JP7464931B2 - Novel mucin-type glycoprotein and its use - Google Patents

Description

The present invention relates to a mucin-type glycoprotein having a novel component or structure with a high content of sulfate groups, and its use.

Mucin is a viscous substance found in the mucus of animals and plants, and its main component is a glycoprotein with a molecular weight of 1 to 10 million and a high sugar content. Most of the glycans of this glycoprotein are relatively short glycans formed by O-glycosidic bonds between the hydroxyl group of serine or threonine in the core protein and the sugar (often N-acetylgalactosamine) located at the reducing end of the glycan, and such glycans are called "mucin-type glycans" (hereinafter, glycoproteins with mucin-type glycans are referred to as mucin-type glycoproteins).

Mucin has been reported to have various physiological functions such as protecting mucosal epithelium, moisturizing, antibacterial, and lubricating properties, and mucin or mucin-type glycoproteins extracted and purified from animals and plants are used as health foods and medicines. For example, Patent Document 1 discloses a novel mucin-type glycoprotein characterized by a glycan bonded to a repeating structure consisting of a specific amino acid sequence, and its use for health promotion, drug administration, treatment or prevention of diseases, etc. (Claim 1, Claim 14). Patent Document 2 discloses an antigen-specific T cell proliferation promoter whose active ingredient is mucin extracted from the skin and surface mucus of a ray (Claim 1).

Patent No. 5057383 Patent No. 5355682

However, mucin-type glycoproteins can have a wide variety of components or structures, particularly in their glycans. Therefore, even in light of the above patent documents, it cannot be said that there has yet been a sufficient provision of mucin-type glycoproteins having novel components or structures that can provide useful applications. The present invention has been made to solve such problems, and aims to provide mucin-type glycoproteins having novel components or structures and applications thereof.

As a result of intensive research, the present inventors have succeeded in isolating and purifying a novel mucin-type glycoprotein from stingrays that has a high content of sulfate groups and sialic acid and has unique components or structures. They have also found that mucin-type glycoproteins with a high content of sulfate groups significantly increase the number of Akkermansia and Bacteroides bacteria in the intestine. They have further found that mucin-type glycoproteins with a high content of threonine can further enhance the effect of increasing the number of Akkermansia bacteria.

Here, the following Non-Patent Documents 1 to 3 report that administration of Akkermansia muciniphila, a bacterium of the genus Akkermansia, inhibits the progression of obesity in mice and reduces the development of fat mass, insulin resistance, and dyslipidemia.
Non-Patent Document 1: Hubert P. et al., NATURE MEDICINE, Vol. 23, No. 1, January 2017, pp. 107-116
Non-Patent Document 2: Patrice D. Cani and Willem M. de Vos, Frontiers in Microbiology, Vol. 8, Art. 1765, 22 September 2017
Non-Patent Document 3: Amandine Everard et al., PNAS, Vol. 110, No. 22, May 28, 2013, pp. 9066-9071

In addition, Non-Patent Document 4 reports that the number of bacteria of Bacteroides thetaiotaomicron, a bacterium of the Bacteroides genus, increases after weight loss, and that co-administration of Bacteroides thetaiotaomicron with prebiotics such as lactitol or polydextrose reduces weight loss and blood neutral fats.
Non-Patent Document 4: Kaisa Olli et al., Frontiers in Nutrition, Vol. 3, Art. 15, 08 June 2016

In other words, it is believed that obesity, type 2 diabetes, and dyslipidemia can be prevented or treated by ingesting the novel mucin-type glycoprotein of the present invention to humans or animals and increasing the number of Akkermansia bacteria and/or Bacteroides bacteria in the body. Based on these findings, the following inventions have been completed.

(1) A mucin-type glycoprotein containing sulfate groups and sialic acid, wherein the content of the sulfate groups is 0.07 moles or more per mole of sugar O-glycosidically bonded to the core protein, and the content of the sialic acid is 0.1 moles or more per mole of sugar O-glycosidically bonded to the core protein.

(2) A mucin-type glycoprotein described in (1), in which the mass percentage of threonine in the total amount of amino acids excluding tryptophan, methionine and cysteine is 15% or more.

(3) A mucin-type glycoprotein described in (1) or (2) obtained from the skin and/or surface mucus of a ray.

(4) An agent for increasing the bacterial count of Akkermansia bacteria and/or Bacteroides bacteria, which contains a mucin-type glycoprotein described in any of (1) to (3) as an active ingredient.

(5) An agent for increasing the number of bacteria of the genus Akkermansia and/or the genus Bacteroides, comprising the following mucin-type glycoprotein as an active ingredient:
A mucin-type glycoprotein containing a sulfate group, wherein the content of the sulfate group is 0.07 mol or more per mol of sugar bonded to a core protein via O-glycosidic bond.

(6) A bacterial count increaser for Akkermansia bacteria, wherein in the mucin-type glycoprotein, the mass percentage of threonine in the total amount of amino acids excluding tryptophan, methionine and cysteine is 15% or more.

(7) A bacterial count increasing agent described in (5) or (6), in which the mucin-type glycoprotein is collected from the skin and/or body surface mucus of a ray.

(8) A bacterial count increasing agent described in any of (4) to (7), characterized in that it is used for the prevention or treatment of one or more diseases selected from the group consisting of obesity, type 2 diabetes, and dyslipidemia.

(9) A food composition for increasing the bacterial count of Akkermansia bacteria and/or Bacteroides bacteria, which contains as an active ingredient a mucin-type glycoprotein described in any one of (1) to (3).

(10) A food composition for increasing the bacterial count of Akkermansia bacteria and/or Bacteroides bacteria, comprising the following mucin-type glycoprotein as an active ingredient:
A mucin-type glycoprotein containing a sulfate group, wherein the content of the sulfate group is 0.07 mol or more per mol of sugar bonded to a core protein via O-glycosidic bond.

(11) A food composition for increasing the number of Akkermansia bacteria, wherein in the mucin-type glycoprotein, the mass percentage of threonine in the total amount of amino acids excluding tryptophan, methionine and cysteine is 15% or more.

(12) A food composition for increasing the number of bacteria described in (10) or (11), wherein the mucin-type glycoprotein is collected from the skin and/or surface mucus of a ray.

(13) A food composition for increasing bacterial count described in any of (9) to (12), characterized in that it is used for the prevention or treatment of one or more diseases selected from the group consisting of obesity, type 2 diabetes, and dyslipidemia.

(14) An agent for preventing or treating one or more diseases selected from the group consisting of obesity, type 2 diabetes, and dyslipidemia, comprising the following mucin-type glycoprotein as an active ingredient:
A mucin-type glycoprotein containing a sulfate group, wherein the content of the sulfate group is 0.07 mol or more per mol of sugar bonded to a core protein via O-glycosidic bond.

(15) A preventive or therapeutic agent described in (14), wherein the mucin-type glycoprotein further contains sialic acid, and the content of the sialic acid is 0.1 moles or more per mole of sugar O-glycosidically bonded to the core protein.

(16) A preventive or therapeutic agent described in (14) or (15), in which the mucin-type glycoprotein has a mass percentage of threonine of 15% or more of the total amount of amino acids excluding tryptophan, methionine and cysteine.

(17) A preventive or therapeutic agent described in any of (14) to (16), wherein the mucin-type glycoprotein is collected from the skin and/or body surface mucus of a ray.

(18) A preventive or therapeutic agent described in any of (14) to (17), wherein the mucin-type glycoprotein increases the number of Akkermansia bacteria and/or Bacteroides bacteria in the intestine of a human or animal.

(19) A food composition for preventing or treating one or more diseases selected from the group consisting of obesity, type 2 diabetes, and dyslipidemia, comprising the following mucin-type glycoprotein as an active ingredient:
A mucin-type glycoprotein containing a sulfate group, wherein the content of the sulfate group is 0.07 mol or more per mol of sugar bonded to a core protein via O-glycosidic bond.

(20) A preventive or therapeutic food composition described in (19), wherein the mucin-type glycoprotein further contains sialic acid, and the content of the sialic acid is 0.1 moles or more per mole of sugar O-glycosidically bonded to the core protein.

(21) A preventive or therapeutic food composition described in (19) or (20), in which the mucin-type glycoprotein has a mass percentage of threonine of 15% or more of the total amount of amino acids excluding tryptophan, methionine and cysteine.

(22) A preventive or therapeutic food composition described in any of (19) to (21), wherein the mucin-type glycoprotein is collected from the skin and/or body surface mucus of a ray.

(23) A preventive or therapeutic food composition described in any of (19) to (22), wherein the mucin-type glycoprotein increases the number of Akkermansia bacteria and/or Bacteroides bacteria in the intestine of a human or animal.

(24) A method for preventing or treating one or more diseases selected from the group consisting of obesity, type 2 diabetes, and dyslipidemia, comprising the following steps (a) and (b):
(a) administering to a human or animal suffering from or likely to suffer from the disease a mucin-type glycoprotein as described below;
A mucin-type glycoprotein containing a sulfate group, the content of the sulfate group being 0.07 moles or more per mole of sugar bonded to a core protein via O-glycosidic bond;
(b) increasing the number of Akkermansia bacteria and/or Bacteroides bacteria in the intestine of the human or animal, thereby preventing or treating the disease.

(25) The method described in (24), wherein the mucin-type glycoprotein further contains sialic acid, and the content of the sialic acid is 0.1 moles or more per mole of sugar O-glycosidically bonded to the core protein.

(26) The method described in (24), wherein the mucin-type glycoprotein has a mass percentage of threonine of 15% or more of the total amount of amino acids excluding tryptophan, methionine and cysteine.

(27) The method described in (24), wherein the mucin-type glycoprotein is collected from the skin and/or surface mucus of a ray.

(28) Use of the following mucin-type glycoprotein for the manufacture of a pharmaceutical for the prevention or treatment of one or more diseases selected from the group consisting of obesity, type 2 diabetes, and dyslipidemia;
A mucin-type glycoprotein containing a sulfate group, wherein the content of the sulfate group is 0.07 mol or more per mol of sugar bonded to a core protein via O-glycosidic bond.

(29) The use described in (28), wherein the mucin-type glycoprotein further contains sialic acid, and the content of the sialic acid is 0.1 moles or more per mole of sugar O-glycosidically bonded to the core protein.

(30) The use described in (28) or (29), wherein the mucin-type glycoprotein has a mass percentage of threonine of 15% or more of the total amount of amino acids excluding tryptophan, methionine and cysteine.

(31) The use described in (28) or (29), wherein the mucin-type glycoprotein is collected from the skin and/or surface mucus of a ray.

(32) The use described in (28) or (29), wherein the mucin-type glycoprotein increases the number of Akkermansia bacteria and/or Bacteroides bacteria in the intestine of a human or animal.

According to the present invention, it is possible to obtain a mucin-type glycoprotein having a novel component or structure. Furthermore, according to the present invention, it is possible to effectively increase the number of Akkermansia bacteria and/or Bacteroides bacteria in the living body of a human or animal, thereby contributing to the prevention and treatment of diseases such as obesity, type 2 diabetes, and dyslipidemia.

1 is a graph showing the amount of reducing sugar produced by mucinase reaction using novel mucin-type glycoprotein and porcine gastric mucosa mucin as substrates. 1 is a bar graph showing the amount of reducing sugars produced by mucinase reaction using rat intestinal mucosa mucin as a substrate. 1 is a bar graph showing the amount of reducing sugars produced by mucinase reaction using porcine gastric mucosa mucin as a substrate. 1 is a bar graph showing the amount of reducing sugars produced by mucinase reaction using a novel mucin-type glycoprotein as a substrate. FIG. 1 is a bar graph showing the concentrations of O-linked sugars contained in the cecal contents of rats that did not ingest mucin-type glycoproteins (control group), rats that ingested novel mucin-type glycoproteins (1.5% novel mucin group), and rats that ingested porcine gastric mucosa mucin (1.5% porcine gastric mucosa mucin group). 1 is a bar graph showing the copy numbers of 16S rDNA derived from various intestinal bacteria present in the cecal contents of rats in the control group, 0.75% novel mucin group, 1.5% novel mucin group, and 1.5% porcine gastric mucosa mucin group. 1 is a bar graph showing the number of 16S rDNA copies derived from total eubacteria and Akkermansia muciniphila present in the cecal contents of rats that did not receive mucin-type glycoproteins (control group) and rats that received novel mucin-type glycoproteins (lots I to V).

The present invention provides the following items <1> to <7>.
<1> Mucin-type glycoprotein.
(2) An agent for increasing the number of bacteria of the genus Akkermansia and/or the genus Bacteroides (hereinafter, collectively referred to as "the bacteria").
<3> A food composition for increasing the bacterial count of this bacterium.
<4> A preventive or therapeutic agent for one or more diseases selected from the group consisting of obesity, type 2 diabetes, and dyslipidemia (hereinafter sometimes referred to as "the disease").
<5> A food composition for preventing or treating the disease.
<6> A method for preventing or treating the disease.
<7> Use of a mucin-type glycoprotein for the manufacture of a pharmaceutical for the prevention or treatment of this disease.

In the present invention, as described above, "mucin-type glycoprotein" refers to a glycoprotein having a mucin-type glycan. Furthermore, "mucin-type glycan" refers to a glycan that is bound to a hydroxyl group of serine or threonine in a core protein via an O-glycosidic bond. The sugar located at the reducing end of a mucin-type glycan, i.e., the sugar that is O-glycosidically bound to a serine or threonine residue in the core protein, is often N-acetylgalactosamine.

The mucin-type glycoprotein of the present invention is characterized by containing a high proportion of sulfate groups. Specifically, it contains 0.07 moles or more of sulfate groups per mole of O-glycosidically linked sugar. Since sulfate groups are often attached to sugar residues at the non-reducing end in mucin-type glycans, it can be said that the mucin-type glycoprotein of the present invention has sulfate groups at many of the non-reducing ends of its glycans.

The mucin-type glycoprotein of the present invention may contain a high proportion of sialic acid in addition to sulfate groups. Specifically, it may contain 0.1 moles or more of sialic acid per mole of O-glycosidically linked sugar. Since sialic acid is also often located at the non-reducing end of mucin-type glycans, the mucin-type glycoprotein of the present invention may have sialic acid at many of the non-reducing ends of its glycans.

In the mucin-type glycoprotein according to the present invention, when the content or mass percentage of threonine is a predetermined value or more, the effect of increasing the number of Akkermansia bacteria can be further increased. Preferred threonine contents include, for example, 28 mg/g or more, 28.5 mg/g or more, 29 mg/g or more, 29.5 mg/g or more, 30 mg/g or more, 30.5 mg/g or more, 31 mg/g or more, 31.5 mg/g or more, 32 mg/g or more, 32.5 mg/g or more, 33 mg/g or more, and 33.5 mg/g or more. Furthermore, the mass percentage of threonine in the total amount of amino acids excluding tryptophan, methionine and cysteine can be preferably, for example, 14% or more, 14.5% or more, 15% or more, 15.5% or more, 16% or more, 16.5% or more, 17% or more, 17.5% or more, 18% or more, 18.5% or more, 19% or more, or 19.5% or more.

It is common technical knowledge in the field of the present invention that the measured values of amino acids in proteins vary considerably depending on the measurement method. In this regard, it is preferable to quantify the content ratio and mass percentage of amino acids in the mucin-type glycoprotein of the present invention by hydrolyzing the protein with a strong acid, derivatizing it by the post-column ninhydrin method, and separating and measuring it by chromatography, as shown in Example 6 (2) described below.

The mucin-type glycoprotein of the present invention can be extracted, for example, from viscous matter attached to the epidermis or body surface of rays (cartilaginous fishes belonging to the superorder Strigiformes) such as skates. In the examples described below, a combination of epidermal and body surface viscous matter from the genus Scutellaria and a body surface viscous matter from the genus Skate are used, but in this way, raw materials derived from multiple types of rays may be used in combination, or a raw material derived from a single type of ray may be used.

The skin and mucus on the surface of the ray are rich in the mucin-type glycoprotein of the present invention, so they may be used as is, or may be purified and concentrated before use. When purifying and concentrating, a protease is first applied to the raw material to degrade impurity proteins and peptides into smaller molecules. The protease may be appropriately selected from proteinases (endopeptidases) such as aspartic proteinase, metal proteinase, serine proteinase, and thiol proteinase, or peptidases (exopeptidases) depending on the origin of the raw material. The raw material may then be subjected to ultrafiltration to remove the lowered impurity proteins and peptides, and the polymeric substances may be concentrated. Another method is to grind the raw material, add an appropriate solvent (water, saline, phosphate buffer, etc.), stir, extract, and then centrifuge to recover the supernatant. Other examples of purification methods include the mucin clot method, ammonium sulfate fractionation, alcohol fractionation in the presence of barium ions or calcium ions, and precipitation methods using positive surfactants of quaternary amines such as cetablon (cetyltrimethylammonium bromide) or cetylpyridinium chloride (CPC).

The mucin-type glycoprotein according to the present invention can be used by orally ingesting it in humans or animals. In addition, since the mucin-type glycoprotein according to the present invention exerts its function in the intestines of the living body, it may be used in a manner that allows it to reach the intestines. For example, the active ingredient may be added to an enteral nutritional agent, which may be administered by enteral nutrition via a tube inserted into the digestive tract, such as the stomach or small intestine.

The mucin-type glycoprotein of the present invention exerts its action (increasing the number of bacteria in a specific intestinal bacterium) mainly in the digestive tract. Therefore, it is considered appropriate to calculate the intake (dosage) of the mucin-type glycoprotein of the present invention when used in humans or animals per food intake, rather than per body weight as is common for other drugs. In the examples described below, the effect was observed in rats that consumed feed containing about 1% by mass of the mucin-type glycoprotein (Figure 6). In general, since rats have a significantly higher basal metabolism than humans, a dose of 1/4 to 1/2 of the effective dose for rats is often effective for humans. Therefore, according to the examples, the daily intake of the mucin-type glycoprotein of the present invention when used in humans can be exemplified as "about 0.25 to 0.5% by mass of the daily food (solid) intake of the human individual."

The mucin-type glycoprotein of the present invention contains a high proportion of sulfate groups, and therefore can specifically increase the number of Akkermansia and Bacteroides bacteria, which are intestinal bacteria that have sulfate group-degrading enzymes (sulfatases), in the intestines of humans and animals that ingest it.

Here, "Akkermansia bacteria" refers to microorganisms belonging to the genus Akkermansia. An example of such a microorganism is Akkermansia muciniphila. Akkermansia muciniphila is an intestinal bacterium that inhabits the intestines of many humans, and as mentioned above, it has been reported that administration of this bacterium inhibits the progression of obesity in mice, and reduces the development of fat mass, insulin resistance, and dyslipidemia.

"Bacteroides bacteria" refers to microorganisms belonging to the genus Bacteroides. An example of such a microorganism is Bacteroides thetaiotaomicron. Bacteroides bacteria are also part of the intestinal flora, and as mentioned above, it has been reported that the bacterial count of Bacteroides thetaiotaomicron increases after weight loss, and that co-administration of Bacteroides thetaiotaomicron with prebiotics such as lactitol or polydextrose reduces weight loss and blood neutral fats.

In other words, it is believed that obesity, type 2 diabetes, and dyslipidemia can be prevented or treated by ingesting the mucin-type glycoprotein of the present invention into humans or animals and increasing the number of the bacterium in the body. For this reason, the mucin-type glycoprotein of the present invention can be used to prevent or treat these diseases.

Specifically, for example, the mucin-type glycoprotein of the present invention can be used as an active ingredient of an agent for increasing the bacterial count of the bacterium, a food composition for increasing the bacterial count of the bacterium, an agent for preventing or treating the disease, or a food composition for preventing or treating the disease. That is, the mucin-type glycoprotein of the present invention can be used to manufacture a pharmaceutical for preventing or treating the disease. In addition, the disease can be prevented or treated by (a) a step of having a human or animal suffering from or likely to suffer from the disease ingest the mucin-type glycoprotein of the present invention, and (b) a step of increasing the bacterial count of the bacterium in the intestine to prevent or treat the disease.

The formulation of the present invention may be in the form of a drug, food additive, supplement, or the like, which is made up of only the mucin-type glycoprotein, which is the active ingredient, as well as in the form of a drug, food additive, or supplement, which is made up of a suitable excipient or carrier. When made into a drug, food additive, or supplement, the dosage form may be, for example, a solid or liquid dosage form such as a powder, tablet, sugar-coated agent, capsule, granule, dry syrup, liquid agent, syrup, drop, or drink. Such dosage forms of drugs, food additives, and supplements can be manufactured by methods known to those skilled in the art.

The food composition of the present invention may take the form of ordinary foods and beverages, such as confectionery, beverages, processed foods, health foods, and foods for infants and young children, as well as those consisting only of the mucin-type glycoprotein, which is the active ingredient. When the food and beverages are to be used, the active ingredient can be added during the usual manufacturing process.

In the present invention, "increasing the number of bacteria" of the bacterium means increasing the number of bacteria of the bacterium in any cell, tissue, or organ of a living organism.

For example, since the number of bacteria of the present bacterium in the intestine is thought to correlate with the number of bacteria of the present bacterium in the intestinal contents or feces, it is possible to confirm whether the number of bacteria of the present bacterium in the intestine has increased by measuring the number of bacteria of the present bacterium in the intestinal contents or feces. Specifically, for example, the intestinal contents or feces after ingestion of the mucin-type glycoprotein according to the present invention is used as a sample, and the 16S rDNA copy number is measured by performing a real-time PCR method using a primer specific to the present bacterium. The primer specific to the present bacterium can be designed based on the known base sequence of the present bacterium, and for example, a primer consisting of the sequence shown in SEQ ID NO: 1 to 4 can be used. Alternatively, the present bacterium can be quantified using a commercially available kit for quantifying the present bacterium.

Since the 16S rDNA copy number of the bacterium correlates with the bacterial count, the 16S rDNA copy number can be used as an index of the bacterial count. Therefore, if the 16S rDNA copy number of the bacterium is greater in the feces after ingestion than before ingestion, or if the 16S rDNA copy number in the cecal contents after ingestion is greater than the cecal contents of a subject who has not ingested the bacterium, it can be determined that the mucin-type glycoprotein of the present invention has increased the bacterial count of the bacterium.

The present invention will now be described with reference to the following examples. Note that the technical scope of the present invention is not limited to the characteristics shown in these examples. In the examples, "%" stands for mass % (w/w %) unless otherwise specified.

Example 1: Isolation and purification of a novel mucin-type glycoprotein The epidermis was peeled off from a true skate (Raja pulchra Liu, family Skateidae, genus Raja) together with the viscous matter adhering to the body surface, and this was used as a true skate-derived raw material. Also, from a water skate (Bathyraja smirnovi, family Skateidae, genus Bathyraja) the viscous matter adhering to the body surface was peeled off by washing with water and collected, and this was used as a water skate-derived raw material.

Approximately 240 kg of raw material derived from true kasube and approximately 120 kg of raw material derived from water kasube, totaling approximately 360 kg, were placed in a beveled shaft kneader (GN100/60ST, Samsung), 300 g of a thiol proteinase preparation was added, and the mixture was stirred at 55°C for 4 hours. Next, 300 g of a mixed preparation of metal proteinase and peptidase was added, and the mixture was incubated at 55°C for a further 4 hours. The enzymes were then inactivated by heat treatment at 90°C for 10 minutes.

After the heat treatment, 35 kg of diatomaceous earth (Radiolite #100, Showa Chemical Industry) was added to the enzyme reaction solution, which was then filtered through a filter press (FP-66, Yabuta Kikai) to recover the filtrate. This filtrate was used as the internal retentate and ultrafiltered while adding fresh water using an ultrafiltration membrane (Microza ACP-3013D, molecular weight cutoff 13,000, Asahi Kasei) to remove impurities such as contaminating proteins and peptides. After confirming that the solids concentration of the membrane permeate was approximately zero on the Brix meter (MASTER-10Pα, Atago) indicator, the injection of fresh water was stopped and operation was continued. The membrane permeate was concentrated until almost no longer discharged, yielding approximately 90 L of internal retentate. This was heat sterilized at 90°C for 10 minutes, and then spray-dried using a rotary disk type spray dryer (DA220-10S, Sakamoto Giken) to obtain 1.4 kg of dry powder. Hereinafter, this was used as the "novel mucin-type glycoprotein."

Comparative Example 1: Porcine stomach mucosa mucin As Comparative Example 1, a purified product of porcine stomach mucosa mucin was used. Specifically, 5 g of commercially available porcine stomach mucosa mucin (Mucin from porcine stomach Type II, SIGMA-ALDRICH) was weighed into a beaker, 100 times the amount of 0.15 M NaCl aqueous solution was added thereto to suspend it, and then the pH was adjusted to 7.5 with 1 M NaOH aqueous solution. This was homogenized using a homogenizer PT-3100 (KINEMATICA) at 4°C for 60 seconds at 14,500 revolutions per minute (rpm), and then suction filtered to obtain a filtrate. To this filtrate, 2 times the amount of 90% ethanol was added, mixed by inversion, left overnight at -30°C, and then centrifuged at 2,300 x g for 10 minutes at 4°C to remove the supernatant, thereby carrying out ethanol precipitation. 500 mL of 0.15 M NaCl aqueous solution was added to the precipitate, and suspended using a vortex mixer. This was again subjected to ethanol precipitation, and 150 mL of distilled water was added to the obtained precipitate, which was then suspended using a vortex mixer. This suspension was freeze-dried to obtain "porcine gastric mucosa mucin," and its weight was measured.

Comparative Example 2: Rat intestinal mucosa mucin Mucin secreted from the intestinal mucosa of rats was used in Comparative Example 2. Since the mucin contained in the cecal contents of rats that do not ingest mucin is mucin secreted from the intestinal mucosa, rats raised under the conditions in (1) below were dissected to collect the cecal contents, from which a cecal content mucin fraction was prepared by the method in (2) below, and this was designated "rat intestinal mucosa mucin."

(1) Rat breeding conditions Diet: Standard purified diet not containing mucin (milk casein 25.0%, corn starch 60.25%, cellulose powder 5.0%, corn oil 5.0%, vitamin mixture 1.0%, mineral mixture 3.5%, choline bitartrate 0.25%). The vitamins and minerals used were a mixture conforming to AIN-76 (Guidelines for standard purified diet for rats published in 1977 by the National Institute of Nutrition (AIN) of the United States).
Drinking water: In order to inhibit the decomposition of mucin by intestinal bacteria, the following antibiotics were added to the drinking water to the final concentrations shown in parentheses: benzylpenicillin (50 units/mL), neomycin trisulfate (2 mg/mL), and cefoperazone sodium (0.5 mg/mL).
Rearing period: 7 days

(2) Preparation of mucin fraction from cecal contents 200 mg of freeze-dried cecal contents was weighed into a glass centrifuge tube, 30 volumes of phosphate buffered saline (pH 7.2) were added thereto, and the mixture was suspended, followed by boiling for 10 minutes to sterilize. The mixture was placed in a 37°C thermostatic shaking water bath and shaken at 125 rpm for 90 minutes. The mixture was homogenized by homogenization for 20 seconds at level 11 using a homogenizer PT-2100 (KINEMATICA) at 4°C, and then centrifuged twice at 20,000×g and 4°C for 30 minutes to recover the supernatant. The mixture was transferred to a 50 mL Falcon tube, 3 volumes of 100% ethanol was added, mixed by inversion, left overnight at -30°C, and then centrifuged at 2,300×g and 4°C for 10 minutes to remove the supernatant, thereby carrying out ethanol precipitation. 15 mL of 0.15 M NaCl aqueous solution was added to the precipitate, and the mixture was suspended using a vortex mixer. This was again subjected to ethanol precipitation, and 5 mL of distilled water was added to the obtained precipitate, which was then suspended using a vortex mixer. The solution was freeze-dried to obtain the cecal content mucin fraction, and its weight was measured.

Example 2: Evaluation of novel mucin-type glycoprotein: components and structure The novel mucin-type glycoprotein of Example 1, the porcine gastric mucosa mucin of Comparative Example 1, and the rat intestinal mucosa mucin of Comparative Example 2 were subjected to component analysis by the following methods (1) to (6). 10 mg of each powder was dissolved in 4 mL of distilled water to prepare a mucin solution for analysis. The novel mucin-type glycoprotein was prepared from six different raw materials (lots A to F), and multiple samples (samples 1 to 13) were individually collected (sampled) from each lot for analysis. Seven samples each of the porcine gastric mucosa mucin and rat intestinal mucosa mucin (samples 1 to 7) were also individually sampled and analyzed.

(1) Measurement of protein concentration Protein concentration was measured according to the Lowry method. That is, bovine serum albumin (SIGMA-ALDRICH) was used as a standard sample, and a dilution series of 25-100 μg/mL was prepared with distilled water. For the measurement sample, mucin solution was diluted 20 times with distilled water. Biuret reagent was prepared by mixing 0.5N sodium hydroxide aqueous solution containing 10% Na ₂ CO ₃ and 1% sodium citrate aqueous solution containing 0.5% CuSO _{4.5H 2} O in a volume ratio of 10:1. In addition, 1.8N phenol reagent (Nacalai Tesques) was diluted 12 times with distilled water to prepare diluted phenol reagent.

0.5 mL of Biuret reagent was added to 0.5 mL of each standard sample and measurement sample, and the mixture was left at room temperature for 10 minutes. 1.5 mL of diluted phenol reagent was added, stirred, and left at 37°C for 30 minutes. After leaving the mixture at room temperature for 15 minutes, the absorbance at 750 nm was measured. Based on the measurement results of the standard sample, the protein concentration in the measurement sample was determined, and the protein concentration (μg/mg) per 1 mg of novel mucin-type glycoprotein or porcine gastric mucosa mucin was calculated.

(2) Measurement of total sugar concentration Total sugar concentration was measured according to the phenol-sulfuric acid method and calculated in terms of glucose. That is, 1 mg/mL D(+)-glucose (Wako) was used as the standard sample, and a dilution series of 31.25 to 250 μg/mL was prepared with distilled water. 1 mL of each was dispensed into two large test tubes, including a blank of distilled water only. The measurement samples were prepared by dispersing 50 mg of powdered mucin in 10 mL of distilled water as the stock solution, which was then diluted 10, 20, 40, and 100 times with distilled water, and 1 mL of each was dispensed into two large test tubes, including the stock solution.

A 5% phenol solution was added to the standard sample and the measurement sample, and the mixture was stirred using a vortex mixer. 5 mL of concentrated sulfuric acid was added directly to the liquid surface using a volumetric pipette, and the mixture was stirred using a vortex mixer. The samples were left to return to room temperature, and then the absorbance at 480 nm was measured. Based on the measurement results of the standard sample, the total sugar concentration in the measurement sample was determined, and the total sugar concentration (μg/mg) per mg of the novel mucin-type glycoprotein or porcine gastric mucosa mucin was calculated.

(3) Measurement of O-linked sugar concentration The concentration of O-glycosidically linked sugars (O-linked sugars) was measured according to the method of Crowther RS et al. (Crowther RS, Wetmore RF, Fluorometric assay of O-linked glycoproteins by reaction with 2-cyanoacetamide, Anal. Biochem., vol. 163, pp. 170-174, 1987). That is, the O-glycosidic bonds of glycoproteins were cleaved by alkali treatment, and the resulting reducing ends of the sugar chains were reacted with 2-cyanoacetamide (2-CNA) to generate fluorescent substances, and the fluorescence intensities were measured.

Specifically, N-acetylgalactosamine (SIGMA-ALDRICH) was used as the standard sample, and a dilution series of 0.15625 to 10 μg/mL was prepared with distilled water. For the measurement sample, mucin solution was diluted 80 times with distilled water. In addition, an alkalized 2-CNA solution was prepared by mixing 0.15 M sodium hydroxide aqueous solution and 0.6 M 2-CNA aqueous solution in a volume ratio of 5:1. 100 μL of each of the standard sample and measurement sample was dispensed into a 1.5 mL microtube, 120 μL of the alkalized 2-CNA solution was added, and the tubes were heated at 100°C for 30 minutes. After cooling to room temperature, 1 mL of 0.6 M borate buffer (pH 8.0) was added to each microtube and stirred. Next, the fluorescence at 383 nm was measured using a fluorometer (F-2000, Hitachi) with an excitation light of 336 nm. Based on the measurement results of the standard samples, the O-linked sugar concentration in the measurement samples was determined, and the O-linked sugar concentration (μmol/mg) per mg of novel mucin-type glycoprotein or porcine gastric mucosa mucin was calculated.

(4) Measurement of sulfate group concentration 100 μL of a measurement sample obtained by diluting the mucin solution 10 times was dispensed into a 1.5 mL microtube and centrifugal concentration was performed for 1 hour to completely evaporate water. Then, 200 μL of 4M hydrochloric acid prepared with Milli-Q water was added and the mixture was left at 100° C. for 4 hours to perform acid hydrolysis. Then, centrifugal concentration was performed to evaporate hydrochloric acid. Then, 300 μL of Milli-Q water was added to dissolve the hydrolyzate, and centrifugal concentration was performed again. This washing operation of the hydrolyzate with Milli-Q water was repeated three times in total, and finally, it was dissolved in 500 μL of Milli-Q water. This was filtered through a filter (DISMIC-13HP, 13HP020AN, Advantec) and subjected to ion chromatography under the following conditions to measure the sulfate ion concentration. Based on the measurement results, the sulfate group concentration (μmol/mg) per 1 mg of the novel mucin-type glycoprotein or porcine gastric mucosa mucin was calculated.

<Ion Chromatography Conditions>
Equipment: Ion chromatograph ICS-2000 (DIONEX)
Detector: Electrical conductivity detector DS6 (DIONEX)
Column: IonPacAS17 (4 x 250 mm) (DIONEX)
Guard column: IonPac AG17C (DIONEX)
Column temperature: 30°C
Eluent: Aqueous potassium hydroxide solution with linearly increasing concentration from 5 mM to 40 mM over 18 minutes Flow rate: 1 mL/min

(5) Measurement of sialic acid concentration N-acetylneuraminic acid (NeuAc) and N-glycolylneuraminic acid (NeuGc) were used as standard samples. The measurement sample was prepared by diluting the mucin solution 20-fold with distilled water. 50 μL of the measurement sample and 200 μL of 62.5 mM hydrochloric acid were placed in a glass vial. After stirring with a vortex mixer, the solution was left in a heat block set at 80° C. for 1 hour to perform acid hydrolysis and liberate sialic acid. The solution was then allowed to cool at room temperature for 20 minutes. 50 μL of this solution was dispensed into a glass vial, and 200 μL of DMB solution (Coupling solution: distilled water: DMB solution = 5:4:1 (volume ratio), sialic acid fluorescent labeling reagent kit, Takara Bio) was added. After stirring with a vortex mixer, the mixture was left in the dark at 50°C for 2.5 hours to fluorescently label the liberated sialic acid with 1,2-diamino-4,5-methylenedioxybenzene (DMB). After cooling at room temperature, the mixture was subjected to high performance liquid chromatography (HPLC) under the following conditions. A calibration curve was prepared based on the measurement results of the standard sample, and the sialic acid concentration (μmol/mg) per 1 mg of the novel mucin-type glycoprotein or porcine gastric mucosa mucin was calculated.

HPLC conditions
Equipment: High-performance liquid chromatograph LC-10AD (Shimadzu Corporation)
Detector: Fluorescence detector RF-10AXL (Shimadzu Corporation)
Excitation wavelength: 373 nm, measurement wavelength: 448 nm
Column: TSK gel ODS-80TS (TOSOH)
Eluent: Solution A is water:methanol = 93:7 (volume ratio), and solution B is acetonitrile:methanol = 93:7 (volume ratio), with a linear concentration gradient from A:B = 90:10 (volume ratio) to A:B = 40:60 (volume ratio) Solution flow rate: 0.5 mL/min Column temperature: 40 °C
Injection volume: 10 μL

(6) Measurement of monosaccharides constituting glycans Monosaccharide Mixture-11 (J-Oil Mills) was used as the standard sample. The measurement sample was a mucin solution diluted to a total sugar content of 1 μmol/mL. 50 μL of the sample was dispensed into a 1.5 mL Eppendorf tube, and 8N trifluoroacetic acid (TFA) or hydrochloric acid (HCl) was added. This was heated to 100°C using a heat block, and left for 3 hours in the case of TFA and 4 hours in the case of HCl to perform acid hydrolysis of the sugar. Then, 20 μL was transferred to a new Eppendorf tube and centrifuged at 80°C for 1 hour. Next, 40 μL of 2-propanol was added, and centrifuged again at 80°C. Then, 40 μL of a solution of pyridine:methanol mixed at a volume ratio of 1:9 was added, and mixed with a vortex mixer. 10 μL of acetic anhydride was added thereto, and mixed again with a vortex mixer, and left at room temperature for 30 minutes. The mixture was then concentrated by centrifugation at 80°C for 30 minutes, and 10 μL of distilled water and 40 μL of ABEE Labeling solution (ABEE Labeling Kit, J-Oil Mills) were added, followed by heating at 80°C for 1 hour using a heat block. Then, 200 μL of distilled water and 200 μL of chloroform were added and mixed using a vortex mixer. After centrifugation at 15,000×g and room temperature for 5 minutes, the upper layer (aqueous layer) was collected and filtered using a filter (DISMIC-13HP, 13HP020AN (Advantech)) and subjected to HPLC under the following conditions. Based on the measurement results of the standard sample, monosaccharides were identified and quantified. Since glucose, arabinose, and ribose detected in the results are not sugar chain constituent sugars of mucin-type glycoproteins, they are considered to be impurities derived from the raw materials or contaminants during the preparation of each sample. Therefore, these monosaccharides are collectively shown as "other monosaccharides".

HPLC conditions
Equipment: High-performance liquid chromatograph LC-10AD (Shimadzu Corporation)
Detector: Fluorescence detector RF-10AXL (Shimadzu Corporation)
Excitation wavelength: 305 nm, measurement wavelength: 360 nm
Column: Honenpak C18 (J-Oil Mills)
Eluent: Potassium borate buffer (pH 8.9)
Flow rate: 1 mL/min Column temperature: 30° C.
Injection volume: 10 μL

The results of (1) to (5) of this Example 2 are shown in Table 1, and the results of (6) are shown in Table 2.

As shown in Table 1, the concentration of O-linked sugars, which is an indicator of the amount of mucin-type glycans, was 0.434-0.548 micromoles/mg (μmol/mg) for the novel mucin-type glycoprotein, 0.728-0.752 μmol/mg for porcine gastric mucosa mucin, and 0.434-0.498 μmol/mg for rat intestinal mucosa mucin. The sulfate group concentration was 0.039-0.090 μmol/mg for the novel mucin-type glycoprotein, whereas it was 0.035-0.046 μmol/mg for porcine gastric mucosa mucin and 0.021-0.037 μmol/mg for rat intestinal mucosa mucin. That is, the amount of sulfate groups per mole of O-linked sugar was 0.047-0.063 moles (0.035/0.752 ≒ 0.047-0.046/0.728 ≒ 0.063) for porcine gastric mucosa mucin and 0.042-0.085 moles (0.021/0.498 ≒ 0.042-0.037/0.434 ≒ 0.085) for rat intestinal mucosa mucin, while it was 0.071-0.207 moles (0.039/0.548 ≒ 0.071-0.090/0.434 ≒ 0.207) for the novel mucin-type glycoprotein, demonstrating that the amount was significantly greater in the novel mucin-type glycoprotein.

In addition, the sialic acid concentration was 0.045-0.051 μmol/mg in porcine gastric mucosal mucin, 0.068-0.085 μmol/mg in the novel mucin-type glycoprotein, and 0.189-0.208 μmol/mg in rat intestinal mucosal mucin. That is, the amount of sialic acid per mole of O-linked sugar was 0.060-0.070 moles (0.045/0.752 ≒ 0.060-0.051/0.728 ≒ 0.070) for porcine gastric mucosal mucin, 0.124-0.196 moles (0.068/0.548 ≒ 0.124-0.085/0.434 ≒ 0.196) for the novel mucin-type glycoprotein, and 0.380-0.479 moles (0.189/0.498 ≒ 0.380-0.208/0.434 ≒ 0.479) for rat intestinal mucosal mucin, indicating that the novel mucin-type glycoprotein and rat intestinal mucosal mucin are significantly larger.

On the other hand, as shown in Table 2, it was revealed that the glycans of the novel mucin-type glycoprotein contain approximately 0.3 to 0.7 μmol/mg of galactose, approximately 0.3 to 0.5 μmol/mg of fucose, approximately 0 to 0.05 μmol/mg of mannose, approximately 0.3 to 0.6 μmol/mg of N-acetylglucosamine (GlcNAc), and approximately 0.7 to 1.1 μmol/mg of N-acetylgalactosamine (GalNAc).

These results demonstrate that the novel mucin-type glycoprotein has a novel component or structure in that it contains a high ratio of sulfate groups (0.07 moles or more) per mole of O-glycosidically linked sugar, even taking into account differences between lots and measurement errors. Furthermore, it was revealed that the novel mucin-type glycoprotein also contains a high amount of sialic acid in addition to sulfate groups, containing 0.1 moles or more of sialic acid per mole of O-glycosidically linked sugar.

Here, generally, in mucin-type glycans, sulfate groups are often attached to sugar residues at the non-reducing end of the glycan. Therefore, in the measurement results in Table 1, if we provisionally consider the number of moles of O-linked sugars to be the number of moles of mucin-type glycans, and assume that all sulfate groups are located at the non-reducing end of the mucin-type glycan, then in the novel mucin-type glycoprotein, there are 0.064 moles (average value) of sulfate groups compared to 0.481 moles (average value) of mucin-type glycans, and the blocking rate of the non-reducing end of the glycan with sulfate groups (terminal capping rate) is approximately 13.3% on average ((0.064/0.481) x 100 ≒ 13.31). In contrast, in the case of porcine gastric mucosal mucin, the mucin-type glycan has 0.740 moles (average value) and sulfate group has 0.040 moles (average value), so the terminal capping rate by sulfate group is only about 5.4% on average ((0.040/0.740) x 100 ≒ 5.41). In addition, in the case of rat intestinal mucosal mucin, the mucin-type glycan has 0.466 moles (average value) and sulfate group has 0.026 moles (average value), so the terminal capping rate by sulfate group is only about 5.6% on average ((0.026/0.466) x 100 ≒ 5.58). In other words, it was revealed that the novel mucin-type glycoprotein contains sulfate groups at many non-reducing ends of glycans, and the terminal capping rate is remarkably higher, more than twice as high as that of other mucin-type glycoproteins such as porcine gastric mucosal mucin and rat intestinal mucosal mucin. This demonstrated that the novel mucin-type glycoprotein has a unique structure in which many of the glycans contain sulfate groups at the non-reducing ends.

Example 3: Evaluation of novel mucin-type glycoprotein: mucinase activity in rats not ingesting mucin The extent to which the novel mucin-type glycoprotein of Example 1 and the porcine gastric mucosa mucin of Comparative Example 1 are decomposed by a mucin-type glycolytic enzyme (mucinase) contained in the feces of rats not ingesting mucin (mucinase activity) was analyzed. Most of the mucinase present in the feces is derived from intestinal bacteria.

(1) Preparation of mucinase enzyme solution Feces were collected from rats that had consumed the standard purified feed of Comparative Example 2 (1). Within 3 hours of collection, 100 volumes (w/v) of 0.01 M acetate buffer (pH 5.5) was added to the feces, which was then shredded with scissors and left on ice for 20 minutes to soften it. The feces were homogenized at 4°C for 30 seconds at level 11 using a homogenizer PT-2100 (KINEMATICA) to prepare a mucinase enzyme solution.

(2) Mucinase reaction 200 mg of the novel mucin-type glycoprotein or porcine gastric mucosa mucin was dissolved in 10 mL of 0.01 M acetate buffer (pH 5.5) and refrigerated overnight to prepare a substrate solution. The mucinase enzyme solution was preheated at 30° C. for 2 minutes, and then 0.1 mL of the substrate solution was added to 0.9 mL of the mucinase enzyme solution, followed by allowing to stand at 30° C. for 30 minutes to carry out the mucinase reaction. The reaction was then stopped by inactivating the enzyme by heating in boiling water for 3 minutes, and this was used as a post-reaction solution.

(3) Measurement of reducing sugar concentration The amount of reducing sugar liberated in the solution after the reaction was measured by the Somogyi-Nelson method. That is, first, solution A (15% copper sulfate solution) and solution B (a solution in which 12.5 g of Na ₂ CO ₃ , 12.5 g of Rochelle salt, 10 g of NaHCO ₃ , and 100 g of Na ₂ SO ₄ were dissolved in 500 mL of distilled water) were mixed in a volume ratio of 1:25 to prepare a Somogyi reagent. In addition, a solution in which 25 g of (NH ₄ ) ₆ Mo ₇ O _{24.4H 2} O was dissolved in 450 mL of distilled water, 21 mL of H ₂ SO ₄ , and a solution in which 3 g of Na ₂ HAsO _{4.7H 2} O was dissolved in 25 mL of distilled water were mixed and heated at 37 ° C. for 24 to 48 hours to prepare a Nelson reagent. The Nelson reagent was stored at room temperature and was reheated at 37° C. for 24 to 48 hours before use.

1 mg/mL D(+)-glucose (Wako) was used as the standard sample, and a dilution series of 25 to 200 μg/mL was prepared with distilled water. 1 mL of Somogyi reagent was added to 1 mL of the standard sample or the reaction solution, and the test tube was covered with a marble and reacted in boiling water for 20 minutes. The reaction was stopped by immediately cooling in ice water to prevent reverse oxidation. Next, 1 mL of Nelson reagent was added, and the mixture was left for 15 minutes to develop color, after which 450 μL of this was measured and added to 3.3 mL of distilled water. The mixture was centrifuged at 2330 × g and room temperature for 10 minutes to recover the supernatant, and the absorbance was measured at 660 nm. A calibration curve was created based on the absorbance measurement results of the standard sample. Using this calibration curve, the reducing sugar concentration (nmol/mL) in the reaction solution was calculated from the absorbance measurement results of the reaction solution. The results are shown in Figure 1.

As shown in Figure 1, the reducing sugar concentration increased with increasing enzyme reaction time for both the novel mucin-type glycoprotein and porcine gastric mucosal mucin. This indicates that the sugar chains were decomposed to produce reducing sugars by mucinase present in the feces. However, when comparing the reducing sugar concentrations of the novel mucin-type glycoprotein and porcine gastric mucosal mucin, the reducing sugar concentration was significantly lower for the novel mucin-type glycoprotein at enzyme reaction times of 10, 20, and 30 minutes, and was approximately 1/3 to 1/5 of that of porcine gastric mucosal mucin. In other words, the mucinase activity for the novel mucin-type glycoprotein was significantly lower than that for porcine gastric mucosal mucin. This result indicates that the novel mucin-type glycoprotein has a unique component or structure that is difficult to assimilate by the intestinal bacteria of rats that ingested purified feed that does not contain mucin.

In general, the decomposition of mucin-type glycans proceeds from the non-reducing end by exo-type mucinase, but decomposition is inhibited when sulfate esters or sialic acid are present at the non-reducing end of the glycan. Considering this and the results of Example 2, it is possible that the reason for the low mucinase activity against the novel mucin-type glycoprotein is due to the presence of sulfate groups and sialic acid at many of the non-reducing ends of the glycan of the novel mucin-type glycoprotein.

Example 4: Evaluation of novel mucin-type glycoprotein: mucinase activity in rats that ingested mucin The extent to which the novel mucin-type glycoprotein of Example 1, the porcine gastric mucosa mucin of Comparative Example 1, and the rat intestinal mucosa mucin of Comparative Example 2 were decomposed by mucinase contained in the feces of rats that ingested mucin (mucinase activity) was analyzed.

(1) Rat breeding Eighteen 7-week-old (body weight 150-170 g) male Wistar rats (Japan SLC) were divided into three groups of six rats each: a control group, a 1.5% novel mucin group, and a 1.5% porcine gastric mucosa mucin group. Each group was bred for 15 days with free intake of the following feed along with tap water. The breeding conditions were room temperature 24±1°C, relative humidity 55±5°C, 12-hour light-dark cycle (lights on 7:00-19:00), and individual breeding in stainless steel cages. Feces were collected on the 12th day, and the cecum was removed by dissection on the 15th day and cut open to collect cecal tissue and cecal contents.
Control group: Standard purified feed of Comparative Example 2(1).
1.5% novel mucin group: Feed containing 1.5% novel mucin-type glycoprotein by substituting cornstarch in the standard purified feed of Comparative Example 2(1).
1.5% porcine gastric mucosa mucin group: Feed containing 1.5% porcine gastric mucosa mucin by substituting cornstarch in the standard purified feed of Comparative Example 2(1).

(2) Preparation of mucinase enzyme solutions Mucinase enzyme solutions were prepared from the feces of the control group, the 1.5% novel mucin group, and the 1.5% porcine gastric mucosa mucin group by the method described in Example 3(1), and designated as "enzyme derived from the control group,""enzyme derived from the novel mucin group," and "enzyme derived from the porcine gastric mucosa mucin group." The protein concentrations in these mucinase enzyme solutions were measured according to the Lowry method described in Example 2(1).

(3) Mucinase reaction Using three types of substrates, namely the novel mucin-type glycoprotein of Example 1, the porcine gastric mucosa mucin of Comparative Example 1, and the rat intestinal mucosa mucin of Comparative Example 2, the mucinase reaction was carried out by the method described in Example 3 (2) using the mucinase enzyme solution of this Example 4 (2). However, in the reaction using rat intestinal mucosa mucin as the substrate, the mucinase enzyme solution was diluted 4-fold with 0.01 M acetate buffer (pH 5.5) before use. Subsequently, the reducing sugar concentration was measured by the method described in Example 3 (3). The measured reducing sugar concentration was divided by the time of the mucinase reaction and the amount of protein in the mucinase enzyme solution, and expressed as the amount of reducing sugar (nmol/min/mg protein) generated per minute of mucinase reaction by 1 mg of protein in the mucinase enzyme solution. The results when rat intestinal mucosa mucin was used as the substrate are shown in FIG. 2, the results when porcine gastric mucosa mucin was used as the substrate are shown in FIG. 3, and the results when the novel mucin-type glycoprotein was used as the substrate are shown in FIG. 4.

As shown in Figure 2, the amount of reducing sugars produced when rat intestinal mucosa mucin was used as a substrate was 29.6 ± 2.1 nmol/min/mg protein for the enzyme derived from the control group, 92.6 ± 5.7 nmol/min/mg protein for the enzyme derived from the novel mucin group, and 87.6 ± 13.0 nmol/min/mg protein for the enzyme derived from the porcine gastric mucosa mucin group, all of which were significantly higher than those of the enzyme derived from the control group. In other words, the mucinase activity against rat intestinal mucosa mucin was higher in the mucinase contained in the feces of rats that had ingested the novel mucin-type glycoprotein or porcine gastric mucosa mucin than in the feces of rats that had not ingested mucin. These results demonstrated that ingestion of the novel mucin-type glycoprotein or porcine gastric mucosa mucin induces intestinal bacteria with high decomposition activity against "mucin secreted from the intestinal mucosa."

Next, as shown in Figure 3, the amount of reducing sugars when porcine gastric mucosal mucin was used as a substrate was 7.6 ± 1.8 nmol/min/mg protein for the enzyme derived from the control group, whereas it was 21.9 ± 2.6 nmol/min/mg protein for the enzyme derived from the novel mucin group and 23.6 ± 5.3 nmol/min/mg protein for the enzyme derived from the porcine gastric mucosal mucin group, both of which were significantly higher than those of the enzyme derived from the control group. In other words, the mucinase activity against porcine gastric mucosal mucin was higher in the mucinase contained in the feces of rats that had ingested the novel mucin-type glycoprotein or porcine gastric mucosal mucin than in the feces of rats that had not ingested mucin. These results demonstrated that ingestion of the novel mucin-type glycoprotein or porcine gastric mucosal mucin induces intestinal bacteria with high decomposition activity against "porcine gastric mucosal mucin."

Finally, as shown in Figure 4, the amount of reducing sugars produced when the novel mucin-type glycoprotein was used as a substrate was 3.3 ± 0.4 nmol/min/mg protein for the enzyme derived from the control group, 5.3 ± 0.6 nmol/min/mg protein for the enzyme derived from the porcine gastric mucosa mucin group, and 9.6 ± 0.7 nmol/min/mg protein for the enzyme derived from the novel mucin group, which was significantly higher than the enzyme derived from the control group and the enzyme derived from the porcine gastric mucosa mucin group. In other words, the mucinase activity against the novel mucin-type glycoprotein was higher in the mucinase contained in the feces of rats that had ingested the novel mucin-type glycoprotein than in the feces of rats that had not ingested mucin, as well as in the feces of rats that had ingested porcine gastric mucin. These results demonstrated that ingestion of the novel mucin-type glycoprotein induces intestinal bacteria with high decomposition activity against the "novel mucin-type glycoprotein."

As described above, the decomposition activity against porcine gastric mucosal mucin was similarly high when either the novel mucin-type glycoprotein or porcine gastric mucosal mucin was ingested (Fig. 3), whereas the decomposition activity against the novel mucin-type glycoprotein was high only when the novel mucin-type glycoprotein was ingested (Fig. 4). These results demonstrated that the novel mucin-type glycoprotein has unique components or structures that are difficult to decompose by the intestinal bacteria induced by the ingestion of porcine gastric mucosal mucin. It was also demonstrated that the ingestion of the novel mucin-type glycoprotein can induce a unique intestinal bacterial flora that differs from that induced by the ingestion of porcine gastric mucosal mucin.

(4) Measurement of O-linked sugar concentration in cecal contents A cecal contents mucin fraction was prepared from the cecal contents collected in Example 4 (1) by the method described in Comparative Example 2 (2). Here, the mucin contained in the cecal contents of rats that did not ingest mucin (control group) was rat intestinal mucosa mucin, whereas the mucin contained in the cecal contents of rats that ingested mucin (1.5% novel mucin group, 1.5% porcine gastric mucosa mucin group) was derived from rat intestinal mucosa mucin and the ingested mucin.

Distilled water was added to the prepared cecal content mucin fraction to a constant volume of 5 mL, and then the fraction was further diluted 10-fold with distilled water. Using this as the measurement sample, the concentration of O-glycosidically linked sugars (O-linked sugars) was measured by the method described in Example 2 (3). Based on the measurement results of the standard sample, the concentration of O-linked sugars in the measurement sample was determined, and the O-linked sugar concentration (μmol/g) per 1 g of cecal content mucin fraction was calculated. The results are shown in Figure 5.

As shown in FIG. 5, the O-linked sugar concentration was 0.50±0.04 μmol/g in the control group, whereas it was 2.26±0.47 μmol/g in the 1.5% novel mucin group, which was significantly higher than the control group. On the other hand, the O-linked sugar concentration in the 1.5% porcine gastric mucosa mucin group was 0.54±0.11 μmol/g, which was not significantly different from the control group. Here, the concentration of O-linked sugar is considered to be proportional to the amount of mucin-type glycans. Therefore, it was revealed that a significantly larger amount of mucin-type glycans remained in the intestines of rats that had ingested the novel mucin-type glycoprotein, compared to the intestines of rats that had ingested porcine gastric mucosa mucin.

These results revealed that the novel mucin-type glycoprotein was utilized more slowly in the rat intestine than porcine gastric mucosa mucin. This is thought to be because, as described in Example 3 and this Example 4 (3), the novel mucin-type glycoprotein has a unique component or structure that is difficult to assimilate by intestinal bacteria that have not ingested it. There were no significant differences between the groups in the number of goblet cells in the cecal tissue, crypt length, or ammonia concentration in the cecal contents.

Example 5: Evaluation of novel mucin-type glycoprotein: effect on intestinal bacteria Changes in the amount of intestinal bacteria (total eubacteria, Akkermansia muciniphila, and Bacteroides thetaiotaomicron) in rats that had ingested the novel mucin-type glycoprotein of Example 1 and the porcine gastric mucosa mucin of Comparative Example 1 were analyzed by real-time PCR targeting the 16S rRNA gene.

(1) Rat breeding Twenty-four 7-week-old (body weight 150-170 g) male Wistar rats (Japan SLC) were divided into four groups of six rats each: a control group, a 0.75% novel mucin group, a 1.5% novel mucin group, and a 1.5% porcine gastric mucosa mucin group. Each group was bred for 14 days while being allowed to freely consume the following feed along with tap water. The breeding conditions were the same as those described in Example 4 (1). Thereafter, the cecum was removed by dissection and cut open to collect the cecal contents.
Control group: Standard purified feed of Comparative Example 2(1).
0.75% novel mucin group: Feed containing 0.75% novel mucin-type glycoprotein by substituting cornstarch in the standard purified feed of Comparative Example 2(1).
1.5% novel mucin group: Feed containing 1.5% novel mucin-type glycoprotein by substituting cornstarch in the standard purified feed of Comparative Example 2(1).
1.5% porcine gastric mucosa mucin group: Feed containing 1.5% porcine gastric mucosa mucin by substituting cornstarch in the standard purified feed of Comparative Example 2(1).

(2) Extraction of DNA Extraction of DNA from cecal contents was performed using the DNA extraction kit ISOFECAL for Beads Beating (Nippon Gene). Specifically, 150 mg of cecal contents was suspended in 1 mL of Lysis Solution F, and then the entire amount was transferred to a 2 mL Beads Tube and mixed. Next, the beads were crushed at 2700 rpm and room temperature for 2 minutes using a bead crusher, and then centrifuged at 12000 x g and room temperature for 5 minutes, and 600 μL of the supernatant was transferred to a 2 mL microtube. After adding and mixing 400 μL of purification solution, 600 μL of chloroform was added and mixed with a vortex mixer for 15 seconds. After centrifugation at 12000 x g and room temperature for 5 minutes, 800 μL of the supernatant was transferred to a 1.5 mL microtube, and 800 μL of Precipitation solution was added and mixed with a vortex mixer. The mixture was centrifuged at 20,000×g for 15 minutes at room temperature and the supernatant was removed. 1 mL of Wash solution was added to the precipitate and mixed by inversion. The mixture was centrifuged at 20,000×g for 10 minutes at 4°C, the supernatant was removed, and 1 mL of 70% ethanol and 2 μL of Etachinmate were added to the precipitate and mixed with a vortex mixer. The mixture was centrifuged at 20,000×g for 5 minutes at 4°C, the supernatant was removed, the precipitate was dried, and then dissolved in 100 μL of TE (pH 8.0). This solution was used as the DNA solution.

(3) Real-time PCR
Real-time PCR was performed using LightCycler (registered trademark) Nano (Roche) according to the attached instruction manual. The composition of the reaction solution was 2 μL of template DNA solution, 10 μL of SYBR Premix EX Taq II (Takara Bio), 0.8 μL of 10 μM sense primer solution, 0.8 μL of 10 μM antisense primer solution, and 6.4 μL of DEPC-treated water, totaling 20 μL. The template DNA solution was the DNA solution of this Example 5 (2) diluted 500 times when measuring total eubacteria, and 100 times when measuring Akkermansia muciniphila or Bacteroides thetaiotaomicron. A calibration curve was created by measurement using DNA of known concentration, and the 16S rDNA copy number of each bacterium per 1 g of cecal contents was absolutely quantified based on the measurement results from the calibration curve. The results are shown in FIG. 6. The sequences of primers specific to each bacterium are shown below.

Akkermansia muciniphila
Sense primer: CAGCACGTGAAGGTGGGGAC (SEQ ID NO: 1)
Antisense primer: CCTTGCGGTTGGCTTCAGAT (SEQ ID NO: 2)
Bacteroides thetaiotaomicron
Sense primer: GCAAACTGGAGATGGCGA (SEQ ID NO: 3)
Antisense primer: AAGGTTTGGTGAGCCGTTA (SEQ ID NO: 4)
All Eubacteria
Sense primer: CGGCAACGAGCGCAACCC (SEQ ID NO: 5)
Antisense primer: CCATTGTAGCACGTGTGTAGCC (SEQ ID NO: 6)

As shown in FIG. 6, the 16S rDNA copy number of all eubacteria did not differ significantly between the groups. On the other hand, the 16S rDNA copy number of Akkermansia muciniphila was significantly higher in the 1.5% new mucin group than the control group, and was also higher in the 0.75% new mucin group than the control group, although there was no significant difference. In contrast, the 16S rDNA copy number of Akkermansia muciniphila in the porcine gastric mucosa mucin group was equivalent to that of the control group. The 16S rDNA copy number of Bacteroides thetaiotaomicron was also significantly higher in the 1.5% new mucin group than the control group, and was also higher in the 0.75% new mucin group than the control group, although there was no significant difference. In contrast, the 16S rDNA copy number of Bacteroides thetaiotaomicron in the porcine gastric mucosa mucin group was equivalent to that of the control group.

That is, the 16S rDNA copy numbers of Akkermansia bacteria and Bacteroides bacteria in the cecal contents of rats were significantly increased by ingestion of the novel mucin-type glycoprotein. This result demonstrated that the novel mucin-type glycoprotein has the effect of increasing the bacterial counts of Akkermansia bacteria and Bacteroides bacteria.

Generally, most enterobacteria do not have the enzymes that break down sulfate groups (sulfatases) or sialic acid (sialidases), and therefore cannot assimilate glycans with high sulfate or sialic acid content. In contrast, it has been reported that bacteria of the genus Akkermansia and Bacteroides have these enzymes and can therefore assimilate glycans with high sulfate or sialic acid content and use them as a nutrient source.

However, in this Example 5, although all groups originally had rat intestinal mucosal mucin with a considerably high content of sialic acid as shown in Table 1, the numbers of these bacteria were significantly different. This suggests that a high content of sialic acid in the ingested mucin-type glycoprotein is not a factor in the increase of Akkermansia and Bacteroides bacteria. Furthermore, since these bacteria increased only in the group that ingested the novel mucin-type glycoprotein with a high content of sulfate groups, it suggests that a high content of sulfate groups is a factor in the increase of these bacteria.

In other words, it is believed that in the intestines of rats that ingested a mucin-type glycoprotein with a high content of sulfate groups, Akkermansia bacteria and Bacteroides bacteria became dominant and specifically increased compared to other intestinal bacterial species that cannot utilize the mucin-type glycoprotein. This demonstrated that mucin-type glycoproteins that contain a high ratio of sulfate groups (0.07 moles or more per mole of sugar O-glycosidically linked to the core protein) have the effect of increasing the bacterial counts of Akkermansia bacteria and Bacteroides bacteria.

Example 6: Evaluation of novel mucin-type glycoproteins: Effect on increasing the number of bacteria of the genus Akkermansia (1) Preparation of novel mucin-type glycoproteins and analysis of their components Novel mucin-type glycoproteins were prepared from five different raw materials by the method described in Example 1, and designated Lots I to V. Lots I and III were prepared from raw materials in a ratio of 2:1 (weight ratio) between raw materials derived from true kasu and raw materials derived from water kasu, Lot II was prepared only from raw materials derived from true kasu, and Lots IV and V were prepared only from raw materials derived from water kasu. The protein concentrations, total sugar concentrations, O-linked sugar concentrations, sulfate group concentrations, and sialic acid concentrations were measured for these samples by the methods described in Examples 2 (1) to (5). The results are shown in Table 3. In Table 3, the figures to the left of ± indicate the average value, and the figures to the right indicate the standard error. Values with standard error are the results of sampling three samples from each lot and measuring each sample in triplicate. Values without standard error are the average value of sampling one sample from each lot and measuring each sample in triplicate.

As shown in Table 3, it was confirmed that all lots of the novel mucin-type glycoprotein contained high ratios of sulfate groups (0.07 moles or more) and sialic acid (0.1 moles or more) per mole of O-glycosidically linked sugar.

(2) Amino acid analysis The content ratio (mg/g) of each amino acid in the novel mucin-type glycoprotein of Example 6(1) was measured by the following method. Based on the measurement results, the mass percentage (%) of each amino acid in the total amino acids was analyzed. In the following measurement method, tryptophan (W), methionine (M), and cysteine (C) were not measured because these amino acids were decomposed. In addition, "total amino acids" means "total amino acids excluding W, M, and C". The analysis results are shown in Table 4. In Table 4, the content ratio is shown as the content (mg) of each amino acid per 1 g of mucin-type glycoprotein. In addition, the mass percentage is shown as the percentage of the mass of each amino acid in the total amount of amino acids excluding W, M, and C. The numerical values are the average values obtained by sampling one sample from each lot and measuring each sample in duplicate.

<Amino acid measurement>
50 mg of mucin-type glycoprotein was suspended in 2.0 mL of distilled water, and 0.5 mL of the suspension was weighed into a 1 mL vacuum reaction tube (GL Sciences). 0.5 mL of 12 mol/L hydrochloric acid solution containing 0.2% 2-mercaptoethanol was added thereto and mixed well, and then degassed with a vacuum pump (DTC-22, ULVAC). The reaction tube was placed in a heat block (HF61, Yamato Scientific) filled with liquid paraffin (Wako) and left at 110°C for 24 hours to acid-hydrolyze the mucin-type glycoprotein. The reaction tube was returned to room temperature, and the contents in the tube were transferred to a measuring flask and washed five times with distilled water. 1.75 mL of 3 mol/L NaOH was added to adjust the pH to around 2.2, and the volume was adjusted to 25 mL with 0.067 mol/L sodium citrate buffer (pH 2.2, Wako). The mixture was filtered through a membrane filter (DISMIC-13HP, 13HP020AN, Advantec) to recover the filtrate, which was then subjected to amino acid analysis. Amino acid analysis was performed using an L-8900 high-speed amino acid analyzer (Hitachi High-Technologies) equipped with an analytical column (Hitachi High-Tech packed column #2622PH, diameter 4.6 x 60 mm, Hitachi High-Technologies) and a precolumn (Hitachi packed column #2650L, diameter 4.6 x 40 mm, Hitachi High-Technologies). Commercially available kits were used for the eluent (MCI (trademark) BUFFER L-8500-PH-KIT, Mitsubishi Chemical) and reaction solution (Hitachi ninhydrin coloring solution kit, Wako). The amino acid standard used was 1 mL of amino acid mixed standard solution type H (Wako) diluted to 25 mL with 0.067 mol/L sodium citrate buffer (pH 2.2, Wako).

As shown in Table 4, Lot IV had a smaller content and mass percentage of serine and threonine, and a larger content and mass percentage of isoleucine, tyrosine, and phenylalanine, compared to Lots I to III and Lot V.

(3) Rat breeding Thirty-six 7-week-old male Wistar rats (Japan SLC) (body weight 140-160 g) were divided into six groups of six rats each, a control group and groups I to V of lots. Each group was bred for 14 days with free intake of the following feed along with tap water. The breeding conditions were the same as those described in Example 4 (1). Thereafter, the cecum was removed by dissection and cut open to collect the cecal contents.
Control group: Feed containing 5% by weight of cellulose and 10% by weight of sucrose by partially replacing corn starch in the standard purified feed of Comparative Example 2(1).
Lot I to V group: In the standard purified feed of Comparative Example 2 (1), corn starch was partially replaced to obtain 1.2% of the novel mucin-type glycoprotein (Lot I to V of this Example 6 (1)
V).

(4) DNA extraction and real-time PCR
DNA was extracted from the collected cecal contents by the method described in Example 5 (2). Then, real-time PCR was performed by the method described in Example 5 (3) to measure the 16S rDNA copy numbers of all eubacteria and Akkermansia muciniphila. The results are shown in FIG.

As shown in FIG. 7, there was no significant difference between the 16S rDNA copy numbers of all eubacteria among the groups. On the other hand, the 16S rDNA copy numbers of Akkermansia muciniphila were significantly higher in the lot I, lot II, lot III, and lot V groups than in the control group, and were also higher in the lot IV group compared to the control group, although there was no significant difference. In other words, the 16S rDNA copy numbers of Akkermansia bacteria in the cecal contents of rats were increased by ingestion of the novel mucin-type glycoprotein. This result revealed that the novel mucin-type glycoprotein has the effect of increasing the number of Akkermansia bacteria.

According to Non-Patent Document 5, Akkermansia muciniphila cannot synthesize threonine, one of the essential amino acids (RESULTS AND DISCUSSION, 2nd paragraph, lines 5-7). Also, according to Non-Patent Document 6, Akkermansia muciniphila cannot grow in a medium containing ammonia and other amino acids but not L-threonine (Results and discussion, 1st paragraph, lines 14-17, Fig. S1). In other words, Akkermansia muciniphila needs to be supplied with threonine from the outside in order to survive or grow.
Non-Patent Document 5: Ottman N. et al., Genome-scale model and omics analysis of metabolic capacities of Akkermansia muciniphila reveal a preferential mucin-degrading lifestyle, Appl Environ Microbiol, Volume 83, Issue 18, e01014-e01017, September 2017
Non-Patent Document 6: Kees CH van der Ark et al., Model-driven design of a minimal medium for Akkermansia muciniphila confirms mucus adaptation, Microbial Biotechnology 11(1339-1353), January 2018, DOI: 10.1111/1751-7915.13033

In this regard, as shown in Table 4, the mucin-type glycoprotein of Lot IV had a smaller threonine content of 28.5 mg per 1 g of mucin-type glycoprotein and a smaller mass percentage of threonine in the total amino acids of 14.2% compared to other lots. From this, it was considered that the increase in the number of Akkermansia bacteria in the Lot IV group was relatively small because the content of threonine in the ingested mucin-type glycoprotein or the mass percentage of threonine in the total amino acids was small. In other words, from this result, it was revealed that a mucin-type glycoprotein with a high threonine content has a stronger effect of increasing the number of Akkermansia bacteria. Specifically, it was revealed that in order to obtain a high effect of increasing the number of Akkermansia bacteria, it is preferable that the content of threonine in the mucin-type glycoprotein is 29 mg/g or more, or the mass percentage of threonine in the total amount of amino acids excluding tryptophan, methionine and cysteine is 15% or more.

Claims (8)

An agent for increasing the number of bacteria of the genus Akkermansia, comprising as an active ingredient a mucin-type glycoprotein having the following components or structures (i) and (iii):
(i) A mucin-type glycoprotein containing a sulfate group, the content of the sulfate group being 0.07 moles or more per mole of sugar bonded to a core protein via O-glycosidic bond;
(iii) In the mucin-type glycoprotein, the mass percentage of threonine in the total amount of amino acids excluding tryptophan, methionine and cysteine is 15% or more . An agent for increasing the number of bacteria of the genus Bacteroides, comprising as an active ingredient a mucin-type glycoprotein having the following components or structures (i) and (iv):
(i) A mucin-type glycoprotein containing a sulfate group, the content of the sulfate group being 0.07 moles or more per mole of sugar bonded to a core protein via O-glycosidic bond;
(iv) It is obtained from the skin and/or mucus on the surface of a ray . The agent for increasing the number of bacteria according to claim 1 or 2, wherein the mucin-type glycoprotein is a mucin-type glycoprotein containing a sulfate group and sialic acid, and the content of the sialic acid is 0.1 mol or more per mol of sugar bonded to the core protein via O -glycoside bond. The agent for increasing the number of bacteria according to any one of claims 1 to 3 , which is used for the prevention or treatment of one or more diseases selected from the group consisting of obesity, type 2 diabetes and dyslipidemia. A food composition for increasing the number of bacteria of the genus Akkermansia, comprising as an active ingredient a mucin-type glycoprotein having the following components or structures (i) and (iii):
(i) A mucin-type glycoprotein containing a sulfate group, the content of the sulfate group being 0.07 moles or more per mole of sugar bonded to a core protein via O-glycosidic bond;
(iii) In the mucin-type glycoprotein, the mass percentage of threonine in the total amount of amino acids excluding tryptophan, methionine and cysteine is 15% or more . A food composition for increasing the bacterial count of bacteria of the genus Bacteroides, comprising as an active ingredient a mucin-type glycoprotein having the following components or structures (i) and (iv):
(i) A mucin-type glycoprotein containing a sulfate group, the content of the sulfate group being 0.07 moles or more per mole of sugar bonded to a core protein via O-glycosidic bond;
(iv) It is obtained from the skin and/or mucus on the surface of a ray . 7. The food composition for increasing the number of bacteria according to claim 5 or 6, wherein the mucin-type glycoprotein is a mucin-type glycoprotein containing a sulfate group and sialic acid, and the content of the sialic acid is 0.1 mol or more per mol of sugar bonded to the core protein via O-glycoside bond. A food composition for increasing the number of bacteria described in any one of claims 5 to 7 , characterized in that it is used for the prevention or treatment of one or more diseases selected from the group consisting of obesity, type 2 diabetes and dyslipidemia.

Images