JP2023130618A - Method for detecting oligonucleotide having suppressed cross-reactivity - Google Patents

Abstract

To provide an oligonucleotide measurement method performed in a simpler manner, with higher sensitivity and superior specificity and quantitativity, as compared with conventional measurement methods, and also provide an oligonucleotide measurement method with superior specificity, which makes it possible to distinguish an intact target oligonucleotide (unmodified form) from a metabolite thereof so as to detect only the unmodified form.SOLUTION: In a hybridization method using a capture probe and an assist probe, a spacer is inserted between a solid phase and a nucleic acid probe, which are included in the capture probe. As a result, a target oligonucleotide in a sample can be detected, and the oligonucleotide can be also distinguished from the metabolite of the nucleic acid drug.SELECTED DRAWING: Figure 1

Description

The present invention relates to a method for detecting or quantifying oligonucleotides with high sensitivity, excellent specificity, and quantitative performance.

Nucleic acid drugs induce sequence-specific gene silencing, and have attracted much attention in recent years as new therapeutic agents for various diseases that have been difficult to treat, including genetic diseases and intractable diseases. (Non-patent Document 1, Ando 2012).

In pharmacokinetic/pharmacodynamic (PK/PD) screening tests in the exploration stage of drug development, in safety tests, pharmacology tests, and pharmacokinetic tests in the non-clinical stage, and in the clinical stage, animals or humans to which drugs are administered The drug concentration in the biological sample is measured. In addition, when receiving approval as a new drug, it is necessary to obtain data on drug concentrations in biological samples and submit safety and pharmacokinetic data in accordance with the guidelines established by the Ordinance of the Ministry of Health, Labor and Welfare.

Ando et al. have reported that by labeling nucleic acid medicines with positron-emitting nuclides, their behavior in vivo can be analyzed non-invasively and in real time in three dimensions (Non-Patent Document 1, Ando 2012). In addition, Healey et al. reported that a lower limit of quantification of 0.01 pg/μL was achieved using the stem-loop RT-PCR method (Non-patent Document 3, Chen 2005) (Non-Patent Document 2, Healey 2014 ).

However, in recent years, the development of artificial nucleic acids and delivery materials has made it possible to treat with lower doses. As a result, drug concentrations in biological samples have become lower than before, and more sensitive measurement systems are now required to detect these low concentrations of drugs. Furthermore, in order to comply with the guidelines set by the Ministry of Health, Labor and Welfare ordinance, the measurement system must have high quantitative performance that is independent of the operator. It was unsuitable for the purpose of detecting drug concentrations.

In addition, in conventional measurement systems, when oligonucleotides used in nucleic acid medicines are metabolized and degraded from the 5' or 3' ends, the oligonucleotides that are the target of measurement are not degraded from the 5' or 3' ends by metabolism. (hereinafter sometimes simply referred to as "intact") oligonucleotides, making it impossible to accurately measure drug concentrations.

In order to distinguish between intact oligonucleotides and their metabolites, which are the measurement targets, and to specifically measure biologically active nucleic acid drugs, Yu et al. developed a hybridization/ligation ELISA method (Non-patent Document 4, Yu et al. 2002). In this method, a "template" oligonucleotide containing a sequence complementary to the oligonucleotide to be measured and a "ligation probe" are used. The "template" oligonucleotide has a 9mer of additional nucleotides adjacent to the 5' terminal nucleotide of the complementary sequence and has biotin at the 3' end. The "ligation probe" is a 9mer oligonucleotide having a sequence complementary to the additional nucleotide of the 9mer, and has phosphate at the 5' end and digoxigenin at the 3' end. Therefore, when the oligonucleotide to be measured is intact, the intact oligonucleotide and ligation probe will hybridize on the template oligonucleotide without any gaps. Treatment of this hybridization product with ligase joins the intact oligonucleotide and ligation probe. On the other hand, if the oligonucleotide to be measured is metabolized and the 3'-end nucleotide is missing, this linkage does not occur. The ligation product is bound to a solid phase using biotin, unreacted ligation probe is washed and removed, and digoxigenin at the 3' end of the immobilized ligation product is detected by ELISA ( (See Figure 1 of Yu 2002, Non-Patent Document 4).
Wei et al. discloses performing S1 nuclease treatment after ligase treatment in order to improve the specificity of the hybridization/ligation ELISA method (Non-Patent Document 5, Wei 2006).
However, the hybridization/ligation ELISA method is complicated and unsuitable for multiplexing because it is necessary to design an optimal ligation probe sequence in consideration of the sequence of the oligonucleotide to be measured.

In order to solve the above problems of the hybridization/ligation ELISA method, Omori et al. decomposed and removed products derived from metabolites of the target oligonucleotide using S1 nuclease, etc., and the remaining intact target oligonucleotide developed a method for measuring products derived from (Patent Document 1). In this method, the target oligonucleotide to be measured is hybridized with a complementary nucleic acid probe (3'-complementary sequence to the target sequence-5'), or the target oligonucleotide to be measured is injected with polyA, etc. Add any base (first polynucleotide) to this and hybridize with a complementary nucleic acid probe (3'-complementary sequence of target oligonucleotide + complementary sequence of first polynucleotide -5') The incomplete hybridization products are degraded and removed using a single-strand specific nuclease such as S1 nuclease, and the nucleic acid probe contained in the remaining complete hybridization products is measured.

Omori et al.'s method is a method for measuring oligonucleotides that is more sensitive, specific, and quantitative than conventional methods such as hybridization/ligation ELISA, but single-strand-specific oligonucleotides such as S1 nuclease It is disadvantageous in that it is complicated because it uses nuclease and requires additional incubation time.
Furthermore, the Ministry of Health, Labor and Welfare's ``Guidance on conducting non-clinical safety studies for drug clinical trials and manufacturing and marketing approval applications'' states that toxicity studies are required if the cross-reactivity of metabolites exceeds 10%. has been done. As mentioned above, being able to measure the cross-reactivity of metabolites at 10% or less is an important standard in drug development, but in conventional methods based on hybridization such as hybridization/ligation ELISA, The cross-reactivity of metabolites is still high, and it has been difficult to stably suppress and detect cross-reactivity to 10% or less.

In order to develop a highly versatile oligonucleotide detection or quantification method that satisfies the above-mentioned high demands in drug development, the present inventors developed a method that is simple, highly sensitive, quantitative, and metabolite discriminatory. We have developed an excellent method for detecting or quantifying oligonucleotides and completed the present invention.

Japanese Patent No. 6718032 International publication WO2013/172305 pamphlet Patent No. 4902674 International publication WO2007/037282 pamphlet

Ando H, Yonenaga N, Asai T, Hatanaka K, Koide H, Tsuzuku T, Harada N, Tsukada H, Oku N. [In vivo imaging of liposomal small interfering RNA (siRNA) trafficking by positron emission tomography]. Yakugaku Zasshi. 2012 ;132(12):1373-81. Review. Healey GD, Lockridge JA, Zinnen S, Hopkin JM, Richards I, Walker W. Development of pre-clinical models for evaluating the therapeutic potential of candidate siRNA targeting STAT6. PLoS One. 2014 Feb 27;9(2):e90338. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Guegler KJ. Real-time quantification of microRNAs by stem-loop RT -PCR. Nucleic Acids Res. 2005 Nov 27;33(20):e179. Yu RZ, Baker B, Chappell A, Geary RS, Cheung E, Levin AA. Development of an ultrasensitive noncompetitive hybridization-ligation enzyme-linked immunosorbent assay for the determination of phosphorothioate oligodeoxynucleotide in plasma. Anal Biochem. 2002 May 1;304(1 ):19-25. Wei X, Dai G, Marcucci G, Liu Z, Hoyt D, Blum W, Chan KK. A specific picomolar hybridization-based ELISA assay for the determination of phosphorothioate oligonucleotides in plasma and cellular matrices. Pharm Res. 2006 Jun;23(6 ):1251-64.

Conventional signal detection methods (Hybridization method, Ligation method, Ligand Binding Assay, qPCR) detect oligonucleotides with a part of the sequence of the target oligonucleotide to be measured, especially those with deletions on the 5' or 3' side. There was a problem in that it was impossible to distinguish between oligonucleotides (such as metabolites) and intact target oligonucleotides (unchanged forms), and both metabolites and unchanged forms were measured. In addition, the methods of Yu et al. and Omori et al. that solved this problem required enzyme treatment of the sample, and had problems in terms of simplicity.
On the other hand, liquid chromatography-mass spectrometry (LC-MS) and HPLC-UV methods can distinguish between metabolites and intact target oligonucleotides, but they suffer from a lack of sensitivity.
The problem to be solved by the present invention is to provide a method for measuring oligonucleotides that is simpler, more sensitive, and has excellent specificity and quantitative properties compared to conventional measuring methods.
Another problem to be solved by the present invention is to provide a method for measuring oligonucleotides with excellent specificity that can distinguish between the unchanged substance and the metabolite and detect only the unchanged substance. .

As a method for measuring anti-drug antibodies, a double antigen crosslinking immunoassay method using a capture drug antibody and a tracer drug antibody is known (Patent Document 3). In this method, the capture drug antibody and the tracer drug antibody specifically bind to the analyte (anti-drug antibody) contained in the sample, resulting in a triple concentration of capture drug antibody-analyte-tracer drug antibody. A body is formed. By binding the capture drug antibody to a solid phase to remove free tracer drug antibodies, and then detecting the signal derived from the label contained in the tracer drug antibody, a signal proportional to the amount of analyte in the sample is generated. You can get it.
The present inventors investigated a hybridization method using a capture probe and an assist probe (see Patent Document 4) as a method for measuring target oligonucleotides in samples, and eventually nucleic acid drugs (hereinafter referred to as CP-AP method for convenience). ). In the CP-AP method, a first nucleic acid probe contained in a capture probe and a second nucleic acid probe contained in an assist probe specifically hybridize to a nucleic acid drug (target oligonucleotide) contained in a sample. As a result, a capture probe-nucleic acid drug-assist probe trimer is formed (see Figure 1). The present inventors removed the free assist probe using the solid phase contained in the capture probe, and then detected the signal derived from the label contained in the assist probe, thereby detecting the target oligonucleotide in the sample. An attempt was made to obtain a signal proportional to the amount.
The present inventors have made extensive studies to realize the measurement of oligonucleotides and, by extension, nucleic acid medicines by the CP-AP method, and have found that by inserting a spacer between the solid phase contained in the capture probe and the nucleic acid probe, the sample Surprisingly, it has been found that it is possible not only to detect the nucleic acid medicine (target oligonucleotide) in the nucleic acid medicine, but also to distinguish it from metabolites of the nucleic acid medicine. This effect was particularly pronounced when streptavidin or avidin and biotin were used as adapters to link the nucleic acid probe to the solid phase in the capture probe. The present inventors further discovered that by using the present invention, cross-reactivity of metabolites of nucleic acid medicines can be suppressed to a surprisingly low level.

From the above, the present invention has the following configuration.
[Embodiment 1]
A method of measuring a target oligonucleotide in a sample using a combination of a capture probe and an assist probe based on the principle of hybridization, and a method of distinguishing between a target oligonucleotide that retains its full-length sequence and its metabolites. And,
The capture probe includes a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe,
The assist probe includes a tag or label and a second nucleic acid probe linked to the tag or label,
In a preferred embodiment, the nucleotide of the first nucleic acid probe that is closest to the solid phase forms a base pair with a nucleotide at the 3' end or 5' end of the target oligonucleotide,
In the metabolite, one or more consecutive nucleotides including the nucleotide at the 3' end or 5' end are missing,
the first nucleic acid probe is capable of hybridizing to a portion of the target oligonucleotide that includes a nucleotide that is missing in the metabolite;
the second nucleic acid probe can hybridize to a portion of the target oligonucleotide other than the portion;
the capture probe, target oligonucleotide, and assist probe form a complex;
Method.
[Embodiment 1.2]
When measuring a target oligonucleotide in a sample while distinguishing it from a metabolite lacking one or more nucleotides from its 3' end, the first nucleic acid probe included in the capture probe is 2. The method of embodiment 1, wherein the first spacer is attached to the first spacer via the first spacer.
[Embodiment 1.3]
When measuring a target oligonucleotide in a sample while distinguishing it from a metabolite that is missing one or more nucleotides from its 5' end, the first nucleic acid probe included in the capture probe has a nucleotide missing from its 3' end. 2. The method of embodiment 1, wherein the first spacer is attached to the first spacer via the first spacer.
[Embodiment 2]
A method for detecting a target oligonucleotide in a sample as distinct from a metabolite lacking one or more nucleotides from its 3' or 5' end, comprising the following steps:
(i) A capture probe for capturing the target oligonucleotide and a probe for detecting the target oligonucleotide are applied to a sample containing the target oligonucleotide or a metabolite lacking one or more nucleotides from its 3' or 5' end. contacting the assist probe to form a complex of the capture probe, target oligonucleotide, and assist probe;
here,
The capture probe includes a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe,
The assist probe includes a tag or label and a second nucleic acid probe linked to the tag or label,
The sequence of the first nucleic acid probe is complementary to a partial sequence of the target oligonucleotide, and the partial sequence includes a nucleotide that is missing in the metabolite;
The sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide, and
In a preferred embodiment, the first spacer is attached to a terminal nucleotide of the first nucleic acid probe, and the terminal nucleotide is attached to the metabolite when the target oligonucleotide and the first nucleic acid probe hybridize. base pairs with the terminal nucleotide of the missing target oligonucleotide; and
(ii) detecting the target oligonucleotide in the sample by detecting the complex;
[Embodiment 2.1]
When detecting a target oligonucleotide in a sample separately from a metabolite lacking one or more nucleotides from its 3' end, the first nucleic acid probe connects to the first spacer via the nucleotide at its 5' end. 3. The method of embodiment 2, wherein the first nucleic acid probe has a sequence complementary to a sequence comprising the 3' end of the target oligonucleotide.
[Embodiment 2.2]
When detecting a target oligonucleotide in a sample separately from a metabolite lacking one or more nucleotides from its 5' end, the first nucleic acid probe is attached to the first spacer via the nucleotide at its 3' end. 3. The method of embodiment 2, wherein the first nucleic acid probe has a sequence complementary to a sequence comprising the 5' end of the target oligonucleotide.
[Embodiment 3]
A method of detecting a target oligonucleotide in a sample comprising the steps of:
(i) contacting the sample with a capture probe for capturing the target oligonucleotide and an assist probe for detecting the target oligonucleotide to form a complex of the capture probe, the target oligonucleotide, and the assist probe;
here,
The capture probe includes a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe,
The assist probe includes a tag or label and a second nucleic acid probe linked to the tag or label,
the sequence of the first nucleic acid probe is complementary to a partial sequence of the target oligonucleotide including the terminal nucleotide of the target oligonucleotide;
The sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide, and
In a preferred embodiment, the first spacer is bound to a terminal nucleotide of the first nucleic acid probe, and the terminal nucleotide of the first nucleic acid probe is attached to the target oligonucleotide and the first nucleic acid probe hybridized. base pairing with said terminal nucleotide of the target oligonucleotide; and
(ii) detecting the target oligonucleotide in the sample by detecting the complex;
[Embodiment 3.1]
The sequence of the first nucleic acid probe is complementary to the 3'-side partial sequence of the target oligonucleotide, which includes the 3'-terminal nucleotide of the target oligonucleotide, and the sequence of the second nucleic acid probe is complementary to the 3'-side partial sequence of the target oligonucleotide, which includes the nucleotide at the 3' end of the target oligonucleotide. 4. The method according to embodiment 3, wherein the first spacer is complementary to a sequence other than the 5' side partial sequence, and the first spacer is bound to a nucleotide at the 5' end of the first nucleic acid probe.
[Embodiment 3.2]
The sequence of the first nucleic acid probe is complementary to the 5' partial sequence of the target oligonucleotide, which includes the nucleotide at the 5' end of the target oligonucleotide, and the sequence of the second nucleic acid probe is complementary to the 5' partial sequence of the target oligonucleotide, which includes the nucleotide at the 5' end of the target oligonucleotide. 4. The method according to embodiment 3, wherein the first spacer is complementary to a sequence other than the ' side partial sequence, and the first spacer is bound to a nucleotide at the 3' end of the first nucleic acid probe.
[Embodiment 3.3]
Embodiments 1 to 3.2, wherein the first nucleic acid probe included in the capture probe has a length of 5 bases, 6 bases, 7 bases, 8 bases, 9 bases, 10 bases, or 11 bases. Any method described.
[Embodiment 3.4]
The second nucleic acid probe included in the assist probe is 4 bases long, 5 bases long, 6 bases long, 7 bases long, 8 bases long, 9 bases long, 10 bases long, 11 bases long, 12 bases long, 13 bases long. Base length, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases The method according to any one of embodiments 1 to 3.3, which is: However, in one embodiment, when the first nucleic acid probe included in the capture probe is 11 bases long, the second nucleic acid probe included in the assist probe is Nucleic acid probes are not 4 bases long.
[Embodiment 4]
A method according to any of embodiments 1 to 3.4, wherein the capture probe comprises an adapter between the solid phase and the first spacer.
[Embodiment 5]
5. The method of embodiment 4, wherein the capture probe comprises a second spacer between the solid phase and the adapter.
[Embodiment 6]
6. The method according to embodiment 4 or 5, wherein the adapter is streptavidin or avidin and biotin.
[Embodiment 7]
7. The method of embodiment 6, wherein the binding of streptavidin or avidin to biotin occurs after complex formation of the capture probe, target oligonucleotide, and assist probe.
[Embodiment 8]
8. The method according to any of embodiments 1 to 7, wherein the first spacer is a 5mer to 90mer oligonucleotide.
[Embodiment 8.1]
Further including the following steps,
(i) adding to the complex a pair of self-assembleable signal amplification probes having complementary base sequence regions that can hybridize with each other to form a probe polymer bound to the complex; and
(ii) detecting the probe polymer;
The assist probe is characterized in that it includes a tag having a base sequence complementary to part or all of one signal amplification probe of the pair of self-assembleable signal amplification probes.
The method according to any of embodiments 1-8.
[Embodiment 8.2]
The method according to embodiment 8.1, wherein at least one of the pair of signal amplification probes capable of self-assembly contains a polyT sequence.
[Embodiment 8.3]
The method according to embodiment 8.1 or 8.2, wherein at least one of the pair of signal amplification probes capable of self-assembly is labeled with a labeling substance.
[Embodiment 8.4]
The pair of signal amplification probes capable of self-assembly consists of a first signal amplification probe and a second signal amplification probe,
A nucleic acid in which the first signal amplification probe includes three or more nucleic acid regions, and includes, in order from the 5' end, at least a nucleic acid region X, a nucleic acid region Y, and a nucleic acid region Z or a nucleic acid region Z containing a polyT sequence. is a probe,
The second signal amplification probe includes three or more nucleic acid regions, and in order from the 5' end, a nucleic acid region X' that is complementary to at least the nucleic acid region X, and a nucleic acid region Y that is complementary to the nucleic acid region Y. ', and a nucleic acid region Z' complementary to the nucleic acid region Z' or a nucleic acid region Z' containing a polyA sequence.
The method according to any of embodiments 8.1 to 8.3.
[Embodiment 9]
A detection kit used for detecting a target oligonucleotide, comprising a capture probe, an assist probe, and a pair of signal amplification probes that have complementary base sequence regions that can hybridize with each other and can form a probe polymer by self-assembly. And,
The capture probe includes a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe,
The assist probe includes a tag having a base sequence complementary to part or all of one signal amplification probe in the pair of signal amplification probes, and a second nucleic acid probe linked to the tag. ,
The sequence of the first nucleic acid probe is complementary to a partial sequence of the target oligonucleotide including the terminal nucleotide of the target oligonucleotide, and
The sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide,
In a preferred embodiment, the first spacer is bound to a terminal nucleotide of the first nucleic acid probe, and the terminal nucleotide of the first nucleic acid probe is such that the first spacer is bonded to a terminal nucleotide of the first nucleic acid probe, and the first spacer is bonded to a terminal nucleotide of the first nucleic acid probe. Forms a base pair with the terminal nucleotide of the target oligonucleotide when soyized,
Detection kit.
[Embodiment 10]
10. The detection kit according to embodiment 9, wherein the capture probe includes an adapter between the solid phase and the first spacer.
[Embodiment 11]
11. The detection kit according to embodiment 10, wherein the capture probe includes a second spacer between the solid phase and the adapter.
[Embodiment 12]
The detection kit according to embodiment 10 or 11, wherein the adapter is streptavidin or avidin and biotin.
[Embodiment 13]
13. The detection kit according to embodiment 12, wherein the binding of streptavidin or avidin to biotin occurs after complex formation of the capture probe, target oligonucleotide, and assist probe.
[Embodiment 14]
The detection kit according to any one of embodiments 9 to 13, wherein the first spacer is a 5-mer to 90-mer oligonucleotide.
[Embodiment 14.1]
A detection kit for measuring a target oligonucleotide in a sample while distinguishing it from a metabolite lacking one or more nucleotides from its 3' end, the first nucleic acid probe included in the capture probe comprising: The detection kit according to embodiment 9 or 10, wherein the detection kit is bound to the first spacer via the nucleotide at the 5' end.
[Embodiment 14.2]
A detection kit for measuring a target oligonucleotide in a sample while distinguishing it from a metabolite lacking one or more nucleotides from its 5' end, the first nucleic acid probe included in the capture probe comprising: The detection kit according to embodiment 9 or 10, wherein the detection kit is bound to the first spacer via the nucleotide at the 3' end.
[Embodiment 15]
The detection kit according to any one of embodiments 9 to 14.2, wherein at least one of the pair of signal amplification probes is labeled with a labeling substance.
[Embodiment 16]
The pair of signal amplification probes includes a first signal amplification probe and a second signal amplification probe,
The first signal amplification probe is a nucleic acid probe that includes, in order from the 5' end, at least a nucleic acid region X, a nucleic acid region Y, and a nucleic acid region Z or a nucleic acid region Z containing a poly T sequence,
The second signal amplification probe includes, in order from the 5' end, at least a nucleic acid region X' complementary to the nucleic acid region X, a nucleic acid region Y' complementary to the nucleic acid region Y, and a nucleic acid region complementary to the nucleic acid region Z. A nucleic acid probe containing a nucleic acid region Z′ or a nucleic acid region Z′ containing a polyA sequence,
The detection kit according to any one of embodiments 9 to 15.

According to the present invention, oligonucleotides can be easily detected or quantified with high sensitivity, excellent specificity, and quantitative performance without using enzymes or the like, through a step of only hybridization between probes. In addition, it distinguishes between oligonucleotide metabolites in which the 5' or 3' side of the target oligonucleotide to be measured is deleted and unchanged oligonucleotides, and there is almost no cross-reactivity of metabolites, and only unchanged oligonucleotides are detected. A method for detecting or quantifying oligonucleotides with excellent specificity and quantitative performance can be provided.

FIG. 1 is a diagram showing the principle of a hybridization method (CP-AP method) using a capture probe and an assist probe. FIG. 2 is a diagram showing the structure of LNA and DNA components.

(sample)
The "sample" used in the method of the present invention includes whole blood, serum, plasma, lymph, urine, saliva, lacrimal fluid, sweat, gastric juice, pancreatic juice, and bile of humans, monkeys, dogs, pigs, rats, guinea pigs, or mice. , body fluids such as pleural effusion, joint cavity fluid, cerebrospinal fluid, cerebrospinal fluid, and bone marrow fluid, or tissues such as liver, kidney, lung, and heart. Preferably, the sample is human, monkey, dog, pig, rat, guinea pig, or mouse, preferably human whole blood, serum, plasma, or urine. More preferably, the sample is whole blood, serum, plasma, or urine of a human, monkey, dog, pig, rat, guinea pig, or mouse, preferably a human, who has been administered a medicament containing the target oligonucleotide.

(target oligonucleotide)
As used herein, the term "target oligonucleotide" refers to the intact oligonucleotide to be measured (intact target oligonucleotide/unchanged form). That is, the term "target oligonucleotide" does not include distinguishable metabolites. As used herein, the term "target oligonucleotide" refers to any DNA or RNA, single-stranded or double-stranded oligonucleotide, as long as it can form a specific hybrid with a nucleic acid probe. May be modified. Chemical modifications include phosphorothioate modification (S-modification), 2'-F modification, 2'-O-Methyl (2'-OMe) modification, 2'-O-Methoxyethyl (2'-MOE) modification, morpholino modification, and LNA. modification, BNACOC modification, BNANC modification, ENA modification, cEt BNA modification, etc. When the target oligonucleotide described above is double-stranded, it is used in the present invention as a single-stranded oligonucleotide. The base length of the target oligonucleotide is not limited, but preferably 12mer, 13mer, 14mer, 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, 22mer, 23mer, 24mer, 25mer, 26mer, 27mer. , 28mer, 29mer, or 30mer.

(capture probe)
The "capture probe" used in the present invention is a probe for capturing a target oligonucleotide, and is immobilized or bound to a nucleic acid probe adjacent to a nucleotide at the 3' end or 5' end of the nucleic acid probe. a first spacer that binds to, or connects to, and a solid phase that is adjacent to, immobilized, binds to, or connects to the first spacer.

(assist probe)
The "assist probe" used in the present invention is a probe for detecting a target oligonucleotide, and includes a nucleic acid probe and a tag or label adjacent to a nucleotide at the 5' end or 3' end of the nucleic acid probe.

(Nucleic acid probes included in capture probes and assist probes - Regarding the constituent nucleotides)
The nucleic acid probes contained in the capture probe and the assist probe consist of deoxyribonucleotides or ribonucleotides, and in one embodiment of the present invention, each independently comprises 0, 1, 2, 3, 4, 5, Contains 6, 7, 8, 9, 10, or 11 locked nucleic acids (LNA) (Figure 2). When the nucleic acid probe has a base length of 5mer, the nucleic acid probe preferably contains 5 locked nucleic acids (LNA), and when the nucleic acid probe has a base length of 6mer to 11mer, the nucleic acid probe preferably contains 0. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 locked nucleic acids (LNA).

(Nucleic acid probe - About base length)
In one embodiment, the nucleic acid probe included in the capture probe has a base length of 5mer, 6mer, 7mer, 8mer, 9mer, 10mer, or 11mer. In this embodiment, it was possible to actually distinguish and measure target oligonucleotides in a sample that retain the full-length sequence and metabolites lacking one or more nucleotides from their 3' or 5' ends.
The nucleic acid probe included in the assist probe only needs to be able to bind to a region other than the nucleic acid probe region included in the capture probe. , 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, 22mer, 23mer, 24mer or 25mer base length. In this embodiment, it was possible to actually distinguish and measure target oligonucleotides in a sample that retain the full-length sequence and metabolites lacking one or more nucleotides from their 3' or 5' ends. In another embodiment, the nucleic acid probe included in the assist probe has a base length of 4mer, 5mer, 6mer, 7mer, 8mer, 9mer, 10mer, 11mer, 12mer, 13mer, 14mer, 15mer, or 16mer. In this embodiment, it was possible to actually distinguish and measure target oligonucleotides in a sample that retain the full-length sequence and metabolites lacking one or more nucleotides from their 3' or 5' ends.
However, in one embodiment, an embodiment in which the nucleic acid probe included in the capture probe has a base length of 11 mer and the nucleic acid probe included in the assist probe has a base length of 4 mer is not included in the present invention. In one embodiment, the present invention includes an embodiment in which the nucleic acid probe included in the capture probe has a base length of 10 mer, and the nucleic acid probe included in the assist probe has a base length of 4 mer. In another embodiment, an embodiment in which the nucleic acid probe included in the capture probe has a base length of 10 mer and the nucleic acid probe included in the assist probe has a base length of 4 mer is not included in the present invention.

(contact)
In this specification, the term "contact" or the step of "contacting" refers to the formation of chemical bonds such as covalent bonds, ionic bonds, metallic bonds, and non-covalent bonds between a substance and another substance. This means placing these substances in close proximity to each other so that they can In one embodiment of the present invention, "contacting" a substance and another substance means mixing a solution containing the certain substance and a solution containing the other substance. In the present invention, a complex is formed by bringing a capture probe, a target oligonucleotide, and an assist probe into contact with each other. In one embodiment, the step of contacting the sample with the capture probe and the assist probe includes contacting the sample, the capture probe, and the assist probe at a melting temperature of the target oligonucleotide and the nucleic acid probe contained in the capture probe. +2°C to -10°C, +1°C to -9°C, 0°C to -8°C, -1°C to -7°C, -2°C to -6°C, or -3°C compared to Tm) -5℃, or +10℃, +9℃, +8℃, +7℃, +6℃, +5℃, +4℃, +3℃, +2℃, +1℃, 0℃, - This is done by keeping the temperature at 1℃, -2℃, -3℃, -4℃, -5℃, -6℃, -7℃, -8℃, -9℃, or -10℃ for a certain period of time. . For example, if Tm is 50°C, +2°C to -10°C compared to Tm means 52°C to 40°C. In one embodiment, the heat retention time is 10 seconds to 4 minutes, 20 seconds to 3 minutes, or 30 seconds to 2 minutes, or 10 seconds, 20 seconds, 30 seconds, 40 seconds, 50 seconds, 60 seconds, 70 seconds, 80 seconds, 90 seconds, 100 seconds, 110 seconds, 120 seconds, 130 seconds, 140 seconds, 150 seconds, 160 seconds, 170 seconds, or 180 seconds.

(capture)
In the present invention, when a capture probe "captures" a target oligonucleotide, it primarily means that the nucleic acid probe contained in the capture probe and the target oligonucleotide hybridize. In one embodiment, when the capture probe "captures" the target oligonucleotide, the target oligonucleotide binds to a solid phase included in the capture probe or an adapter via the nucleic acid probe and spacer included in the capture probe. It means to bind indirectly to a solid phase. In the present invention, the capture probe directly captures the target oligonucleotide and further indirectly captures the assist probe via the target oligonucleotide, thereby producing a signal proportional to the amount of the target oligonucleotide in the sample. Can be obtained from assist probes.

(hybridization/hybridization)
In this specification, hybridization of a nucleic acid probe contained in a capture probe or an assist probe to a target oligonucleotide means that a nucleic acid probe contained in a capture probe or an assist probe hybridizes to a single-stranded target oligonucleotide having a specific base sequence, and is complementary to a part of the sequence. It means that single-stranded nucleic acid probes having a sequence of 2-stranded nucleic acid probes combine through base pairing to form a double-stranded nucleic acid molecule.

(complex)
In this specification, when a capture probe, a target oligonucleotide, and an assist probe are used to form a "complex", a part of the nucleic acid probe and the target oligonucleotide contained in the capture probe specifically hybridize, and , means that the nucleic acid probe contained in the assist probe and another part of the target oligonucleotide specifically hybridize to form a trimer. Here, specifically hybridizing between the nucleic acid probe and a part of the target oligonucleotide means that all bases contained in the nucleic acid probe, excluding the spacer and tag, form a pair with the base of the target oligonucleotide. . In one embodiment, all the bases included in the target oligonucleotide form pairs with the bases of the nucleic acid probe included in the capture probe or the bases of the nucleic acid probe included in the assist probe.

(Removal)
When detecting a complex of a capture probe, a target oligonucleotide, and an assist probe, if a signal derived from the free assist probe interferes with the detection, it is preferable to remove the free assist probe. For example, free assist probe can be removed by washing the solid phase contained in the capture probe or the solid phase bound via an adapter contained in the capture probe. In order to wash the solid phase, the liquid phase of the reaction liquid may be separated by centrifuging or filtering the reaction liquid in which the solid phase is suspended. Furthermore, if the solid phase has magnetism, it is also possible to collect the solid phase using a magnet. The solid phase may be washed multiple times if necessary.

(detection)
To "detect" the target oligonucleotide, a tag or label included in the assist probe or a label attached via the tag can be utilized. Furthermore, if the solid phase contained in the capture probe can emit a signal such as fluorescence, the signal can also be used. The signal from the label or solid phase may be any signal as long as it is physically or chemically detectable, but optically detectable signals are preferred in order to achieve high throughput.

(Self-assembly: PALSAR method)
A state in which a plurality of first signal amplification probes form a probe polymer by hybridization with a second signal amplification probe, and a plurality of second signal amplification probes form a probe polymer with a first signal amplification probe. means a state in which a probe polymer is formed by hybridization with

(Pair of signal amplification probes that can self-assemble)
A pair of “self-assembly capable” signal amplification probes used in the method of the present invention has complementary base sequence regions in which the first signal amplification probe and the second signal amplification probe can hybridize with each other. , refers to an oligonucleotide that can form a probe polymer through a self-assembly reaction. Here, "hybridizable" means, in one embodiment, completely complementary in the complementary base sequence region.

It is also possible to label the pair of probes capable of self-assembly with a labeling substance for detection in advance. Preferably, at least one of the first and second signal amplification probes is labeled with a labeling substance. Examples of such labeling substances include radioactive isotopes, biotin, digoxigenin, fluorescent substances, luminescent substances, and dyes. Specifically, radioisotopes such as ¹²⁵ I and ³² P, luminescent/chromogenic substances such as digoxigenin and acridinium ester, luminescent substances such as dioxetane, and fluorescent substances such as 4-methylumbelliferyl phosphate are used. Examples include alkaline phosphatase and biotin for utilizing fluorescent, luminescent, and chromogenic substances bound to avidin. Furthermore, it is also possible to detect the target oligonucleotide by adding a donor fluorescent dye and an acceptor fluorescent dye for utilizing fluorescence resonance energy transfer (FRET).
In one embodiment, the labeling substance is biotin, and the oligonucleotide is labeled by biotinylating the 5' end or 3' end. When the labeling substance is biotin, the substance that specifically binds to the labeling substance is streptavidin or avidin. In one embodiment, the labeling substance is not biotin, and the substance that specifically binds to the labeling substance is not streptavidin or avidin.

A pair of probes capable of self-assembly consisting of first and second signal amplification probes is brought into contact with a complex containing a hybridization product of a target oligonucleotide, a capture probe, and an assist probe according to the present invention. Detection may be performed by binding a complex to a probe polymer consisting of a second signal amplification probe.

In one embodiment, the assist probe used above includes a tag capable of binding to one of a pair of probes capable of self-assembly consisting of first and second signal amplification probes, and the assist probe includes a tag capable of binding to one of a pair of probes capable of self-assembly consisting of first and second signal amplification probes, and binds the target oligonucleotide to the probe polymer. It has the role of assisting. A first aspect of the assist probe includes a tag comprising a sequence complementary to the entire sequence or a partial sequence of at least one of the first or second oligonucleotide, and a tag complementary to the partial sequence of the target oligonucleotide. A probe containing a sequence.

(solid phase)
As used herein, examples of the term "solid phase" include insoluble microparticles, microbeads, fluorescent microparticles, magnetic particles, microplates, microarrays, glass slides, substrates such as electrically conductive substrates, and the like.
In one embodiment of the present invention, the "solid phase" is a fluorescent fine particle, in another embodiment, a fluorescent bead, and in yet another embodiment, a bead having a fluorescent substance on its surface. The "beads having a fluorescent substance on their surface" used in the present invention are not particularly limited as long as they have a fluorescent substance, and for example, MicroPlex ^™ Microspheres manufactured by Luminex can be suitably used. One type of bead can be used, or multiple types of beads can be used. By using multiple types of color-coded beads, the oligonucleotide quantification method of the present invention can be easily multiplexed.
In one embodiment of the invention, the "solid phase" is a microplate. Materials for the microplate used in the present invention include, but are not limited to, polystyrene, polypropylene, polycarbonate, and cyclic olefin copolymers. In one embodiment of the present invention, the microplate includes a biotin coated plate, a protein A, G, A/G, and/or L coated plate, an anti-GST antibody coated plate, a glutathione, nickel, and/or copper coated plate. , amine- and/or sulfhydryl-bound plates, carboxylated plates, and coated plates such as streptavidin-coated plates.
In one embodiment, the solid phase is not an insoluble microparticle, not a microbead, not a fluorescent microparticle, not a magnetic particle, not a microplate, not a microarray, not a glass slide, or a substrate such as an electrically conductive substrate. etc. Not.

(adapter)
Examples of the "adapter" used in the present invention include biotin, streptavidin or avidin, and combinations thereof, antigens, antibodies, and combinations thereof, preferably biotin, streptavidin or avidin, and combinations thereof. etc. In one embodiment, the adapter is not a nucleic acid such as an oligonucleotide or nucleotide, biotin, streptavidin or avidin, and combinations thereof, an antigen, an antibody, and a combination thereof, such as Spacer 9, Spacer 12, Spacer 18, Spacer C3, etc. It is not a compound having an amino group or a carboxyl group, such as a spacer. In another embodiment, the adapter does not include nucleic acids such as oligonucleotides or nucleotides. Furthermore, in one embodiment, streptavidin or avidin is immobilized directly to a solid phase. In another embodiment, streptavidin or avidin is not directly immobilized on a solid phase. For example, in one such embodiment, streptavidin or avidin is immobilized to the solid phase via a (second) spacer.

(spacer)
Examples of the "spacer" used in the present invention include nucleic acids such as oligonucleotides and nucleotides, compounds having an amino group or carboxyl group such as spacers such as Spacer 9, Spacer 12, Spacer 18, and Spacer C3, etc., and are preferably is 5'-Amino-Modifier C12 (12-(4-Monomethoxytritylamino)dodecyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite), etc. For example, in an embodiment in which a nucleic acid probe that has a carboxyl group on the bead surface and a compound with an amino group attached thereto binds to the carboxyl group on the bead surface via the amino group, the compound that has an amino group is an example of a spacer. In one embodiment, the spacer is not a nucleic acid such as an oligonucleotide or a nucleotide, is not biotin, is not a compound having an amino group or a carboxyl group, such as spacers such as Spacer 9, Spacer 12, Spacer 18, Spacer C3, etc. In another embodiment, the spacer does not include a nucleic acid such as an oligonucleotide or nucleotide. Furthermore, in one embodiment, the first spacer is immobilized directly to the solid phase. Furthermore, in another embodiment, the first spacer is not directly immobilized on the solid phase. For example, in another such embodiment, the first spacer is immobilized to the solid phase via biotin, streptavidin or avidin, and combinations thereof.
When the spacer is an oligonucleotide, the base length of the oligonucleotide is 4mer to 130mer, 5mer to 90mer, 7mer to 50mer, 10mer to 40mer, 15mer to 30mer, or 4mer, 5mer, 6mer, 7mer, 8mer, 9mer, 10mer, 11mer, 12mer, 13mer, 14mer, 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, 22mer, 23mer, 24mer, 25mer, 26mer, 27mer, 28mer, 29mer, 30mer, 31mer, 32mer, 33mer, 34mer, 35mer, 36mer, 37mer, 38mer, 39mer, 40mer, 41mer, 42mer, 43mer, 44mer, 45mer, 46mer, 47mer, 48mer, 49mer, 50mer, 51mer, 52mer, 53mer, 54mer, 55mer, 56mer, 57mer, 58mer, 59mer, 60mer, 61mer, 62mer, 63mer, 64mer, 65mer, 66mer, 67mer, 68mer, 69mer, 70mer, 71mer, 72mer, 73mer, 74mer, 75mer, 76mer, 77mer, 78mer, 79mer, 80mer, 81mer, 82mer, 83mer, 84mer, 85mer, 86mer, 87mer, 88mer, 89mer, 90mer, 91mer, 92mer, 93mer, 94mer, 95mer, 96mer, 97mer, 98mer, 99mer, 100mer, 101mer, 102mer, 103mer, 104mer, 105mer, 106mer, 107mer, 108mer, 109mer, 110mer, 111mer, 112mer, 113mer, 114mer, 115mer, 116mer, 117mer, 118mer, 119mer, 120mer, 121mer, 122mer, 123mer, 124mer, 125mer, 126mer, 127mer, 128mer, 129mer, or 130mer.

(tag or sign)
The "tag" included in the assist probe includes a polyA sequence, a polyT sequence, a polyU sequence, a poly(T/U) sequence, a polyG sequence, a polyC sequence, and any specific sequence or Nucleic acids consisting of these can be mentioned. The base length of the nucleic acid tag is 5mer to 115mer, 10mer to 110mer, 15mer to 105mer, 20mer to 100mer, 25mer to 95mer, 30mer to 90mer, 35mer to 85mer, 40mer to 80mer, 45mer to 75mer. Below, 50mer to 70mer, or 55mer to 65mer, or 5mer, 6mer, 7mer, 8mer, 9mer, 10mer, 11mer, 12mer, 13mer, 14mer, 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, 22mer , 23mer, 24mer, 25mer, 26mer, 27mer, 28mer, 29mer, 30mer, 31mer, 32mer, 33mer, 34mer, 35mer, 36mer, 37mer, 38mer, 39mer, 40mer, 41mer, 42mer, 43mer, 44mer, 45mer, 46mer, 47mer , 48mer, 49mer, 50mer, 51mer, 52mer, 53mer, 54mer, 55mer, 56mer, 57mer, 58mer, 59mer, 60mer, 61mer, 62mer, 63mer, 64mer, 65mer, 66mer, 67mer, 68mer, 69mer, 70mer, 71mer, 72mer , 73mer, 74mer, 75mer, 76mer, 77mer, 78mer, 79mer, 80mer, 81mer, 82mer, 83mer, 84mer, 85mer, 86mer, 87mer, 88mer, 89mer, 90mer, 91mer, 92mer, 93mer, 94mer, 95mer, 96mer, 97mer , 98mer, 99mer, 100mer, 101mer, 102mer, 103mer, 104mer, 105mer, 106mer, 107mer, 108mer, 109mer, 110mer, 111mer, 112mer, 113mer, 114mer, or 115mer. In one embodiment, the tag or label does not include a nucleic acid such as an oligonucleotide or nucleotide. Examples of the "label" included in the assist probe include radioactive isotopes, biotin, digoxigenin, fluorescent substances, luminescent substances, or dyes. Specifically, radioisotopes such as ¹²⁵ I and ³² P, luminescent/chromogenic substances such as digoxigenin and acridinium ester, luminescent substances such as dioxetane, and fluorescent substances such as 4-methylumbelliferyl phosphate are used. Examples include alkaline phosphatase and biotin for utilizing fluorescent, luminescent, and chromogenic substances bound to avidin. Furthermore, it is also possible to detect the target oligonucleotide by adding a donor fluorescent dye and an acceptor fluorescent dye for utilizing fluorescence resonance energy transfer (FRET). In one embodiment, the label may be included in another nucleic acid molecule that hybridizes to the nucleic acid tag included in the assist probe. In one embodiment, the "label" included in the assist probe is not a radioactive isotope, biotin, digoxigenin, fluorescent substance, luminescent substance, dye, or the like. Particularly when using biotin, streptavidin or avidin, and combinations thereof as adapters, in one embodiment the "label" included in the assist probe is not biotin.

(adjacent)
The term "adjacent", "immobilized", "bonded", or "linked" with the first spacer or tag or label to the nucleotide at the 5' end or 3' end of the nucleic acid probe is primarily defined as means that the first spacer or tag or label is directly attached to the nucleotide. For example, if the first spacer or tag or label is attached to the nucleotide via some molecule, then that molecule itself can be considered the first spacer or tag or label; can be considered to form part of the first spacer or tag or label. The solid phase may be attached to the first spacer and the nucleic acid probe via an adapter.

(Nucleic acid probe - Regarding the relationship with target oligonucleotides and their metabolites)
In the present invention, metabolites refer to the 3' end and/or
Or, it refers to an oligonucleotide lacking at least one nucleotide from the 5' end.
In one embodiment of the present invention, the metabolite of the target oligonucleotide is missing one or more nucleotides from the 3' end, and the sequence of the "nucleic acid probe" included in the capture probe is the nucleotide at the 3' end of the target oligonucleotide. The sequence of the "nucleic acid probe" included in the assist probe is complementary to a sequence other than the partial sequence of the target oligonucleotide. In this embodiment, the first spacer included in the capture probe is adjacent to the nucleotide at the 5' end of the nucleic acid probe included in the capture probe, and the tag or label included in the assist probe is adjacent to the nucleotide at the 3' end of the nucleic acid probe included in the assist probe. adjacent to the nucleotide.
In another embodiment of the invention, the metabolite of the target oligonucleotide is missing one or more nucleotides from the 5' end, and the sequence of the "nucleic acid probe" included in the capture probe is It is complementary to a partial sequence of the target oligonucleotide containing nucleotides, and the sequence of the "nucleic acid probe" included in the assist probe is complementary to a sequence other than the partial sequence of the target oligonucleotide. In this embodiment, the first spacer included in the capture probe is adjacent to the nucleotide at the 3' end of the nucleic acid probe included in the capture probe, and the tag or label included in the assist probe is adjacent to the nucleotide at the 5' end of the nucleic acid probe included in the assist probe. adjacent to the nucleotide.
Note that in this specification, for convenience, the "nucleic acid probe" included in the capture probe may be referred to as the "first nucleic acid probe" and the "nucleic acid probe" included in the assist probe may be referred to as the "second nucleic acid probe." be.
The first nucleic acid probe included in the capture probe and the second nucleic acid probe included in the assist probe may be adjacent to each other (without a gap) when hybridized to the target oligonucleotide; 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, (with gaps of 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides). In one embodiment of the present invention, the first nucleic acid probe included in the capture probe and the second nucleic acid probe included in the assist probe have 1 to 21 nucleotides, 1 to 16 nucleotides when hybridized to the target oligonucleotide. Not adjacent with gaps of nucleotides, 1-11 nucleotides, or 1-7 nucleotides.
When the first nucleic acid probe included in the capture probe and the second nucleic acid probe included in the assist probe hybridize to the target oligonucleotide, they form gaps between each other (3, 6, 9, 11, and 12 nucleotide gaps). actually distinguish and measure target oligonucleotides that retain the full-length sequence in the sample, even if they are not contiguous (accompanied by I was able to do it. 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1- Those skilled in the art will appreciate that the presence of gaps of 14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20, or 1-21 nucleotides is not a practical problem. Dew.
Another aspect of the case where there is a gap between the first nucleic acid probe included in the capture probe and the second nucleic acid probe included in the assist probe is that the first nucleic acid probe included in the capture probe and the second nucleic acid probe included in the assist probe Blocking probes that flank each of the second nucleic acid probes and hybridize to gap sites on the target oligonucleotide may be used. It will be understood by those skilled in the art that in such embodiments, there may be a gap between the first nucleic acid probe and the blocking probe and/or between the second nucleic acid probe and the blocking probe.

(complementary - for capture probes)
When a nucleic acid probe contained in a capture probe is "complementary" to a sequence on the 3' side (5' side) of a target oligonucleotide, it is preferably a sequence that includes the nucleotides at the 3' end (5' end) of the target oligonucleotide. This means that the sequence of the nucleic acid probe is completely complementary to the nucleotide sequence of the nucleic acid probe. The length of this fully complementary sequence is preferably the same as the base length of the nucleic acid probe contained in the capture probe. However, in one embodiment, the nucleic acid probe has an additional nucleotide at the 5' end (3' end) in addition to the part that is completely complementary to the 3' side (5' side) sequence of the target oligonucleotide. be able to. It will be readily appreciated that there is no partner on the target oligonucleotide with which to form a pair or mismatch for the additional nucleotide. The additional nucleotides can also be considered to constitute part or all of the solid phase or adapter or spacer adjacent to the nucleotide at the 5' end (3' end) of the nucleic acid probe. Additionally, in one embodiment, one skilled in the art can introduce artificial mutations into the sequence of a nucleic acid probe, provided that the nucleic acid probe can preferentially bind to the target oligonucleotide compared to metabolites. be understood. Replace the words in parentheses as appropriate.

(About Complementary - Assist Probe)
When the nucleic acid probe contained in the assist probe is said to be "complementary" to the 5'(3') sequence of the target oligonucleotide, it is preferably a continuous sequence that includes the 5'(3') nucleotides of the target oligonucleotide. This means that the sequence of the nucleic acid probe is completely complementary to the nucleotide sequence of the nucleic acid probe. The length of this completely complementary sequence is preferably the same as the base length of the nucleic acid probe contained in the assist probe. However, in one embodiment, the nucleic acid probe has an additional nucleotide at the 3' end (5' end) in addition to the part that is completely complementary to the 5' side (3' side) sequence of the target oligonucleotide. be able to. It will be readily appreciated that there is no partner on the target oligonucleotide with which to form a pair or mismatch for the additional nucleotide. The additional nucleotides can also be considered to constitute part or all of the tag adjacent to the nucleotide at the 3' end (5' end) of the nucleic acid probe. It will also be understood by those skilled in the art that in one embodiment, artificial mutations can be introduced into the sequence of the nucleic acid probe. Replace the words in parentheses as appropriate.

[Example 1] Verification of the effect of inserting a spacer between the solid phase included in the capture probe and the nucleic acid probe
1. Materials and methods
(1) Target nucleic acid PT1 was used as the target nucleic acid to be measured. As a metabolite model nucleic acid of the target nucleic acid, a nucleic acid PT1-3n-1 with one base deleted at the 3' end was used. Nucleic acid was synthesized by Japan Gene Research Institute (HPLC purification grade). The above target nucleic acid is completely S-modified (phosphorothioate), similar to the general structure of antisense nucleic acids, which are one of the nucleic acid medicines, and PT1 has three bases each from the 5' and 3' ends. has been replaced by LNA. Furthermore, for PT1-3n-1, 3 bases from the 5' end and 2 bases from the 3' end were replaced with LNA. Both PT1 and PT1-3n-1 were adjusted to 1, 2, 10, or 100 ng/ml using Nuclease free water containing 0.01% Tween20. A blank sample containing no PT1 or PT1-3n-1 was also prepared.
<Base sequence of PT1>
5'-A(L)^G(L)^A(L)^G^C^T^G^A^C^T^T^G^A^T(L)^G(L)^5( L)-3' (base part is SEQ ID NO: 1)
<Base sequence of PT1-3n-1>
5'-A(L)^G(L)^A(L)^G^C^T^G^A^C^T^T^G^A^T(L)^G(L)-3' (The base part is SEQ ID NO. 2)
*(L)=LNA, 5=substituted with 5-Methyl-Cytosine, ^=indicates phosphorothioate.

(2) Preparation of capture probe
(2-1) When using an ECL plate [plate-ECL series] as a solid phase. A nucleic acid probe with a complementary base sequence [called CP-sp0-B] or a 15-mer oligonucleotide spacer [called CP-sp15-B] is plated via biotin modification at the 5' end. The capture probes were each prepared by binding to the top [referred to as plate-ECL-sp0, plate-ECL-sp15, respectively]. The reaction was performed in Thermomixer comfort (Eppendorf) with 1×PBS-TP [1×PBS [137mM Sodium Chloride, 8.1mM Disodium Phosphate, 2.68mM Potassium Chloride, 1.47mM Potassium Dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300. ] 10 pmol of the nucleic acid probe was added to 100 μL and reacted at 37° C. for 30 minutes with stirring (700 rpm). After washing twice with 200 μL of 1×PBS-TP, 150 μL of 3% Blocker A (MSD, product number: R93BA-4) was added and reacted at 37° C. for 1 hour (700 rpm). Thereafter, it was washed three times with 200 μL of 1×PBS-TP.
<Base sequence of CP-sp0-B>
5'-(biotin)GCATCAAGT-3' (base part is SEQ ID NO: 3)
<Base sequence of CP-sp15-B>
5'-(biotin) AGAGTGGTTGTGGTA GCATCAAGT-3' (base part is SEQ ID NO: 4)
*The underlined part indicates the first spacer part.

(2-2) When using ELOSA plates [plate-Elo1 series] as the solid phase Pierce (registered trademark) NeutrAvidin (registered trademark) Coated 96-Well Plates (Thermo Fisher Scientific/product number: 15129) as the solid phase The nucleic acid probe CP-sp0-B with a base sequence complementary to the 3' side of PT1 or CP-sp15-B containing a 15mer oligonucleotide spacer was added onto the plate via biotin modification of the 5' end. The capture probes were prepared by binding [referred to as plate-Elo1-sp0 and plate-Elo1-sp15, respectively]. The reaction was performed in Thermomixer comfort (Eppendorf) with 1×PBS-TP [1×PBS [137mM Sodium Chloride, 8.1mM Disodium Phosphate, 2.68mM Potassium Chloride, 1.47mM Potassium Dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300. ] 10 pmol of nucleic acid probe was added to 100 μL and reacted at 37° C. for 30 minutes (700 rpm). After washing twice with 200 μL of 1×PBS-TP, 150 μL of 3% Blocker A (MSD/product number: R93BA-4) was added and reacted at 37° C. for 1 hour (700 rpm). Thereafter, it was washed three times with 200 μL of 1×PBS-TP.

(2-3) When using ELOSA plate [plate-Elo2 series] as a solid phase Nunc immobilizer Streptavidin F96 CLEAR (Thermo Fisher Scientific/ Product number: 436020) was modified with biotin at the 5' end of the nucleic acid probe CP-sp0-B, which has a complementary base sequence to the 3' side of PT1, or CP-sp15-B, which contains a 15mer oligonucleotide spacer. The capture probes were each prepared by binding onto the plate via [referred to as plate-Elo2-sp0 and plate-Elo2-sp15, respectively]. The reaction was performed in Thermomixer comfort (Eppendorf) with 1×PBS-TP [1×PBS [137mM Sodium Chloride, 8.1mM Disodium Phosphate, 2.68mM Potassium Chloride, 1.47mM Potassium Dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300. ] 10 pmol of nucleic acid probe was added to 100 μL and reacted at 37° C. for 30 minutes (700 rpm). After washing twice with 200 μL of 1×PBS-TP, 150 μL of 3% Blocker A (MSD/product number: R93BA-4) was added and reacted at 37° C. for 1 hour (700 rpm). Thereafter, it was washed three times with 200 μL of 1×PBS-TP.

(2-4) When polystyrene beads [beads-1 series] are used as the solid phase A base complementary to the 3' side of PT1 is added to the solid phase MicroPlex Microspheres (Luminex, product number: LC10015-01). Capture probes were prepared by binding a nucleic acid probe CP-sp0-B with the sequence or CP-sp15-B containing a 15-mer oligonucleotide spacer onto beads via biotin modification at the 5' end [respectively, called beads-1-sp0 and beads-1-sp15].

(2-5) When polystyrene beads [beads-2 series] are used as the solid phase A base complementary to the 3' side of PT1 is added to the solid phase MicroPlex Microspheres (Luminex, product number: LC10015-01). A nucleic acid probe with the sequence [called CP-sp0-N] or a nucleic acid probe containing a 15mer oligonucleotide spacer [called CP-sp15-N] is attached to the beads via _NH2 modification at the 5' end. [referred to as beads-2-sp0 and beads-2-sp15, respectively].
<Base sequence of CP-sp0-N>
5'-(NH ₂ )GCATCAAGT-3' (base part is SEQ ID NO: 3)
<Base sequence of CP-sp15-N>
5'-(NH ₂ ) AGAGTGGTTGTGGTA GCATCAAGT-3' (base part is SEQ ID NO: 4)
*The underlined part indicates the first spacer part.

(3) Capture of target nucleic acid to capture probe ( ^1st Hybridization reaction)
(3-1) When using an ECL plate [plate-ECL series] as a solid phase Add 40 μL of 1st Hybridization reaction solution to 10 μL of target nucleic acid, target nucleic acid metabolite model nucleic acid, or blank sample to make a total of 50 μL, and add 40 μL of 1st Hybridization reaction solution to 10 μL of target nucleic acid, target nucleic acid metabolite model nucleic acid, or blank sample to make a total of 50 μL. Eppendorf) for 1 hour (700 rpm) at 25°C. The reaction was carried out at 25°C for 1 hour.
(3-1-1) Composition of ^1st Hybridization reaction solution
5M TMAC (tetramethylammonium chloride) 15μL, 10× supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8.0% N-lauroylsarcosine sodium] 7.5μL, 12.5% PEG8000 (polyethylene glycol) 10μL, RNase Free water 6.5μL, 100 fmol/ml Assist probe (AP-1 with complementary base sequence to the 5' side of PT1 with poly A chain added) 1μL
<Base sequence of AP-1>
5'-5(L)A(L)G(L)5(L)T(L)5(L)AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3' (base part is SEQ ID NO. 5)

(3-2) When using ELOSA plate [plate-Elo1 series] [plate-Elo2 series] as a solid phase Add 90 μL of 1st Hybridization reaction solution to 10 μL of target nucleic acid, target nucleic acid metabolite model nucleic acid, or blank sample and count. The volume was adjusted to 100 μL, and the reaction was carried out for 25.1 hours (700 rpm) using Thermomixer comfort (Eppendorf).
(3-2-1) Composition of ^1st Hybridization reaction solution
5M TMAC (tetramethylammonium chloride) 30μL, 10× supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8.0% N-lauroylsarcosine sodium] 15μL, 12.5% PEG8000 (polyethylene glycol) 20μL , RNase Free water 24μL, 100 fmol/ml Assist probe (AP-1 (SEQ ID NO: 5), which has a complementary base sequence to the 5' side of PT1 with a poly A chain added) 1μL

(3-3) When polystyrene beads [beads-1 series] [beads-2 series] are used as the solid phase Add 25 μL of the 1st Hybridization reaction solution to 10 μL of the target nucleic acid, target nucleic acid metabolite model nucleic acid, or blank sample and count. The volume was adjusted to 35 μL, and the reaction was carried out at 25° C. for 1 hour using a thermal cycler (Eppendorf).
(3-3-1) Composition of 1 ^st Hybridization reaction solution 0.4 μL (800 pieces) of the supplementary probe solidified in (2) above, 10.5 μL of 5M TMAC (tetramethylammonium chloride), 10× supplement [500mM Tris-HCl] (pH8.0), 40mM EDTA (pH8.0), 8.0% N-lauroylsarcosine sodium] 5.25μL, 17.5% PEG8000 (polyethylene glycol) 5μL, RNase Free water 2.85μL, 100 fmol/ml Assist probe
(AP-1 (SEQ ID NO: 5), which has a complementary base sequence to the 5' side of PT1 with a poly A chain added) 1 μL

(4) Signal amplification by PALSAR reaction
(4-1) When using ECL plate [plate-ECL series] as solid phase
30 μL of the PALSAR reaction solution was added to 50 μL of the reaction solution after the 1st Hybridization reaction to make a total of 80 μL, and the mixture was reacted at 25° C. for 1 hour in a Thermomixer comfort (Eppendorf). The sequences of a pair of self-aggregating probes (also called signal amplification probes) used in the PALSAR reaction are the following HCP-1-C3 and HCP-2-C3, which are labeled with cyanine3 (C3) at the 5' end. be.
<Base sequence of HCP-1-C3>
5'-(C3)CAACAATCAGGACGATACCGATGAAGTTTTTTTTTTTTTTTTTT-3' (base part is SEQ ID NO: 6)
<Base sequence of HCP-2-C3>
5'-(C3)GTCCTGATTGTTGCTTCATCGGTATCAAAAAAAAAAAAAAAAAAAA-3' (base part is SEQ ID NO: 7)
(4-1-1) Composition of PALSAR reaction solution
Nuclease-Free Water 5.1μL, 5M TMAC 4.5μL, 10× supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8% N-lauroylsarcosine sodium] 2.25μL, 20pmol/μL HCP-1-C3 1.75μL, 20pmol/μL HCP-2-C3 1.4μL

(4-2) When using ELOSA plates [plate-Elo1 series] [plate-Elo2 series] as the solid phase
50 μL of the PALSAR reaction solution was added to 100 μL of the reaction solution after the 1st Hybridization reaction to make a total of 150 μL, and the mixture was reacted at 25° C. for 1 hour (700 rpm) in a Thermomixer comfort (Eppendorf). The sequences of a pair of self-aggregating probes (also called signal amplification probes) used in the PALSAR reaction are the following HCP-1-D and HCP-2-D, whose 5' ends are labeled with digoxigenin (Dig). be.
<Base sequence of HCP-1-D>
5'-(Dig)CAACAATCAGGACGATACCGATGAAGTTTTTTTTTTTTTTTTTT-3' (base part is SEQ ID NO: 6)
<Base sequence of HCP-2-D>
5'-(Dig)GTCCTGATTGTTGCTTCATCGGTATCAAAAAAAAAAAAAAAAAAAA-3' (base part is SEQ ID NO: 7)
(4-2-1) Composition of PALSAR reaction solution
Nuclease-Free Water 24.35μL, 5M TMAC 15μL, 10× supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8% N-lauroylsarcosine sodium] 7.5μL, 20pmol/μL HCP -1-D 1.75μL, 20pmol/μL HCP-2-D 1.4μL

(4-3) When using polystyrene beads [beads-1 series] as the solid phase
15 μL of the PALSAR reaction solution was added to 35 μL of the reaction solution after the 1st Hybridization reaction to make a total of 50 μL, and the mixture was reacted at 25° C. for 1 hour in a thermal cycler (Eppendorf). The sequences of a pair of self-aggregating probes (also referred to as signal amplification probes) used in the PALSAR reaction are HCP-1-C3 (SEQ ID NO: 6) and HCP-2 labeled with cyanine3 (C3) at the 5' end. -C3 (SEQ ID NO: 7).
(4-3-1) Composition of PALSAR reaction solution
Nuclease-Free Water 5.1μL, 5M TMAC 4.5μL, 10× supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8% N-lauroylsarcosine sodium] 2.25μL, 20pmol/μL HCP-1-C3 1.75μL, 20pmol/μL HCP-2-C3 1.4μL

(4-4) When using polystyrene beads [beads-2 series] as the solid phase
15 μL of the PALSAR reaction solution was added to 35 μL of the reaction solution after the 1st Hybridization reaction to make a total of 50 μL, and the mixture was reacted at 25° C. for 1 hour in a thermal cycler (Eppendorf). The sequences of a pair of probes capable of self-aggregation (also referred to as signal amplification probes) used in the PALSAR reaction are HCP-1-D (SEQ ID NO: 6) and HCP-2, which are labeled with digoxigenin (Dig) at the 5' end. -D (sequence number 7).
(4-3-1) Composition of PALSAR reaction solution
Nuclease-Free Water 4.6μL, 5M TMAC 4.5μL, 10× supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8% N-lauroylsarcosine sodium] 2.75μL, 20pmol/μL HCP-1-D 1.75μL, 20pmol/μL HCP-2-D 1.4μL

(5) Detection
(5-1) When using an ECL plate [plate-ECL series] as the solid phase
After the PALSAR reaction was completed, it was washed twice with 200 μL of 1×PBS-TP. After that, anti-Dig-Fab antibody-Ru (MSD SULFO-TAG NHS-Ester; MSD, manufacturing number: R91AO-1, Anti-DIG, Fab fragments from sheep; Roche, manufacturing number: 11214667001) 0.25 μL, 3% Blocker A 16.7 μL, and Nuclease-Free Water 33.1 μL were added, and the mixture was reacted at 25° C. for 1 hour (700 rpm) in a Thermomixer comfort. After washing again three times with 200 μL of 1× PBS-TP, add 150 μL of MSD GOLD Read Buffer A (MSD/manufacturing number: R92TG-2) diluted 2 times with Nuclease-Free Water, and add MESO QuickPlex SQ 120MM. The positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using a measuring device (MSD).

(5-2) When using ELOSA plates [plate-Elo1 series] [plate-Elo2 series] as the solid phase
After the PALSAR reaction was completed, it was washed three times with 200 μL of 1×PBS-TP. After that, 100 μL of anti-Dig-HRP antibody (R&D systems/manufacturing number: HAM7520) diluted 10,000 times with 1× PBS-TP containing 1% BSA was added, and the mixture was heated at 25°C in a Thermomixer comfort for 1 hour (700 rpm). ) reacted. After washing 3 times with 200 μL of 1× PBS-TP, add 100 μL of luminescent substrate solution (KPL SureBlue Reserve TMB Microwell Peroxidase Substrate; seracare/manufacturing number: 5120-0083) and wash again 3 times with 200 μL of 1× PBS-TP. After that, 100 uL of reaction stop solution (1M sulfuric acid/manufacturing number: 198-09595) was added. The positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using TECAN infinite50R; 50-620 nm wavelength (TECAN).

(5-3) When using polystyrene beads [beads-1 series] as the solid phase
After the PALSAR reaction, the reaction solution was washed twice with 1×PBS-TP [1×PBS [137mM Sodium Chloride, 8.1mM Disodium Phosphate, 2.68mM Potassium Chloride, 1.47mM Potassium Dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300] did.
Thereafter, 75 μL of 1×PBS-TP was added, and the positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using Luminex System (Luminex).

(5-4) When using polystyrene beads [beads-2 series] as the solid phase
After the PALSAR reaction was completed, the cells were washed once with 1×PBS-TP [1×PBS [137mM Sodium Chloride, 8.1mM Disodium Phosphate, 2.68mM Potassium Chloride, 1.47mM Potassium Dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300]. Add 50 μL of detection reagent (SAPE; Streptavidin-R-Phycoerythrin, Prozyme Co., Ltd./manufacturing number: PJ31S-1) at 5 μg/mL, leave it at 25°C for 10 minutes in the dark, and wash twice with 1× PBS-TP. . Thereafter, 75 μL of 1×PBS-TP was added, and the positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using Luminex System (Luminex).

2. Results
(1) Study using ECL plate [plate-ECL series] as solid phase Using capture probe plate-ECL-sp0 without the first spacer and capture probe plate-ECL-sp15 with the first spacer, Table 1 shows the cross-reactivity when measuring target nucleic acid and metabolite models. When plate-ECL-sp0 without the first spacer was used as the capture probe, the average cross-reactivity was 44.0%, whereas when plate-ECL-sp15 with the first spacer was used as the capture probe. The average reactivity was less than 1%. This indicates that cross-reactivity can be significantly suppressed by inserting the first spacer into the capture probe.

交差反応性(%)=[代謝物モデル核酸(PS-BG)] / [標的核酸(PS-BG)]×100

Cross-reactivity (%) = [metabolite model nucleic acid (PS-BG)] / [target nucleic acid (PS-BG)] × 100

(2) Study using ELOSA plate [plate-Elo1 series] as a solid phase Using the capture probe plate-Elo1-sp0 without the first spacer and the capture probe plate-Elo1-sp15 with the first spacer, Table 2 shows the cross-reactivity when measuring target nucleic acid and metabolite models. When plate-Elo1-sp0 without the first spacer was used as the complementary probe, the average cross-reactivity was 111.8%, whereas when plate-Elo1-sp15 with the first spacer was used as the complementary probe. The average reactivity was 3.9%. This indicates that cross-reactivity can be significantly suppressed by inserting the first spacer into the capture probe.

交差反応性(%)=[代謝物モデル(PS-BG)] / [標的核酸(PS-BG)]×100

Cross-reactivity (%) = [metabolite model (PS-BG)] / [target nucleic acid (PS-BG)] × 100

(3) Study using ELOSA plate [plate-Elo2 series] as a solid phase Using the capture probe plate-Elo2-sp0 without the first spacer and the capture probe plate-Elo2-sp15 with the first spacer, Table 3 shows the cross-reactivity when measuring target nucleic acid and metabolite models. When plate-Elo2-sp0 without the first spacer was used as the complementary probe, the average cross-reactivity was 55.5%, whereas when plate-Elo2-sp15 with the first spacer was used as the complementary probe. The gender average was less than 1%, indicating that cross-reactivity can be significantly suppressed by inserting the first spacer into the capture probe.

交差反応性(%)=[代謝物モデル(PS-BG)] / [標的核酸(PS-BG)]×100

Cross-reactivity (%) = [metabolite model (PS-BG)] / [target nucleic acid (PS-BG)] × 100

交差反応性(%)=[代謝物モデル(PS-BG)] / [標的核酸(PS-BG)]×100 (4) Study using polystyrene beads [beads-1 series] as a solid phase Using the first capture probe beads-1-sp0 without a spacer and the capture probe beads-1-sp15 with a first spacer, Table 4 shows the cross-reactivity when measuring target nucleic acid and metabolite models. When using beads-1-sp0 without the first spacer as the complementary probe, the average cross-reactivity was 29.1%, compared to 29.1% when using beads-1-sp15 with the first spacer. The average reactivity was 3.7%. This indicates that cross-reactivity can be significantly suppressed by inserting the first spacer into the capture probe.

Cross-reactivity (%) = [metabolite model (PS-BG)] / [target nucleic acid (PS-BG)] × 100

(5) Study using polystyrene beads [beads-2 series] as a solid phase Using the first capture probe beads-2-sp0 without a spacer and the capture probe beads-2-sp15 with a first spacer, Table 5 shows the cross-reactivity when measuring target nucleic acid and metabolite models. When using beads-2-sp0 without the first spacer as the complementary probe, the average cross-reactivity was 1.6%, compared to 1.6% when using beads-2-sp15 with the first spacer. The average reactivity was less than 1%. This indicates that cross-reactivity can be suppressed by inserting the first spacer into the capture probe.

交差反応性(%)=[代謝物モデル(PS-BG)] / [標的核酸(PS-BG)]×100

Cross-reactivity (%) = [metabolite model (PS-BG)] / [target nucleic acid (PS-BG)] × 100

[Example 2] Examination of the length of the spacer between the solid phase included in the capture probe and the nucleic acid probe
1. Materials and methods
(1) Target nucleic acid The target nucleic acid PT1 (SEQ ID NO: 1) used in Example 1 and the metabolite model nucleic acid of the target nucleic acid (nucleic acid with one base deleted at the 3' end) PT1-3n-1 (SEQ ID NO: 2). Using. Both PT1 and PT1-3n-1 were adjusted to 10 ng/ml using Nuclease free water containing 0.01% Tween20. A blank sample containing no PT1 or PT1-3n-1 was also prepared.

(2) Preparation of capture probe A spacer with a base sequence complementary to the 3' side of PT1 was added to the solid phase MSD GOLD 96-well Small Spot SA SECTOR (MSD/product number: L45SA-1). Nucleic acid probe CP-sp0-B without, or CP-sp5-B, CP-sp10-B, CP-sp15- containing 5, 10, 15, 20, 25, 30, 50, and 90mer oligonucleotide spacers, respectively. B, Capture probe by binding CP-sp20-B, CP-sp25-B, CP-sp30-B, CP-sp50-B, and CP-sp90-B onto the plate via biotin modification at the 5' end. were adjusted respectively. The reaction was performed in Thermomixer comfort (Eppendorf) with 1×PBS-TP [1×PBS [137mM Sodium Chloride, 8.1mM Disodium Phosphate, 2.68mM Potassium Chloride, 1.47mM Potassium Dihydrogenphosphate], 0.02% Tween20, 1.5 ppm ProClin300. ] 10 pmol of nucleic acid probe was added to 100 μL and reacted at 37° C. for 30 minutes (700 rpm). After washing twice with 200 μL of 1×PBS-TP, 150 μL of 3% Blocker A (MSD, product number: R93BA-4) was added and reacted at 37° C. for 1 hour (700 rpm). Thereafter, it was washed three times with 200 μL of 1×PBS-TP.
<Base sequence of CP-sp0-B>
5'-(biotin)GCATCAAGT-3' (base part is SEQ ID NO: 3)
<Base sequence of CP-sp5-B>
5'-(biotin) TGGTA GCATCAAGT-3' (base part is SEQ ID NO: 8)
<Base sequence of CP-sp10-B>
5'-(biotin) GGTTGTGGTA GCATCAAGT-3' (base part is SEQ ID NO: 9)
<Base sequence of CP-sp15-B>
5'-(biotin) AGAGTGGTTGTGGTA GCATCAAGT-3' (base part is SEQ ID NO: 4)
<Base sequence of CP-sp20-B>
5'-(biotin) TGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (base part is SEQ ID NO: 10)
<Base sequence of CP-sp25-B>
5'-(biotin) AGAGTTGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (base part is SEQ ID NO: 11)
<Base sequence of CP-sp30-B>
5'-(biotin) TTGTGAGAGTTGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (base part is SEQ ID NO: 12)
<Base sequence of CP-sp50-B>
5'-(biotin) TGGTAAGAGTGGTTGTGGTATTGTGAGAGTTGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (base part is SEQ ID NO: 13)
<Base sequence of CP-sp90-B>
5'-(biotin) GGTTGTGGTATTGTGAGAGTTGGTAAGAGTGGTTGTGGTATGGTAAGAGTGGTTGTGGTATTGTGAGAGTTGGTAAGAGTGGTTGTGGTA GCATCAAGT-3' (base part is SEQ ID NO: 14)
*The underlined part indicates the first spacer part.

(3) Capture of target nucleic acid to capture probe ( ^1st Hybridization reaction)
40 μL of the 1st Hybridization reaction solution was added to 10 μL of the target nucleic acid, target nucleic acid metabolite model nucleic acid, or blank sample to make a total of 50 μL, and the mixture was reacted at 25° C. (700 rpm) for 1 hour in a Thermomixer comfort (Eppendorf). The reaction was carried out at 25°C for 1 hour.
(3-1) Composition of ^1st Hybridization reaction solution
5M TMAC (tetramethylammonium chloride) 15μL, 10× supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8.0% N-lauroylsarcosine sodium] 7.5μL, 12.5% PEG8000 (polyethylene glycol) 10μL, RNase Free water 6.5μL, 100 fmol/ml Assist probe (AP-1 (SEQ ID NO: 5), which has a complementary base sequence to the 5' side of PT1 with poly A chain added) 1μL

(4) Signal amplification by PALSAR reaction
30 μL of the PALSAR reaction solution was added to 50 μL of the reaction solution after the 1st Hybridization reaction to make a total of 80 μL, and the mixture was reacted at 25° C. for 1 hour in a Thermomixer comfort (Eppendorf). The sequences of a pair of probes capable of self-aggregation (also referred to as signal amplification probes) used in the PALSAR reaction are HCP-1-C3 (SEQ ID NO: 6) and HCP-2 labeled with cyanine3 (C3) at the 5' end. -C3 (sequence number 7).
(4-1) Composition of PALSAR reaction solution
Nuclease-Free Water 5.1μL, 5M TMAC 4.5μL, 10× supplement [500mM Tris-HCl (pH8.0), 40mM EDTA (pH8.0), 8% N-lauroylsarcosine sodium] 2.25μL, 20pmol/μL HCP-1-C3 1.75μL, 20pmol/μL HCP-2-C3 1.4μL

(5) Detection
After the PALSAR reaction was completed, it was washed twice with 200 μL of 1×PBS-TP. After that, anti-Dig-Fab antibody-Ru (MSD SULFO-TAG NHS-Ester; MSD, manufacturing number: R91AO-1, Anti-DIG, Fab fragments from sheep; Roche, manufacturing number: 11214667001) 0.25 μL, 3% Blocker A 16.7 μL, and Nuclease-Free Water 33.1 μL were added, and the mixture was reacted at 25° C. for 1 hour (700 rpm) in a Thermomixer comfort. After washing 3 times with 200 μL of 1× PBS-TP again, add 150 μL of MSD GOLD Read Buffer A (MSD/manufacturing number: R92TG-2) diluted 2 times with Nuclease-Free Water, and add MESO QuickPlex SQ 120MM. The positive signal value (PS) and background value (BG) of the target nucleic acid and metabolite model nucleic acid were measured using a measuring device (MSD).

交差反応性(%)=[代謝物モデル核酸(PS-BG)] / [標的核酸(PS-BG)]×100 2. Results Capture probe CP-sp0-B without first spacer and capture probe CP-sp5-B, CP- with first spacer of 5, 10, 15, 20, 25, 30, 50, 90mer. Target nucleic acid and metabolite models using sp10-B, CP-sp15-B, CP-sp20-B, CP-sp25-B, CP-sp30-B, CP-sp50-B, and CP-sp90-B, respectively. Table 6 shows the cross-reactivity when measuring. Without the first spacer in the capture probe, the cross-reactivity is 24.8%, whereas when a 5-mer spacer is inserted into the CP, the cross-reactivity is 5.9%, and even more so with 10-mer, 15-mer, 20-mer, 25-mer, and 30-mer spacers. The cross-reactivity was less than 1% when each was inserted, 1.4% when a 50mer spacer was inserted, and 4.8% when a 90mer spacer was inserted. Extrapolation based on the above results shows that by inserting a 4-mer to 130-mer first spacer into the capture probe, cross-reactivity can be reduced to 10% or less, which can be significantly suppressed. .

Cross-reactivity (%) = [metabolite model nucleic acid (PS-BG)] / [target nucleic acid (PS-BG)] × 100

By using the measurement method of the present invention, drug development can be performed in pharmacokinetic/pharmacodynamic (PK/PD) screening tests in the exploration stage, safety tests in the non-clinical stage, pharmacological tests and pharmacokinetic tests, and in the clinical stage. It is possible to accurately measure drug concentrations in administered animal or human biological samples without being affected by metabolites.

Claims (16)

A method of measuring a target oligonucleotide in a sample using a combination of a capture probe and an assist probe based on the principle of hybridization, and a method of distinguishing between a target oligonucleotide that retains its full-length sequence and its metabolites. And,
The capture probe includes a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe,
The assist probe includes a tag or label and a second nucleic acid probe linked to the tag or label,
In the metabolite, one or more consecutive nucleotides including the nucleotide at the 3' end or 5' end are missing,
the first nucleic acid probe is capable of hybridizing to a portion of the target oligonucleotide that includes a nucleotide that is missing in the metabolite;
the second nucleic acid probe can hybridize to a portion of the target oligonucleotide other than the portion;
the capture probe, target oligonucleotide, and assist probe form a complex;
Method. A method for detecting a target oligonucleotide in a sample as distinct from a metabolite lacking one or more nucleotides from its 3' or 5' end, comprising the following steps:
(i) A capture probe for capturing the target oligonucleotide and a probe for detecting the target oligonucleotide are applied to a sample containing the target oligonucleotide or a metabolite lacking one or more nucleotides from its 3' or 5' end. contacting the assist probe to form a complex of the capture probe, target oligonucleotide, and assist probe;
here,
The capture probe includes a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe,
The assist probe includes a tag or label and a second nucleic acid probe linked to the tag or label,
The sequence of the first nucleic acid probe is complementary to a partial sequence of the target oligonucleotide, and the partial sequence includes a nucleotide that is missing in the metabolite;
the sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide; and
(ii) detecting the target oligonucleotide in the sample by detecting the complex; A method of detecting a target oligonucleotide in a sample comprising the steps of:
(i) contacting the sample with a capture probe for capturing the target oligonucleotide and an assist probe for detecting the target oligonucleotide to form a complex of the capture probe, the target oligonucleotide, and the assist probe;
here,
The capture probe includes a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe,
The assist probe includes a tag or label and a second nucleic acid probe linked to the tag or label,
the sequence of the first nucleic acid probe is complementary to a partial sequence of the target oligonucleotide including the terminal nucleotide of the target oligonucleotide;
the sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide; and
(ii) detecting the target oligonucleotide in the sample by detecting the complex; 4. The method of any of claims 1 to 3, wherein the capture probe comprises an adapter between the solid phase and the first spacer. 5. The method of claim 4, wherein the capture probe includes a second spacer between the solid phase and the adapter. 6. The method according to claim 4 or 5, wherein the adapter is streptavidin or avidin and biotin. 7. The method of claim 6, wherein binding of streptavidin or avidin to biotin occurs after complex formation of the capture probe, target oligonucleotide, and assist probe. 8. The method according to claim 1, wherein the first spacer is a 5mer to 90mer oligonucleotide. A detection kit used for detecting a target oligonucleotide, comprising a capture probe, an assist probe, and a pair of signal amplification probes that have complementary base sequence regions that can hybridize with each other and can form a probe polymer by self-assembly. And,
The capture probe includes a solid phase, a first nucleic acid probe immobilized on the solid phase, and a first spacer between the solid phase and the first nucleic acid probe,
The assist probe includes a tag having a base sequence complementary to part or all of one signal amplification probe in the pair of signal amplification probes, and a second nucleic acid probe linked to the tag. ,
The sequence of the first nucleic acid probe is complementary to a partial sequence of the target oligonucleotide including the terminal nucleotide of the target oligonucleotide, and
the sequence of the second nucleic acid probe is complementary to a sequence other than the partial sequence of the target oligonucleotide;
Detection kit. 10. The detection kit according to claim 9, wherein the capture probe includes an adapter between the solid phase and the first spacer. 11. The detection kit according to claim 10, wherein the capture probe includes a second spacer between the solid phase and the adapter. 12. The detection kit according to claim 10 or 11, wherein the adapter is streptavidin or avidin and biotin. 13. The detection kit according to claim 12, wherein the binding of streptavidin or avidin to biotin occurs after complex formation of the capture probe, target oligonucleotide, and assist probe. 14. The detection kit according to claim 9, wherein the first spacer is a 5-mer to 90-mer oligonucleotide. 15. The detection kit according to claim 9, wherein at least one of the pair of signal amplification probes is labeled with a labeling substance. The pair of signal amplification probes includes a first signal amplification probe and a second signal amplification probe,
The first signal amplification probe is a nucleic acid probe that includes, in order from the 5' end, at least a nucleic acid region X, a nucleic acid region Y, and a nucleic acid region Z or a nucleic acid region Z containing a poly T sequence,
The second signal amplification probe includes, in order from the 5' end, at least a nucleic acid region X' complementary to the nucleic acid region X, a nucleic acid region Y' complementary to the nucleic acid region Y, and a nucleic acid region complementary to the nucleic acid region Z. A nucleic acid probe containing a nucleic acid region Z′ or a nucleic acid region Z′ containing a polyA sequence,
The detection kit according to any one of claims 9 to 15.