing.

In order to solve the above problems of the hybridization-ligation ELISA method, Omori et al. developed a method in which products derived from metabolites of a target oligonucleotide are degraded and removed using S1 nuclease or the like, and the products derived from the remaining intact target oligonucleotide are measured (Patent Document 1). In this method, the target oligonucleotide to be measured is hybridized with a complementary nucleic acid probe (3'-complementary sequence of the target sequence-5'), or an arbitrary base such as polyA (first polynucleotide) is added to the target oligonucleotide to be measured, and the target oligonucleotide is hybridized with a complementary nucleic acid probe (3'-complementary sequence of the target oligonucleotide+complementary sequence of the first polynucleotide-5'), and incomplete hybridization products are degraded and removed using a single-strand specific nuclease such as S1 nuclease, and the nucleic acid probe contained in the remaining complete hybridization product is measured.

The method of Omori et al. is a method for measuring oligonucleotides that is more sensitive, specific and quantitative than conventional methods such as hybridization-ligation ELISA. However, it is disadvantageous in that it is cumbersome because it requires the use of single-strand-specific nucleases such as S1 nuclease and requires additional incubation time.
Furthermore, the Ministry of Health, Labor and Welfare's "Guidance on the Implementation of Nonclinical Safety Studies for Drug Clinical Trials and Marketing Approval Applications" requires toxicity testing if the cross-reactivity of metabolites exceeds 10%. As mentioned above, being able to measure the cross-reactivity of metabolites at 10% or less is an important criterion in drug development, but in conventional hybridization-based methods such as hybridization ligation ELISA, the cross-reactivity of metabolites remains high, making it difficult to stably suppress and detect the cross-reactivity to 10% or less.

In order to develop a versatile method for detecting or quantifying oligonucleotides that satisfies the high demands in pharmaceutical development, the inventors have developed a method for detecting or quantifying oligonucleotides that is simple, highly sensitive, and has excellent quantitative and metabolite discrimination capabilities, and have completed the present invention.

Japanese Patent No. 6718032 International Publication WO2013/172305 Brochure Patent No. 4902674 International Publication WO2007/037282 Brochure

Ando H, Yonenaga N, Asai T, Hatanaka K, Koide H, Tsuzuku T, Harada N, Tsukada H, Oku N. [In vivo imaging of liposomal small interfering RNA (siRNA) trafficking by positron emission tomography]. Yakugaku Zasshi. 2012;132(12):1373-81. Review. Healey GD, Lockridge JA, Zinnen S, Hopkin JM, Richards I, Walker W. Development of pre-clinical models for evaluating the therapeutic potential of candidate siRNA targeting STAT6. PLoS One. 2014 Feb 27;9(2):e90338. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Guegler KJ. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005 Nov 27;33(20):e179. Yu RZ, Baker B, Chappell A, Geary RS, Cheung E, Levin AA. Development of an ultrasensitive noncompetitive hybridization-ligation enzyme-linked immunosorbent assay for the determination of phosphorothioate oligodeoxynucleotide in plasma. Anal Biochem. 2002 May 1;304(1):19-25. Wei X, Dai G, Marcucci G, Liu Z, Hoyt D, Blum W, Chan KK. A specific picomolar hybridization-based ELISA assay for the determination of phosphorothioate oligonucleotides in plasma and cellular matrices. Pharm Res. 2006 Jun;23(6):1251-64.

Conventional signal detection methods (Hybridization method, Ligand Binding Assay such as Ligation method, qPCR) have the problem that they cannot distinguish between oligonucleotides with a deleted portion of the target oligonucleotide sequence to be measured, particularly oligonucleotides with a deleted 5' or 3' end (metabolites, etc.), and intact target oligonucleotides (unaltered forms), and therefore measure both metabolites and unaltered forms. In addition, the method of Yu et al. and the method of Omori et al., which solved this problem, require enzyme treatment of the sample, and thus have problems in terms of simplicity.
On the other hand, liquid chromatography mass spectrometry (LC-MS) and HPLC-UV methods can distinguish between metabolites and intact target oligonucleotides, but they have the drawback of lacking sensitivity.
An object of the present invention is to provide a method for measuring oligonucleotides which is simpler, more sensitive, and more specific and quantitative than conventional measurement methods.
Another problem to be solved by the present invention is to provide a method for measuring an oligonucleotide having excellent specificity that can distinguish between the unchanged form and metabolites and detect only the unchanged form.

A double antigen bridge immunoassay method using a capture drug antibody and a tracer drug antibody is known as a method for measuring anti-drug antibodies (Patent Document 3). In this method, the capture drug antibody and the tracer drug antibody specifically bind to the analyte (anti-drug antibody) contained in the sample, forming a trimer of capture drug antibody-analyte-tracer drug antibody. The capture drug antibody is bound to a solid phase to remove free tracer drug antibody, and then a signal derived from the label contained in the tracer drug antibody is detected, thereby obtaining a signal proportional to the amount of analyte in the sample.
The present inventors have investigated a hybridization method using a capture probe and an assist probe (see Patent Document 4) as a method for measuring a target oligonucleotide in a sample, and thus a nucleic acid drug (hereinafter, for convenience, it may be referred to as the CP-AP method). In the CP-AP method, a first nucleic acid probe contained in the capture probe and a second nucleic acid probe contained in the assist probe specifically hybridize to a nucleic acid drug (target oligonucleotide) contained in a sample, forming a capture probe-nucleic acid drug-assist probe trimer (see FIG. 1). The present inventors attempted to obtain a signal proportional to the amount of target oligonucleotide in a sample by removing free assist probe using the solid phase contained in the capture probe and then detecting a signal derived from the label contained in the assist probe.
The present inventors have conducted extensive research to realize the measurement of oligonucleotides and, by extension, nucleic acid drugs by the CP-AP method, and have found that by inserting a spacer between the solid phase and the nucleic acid probe contained in the capture probe, it is possible not only to detect the nucleic acid drug (target oligonucleotide) in the sample, but also, surprisingly, to distinguish it from the metabolites of the nucleic acid drug. This effect is particularly remarkable when streptavidin or avidin and biotin are used as the adapter for binding the solid phase and the nucleic acid probe in the capture probe. The present inventors have further found that by using the present invention, the cross-reactivity of the metabolites of the nucleic acid drug can be suppressed to a surprisingly low level.

Based on the above, the present invention has the following configuration.
[Embodiment 1]
A method for measuring a target oligonucleotide in a sample by combining a capture probe and an assist probe based on the principle of hybridization, and for measuring a target oligonucleotide having a full-length sequence and a metabolite thereof, comprising the steps of:
the capture probe comprises a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe;
The assist probe comprises a tag or label and a second nucleic acid probe linked to the tag or label;
In a preferred embodiment, the nucleotide of the first nucleic acid probe that is most proximal to the solid phase forms a base pair with the nucleotide at the 3' or 5' end of the target oligonucleotide;
The metabolite is deleted from one or more consecutive nucleotides including the 3'-terminal or 5'-terminal nucleotide,
a first nucleic acid probe capable of hybridizing to a portion of the target oligonucleotide that contains a nucleotide that is missing in said metabolite;
the second nucleic acid probe is capable of hybridizing to a portion of the target oligonucleotide other than said portion;
The capture probe, the target oligonucleotide, and the assist probe form a complex.
Method.
[Embodiment 1.2]
2. The method according to embodiment 1, wherein, when a target oligonucleotide in a sample is to be measured in distinction from a metabolite lacking one or more nucleotides from its 3' end, the first nucleic acid probe contained in the capture probe is bound to the first spacer via the nucleotide at its 5' end.
[Embodiment 1.3]
2. The method according to embodiment 1, wherein, when a target oligonucleotide in a sample is to be measured in distinction from a metabolite lacking one or more nucleotides from its 5'-end, the first nucleic acid probe contained in the capture probe is bound to the first spacer via the nucleotide at its 3'-end.
[Embodiment 2]
A method for detecting a target oligonucleotide in a sample while distinguishing it from a metabolite lacking one or more nucleotides from its 3'-end or 5'-end, comprising the steps of:
(i) contacting a sample containing a target oligonucleotide or a metabolite lacking one or more nucleotides from its 3'-end or 5'-end with a capture probe for capturing the target oligonucleotide and an assist probe for detecting the target oligonucleotide to form a complex of the capture probe, the target oligonucleotide, and the assist probe;
here,
the capture probe comprises a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe;
The assist probe comprises a tag or label and a second nucleic acid probe linked to the tag or label;
a sequence of the first nucleic acid probe is complementary to a subsequence of the target oligonucleotide, the subsequence including a nucleotide that is missing in the metabolite;
The sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide, and
In a preferred embodiment, the first spacer is bound to a terminal nucleotide of the first nucleic acid probe, and the terminal nucleotide forms a base pair with the terminal nucleotide of the target oligonucleotide that is missing in the metabolite when the target oligonucleotide and the first nucleic acid probe are hybridized; and
(ii) detecting the complex, thereby detecting the target oligonucleotide in the sample.
[Embodiment 2.1]
3. The method of embodiment 2, wherein when a target oligonucleotide in a sample is to be detected separately from a metabolite lacking one or more nucleotides from its 3' end, the first nucleic acid probe is bound to the first spacer via the 5'-terminal nucleotide, and the sequence of the first nucleic acid probe is complementary to a sequence comprising the 3' end of the target oligonucleotide.
[Embodiment 2.2]
3. The method of embodiment 2, wherein when a target oligonucleotide in a sample is to be detected distinctly from a metabolite lacking one or more nucleotides from its 5' end, the first nucleic acid probe is bound to the first spacer via the nucleotide at its 3' end, and the sequence of the first nucleic acid probe is complementary to a sequence comprising the 5' end of the target oligonucleotide.
[Embodiment 3]
A method for detecting a target oligonucleotide in a sample, comprising the steps of:
(i) contacting a sample with a capture probe for capturing a target oligonucleotide and an assist probe for detecting the target oligonucleotide to form a complex of the capture probe, the target oligonucleotide, and the assist probe;
here,
the capture probe comprises a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe;
The assist probe comprises a tag or label and a second nucleic acid probe linked to the tag or label;
the sequence of the first nucleic acid probe is complementary to a subsequence of the target oligonucleotide that includes a terminal nucleotide of the target oligonucleotide;
The sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide, and
In a preferred embodiment, the first spacer is bound to a terminal nucleotide of the first nucleic acid probe, and the terminal nucleotide of the first nucleic acid probe forms a base pair with the terminal nucleotide of the target oligonucleotide when the target oligonucleotide and the first nucleic acid probe are hybridized; and
(ii) detecting the complex, thereby detecting the target oligonucleotide in the sample.
[Embodiment 3.1]
The method of embodiment 3, wherein the sequence of the first nucleic acid probe is complementary to a 3'-side partial sequence of the target oligonucleotide that includes the 3'-terminal nucleotide of the target oligonucleotide, the sequence of the second nucleic acid probe is complementary to a sequence other than the 3'-side partial sequence of the target oligonucleotide, and the first spacer is bound to the 5'-terminal nucleotide of the first nucleic acid probe.
[Embodiment 3.2]
The method of embodiment 3, wherein the sequence of the first nucleic acid probe is complementary to a 5'-side partial sequence of the target oligonucleotide that includes the 5'-terminal nucleotide of the target oligonucleotide, the sequence of the second nucleic acid probe is complementary to a sequence other than the 5'-side partial sequence of the target oligonucleotide, and the first spacer is bound to the 3'-terminal nucleotide of the first nucleic acid probe.
[Embodiment 3.3]
The method according to any one of embodiments 1 to 3.2, wherein the first nucleic acid probe included in the capture probe is 5 bases, 6 bases, 7 bases, 8 bases, 9 bases, 10 bases, or 11 bases in length.
[Embodiment 3.4]
The method according to any one of embodiments 1 to 3.3, wherein the second nucleic acid probe contained in the assist probe is 4 bases long, 5 bases long, 6 bases long, 7 bases long, 8 bases long, 9 bases long, 10 bases long, 11 bases long, 12 bases long, 13 bases long, 14 bases long, 15 bases long, 16 bases long, 17 bases long, 18 bases long, 19 bases long, 20 bases long, 21 bases long, 22 bases long, 23 bases long, 24 bases long, or 25 bases long; provided, however, that in one embodiment, when the first nucleic acid probe contained in the capture probe is 11 bases long, the second nucleic acid probe contained in the assist probe is not 4 bases long.
[Embodiment 4]
The method according to any of embodiments 1 to 3.4, wherein said capture probe comprises an adaptor between the solid phase and the first spacer.
[Embodiment 5]
5. The method of embodiment 4, wherein the capture probe comprises a second spacer between the solid phase and the adaptor.
[Embodiment 6]
The method of embodiment 4 or 5, wherein the adapter is streptavidin or avidin and biotin.
[Embodiment 7]
The method of embodiment 6, wherein binding of streptavidin or avidin to biotin occurs after complex formation of the capture probe, the target oligonucleotide, and the assist probe.
[Embodiment 8]
The method according to any of the preceding embodiments, wherein the first spacer is a 5mer to 90mer oligonucleotide.
[Embodiment 8.1]
The method further includes the steps of:
(i) adding to the complex a pair of self-assembling signal amplification probes having complementary base sequence regions capable of hybridizing with each other, thereby forming a probe polymer bound to the complex; and
(ii) detecting the probe polymer;
The assist probe includes a tag having a base sequence complementary to a part or all of one of the pair of self-assembling signal amplification probes.
9. The method according to any one of embodiments 1 to 8.
[Embodiment 8.2]
The method of embodiment 8.1, wherein at least one of the pair of self-assembling signal amplification probes comprises a poly-T sequence.
[Embodiment 8.3]
The method according to embodiment 8.1 or 8.2, characterized in that at least one of the pair of self-assembling signal amplification probes is labeled with a labeling substance.
[Embodiment 8.4]
the pair of self-assembling signal amplification probes comprises a first signal amplification probe and a second signal amplification probe;
the first signal amplification probe is a nucleic acid probe that includes three or more nucleic acid regions, and includes, in order from the 5'-end side, at least a nucleic acid region X, a nucleic acid region Y, and a nucleic acid region Z or a nucleic acid region Z including a polyT sequence,
the second signal amplification probe is a nucleic acid probe comprising three or more nucleic acid regions, and comprising, in order from the 5'-end side, at least a nucleic acid region X' complementary to the nucleic acid region X, a nucleic acid region Y' complementary to the nucleic acid region Y, and a nucleic acid region Z' complementary to the nucleic acid region Z or a nucleic acid region Z' comprising a polyA sequence;
A method according to any one of embodiments 8.1 to 8.3.
[Embodiment 9]
A detection kit for detecting a target oligonucleotide, comprising a capture probe, an assist probe, and a pair of signal amplification probes having complementary base sequence regions capable of hybridizing with each other and capable of forming a probe polymer by self-assembly,
the capture probe comprises a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe;
the assist probe includes a tag having a base sequence complementary to a part or all of one of the pair of signal amplification probes, and a second nucleic acid probe linked to the tag;
The sequence of the first nucleic acid probe is complementary to a subsequence of the target oligonucleotide that includes a terminal nucleotide of the target oligonucleotide, and
the sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide;
In a preferred embodiment, the first spacer is bound to a terminal nucleotide of the first nucleic acid probe, and the terminal nucleotide of the first nucleic acid probe forms a base pair with the terminal nucleotide of the target oligonucleotide when the target oligonucleotide and the first nucleic acid probe are hybridized.
Detection kit.
[Embodiment 10]
10. The detection kit according to embodiment 9, wherein the capture probe comprises an adaptor between the solid phase and the first spacer.
[Embodiment 11]
11. The detection kit of embodiment 10, wherein the capture probe comprises a second spacer between the solid phase and the adaptor.
[Embodiment 12]
12. The detection kit according to embodiment 10 or 11, wherein the adapter is streptavidin or avidin and biotin.
[Embodiment 13]
The detection kit according to embodiment 12, wherein binding of streptavidin or avidin to biotin occurs after complex formation of the capture probe, the target oligonucleotide, and the assist probe.
[Embodiment 14]
The detection kit according to any one of embodiments 9 to 13, wherein the first spacer is a 5mer to 90mer oligonucleotide.
[Embodiment 14.1]
A detection kit for measuring a target oligonucleotide in a sample and distinguishing it from a metabolite lacking one or more nucleotides from its 3'-end, wherein a first nucleic acid probe contained in the capture probe is bound to a first spacer via a nucleotide at its 5'-end, the detection kit according to embodiment 9 or 10.
[Embodiment 14.2]
A detection kit for measuring a target oligonucleotide in a sample in distinction from a metabolite lacking one or more nucleotides from its 5'-end, wherein a first nucleic acid probe contained in the capture probe is bound to a first spacer via a nucleotide at its 3'-end, the detection kit according to embodiment 9 or 10.
[Embodiment 15]
The detection kit according to any one of embodiments 9 to 14.2, characterized in that at least one of the pair of signal amplification probes is labeled with a labeling substance.
[Embodiment 16]
the pair of signal amplification probes comprises a first signal amplification probe and a second signal amplification probe,
the first signal amplification probe is a nucleic acid probe including, in order from the 5'-end side, at least a nucleic acid region X, a nucleic acid region Y, and a nucleic acid region Z or a nucleic acid region Z including a polyT sequence,
the second signal amplification probe is a nucleic acid probe comprising, in order from the 5' end, at least a nucleic acid region X' complementary to the nucleic acid region X, a nucleic acid region Y' complementary to the nucleic acid region Y, and a nucleic acid region Z' complementary to the nucleic acid region Z or a nucleic acid region Z' containing a polyA sequence;
A detection kit according to any one of embodiments 9 to 15.

The present invention makes it possible to perform simple detection or quantification of oligonucleotides with high sensitivity, specificity, and quantitative performance, without using enzymes or the like, and through a process involving hybridization between probes alone. It is also possible to provide a method for detecting or quantifying oligonucleotides with excellent specificity and quantitative performance, which distinguishes between an oligonucleotide metabolite in which the 5' or 3' side of the target oligonucleotide to be measured is deleted and the unchanged oligonucleotide, has almost no cross-reactivity with metabolites, and can detect only the unchanged oligonucleotide.

FIG. 1 is a diagram showing the principle of a hybridization method using a capture probe and an assist probe (CP-AP method). FIG. 1 shows the structures of LNA and DNA components.

(sample)
The "sample" used in the method of the present invention is a body fluid such as whole blood, serum, plasma, lymph, urine, saliva, tears, sweat, gastric juice, pancreatic juice, bile, pleural fluid, joint cavity fluid, cerebrospinal fluid, spinal fluid, bone marrow fluid, or tissue such as liver, kidney, lung, or heart from a human, monkey, dog, pig, rat, guinea pig, or mouse, preferably whole blood, serum, plasma, or urine ..., to which a pharmaceutical containing a target oligonucleotide has been administered.

(Targeted Oligonucleotides)
In this specification, the term "target oligonucleotide" refers to an intact oligonucleotide (intact target oligonucleotide/unchanged) to be measured. In other words, the term "target oligonucleotide" does not include metabolites that should be distinguished from it. In this specification, the term "target oligonucleotide" refers to any DNA or RNA, any single-stranded or double-stranded, and any chemically modified oligonucleotide that can form a specific hybrid with a nucleic acid probe. Examples of chemical modifications include phosphorothioate modification (S modification), 2'-F modification, 2'-O-Methyl (2'-OMe) modification, 2'-O-Methoxyethyl (2'-MOE) modification, morpholino modification, LNA modification, BNACOC modification, BNANC modification, ENA modification, cEt BNA modification, etc. When the target oligonucleotide is double-stranded, it is made into a single strand and used in the present invention. The base length of the target oligonucleotide is not limited, but is preferably 12mer, 13mer, 14mer, 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, 22mer, 23mer, 24mer, 25mer, 26mer, 27mer, 28mer, 29mer, or 30mer.

(Capture Probe)
A "capture probe" as used in the present invention is a probe for capturing a target oligonucleotide, and includes a nucleic acid probe, a first spacer adjacent to, immobilized, bound to, or linked to the 3'- or 5'-terminal nucleotide of the nucleic acid probe, and a solid phase adjacent to, immobilized, bound to, or linked to the first spacer.

(Assist Probe)
An "assist probe" as used in the present invention is a probe for detecting a target oligonucleotide, and comprises a nucleic acid probe and a tag or label adjacent to the 5'-terminal or 3'-terminal nucleotide of the nucleic acid probe.

(Nucleic acid probes contained in capture probes and assist probes - Constituent nucleotides)
The nucleic acid probes contained in the capture probe and the assist probe are composed of deoxyribonucleotides or ribonucleotides, and in one embodiment of the present invention, each independently contains 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 locked nucleic acids (LNA) (FIG. 2). When the nucleic acid probe has a base length of 5mer, the nucleic acid probe preferably contains 5 locked nucleic acids (LNA), and when the nucleic acid probe has a base length of 6mer to 11mer, the nucleic acid probe preferably contains 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 locked nucleic acids (LNA).

(Nucleic acid probe - base length)
In one embodiment, the nucleic acid probe included in the capture probe has a base length of 5mer, 6mer, 7mer, 8mer, 9mer, 10mer, or 11mer. In this embodiment, it was possible to actually distinguish and measure a target oligonucleotide that retains the full-length sequence in a sample from a metabolite that has one or more nucleotides deleted from the 3'-end or 5'-end of the target oligonucleotide.
The nucleic acid probe contained in the assist probe only needs to bind to a region other than the nucleic acid probe region contained in the capture probe, and in one embodiment, has a base length of 4mer, 5mer, 6mer, 7mer, 8mer, 9mer, 10mer, 11mer, 12mer, 13mer, 14mer, 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, 22mer, 23mer, 24mer, or 25mer. In this embodiment, it was possible to actually distinguish and measure a target oligonucleotide having a full-length sequence in a sample from a metabolite having one or more nucleotides missing from its 3'-end or 5'-end. In another embodiment, the nucleic acid probe contained in the assist probe has a base length of 4mer, 5mer, 6mer, 7mer, 8mer, 9mer, 10mer, 11mer, 12mer, 13mer, 14mer, 15mer, or 16mer. In this embodiment, it was possible to actually distinguish and measure a target oligonucleotide having a full-length sequence in a sample from a metabolite having one or more nucleotides missing from its 3'-end or 5'-end.
However, in one embodiment, the present invention does not include an embodiment in which the nucleic acid probe contained in the capture probe has a base length of 11 mer and the nucleic acid probe contained in the assist probe has a base length of 4 mer. In one embodiment, the present invention includes an embodiment in which the nucleic acid probe contained in the capture probe has a base length of 10 mer and the nucleic acid probe contained in the assist probe has a base length of 4 mer. In another embodiment, the present invention does not include an embodiment in which the nucleic acid probe contained in the capture probe has a base length of 10 mer and the nucleic acid probe contained in the assist probe has a base length of 4 mer.

(contact)
As used herein, the term "contact" or the process of "contacting" refers to placing a substance in close proximity to another substance so that a chemical bond such as a covalent bond, an ionic bond, a metallic bond, or a non-covalent bond can be formed between the two substances. In one aspect of the present invention, "contacting" a substance with another substance refers to mixing a solution containing the substance with a solution containing the other substance. In the present invention, a capture probe, a target oligonucleotide, and an assist probe are contacted to form a complex between them. In one embodiment, the step of contacting the capture probe and the assist probe with the sample is carried out by incubating the mixture containing the sample, the capture probe, and the assist probe for a certain period of time at a temperature of +2°C to -10°C, +1°C to -9°C, 0°C to -8°C, -1°C to -7°C, -2°C to -6°C, or -3°C to -5°C, or at +10°C, +9°C, +8°C, +7°C, +6°C, +5°C, +4°C, +3°C, +2°C, +1°C, 0°C, -1°C, -2°C, -3°C, -4°C, -5°C, -6°C, -7°C, -8°C, -9°C, or -10°C, compared to the melting temperature (Tm) of the target oligonucleotide and the nucleic acid probe contained in the capture probe. For example, when Tm is 50°C, +2°C to -10°C compared to Tm means 52°C to 40°C. In one embodiment, the incubation time is 10 seconds to 4 minutes, 20 seconds to 3 minutes, or 30 seconds to 2 minutes, or 10 seconds, 20 seconds, 30 seconds, 40 seconds, 50 seconds, 60 seconds, 70 seconds, 80 seconds, 90 seconds, 100 seconds, 110 seconds, 120 seconds, 130 seconds, 140 seconds, 150 seconds, 160 seconds, 170 seconds, or 180 seconds.

(capture)
In the present invention, the capture probe "captures" a target oligonucleotide primarily means that the nucleic acid probe contained in the capture probe hybridizes with the target oligonucleotide. In one embodiment, the capture probe "captures" a target oligonucleotide means that the target oligonucleotide indirectly binds to the solid phase contained in the capture probe or to the solid phase to which the adaptor is bound via the nucleic acid probe and spacer contained in the capture probe. In the present invention, the capture probe directly captures the target oligonucleotide and further indirectly captures the assist probe via the target oligonucleotide, thereby allowing a signal proportional to the amount of the target oligonucleotide in the sample to be obtained from the assist probe.

(Hybridization/Hybridize)
As used herein, hybridization of a nucleic acid probe contained in a capture probe or assist probe to a target oligonucleotide means that a single-stranded nucleic acid probe having a sequence complementary to a portion of a specific base sequence binds to a single-stranded target oligonucleotide having the sequence through base pairing to form a double-stranded nucleic acid molecule.

(Complex)
In this specification, when the "complex" of the capture probe, the target oligonucleotide, and the assist probe is formed, it means that a part of the nucleic acid probe contained in the capture probe specifically hybridizes with the target oligonucleotide, and another part of the nucleic acid probe contained in the assist probe specifically hybridizes with the target oligonucleotide to form a trimer. Here, the specific hybridization of the nucleic acid probe with a part of the target oligonucleotide means that all bases contained in the nucleic acid probe, except for the spacer and the tag, form pairs with the bases of the target oligonucleotide. In one aspect, all bases contained in the target oligonucleotide form pairs with the bases of the nucleic acid probe contained in the capture probe or the bases of the nucleic acid probe contained in the assist probe.

(Removal)
When detecting a complex of a capture probe, a target oligonucleotide, and an assist probe, if a signal derived from a free assist probe interferes with the detection, it is preferable to remove the free assist probe. For example, the free assist probe can be removed by washing the solid phase contained in the capture probe, or the solid phase bound via the adaptor contained in the capture probe. In order to wash the solid phase, the reaction solution in which the solid phase is suspended may be centrifuged or filtered to separate the liquid phase of the reaction solution. In addition, if the solid phase is magnetic, the solid phase can be collected using a magnet. The solid phase may be washed multiple times as necessary.

(detection)
To "detect" the target oligonucleotide, a tag or label contained in the assist probe, or a label bound via the tag, can be used. In addition, if the solid phase contained in the capture probe can emit a signal such as fluorescence, the signal can also be used. The signal from the label or solid phase may be any signal that is physically or chemically detectable, but an optically detectable signal is preferred to achieve high throughput.

(Self-assembly: PALSAR method)
It means a state in which a plurality of first signal amplification probes are hybridized with a second signal amplification probe to form a probe polymer, and a state in which a plurality of second signal amplification probes are hybridized with the first signal amplification probe to form a probe polymer.

(A pair of self-assembling signal amplification probes)
A pair of "self-assembling" signal amplification probes used in the method of the present invention refers to oligonucleotides in which a first signal amplification probe and a second signal amplification probe have complementary base sequence regions that can hybridize with each other and can form a probe polymer by a self-assembly reaction. Here, "hybridizable" means, in one embodiment, that the complementary base sequence regions are completely complementary.

The pair of self-assembling probes may be labeled in advance with a labeling substance for detection. Preferably, at least one of the first and second signal amplification probes is labeled with a labeling substance. Examples of such labeling substances include radioisotopes, biotin, digoxigenin, fluorescent substances, luminescent substances, or dyes. Specific examples include radioisotopes such as ¹²⁵ I and ³² P, luminescent and chromogenic substances such as digoxigenin and acridinium esters, luminescent substances such as dioxetanes, and fluorescent substances such as 4-methylumbelliferyl phosphate, and biotin for using fluorescent, luminescent, or chromogenic substances bound to avidin. In addition, a donor fluorescent dye and an acceptor fluorescent dye for utilizing fluorescence resonance energy transfer (FRET) may be added to detect a target oligonucleotide.
In one embodiment, the labeling substance is biotin, and the oligonucleotide is labeled by biotinylating the 5'-end or 3'-end. When the labeling substance is biotin, the substance that specifically binds to the labeling substance is streptavidin or avidin. In one embodiment, the labeling substance is not biotin, and the substance that specifically binds to the labeling substance is not streptavidin or avidin.

In the present invention, a complex containing a hybridization product of the target oligonucleotide and the capture probe and assist probe may be contacted with a pair of self-assembling probes consisting of a first and second signal amplification probe, and the complex may be bound to a probe polymer consisting of the first and second signal amplification probes for detection.

In one embodiment, the assist probe used above includes a tag that can bind to one of a pair of self-assembling probes consisting of a first and a second signal amplification probe, and has the role of assisting the binding of the target oligonucleotide to the probe polymer. The first embodiment of the assist probe is a probe that includes a tag consisting of a sequence complementary to the entire sequence or a partial sequence of at least one of the first or second oligonucleotides, and a sequence complementary to a partial sequence of the target oligonucleotide.

(Solid Phase)
In this specification, examples of the term "solid phase" include insoluble microparticles, microbeads, fluorescent microparticles, magnetic particles, microplates, microarrays, slide glasses, and substrates such as electrically conductive substrates.
In one embodiment of the present invention, the "solid phase" is a fluorescent microparticle, in another embodiment, a fluorescent bead, and in yet another embodiment, a bead having a fluorescent substance on its surface. The "beads having a fluorescent substance on their surface" used in the present invention are not particularly limited as long as they are beads having a fluorescent substance, and for example, MicroPlex ^™ Microspheres from Luminex Corporation can be suitably used. One type of bead or multiple types of beads can be used. If multiple types of color-coded beads are used, the method for quantifying oligonucleotides of the present invention can be easily multiplexed.
In one embodiment of the present invention, the "solid phase" is a microplate. Materials of the microplate used in the present invention include, but are not limited to, polystyrene, polypropylene, polycarbonate, and cyclic olefin copolymer. In one embodiment of the present invention, the microplate is a coated plate such as a biotin-coated plate, a protein A, G, A/G, and/or L-coated plate, an anti-GST antibody-coated plate, a glutathione-, nickel-, and/or copper-coated plate, an amine- and/or sulfhydryl-conjugated plate, a carboxylated plate, a streptavidin-coated plate, etc.
In one aspect, the solid phase is not an insoluble microparticle, is not a microbead, is not a fluorescent microparticle, is not a magnetic particle, is not a microplate, is not a microarray, is not a glass slide, or is not a substrate such as an electrically conductive substrate.

(adapter)
Examples of the "adapter" used in the present invention include biotin, streptavidin or avidin, and combinations thereof, antigens, antibodies, and combinations thereof, and are preferably biotin, streptavidin or avidin, and combinations thereof. In one embodiment, the adapter is not a nucleic acid such as an oligonucleotide or a nucleotide, is not biotin, streptavidin or avidin, and combinations thereof, antigens, antibodies, and combinations thereof, and is not a compound having an amino group or a carboxyl group such as a spacer such as Spacer 9, Spacer 12, Spacer 18, Spacer C3, etc. In another embodiment, the adapter does not include a nucleic acid such as an oligonucleotide or a nucleotide. Furthermore, in one embodiment, streptavidin or avidin is directly immobilized on a solid phase. In another embodiment, streptavidin or avidin is not directly immobilized on a solid phase. For example, in the other embodiment, streptavidin or avidin is immobilized on a solid phase via a (second) spacer.

(spacer)
Examples of the "spacer" used in the present invention include nucleic acids such as oligonucleotides and nucleotides, and compounds having an amino or carboxyl group such as spacers such as Spacer 9, Spacer 12, Spacer 18, and Spacer C3, and preferably 5'-Amino-Modifier C12 (12-(4-Monomethoxytritylamino)dodecyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite). For example, in an embodiment in which a nucleic acid probe having a carboxyl group on the surface of a bead and an amino group compound is added thereto is bound to the carboxyl group on the surface of the bead via the amino group, a compound having an amino group is an example of the spacer. In one embodiment, the spacer is not a nucleic acid such as an oligonucleotide or nucleotide, is not biotin, and is not a compound having an amino or carboxyl group such as spacers such as Spacer 9, Spacer 12, Spacer 18, and Spacer C3. In another embodiment, the spacer does not include a nucleic acid such as an oligonucleotide or nucleotide. Furthermore, in one embodiment, the first spacer is directly immobilized on a solid phase. In another embodiment, the first spacer is not directly immobilized on a solid phase, for example, the first spacer is immobilized on a solid phase via biotin, streptavidin, avidin, or a combination thereof.
When the spacer is an oligonucleotide, the base length of the oligonucleotide is 4 mer or more and 130 mer or less, 5 mer or more and 90 mer or less, 7 mer or more and 50 mer or less, 10 mer or more and 40 mer or less, 15 mer or more and 30 mer or less, or 4 mer, 5 mer, 6 mer, 7 mer, 8 mer, 9 mer, 10 mer, 11 mer, 12 mer, 13 mer, 14 mer, 15 mer, 16 mer, 17 mer, 18 mer, 19 mer, 20 mer, 21 mer, 22 mer, 23 mer, or 34 mer. r, 24mer, 25mer, 26mer, 27mer, 28mer, 29mer, 30mer, 31mer, 32mer, 33mer, 34mer, 35mer, 36mer, 37mer, 38mer, 39mer, 40mer, 41mer, 42mer, 43mer, 44mer, 45mer, 46mer, 47mer, 48mer, 49mer, 50mer, 51mer, 52mer, 53mer, 54mer, 55mer, 56mer, 57mer, 58mer, 59mer, 60mer, 61m er, 62mer, 63mer, 64mer, 65mer, 66mer, 67mer, 68mer, 69mer, 70mer, 71mer, 72mer, 73mer, 74mer, 75mer, 76mer, 77mer, 78mer, 79mer, 80mer, 81mer, 82mer, 83mer, 84mer, 85mer, 86mer, 87mer, 88mer, 89mer, 90mer, 91mer, 92mer, 93mer, 94mer, 95mer, 96mer, 97mer, 98mer, 99mer, 100mer, 101mer, 102mer, 103mer, 104mer, 105mer, 106mer, 107mer, 108mer, 109mer, 110mer, 111mer, 112mer, 113mer, 114mer, 115mer, 116mer, 117mer, 118mer, 119mer, 120mer, 121mer, 122mer, 123mer, 124mer, 125mer, 126mer, 127mer, 128mer, 129mer, 130mer, 131mer, 132mer, 133mer, 134mer, 135mer, 136mer, 137mer, 138mer, 139mer, 140mer, 141mer, 142mer, 143mer, 144mer, 145mer, 146mer, 147mer, 148mer, 149mer, 150mer, 151mer, 152mer, 9mer, 100mer, 101mer, 102mer, 103mer, 104mer, 105mer, 106mer, 107mer, 108mer, 109mer, 110mer, 111mer, 112mer, 113mer, 114mer, 115mer, 116mer, 117mer, 118mer, 119mer, 120mer, 121mer, 122mer, 123mer, 124mer, 125mer, 126mer, 127mer, 128mer, 129mer, or 130mer.

(Tag or Label)
The "tag" contained in the assist probe includes a poly A sequence, a poly T sequence, a poly U sequence, a poly (T/U) sequence, a poly G sequence, and a poly C sequence, as well as a nucleic acid containing or consisting of any specific sequence. The base length of the nucleic acid tag is 5mer to 115mer, 10mer to 110mer, 15mer to 105mer, 20mer to 100mer, 25mer to 95mer, 30mer to 90mer, 35mer to 85mer, 40mer to 80mer, 45mer to 75mer, 50mer to 70mer, or 55mer to 65mer, or 5mer, 6mer, 7mer, 8mer, 9mer, 10mer, 11mer、12mer、13mer、14mer、15mer、16mer、17mer、18mer、19mer、20mer、21mer、22mer、23mer、24mer、25mer、26mer、27mer、28mer、29mer、30mer、31mer、32mer、33mer、34mer、35mer、36mer、37mer、38mer、39mer、40mer、41mer、42mer、43mer、44mer、45mer、46mer、4 7mer, 48mer, 49mer, 50mer, 51mer, 52mer, 53mer, 54mer, 55mer, 56mer, 57mer, 58mer, 59mer, 60mer, 61mer, 62mer, 63mer, 64mer, 65mer, 66mer, 67mer, 68mer, 69mer, 70mer, 71mer, 72mer, 73mer, 74mer, 75mer, 76mer, 77mer, 78mer, 79mer, 80mer, 81mer, 82mer, 83 mer, 84mer, 85mer, 86mer, 87mer, 88mer, 89mer, 90mer, 91mer, 92mer, 93mer, 94mer, 95mer, 96mer, 97mer, 98mer, 99mer, 100mer, 101mer, 102mer, 103mer, 104mer, 105mer, 106mer, 107mer, 108mer, 109mer, 110mer, 111mer, 112mer, 113mer, 114mer, or 115mer. In one embodiment, the tag or label does not include a nucleic acid such as an oligonucleotide or a nucleotide. Examples of the "label" contained in the assist probe include a radioisotope, biotin, digoxigenin, a fluorescent substance, a luminescent substance, or a dye. Specifically, examples of the label include radioisotopes such as ¹²⁵ I and ³² P, luminescent and chromogenic substances such as digoxigenin and acridinium esters, luminescent substances such as dioxetanes, and fluorescent substances such as 4-methylumbelliferyl phosphate, and alkaline phosphatase for utilizing fluorescent, luminescent, and chromogenic substances bound to avidin. It is also possible to detect a target oligonucleotide by adding a donor fluorescent dye and an acceptor fluorescent dye for utilizing fluorescence resonance energy transfer (FRET). In one embodiment, the label may be contained in another nucleic acid molecule that hybridizes to the nucleic acid tag contained in the assist probe. In one embodiment, the "label" contained in the assist probe is not a radioisotope, biotin, digoxigenin, a fluorescent substance, a luminescent substance, or a dye. In particular, when biotin, streptavidin, avidin, or a combination thereof is used as the adaptor, in one embodiment, the "label" contained in the assist probe is not biotin.

(adjacent)
The term "adjacent to", "immobilized", "bound" or "linked" the first spacer or tag or label to the 5'- or 3'-terminal nucleotide of the nucleic acid probe primarily means that the first spacer or tag or label is directly bound to the nucleotide. For example, when the first spacer or tag or label is bound to the nucleotide via some molecule, the molecule itself can be considered as the first spacer or tag or label, or the molecule itself can be considered as constituting a part of the first spacer or tag or label. The solid phase may be bound to the first spacer and the nucleic acid probe via an adaptor.

(Nucleic acid probes - target oligonucleotides and their relationships to metabolites)
In the present invention, a metabolite is a 3'-terminal and/or
Or it refers to an oligonucleotide having at least one nucleotide deleted from the 5' end.
In one embodiment of the present invention, the metabolite of the target oligonucleotide has one or more nucleotides missing from the 3'-end, the sequence of the "nucleic acid probe" contained in the capture probe is complementary to a partial sequence of the target oligonucleotide including the 3'-end nucleotide of the target oligonucleotide, and the sequence of the "nucleic acid probe" contained in the assist probe is complementary to a sequence of the target oligonucleotide other than the partial sequence. In this embodiment, the first spacer contained in the capture probe is adjacent to the 5'-end nucleotide of the nucleic acid probe contained in the capture probe, and the tag or label contained in the assist probe is adjacent to the 3'-end nucleotide of the nucleic acid probe contained in the assist probe.
In another embodiment of the present invention, the metabolite of the target oligonucleotide has one or more nucleotides missing from the 5'-end, the sequence of the "nucleic acid probe" contained in the capture probe is complementary to a partial sequence of the target oligonucleotide including the 5'-end nucleotide of the target oligonucleotide, and the sequence of the "nucleic acid probe" contained in the assist probe is complementary to a sequence of the target oligonucleotide other than the partial sequence. In this embodiment, the first spacer contained in the capture probe is adjacent to the 3'-end nucleotide of the nucleic acid probe contained in the capture probe, and the tag or label contained in the assist probe is adjacent to the 5'-end nucleotide of the nucleic acid probe contained in the assist probe.
In this specification, for convenience, the "nucleic acid probe" contained in the capture probe may be referred to as the "first nucleic acid probe," and the "nucleic acid probe" contained in the assist probe may be referred to as the "second nucleic acid probe."
The first nucleic acid probe contained in the capture probe and the second nucleic acid probe contained in the assist probe may be adjacent to each other (without a gap) when hybridized to a target oligonucleotide, or may not be adjacent (with a gap of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides). In one embodiment of the present invention, the first nucleic acid probe contained in the capture probe and the second nucleic acid probe contained in the assist probe are not adjacent to each other with a gap of 1 to 21 nucleotides, 1 to 16 nucleotides, 1 to 11 nucleotides, or 1 to 7 nucleotides when hybridized to a target oligonucleotide.
Even when the first nucleic acid probe contained in the capture probe and the second nucleic acid probe contained in the assist probe are not adjacent to each other (with gaps of 3, 6, 9, 11, and 12 nucleotides) when hybridized to the target oligonucleotide, it was possible to actually distinguish and measure the target oligonucleotide retaining the full-length sequence in the sample from the metabolite lacking one or more nucleotides from its 3'-end or 5'-end. Those skilled in the art will understand that the presence of gaps of 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20, or 1-21 nucleotides is not a practical problem.
In another embodiment in which the first nucleic acid probe contained in the capture probe and the second nucleic acid probe contained in the assist probe have a gap, a blocking probe may be used that is adjacent to each of the first nucleic acid probe contained in the capture probe and the second nucleic acid probe contained in the assist probe and hybridizes to the gap site of the target oligonucleotide. In this embodiment, it will be understood by those skilled in the art that there may be a gap between the first nucleic acid probe and the blocking probe and/or between the second nucleic acid probe and the blocking probe.

(complementary - for capture probe)
The nucleic acid probe contained in the capture probe is "complementary" to the sequence at the 3' end (5' end) of the target oligonucleotide, preferably meaning that the sequence of the nucleic acid probe is completely complementary to the sequence of consecutive nucleotides including the nucleotide at the 3' end (5' end) of the target oligonucleotide. The length of this completely complementary sequence is preferably the same as the base length of the nucleic acid probe contained in the capture probe. However, in one embodiment, the nucleic acid probe can have an additional nucleotide at the 5' end (3' end) in addition to the part that is completely complementary to the sequence at the 3' end (5' end) of the target oligonucleotide. It is easily understood that the additional nucleotide does not have a partner on the target oligonucleotide to form a pair or mismatch. The additional nucleotide can be considered to constitute a part or all of the solid phase, adapter, or spacer adjacent to the nucleotide at the 5' end (3' end) of the nucleic acid probe. In one embodiment, it will be understood by those skilled in the art that an artificial mutation can be introduced into the sequence of the nucleic acid probe, provided that the nucleic acid probe can preferentially bind to the target oligonucleotide compared to metabolites. The parentheses should be interpreted appropriately.

(Complementary - for assist probes)
The "complementary" of the nucleic acid probe contained in the assist probe to the sequence at the 5' end (3' end) of the target oligonucleotide preferably means that the sequence of the nucleic acid probe is completely complementary to the sequence of consecutive nucleotides including the nucleotide at the 5' end (3' end) of the target oligonucleotide. The length of this completely complementary sequence is preferably the same as the base length of the nucleic acid probe contained in the assist probe. However, in one embodiment, the nucleic acid probe can have an additional nucleotide at the 3' end (5' end) in addition to the part that is completely complementary to the sequence at the 5' end (3' end) of the target oligonucleotide. It is easily understood that the additional nucleotide does not have a partner on the target oligonucleotide to form a pair or mismatch. The additional nucleotide can be considered to constitute a part or all of the tag adjacent to the nucleotide at the 3' end (5' end) of the nucleic acid probe. In addition, it will be understood by those skilled in the art that in one embodiment, an artificial mutation can be introduced into the sequence of the nucleic acid probe. The parentheses should be read as appropriate.

[Example 1] Verification of the effect of inserting a spacer between the solid phase and the nucleic acid probe contained in the capture probe
1. Materials and Methods
(1) Target nucleic acid PT1 was used as the target nucleic acid to be measured. As a model nucleic acid of the target nucleic acid metabolite, PT1-3n-1, a nucleic acid with one base deleted at the 3' end, was used. The nucleic acid was synthesized by Nihon Gene Research Institute (HPLC purification grade). The above target nucleic acid is fully S-modified (phosphorothioated), similar to the general structure of antisense nucleic acid, which is one of the nucleic acid drugs, and PT1 has three bases each substituted with LNA from the 5' end and 3' end. For PT1-3n-1, three bases from the 5' end and two bases from the 3' end are substituted with LNA. Both PT1 and PT1-3n-1 were prepared at 1, 2, 10, or 100 ng/ml using nuclease-free water containing 0.01% Tween 20. Blank samples not containing PT1 or PT1-3n-1 were also prepared.
<PT1 base sequence>
5'-A(L)^G(L)^A(L)^G^C^T^G^A^C^T^T^G^A^T(L)^G(L)^5(L)-3' (the base portion is sequence number 1)
<PT1-3n-1 base sequence>
5'-A(L)^G(L)^A(L)^G^C^T^G^A^C^T^T^G^A^T(L)^G(L)-3' (the base portion is sequence number 2)
*(L)=LNA, 5=substituted with 5-Methyl-Cytosine, ^=phosphorothioated.

(2) Preparation of capture probe
(2-1) When an ECL plate [plate-ECL series] was used as the solid phase, a nucleic acid probe having a base sequence complementary to the 3' side of PT1 [called CP-sp0-B] or a nucleic acid probe containing a 15-mer oligonucleotide spacer [called CP-sp15-B] was attached to the solid phase MSD GOLD 96-well Small Spot SA SECTOR (MSD/product number: L45SA-1) via biotin modification at the 5' end to prepare a capture probe [called plate-ECL-sp0 and plate-ECL-sp15, respectively]. The reaction was carried out in a Thermomixer comfort (Eppendorf). 10 pmol of the nucleic acid probe was added to 100 μL of 1×PBS-TP [1×PBS [137 mM sodium chloride, 8.1 mM disodium phosphate, 2.68 mM potassium chloride, 1.47 mM potassium dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300], and the reaction was carried out at 37°C for 30 minutes with stirring (700 rpm). After washing twice with 200 μL of 1×PBS-TP, 150 μL of 3% Blocker A (MSD, product number: R93BA-4) was added and the reaction was carried out at 37°C for 1 hour (700 rpm). Then, the reaction was carried out three times with 200 μL of 1×PBS-TP.
<Base sequence of CP-sp0-B>
5'-(biotin)GCATCAAGT-3' (the base portion is SEQ ID NO: 3)
<CP-sp15-B base sequence>
5'-(biotin) AGAGTGGTTGTGGTA GCATCAAGT-3' (the base portion is SEQ ID NO: 4)
*The underlined portion indicates the first spacer region.

(2-2) When ELOSA plates [plate-Elo1 series] were used as the solid phase, the capture probes were prepared by binding the nucleic acid probe CP-sp0-B having a base sequence complementary to the 3' side of PT1 or the nucleic acid probe CP-sp15-B containing a 15-mer oligonucleotide spacer to the solid phase Pierce (registered trademark) NeutrAvidin (registered trademark) Coated 96-Well Plates (Thermo Fisher Scientific, product number: 15129) via biotin modification at the 5' end [referred to as plate-Elo1-sp0 and plate-Elo1-sp15, respectively]. The reaction was carried out in a Thermomixer comfort (Eppendorf). 10 pmol of the nucleic acid probe was added to 100 μL of 1×PBS-TP [1×PBS [137 mM sodium chloride, 8.1 mM disodium phosphate, 2.68 mM potassium chloride, 1.47 mM potassium dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300], and the reaction was carried out at 37°C for 30 minutes (700 rpm). After washing twice with 200 μL of 1×PBS-TP, 150 μL of 3% Blocker A (MSD/product number: R93BA-4) was added, and the reaction was carried out at 37°C for 1 hour (700 rpm). After that, the reaction was carried out three times with 200 μL of 1×PBS-TP.

(2-3) When the ELOSA plate [plate-Elo2 series] was used as the solid phase, the capture probes were prepared by binding the nucleic acid probe CP-sp0-B having a base sequence complementary to the 3' side of PT1 or CP-sp15-B containing a 15-mer oligonucleotide spacer to the plate via biotin modification at the 5' end on the Nunc immobilizer Streptavidin F96 CLEAR (Thermo Fisher Scientific/product number: 436020), a type of solid phase in which an adapter is bound via a second spacer, via the plate [referred to as plate-Elo2-sp0 and plate-Elo2-sp15, respectively]. The reaction was carried out in a Thermomixer comfort (Eppendorf). 10 pmol of the nucleic acid probe was added to 100 μL of 1×PBS-TP [1×PBS [137 mM sodium chloride, 8.1 mM disodium phosphate, 2.68 mM potassium chloride, 1.47 mM potassium dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300], and the reaction was carried out at 37°C for 30 minutes (700 rpm). After washing twice with 200 μL of 1×PBS-TP, 150 μL of 3% Blocker A (MSD/product number: R93BA-4) was added, and the reaction was carried out at 37°C for 1 hour (700 rpm). After that, the reaction was carried out three times with 200 μL of 1×PBS-TP.

(2-4) When polystyrene beads [beads-1 series] were used as the solid phase, the capture probes were prepared by binding the nucleic acid probe CP-sp0-B having a base sequence complementary to the 3' side of PT1 or CP-sp15-B containing a 15-mer oligonucleotide spacer to the solid phase MicroPlex Microspheres (Luminex/product number: LC10015-01) via biotin modification at the 5' end [referred to as beads-1-sp0 and beads-1-sp15, respectively].

(2-5) When polystyrene beads [beads-2 series] were used as the solid phase, a nucleic acid probe having a base sequence complementary to the 3' side of PT1 [referred to as CP-sp0-N] or a nucleic acid probe containing a 15-mer oligonucleotide spacer [referred to as CP-sp15-N] was bound to the solid phase MicroPlex Microspheres (Luminex/product number: LC10015-01) via _NH2 modification at the 5' end to prepare a capture probe [referred to as beads-2-sp0 and beads-2-sp15, respectively].
<Base sequence of CP-sp0-N>
5'-(NH ₂ )GCATCAAGT-3' (the base portion is SEQ ID NO: 3)
<The base sequence of CP-sp15-N>
5'-( _NH2 ) AGAGTGGTTTGTGGTAGCATCAAGT -3' (the base portion is SEQ ID NO: 4)
*The underlined portion indicates the first spacer region.

(3) Capture of target nucleic acid by capture probe ( ^1st hybridization reaction)
(3-1) When an ECL plate [plate-ECL series] was used as the solid phase, 40 μL of the 1st Hybridization reaction solution was added to 10 μL of the target nucleic acid, the metabolite model nucleic acid of the target nucleic acid, or the blank sample to make a total of 50 μL, and the reaction was carried out at 25°C for 1 hour (700 rpm) in a Thermomixer comfort (Eppendorf). The reaction was carried out at 25°C for 1 hour.
(3-1-1) Composition of ^1st Hybridization reaction solution
5M TMAC (tetramethylammonium chloride) 15μL, 10x supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8.0% N-lauroyl sarcosine sodium] 7.5μL, 12.5% PEG8000 (polyethylene glycol) 10μL, RNase Free water 6.5μL, 100 fmol/ml assist probe (AP-1 with a base sequence complementary to the 5' side of PT1 with a polyA chain added) 1μL
<AP-1 base sequence>
5'-5(L)A(L)G(L)5(L)T(L)5(L)AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3' (the base portion is SEQ ID NO: 5)

(3-2) When ELOSA plate [plate-Elo1 series] [plate-Elo2 series] was used as the solid phase, 90 μL of the 1st Hybridization reaction solution was added to 10 μL of the target nucleic acid, metabolite model nucleic acid of the target nucleic acid, or blank sample to make a total of 100 μL, and the reaction was carried out for 25 minutes, 1 hour (700 rpm) in a Thermomixer comfort (Eppendorf).
(3-2-1) Composition of ^1st Hybridization reaction solution
5M TMAC (tetramethylammonium chloride) 30μL, 10x supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8.0% N-lauroyl sarcosine sodium] 15μL, 12.5% PEG8000 (polyethylene glycol) 20μL, RNase Free water 24μL, 100 fmol/ml assist probe (AP-1 (sequence number 5) having a base sequence complementary to the 5' side of PT1 with a polyA chain added) 1μL

(3-3) When polystyrene beads [beads-1 series] [beads-2 series] were used as the solid phase, 25 μL of the 1st Hybridization reaction solution was added to 10 μL of the target nucleic acid, metabolite model nucleic acid of the target nucleic acid, or blank sample to make a total of 35 μL, and the reaction was carried out at 25°C for 1 hour in a thermal cycler (Eppendorf).
(3-3-1) Composition of the ^1st Hybridization reaction solution: 0.4 μL (800 pieces) of the capture probe immobilized in (2) above, 10.5 μL of 5M TMAC (tetramethylammonium chloride), 5.25 μL of 10×supplement [500 mM Tris-HCl (pH 8.0), 40 mM EDTA (pH 8.0), 8.0% N-lauroyl sarcosine sodium], 5 μL of 17.5% PEG8000 (polyethylene glycol), 2.85 μL of RNase Free water, 100 fmol/ml assist probe
(AP-1 (SEQ ID NO: 5) having a base sequence complementary to the 5' side of PT1 with a polyA tail added) 1 μL

(4) Signal amplification by PALSAR reaction
(4-1) When ECL plates [plate-ECL series] are used as the solid phase
30 μL of the PALSAR reaction solution was added to 50 μL of the reaction solution after the 1st Hybridization reaction to make a total of 80 μL, and the reaction was carried out at 25°C for 1 hour in a Thermomixer comfort (Eppendorf). The sequences of the pair of self-aggregating probes (also called signal amplification probes) used in the PALSAR reaction are the following HCP-1-C3 and HCP-2-C3, whose 5' ends are labeled with cyanine3 (C3).
<HCP-1-C3 base sequence>
5'-(C3)CAACAATCAGGACGATACCGATGAAGTTTTTTTTTTTTTTTTTT-3' (the base portion is SEQ ID NO: 6)
<HCP-2-C3 base sequence>
5'-(C3)GTCCTGATTGTTGCTTCATCGGTATCAAAAAAAAAAAAAAAAAAAA-3' (the base portion is SEQ ID NO: 7)
(4-1-1) Composition of PALSAR reaction solution
Nuclease-Free Water 5.1μL, 5M TMAC 4.5μL, 10×supplement [500 mM Tris-HCl (pH 8.0), 40 mM EDTA (pH 8.0), 8% N-lauroyl sarcosine sodium] 2.25μL, 20pmol/μL HCP-1-C3 1.75μL, 20pmol/μL HCP-2-C3 1.4μL

(4-2) When ELOSA plates [plate-Elo1 series] [plate-Elo2 series] are used as the solid phase
50 μL of the PALSAR reaction solution was added to 100 μL of the reaction solution after the 1st Hybridization reaction to make a total of 150 μL, and the reaction was carried out at 25°C for 1 hour (700 rpm) in a Thermomixer comfort (Eppendorf). The sequences of the pair of self-aggregating probes (also called signal amplification probes) used in the PALSAR reaction are the following HCP-1-D and HCP-2-D, whose 5' ends are labeled with digoxigenin (Dig).
<HCP-1-D base sequence>
5'-(Dig)CAACAATCAGGACGATACCGATGAAGTTTTTTTTTTTTTTTTTT-3' (the base portion is SEQ ID NO: 6)
<HCP-2-D base sequence>
5'-(Dig)GTCCTGATTGTTGCTTCATCGGTATCAAAAAAAAAAAAAAAAAAAA-3' (the base portion is SEQ ID NO: 7)
(4-2-1) Composition of PALSAR reaction solution
Nuclease-Free Water 24.35μL, 5M TMAC 15μL, 10×supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8% N-lauroylsarcosine sodium] 7.5μL, 20pmol/μL HCP-1-D 1.75μL, 20pmol/μL HCP-2-D 1.4μL

(4-3) When polystyrene beads [beads-1 series] are used as the solid phase
15 μL of the PALSAR reaction solution was added to 35 μL of the reaction solution after the 1st Hybridization reaction to make a total of 50 μL, and the mixture was reacted in a Thermal cycler (Eppendorf) at 25°C for 1 hour. The sequences of the pair of self-aggregating probes (also called signal amplification probes) used in the PALSAR reaction are HCP-1-C3 (SEQ ID NO: 6) and HCP-2-C3 (SEQ ID NO: 7), whose 5' ends are labeled with cyanine3 (C3).
(4-3-1) Composition of PALSAR reaction solution
Nuclease-Free Water 5.1μL, 5M TMAC 4.5μL, 10×supplement [500 mM Tris-HCl (pH 8.0), 40 mM EDTA (pH 8.0), 8% N-lauroyl sarcosine sodium] 2.25μL, 20pmol/μL HCP-1-C3 1.75μL, 20pmol/μL HCP-2-C3 1.4μL

(4-4) When polystyrene beads [beads-2 series] are used as the solid phase
15 μL of the PALSAR reaction solution was added to 35 μL of the reaction solution after the 1st Hybridization reaction to make a total of 50 μL, and the reaction was carried out in a Thermal cycler (Eppendorf) at 25° C. for 1 hour. The sequences of the pair of self-aggregating probes (also called signal amplification probes) used in the PALSAR reaction are HCP-1-D (SEQ ID NO: 6) and HCP-2-D (SEQ ID NO: 7), whose 5' ends are labeled with digoxigenin (Dig).
(4-3-1) Composition of PALSAR reaction solution
Nuclease-Free Water 4.6μL, 5M TMAC 4.5μL, 10×supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8% N-lauroylsarcosine sodium] 2.75μL, 20pmol/μL HCP-1-D 1.75μL, 20pmol/μL HCP-2-D 1.4μL

(5) Detection
(5-1) When ECL plates [plate-ECL series] are used as the solid phase
After the PALSAR reaction, the plate was washed twice with 200 μL of 1×PBS-TP. Then, 0.25 μL of 100 μg/mL home-prepared anti-Dig-Fab antibody-Ru (MSD SULFO-TAG NHS-Ester; MSD, serial number: R91AO-1, Anti-DIG, Fab fragments from sheep; Roche, serial number: 11214667001), 16.7 μL of 3% Blocker A, and 33.1 μL of Nuclease-Free Water were added, and the plate was reacted at 25°C for 1 hour (700 rpm) in a Thermomixer comfort. After washing three times with 200 μL of 1× PBS-TP, 150 μL of MSD GOLD Read Buffer A (MSD/product number: R92TG-2) diluted 2-fold with Nuclease-Free Water was added, and the positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using a MESO QuickPlex SQ 120MM measuring device (MSD).

(5-2) When ELOSA plates [plate-Elo1 series] [plate-Elo2 series] are used as the solid phase
After the PALSAR reaction, the plate was washed three times with 200 μL of 1×PBS-TP. Then, 100 μL of anti-Dig-HRP antibody (R&D systems/product number: HAM7520) diluted 10,000 times with 1×PBS-TP containing 1% BSA was added, and the plate was reacted at 25°C for 1 hour (700 rpm) in a Thermomixer comfort. After washing three times with 200 μL of 1×PBS-TP, 100 μL of luminescence substrate solution (KPL SureBlue Reserve TMB Microwell Peroxidase Substrate; seracare/product number: 5120-0083) was added, and the plate was washed three times with 200 μL of 1×PBS-TP, and 100 uL of reaction stop solution (1 M sulfuric acid/product number: 198-09595) was added. The positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using TECAN infinite50R; 50-620 nm wavelength (TECAN).

(5-3) When polystyrene beads [beads-1 series] are used as the solid phase
After the PALSAR reaction was completed, the reaction solution was washed twice with 1xPBS-TP [1xPBS [137mM sodium chloride, 8.1mM disodium phosphate, 2.68mM potassium chloride, 1.47mM potassium dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300].
Thereafter, 75 μL of 1×PBS-TP was added, and the positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using a Luminex System (Luminex).

(5-4) When polystyrene beads [beads-2 series] are used as the solid phase
After the PALSAR reaction, the plate was washed once with 1xPBS-TP [1xPBS [137mM sodium chloride, 8.1mM disodium phosphate, 2.68mM potassium chloride, 1.47mM potassium dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300]. 50μL of detection reagent (SAPE; Streptavidin-R-Phycoerythrin, Prozyme Co., Ltd./product number: PJ31S-1) 5μg/mL was added and the plate was left for 10 minutes at 25℃ in the dark, and then washed twice with 1xPBS-TP. Then, 75μL of 1xPBS-TP was added and the positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using the Luminex System (Luminex Co., Ltd.).

2. Results
(1) Study using ECL plate [plate-ECL series] as solid phase Cross-reactivity when target nucleic acid and metabolite model were measured using capture probe plate-ECL-sp0 without the first spacer and capture probe plate-ECL-sp15 with the first spacer is shown in Table 1. When plate-ECL-sp0 without the first spacer was used as the capture probe, the average cross-reactivity was 44.0%, whereas when plate-ECL-sp15 with the first spacer was used, the average cross-reactivity was less than 1%. This shows that it is possible to significantly suppress cross-reactivity by inserting the first spacer into the capture probe.

交差反応性(%)=[代謝物モデル核酸(PS-BG)] / [標的核酸(PS-BG)]×100

Cross-reactivity (%) = [metabolite model nucleic acid (PS-BG)] / [target nucleic acid (PS-BG)] × 100

(2) Study using ELOSA plate [plate-Elo1 series] as solid phase Cross-reactivity when target nucleic acid and metabolite model were measured using capture probe plate-Elo1-sp0 without the first spacer and capture probe plate-Elo1-sp15 with the first spacer is shown in Table 2. When plate-Elo1-sp0 without the first spacer was used as a capture probe, the average cross-reactivity was 111.8%, whereas when plate-Elo1-sp15 with the first spacer was used, the average cross-reactivity was 3.9%. This shows that it is possible to significantly suppress cross-reactivity by inserting the first spacer into the capture probe.

交差反応性(%)=[代謝物モデル(PS-BG)] / [標的核酸(PS-BG)]×100

Cross-reactivity (%) = [metabolite model (PS-BG)] / [target nucleic acid (PS-BG)] × 100

(3) Study using ELOSA plate [plate-Elo2 series] as solid phase Cross-reactivity when target nucleic acid and metabolite model were measured using capture probe plate-Elo2-sp0 without the first spacer and capture probe plate-Elo2-sp15 with the first spacer is shown in Table 3. When plate-Elo2-sp0 without the first spacer was used as a capture probe, the average cross-reactivity was 55.5%, whereas when plate-Elo2-sp15 with the first spacer was used, the average cross-reactivity was less than 1%, indicating that the cross-reactivity can be significantly suppressed by inserting the first spacer into the capture probe.

交差反応性(%)=[代謝物モデル(PS-BG)] / [標的核酸(PS-BG)]×100

Cross-reactivity (%) = [metabolite model (PS-BG)] / [target nucleic acid (PS-BG)] × 100

交差反応性(%)=[代謝物モデル(PS-BG)] / [標的核酸(PS-BG)]×100 (4) Study using polystyrene beads [beads-1 series] as solid phase Table 4 shows the cross-reactivity when target nucleic acid and metabolite model were measured using capture probes beads-1-sp0 without the first spacer and capture probes beads-1-sp15 with the first spacer. When beads-1-sp0 without the first spacer was used as the capture probe, the average cross-reactivity was 29.1%, whereas when beads-1-sp15 with the first spacer was used, the average cross-reactivity was 3.7%. This shows that it is possible to significantly suppress cross-reactivity by inserting the first spacer into the capture probe.

Cross-reactivity (%) = [metabolite model (PS-BG)] / [target nucleic acid (PS-BG)] × 100

(5) Study using polystyrene beads [beads-2 series] as solid phase Table 5 shows the cross-reactivity when target nucleic acid and metabolite model were measured using capture probes beads-2-sp0 without the first spacer and capture probes beads-2-sp15 with the first spacer. When beads-2-sp0 without the first spacer was used as the capture probe, the average cross-reactivity was 1.6%, whereas when beads-2-sp15 with the first spacer was used, the average cross-reactivity was less than 1%. This shows that it is possible to suppress cross-reactivity by inserting the first spacer into the capture probe.

交差反応性(%)=[代謝物モデル(PS-BG)] / [標的核酸(PS-BG)]×100

Cross-reactivity (%) = [metabolite model (PS-BG)] / [target nucleic acid (PS-BG)] × 100

[Example 2] Examination of the length of the spacer between the solid phase and the nucleic acid probe contained in the capture probe
1. Materials and Methods
(1) Target Nucleic Acid The target nucleic acid PT1 (SEQ ID NO: 1) used in Example 1 and a metabolite model nucleic acid of the target nucleic acid (nucleic acid with one base deleted at the 3' end) PT1-3n-1 (SEQ ID NO: 2) were used. Both PT1 and PT1-3n-1 were prepared at 10 ng/ml using nuclease-free water containing 0.01% Tween 20. Blank samples not containing PT1 or PT1-3n-1 were also prepared.

(2) Preparation of capture probes The capture probes were prepared by binding the nucleic acid probes CP-sp0-B, which has a base sequence complementary to the 3' side of PT1 and does not contain a spacer, or CP-sp5-B, CP-sp10-B, CP-sp15-B, CP-sp20-B, CP-sp25-B, CP-sp30-B, CP-sp50-B, and CP-sp90-B, which contain oligonucleotide spacers of 5, 10, 15, 20, 25, 30, 50, and 90 mer, respectively, to the solid phase MSD GOLD 96-well Small Spot SA SECTOR (MSD/product number: L45SA-1) via biotin modification at the 5' end. The reaction was carried out in a Thermomixer comfort (Eppendorf). 10 pmol of the nucleic acid probe was added to 100 μL of 1×PBS-TP [1×PBS [137 mM sodium chloride, 8.1 mM disodium phosphate, 2.68 mM potassium chloride, 1.47 mM potassium dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300], and the reaction was carried out at 37°C for 30 minutes (700 rpm). After washing twice with 200 μL of 1×PBS-TP, 150 μL of 3% Blocker A (MSD, product number: R93BA-4) was added and the reaction was carried out at 37°C for 1 hour (700 rpm). Then, the reaction was carried out three times with 200 μL of 1×PBS-TP.
<Base sequence of CP-sp0-B>
5'-(biotin)GCATCAAGT-3' (the base portion is SEQ ID NO: 3)
<Base sequence of CP-sp5-B>
5'-(biotin) TGGTA GCATCAAGT-3' (the base portion is SEQ ID NO: 8)
<The base sequence of CP-sp10-B>
5'-(biotin) GGTTGTGGTA GCATCAAGT-3' (the base portion is SEQ ID NO: 9)
<CP-sp15-B base sequence>
5'-(biotin) AGAGTGGTTGTGGTA GCATCAAGT-3' (the base portion is SEQ ID NO: 4)
<Base sequence of CP-sp20-B>
5'-(biotin) TGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (the base portion is SEQ ID NO: 10)
<The base sequence of CP-sp25-B>
5'-(biotin) AGAGTTGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (the base portion is SEQ ID NO: 11)
<Base sequence of CP-sp30-B>
5'-(biotin) TTGTGAGAGTTGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (the base portion is SEQ ID NO: 12)
<The base sequence of CP-sp50-B>
5'-(biotin) TGGTAAGAGTGGTTGTGGTATTGTGAGAGTTGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (the base portion is SEQ ID NO: 13)
<The base sequence of CP-sp90-B>
5'-(biotin) GGTTGTGGTATTGTGAGAGTTGGTAAGAGTGGTTGTGGTATGGTAAGAGTGGTTGTGGTATTGTGAGAGTTGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (the base portion is SEQ ID NO: 14)
*The underlined portion indicates the first spacer region.

(3) Capture of target nucleic acid by capture probe ( ^1st hybridization reaction)
40 μL of the 1st Hybridization reaction solution was added to 10 μL of the target nucleic acid, the metabolite model nucleic acid of the target nucleic acid, or the blank sample to make a total of 50 μL, and the reaction was carried out at 25°C for 1 hour (700 rpm) in a Thermomixer comfort (Eppendorf). The reaction was carried out at 25°C for 1 hour.
(3-1) Composition of ^1st Hybridization reaction solution
5M TMAC (tetramethylammonium chloride) 15μL, 10x supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8.0% N-lauroyl sarcosine sodium] 7.5μL, 12.5% PEG8000 (polyethylene glycol) 10μL, RNase Free water 6.5μL, 100 fmol/ml assist probe (AP-1 (sequence number 5) having a base sequence complementary to the 5' side of PT1 with a polyA chain added) 1μL

(4) Signal amplification by PALSAR reaction
30 μL of the PALSAR reaction solution was added to 50 μL of the reaction solution after the 1st Hybridization reaction to make a total of 80 μL, and the reaction was carried out at 25°C for 1 hour in a Thermomixer comfort (Eppendorf). The sequences of the pair of self-aggregating probes (also called signal amplification probes) used in the PALSAR reaction are HCP-1-C3 (SEQ ID NO: 6) and HCP-2-C3 (SEQ ID NO: 7), whose 5' ends are labeled with cyanine3 (C3).
(4-1) Composition of PALSAR reaction solution
Nuclease-Free Water 5.1μL, 5M TMAC 4.5μL, 10×supplement [500 mM Tris-HCl (pH 8.0), 40 mM EDTA (pH 8.0), 8% N-lauroyl sarcosine sodium] 2.25μL, 20pmol/μL HCP-1-C3 1.75μL, 20pmol/μL HCP-2-C3 1.4μL

(5) Detection
After the PALSAR reaction, the plate was washed twice with 200 μL of 1×PBS-TP. Then, 0.25 μL of 100 μg/mL home-prepared anti-Dig-Fab antibody-Ru (MSD SULFO-TAG NHS-Ester; MSD, serial number: R91AO-1, Anti-DIG, Fab fragments from sheep; Roche, serial number: 11214667001), 16.7 μL of 3% Blocker A, and 33.1 μL of Nuclease-Free Water were added, and the plate was reacted at 25°C for 1 hour (700 rpm) in a Thermomixer comfort. Again, after washing three times with 200 μL of 1× PBS-TP, 150 μL of MSD GOLD Read Buffer A (MSD/product number: R92TG-2) diluted 2-fold with Nuclease-Free Water was added, and the positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using a MESO QuickPlex SQ 120MM measuring device (MSD).

交差反応性(%)=[代謝物モデル核酸(PS-BG)] / [標的核酸(PS-BG)]×100 2. Results The cross-reactivity of the target nucleic acid and metabolite model measured using the capture probe CP-sp0-B without the first spacer and the capture probes CP-sp5-B, CP-sp10-B, CP-sp15-B, CP-sp20-B, CP-sp25-B, CP-sp30-B, CP-sp50-B, and CP-sp90-B with the first spacers of 5, 10, 15, 20, 25, 30, 50, and 90mer is shown in Table 6. When the capture probe did not have the first spacer, the cross-reactivity was 24.8%, whereas when a 5mer spacer was inserted into CP, the cross-reactivity was 5.9%, and when a 10mer, 15mer, 20mer, 25mer, or 30mer spacer was inserted, the cross-reactivity was less than 1%, when a 50mer spacer was inserted, it was 1.4%, and when a 90mer spacer was inserted, it was 4.8%. Extrapolating from the above results, it was shown that the cross-reactivity could be reduced to 10% or less by inserting a first spacer of about 4mer to 130mer into the capture probe, making it possible to significantly suppress the cross-reactivity.

Cross-reactivity (%) = [metabolite model nucleic acid (PS-BG)] / [target nucleic acid (PS-BG)] × 100

By using the measurement method of the present invention, it is possible to accurately measure drug concentrations in animal or human biological samples administered with a drug without being affected by metabolites in pharmacokinetic/pharmacodynamic (PK/PD) screening tests in the exploratory stage of drug development, safety tests in the non-clinical stage, pharmacological tests and pharmacokinetic tests, and in the clinical stage.

Claims (12)

A method for measuring a target oligonucleotide in a sample by combining a capture probe and an assist probe based on the principle of hybridization, and for measuring a target oligonucleotide having a full-length sequence and a metabolite thereof, comprising the steps of:
the capture probe comprises a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe;
The first spacer is selected from the group consisting of a 5mer to 90mer oligonucleotide, Spacer 9, Spacer 12, Spacer 18, and 5'-Amino-Modifier C12 (12-(4-Monomethoxytritylamino)dodecyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite);
The assist probe comprises a tag or label and a second nucleic acid probe linked to the tag or label;
The metabolite is missing one or more consecutive nucleotides including the 3' -terminal or 5'-terminal nucleotide,
a first nucleic acid probe capable of hybridizing to a portion of the target oligonucleotide that contains a nucleotide that is missing in said metabolite;
the second nucleic acid probe is capable of hybridizing to a portion of the target oligonucleotide other than said portion;
The capture probe, the target oligonucleotide, and the assist probe form a complex.
Method. A method for detecting a target oligonucleotide in a sample while distinguishing it from a metabolite lacking one or more nucleotides from its 3'-end or 5'-end, comprising the steps of:
(i) contacting a sample containing a target oligonucleotide or a metabolite lacking one or more nucleotides from its 3'-end or 5'-end with a capture probe for capturing the target oligonucleotide and an assist probe for detecting the target oligonucleotide to form a complex of the capture probe, the target oligonucleotide, and the assist probe;
here,
the capture probe comprises a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe;
The first spacer is selected from the group consisting of a 5mer to 90mer oligonucleotide, Spacer 9, Spacer 12, Spacer 18, and 5'-Amino-Modifier C12 (12-(4-Monomethoxytritylamino)dodecyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite);
The assist probe comprises a tag or label and a second nucleic acid probe linked to the tag or label;
a sequence of the first nucleic acid probe is complementary to a subsequence of the target oligonucleotide, the subsequence including a nucleotide that is missing in the metabolite;
the sequence of the second nucleic acid probe is complementary to a sequence other than the subsequence of the target oligonucleotide; and
(ii) detecting the complex, thereby detecting the target oligonucleotide in the sample. A method for detecting a target oligonucleotide in a sample, comprising the steps of:
(i) contacting a sample with a capture probe for capturing a target oligonucleotide and an assist probe for detecting the target oligonucleotide to form a complex of the capture probe, the target oligonucleotide, and the assist probe;
here,
the capture probe comprises a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe;
The first spacer is selected from the group consisting of a 5mer to 90mer oligonucleotide, Spacer 9, Spacer 12, Spacer 18, and 5'-Amino-Modifier C12 (12-(4-Monomethoxytritylamino)dodecyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite);
The assist probe comprises a tag or label and a second nucleic acid probe linked to the tag or label;
the sequence of the first nucleic acid probe is complementary to a subsequence of the target oligonucleotide that includes a terminal nucleotide of the target oligonucleotide;
the sequence of the second nucleic acid probe is complementary to a sequence other than the subsequence of the target oligonucleotide; and
(ii) detecting the complex, thereby detecting the target oligonucleotide in the sample. The method of any one of claims 1 to 3, wherein the capture probe comprises an adapter between the solid phase and a first spacer , and wherein the adapter is not an oligonucleotide, Spacer 9, Spacer 12, Spacer 18, or 5'-Amino-Modifier C12 (12-(4-Monomethoxytritylamino)dodecyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite) . The method of claim 4 , wherein the adaptor is streptavidin or avidin and biotin. The method of claim 5 , wherein binding of streptavidin or avidin to biotin occurs after complex formation of the capture probe, the target oligonucleotide, and the assist probe. A detection kit for detecting a target oligonucleotide, comprising a capture probe, an assist probe, and a pair of signal amplification probes having complementary base sequence regions capable of hybridizing with each other and capable of forming a probe polymer by self-assembly,
the capture probe comprises a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe;
The first spacer is selected from the group consisting of a 5mer to 90mer oligonucleotide, Spacer 9, Spacer 12, Spacer 18, and 5'-Amino-Modifier C12 (12-(4-Monomethoxytritylamino)dodecyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite);
the assist probe includes a tag having a base sequence complementary to a part or all of one of the pair of signal amplification probes, and a second nucleic acid probe linked to the tag;
The sequence of the first nucleic acid probe is complementary to a subsequence of the target oligonucleotide that includes a terminal nucleotide of the target oligonucleotide, and
The sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide.
Detection kit. The detection kit according to claim 7, characterized in that the capture probe comprises an adapter between the solid phase and a first spacer, wherein the adapter is not an oligonucleotide, Spacer 9, Spacer 12, Spacer 18, or 5' -Amino-Modifier C12 (12-(4-Monomethoxytritylamino)dodecyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite). 9. The detection kit according to claim 8 , wherein the adapter is streptavidin or avidin and biotin. 10. The detection kit according to claim 9 , wherein binding of streptavidin or avidin to biotin occurs after complex formation among the capture probe, the target oligonucleotide, and the assist probe. 11. The detection kit according to claim 7 , wherein at least one of the pair of signal amplification probes is labeled with a labeling substance. the pair of signal amplification probes comprises a first signal amplification probe and a second signal amplification probe,
the first signal amplification probe is a nucleic acid probe including, in order from the 5'-end side, at least a nucleic acid region X, a nucleic acid region Y, and a nucleic acid region Z or a nucleic acid region Z including a polyT sequence,
the second signal amplification probe is a nucleic acid probe comprising, in order from the 5' end, at least a nucleic acid region X' complementary to the nucleic acid region X, a nucleic acid region Y' complementary to the nucleic acid region Y, and a nucleic acid region Z' complementary to the nucleic acid region Z or a nucleic acid region Z' containing a polyA sequence;
A detection kit according to any one of claims 7 to 11 .