JP7325742B1 - Lung cancer test method and urine test kit for lung cancer evaluation - Google Patents

Abstract

An object of the present invention is to provide a simple, highly sensitive and non-invasive lung cancer examination method and a urine test kit for evaluating lung cancer. A lung cancer test method comprising a step (A1) of measuring the expression level of microRNA-486-5p (miR-486-5p) contained in urinary exosomes of a subject. [Selection figure] None

Description

Application of Article 30, Paragraph 2 of the Patent Act September 2, 2021 Public Interest Incorporated Foundation Tobacco Science Research Foundation 2nd year of Reiwa 2020 Grant Research Presentation Meeting: Isao Okazaki, Wataru Ando, Takayuki Uematsu, Katsuya Otori, Hiroaki Yokomori, Masaya Sogabe, Narumi Ishikawa, Shunsuke Endo and Hiroyoshi Tsubochi invented microRNA analysis of blood and urinary EXSOMES in lung cancer patients thought to be caused by passive smoking.

Application of Article 30, Paragraph 2 of the Patent Act June 2021 2020 In the Annual Report of the Tobacco Science Research Foundation, Isao Okazaki, Wataru Ando, Takayuki Uematsu, Katsuya Otori, Hiroaki Yokomori, Masaya Sogabe, Narumi Ishikawa, Shunsuke Endo and Hiroyoshi Tsubochi published microRNA analysis of blood and urinary EXSOMES in lung cancer patients thought to be caused by passive smoking.

TECHNICAL FIELD The present invention relates to a lung cancer examination method and a urine test kit for evaluating lung cancer.

Lung cancer (LC) is the leading cause of death in men and the third leading cause of death in women in 2018, in developed as well as developing countries. In Japan, according to 2019 statistics, lung cancer is the disease with the highest mortality rate and the fourth highest morbidity rate among men, and the third highest mortality rate and the fourth highest morbidity rate among women. expensive. Lung cancer treatment outcomes are improving dramatically, mainly because low-dose CT and MRI are increasingly discovering cases of early-stage lung cancer, especially those with tumors of 2 cm or less in size. is still bad. In Japan, the Industrial Safety and Health Law requires all workers to undergo a chest X-ray to prevent tuberculosis and lung disease caused by industrial accidents. It is not suitable for lung cancer detection because it is difficult to diagnose and has insufficient specificity and sensitivity. Therefore, in order to detect lung cancer patients at an early stage, it is necessary to develop a simple, highly sensitive, non-invasive, and inexpensive lung cancer examination method.

In recent years, the relationship between various biomarkers and cancer has been studied for early detection of cancer. By encapsulating and secreting molecules such as proteins and microRNAs (miRNAs) that are advantageous for their own survival, cancer cells can transmit information not only to neighboring cells but also to cells in distant locations, leading to cancer. It has been clarified that it forms a microenvironment and forms a pre-metastatic niche. Therefore, research is being conducted to explore the relationship with cancer using molecules contained in exosomes as biomarkers.

For miRNAs encapsulated in exosomes, for example, a method for early detection of prostate cancer by measuring the expression level of miRNAs in urinary exosomes has been reported (Patent Document 1).
In addition, a breast cancer screening method that can detect early breast cancer using a combination of microRNA-21 (also called miRNA-21, miR-21) and matrix metalloprotease-1 (MMP-1) contained in urinary exosomes has also been reported (Patent Document 2).
However, no lung cancer screening method using urinary exosomes has been reported so far.

Although it has been reported that the expression level of MMP-1 increases in early-stage lung cancer (Non-Patent Document 1), no studies have been conducted to use it as a biomarker for diagnosing lung cancer.

MicroRNA-486-5p (miR-486-5p) is an miRNA reported to be associated with lung cancer. miR-486-5p is a miRNA that targets the PIK3R1 gene involved in tumor cell proliferation suppression, and is reported to be associated with various cancers, metabolic syndrome, and coronary artery disease (Non-Patent Document 1). In particular, the expression level of miR-486-5p in the tissues and sera of non-small cell lung cancer patients is lower than in healthy subjects, so miR-486-5p can be a biomarker for diagnosing non-small cell lung cancer. has been reported (Non-Patent Document 2). However, since these reports directly analyzed miR-486-5p in tissues and serum, the expression level of miR-486-5p in exosomes was unknown.

Japanese Patent Application Publication No. 2018-504915 Japanese Patent Application Laid-Open No. 2021-56103

Sauter W, Rosenberger A, Beckmann L, Kropp S, Mittelst rass K, Timofeeva M, et al. Matrix metalloproteinase 1 (MMP 1) is associated with early onset lung cancer. Cancer Epidemiol Biomarkers Prev 2008; 17:1127-35 ElKhouly AM, Youness RA, Gad MZ, MicroRNA-486-5p and microRNA-486-3p, Multifaceted pleiotropic mediators in oncological and non-oncological conditions. Noncoding RNA Res 2020, 5(1):11-21 Tian F, Wang J, Ouyang T, Lu N, Lu J, Shen Y, Bai Y, Xie X, Ge Q, MiR-486-5p Serves as a Good Biomarker in Nonsmall Cell Lung Cancer and Suppresses Cell Growth With the Involvement of a Target PIK3R1, Front Genet 2019, 10:688

The present inventors wanted to provide a low-cost, easy-to-receive lung cancer test for detecting lung cancer patients at an early stage. If there is an inexpensive and convenient lung cancer test, it is possible to perform screening using that test first, and only if there is suspicion of lung cancer, it is possible to undergo conventional lung cancer screening and detailed examinations. You will be able to take a lung cancer test. Accordingly, an object of the present invention is to provide a simple, highly sensitive and non-invasive lung cancer examination method and a urine test kit for evaluating lung cancer.

The present inventors have diligently studied to solve the above problems. As a result, the inventors have found that the above problems can be solved by having the following configuration, and have completed the present invention.
The present invention relates to, for example, the following [1] to [10].
[1] A lung cancer test method comprising the step (A1) of measuring the expression level of microRNA-486-5p (miR-486-5p) contained in urinary exosomes of a subject.
[2] When the subject is male, the expression level of miR-486-5p obtained in step (A1) is greater than the reference value (M), indicating the possibility that the subject suffers from lung cancer. The inspection method according to [1], which indicates that the is high.
[3] When the subject is female, the possibility that the subject suffers from lung cancer if the expression level of miR-486-5p obtained in step (A1) is lower than the reference value (F) The inspection method according to [1], which indicates that the is high.
[4] Furthermore, the step of measuring the expression level of matrix metalloprotease-1 (MMP-1) contained in the urinary exosomes of the subject (B1), the exosome-specific protein expression level contained in the urinary exosomes The test method according to any one of [1] to [3], including the step of measuring (B2), and the step of calculating the expression level of the MMP-1 / the expression level of the exosome-specific protein (B3).
[5] The test method according to [4], wherein the exosome-specific protein is CD63.
[6] step of measuring the expression level of matrix metalloprotease-1 (MMP-1) contained in the urinary exosomes of the subject (B1), the step of measuring the expression level of the exosome-specific protein contained in the urinary exosomes (B2), and a step (B3) of calculating the expression level of the MMP-1 / the expression level of the exosome-specific protein, a lung cancer test method.
[7] The test method of [6], wherein the value obtained in step (B3) being greater than the reference value (T) indicates that the subject is highly likely to have lung cancer.
[8] The test method according to [6] or [7], wherein the exosome-specific protein is CD63.
[9] A urine test kit for evaluating lung cancer, comprising an exosome preparation reagent and a microRNA-486-5p (miR-486-5p) measurement reagent.
[10] A urine test kit for evaluating lung cancer, comprising an exosome preparation reagent, a matrix metalloprotease-1 (MMP-1) measurement reagent and an exosome-specific protein measurement reagent.

INDUSTRIAL APPLICABILITY According to the present invention, a simple, highly sensitive and non-invasive lung cancer examination method and a urine test kit for evaluating lung cancer can be obtained.

More specifically, the effects of the present invention are as follows.
1. Since the subject's urine is used as the test sample, the subject can undergo the test without feeling pain, and the sample can be easily collected.
2. There is no risk of radiation exposure to the subject or scarring of the body.
3. Inspection can be performed inexpensively without requiring expensive and large inspection equipment. Also, a large number of test samples can be analyzed simultaneously.
4. Lung cancer, especially early lung cancer, can be detected with high sensitivity. The invention is particularly suitable for the detection of lung cancer in non-smoker women and adenocarcinoma in non-smokers.
5. By performing primary lung cancer screening before conventional lung cancer screening methods such as interview, chest X-ray examination, sputum cytology, etc., even busy people and people with little money can easily receive lung cancer screening.
6. By combining conventional lung cancer diagnostic methods, such as interview, chest X-ray examination, sputum cytology, chest CT examination, bronchoscopy, and histopathological findings from biopsy, doctors can make a more accurate diagnosis of lung cancer. It is possible to collect and provide inspection data for

FIG. 1 is a photograph of exosomes in a urine-derived exosome preparation observed with an electron microscope. FIG. 2 shows the results of Western blotting detection of MMP-1 and CD63 in urine-derived exosome preparations from healthy subjects and lung cancer patients. FIG. 3A is a graph comparing MMP-1/CD63 in urine-derived exosome preparations in 40 healthy and 35 lung cancer patients. FIG. 3B is a graph comparing MMP-1/CD63 in urine-derived exosome preparations in 20 healthy and 24 lung cancer patients in men. FIG. 3C is a graph comparing MMP-1/CD63 in urine-derived exosome preparations in 20 healthy and 11 lung cancer patients in women. FIG. 3D is a graph comparing MMP-1/CD63 in urine-derived exosome preparations to healthy controls based on clinical stage of 35 lung cancer patients. FIG. 3E is a graph comparing MMP-1/CD63 in urine-derived exosome preparations to healthy male subjects based on clinical stage of 24 male lung cancer patients. FIG. 3F is a graph comparing MMP-1/CD63 in urine-derived exosome preparations to healthy female subjects based on clinical stage of 11 female lung cancer patients. FIG. 3G is a graph comparing MMP-1/CD63 in urine-derived exosome preparations based on smoking habits of 35 lung cancer patients. FIG. 3H is a graph comparing MMP-1/CD63 in urine-derived exosome preparations based on smoking habits of 24 male lung cancer patients. FIG. 3I is a graph comparing MMP-1/CD63 in urine-derived exosome preparations based on smoking habits of 11 female lung cancer patients. FIG. 4A is a graph comparing miR-486-5p relative expression levels in urine-derived exosome preparations in 40 healthy individuals and 35 lung cancer patients. FIG. 4B is a graph comparing miR-486-5p relative expression levels in urinary exosome preparations in 20 healthy and 24 lung cancer patients in males. FIG. 4C is a graph comparing miR-486-5p relative expression levels in urine-derived exosome preparations in 20 healthy and 11 lung cancer patients in women. FIG. 4D is a graph comparing miR-486-5p relative expression levels in urine-derived exosome preparations to healthy controls based on clinical stage of 35 lung cancer patients. FIG. 4E is a graph comparing miR-486-5p relative expression levels in urine-derived exosome preparations to healthy male subjects based on clinical stage of 24 male lung cancer patients. FIG. 4F is a graph comparing miR-486-5p relative expression levels in urine-derived exosome preparations to healthy female subjects based on clinical stage of 11 female lung cancer patients. FIG. 4G is a graph comparing miR-486-5p relative expression levels in urine-derived exosome preparations based on smoking habits of 35 lung cancer patients. FIG. 4H is a graph comparing miR-486-5p relative expression levels in urine-derived exosome preparations based on smoking habits of 24 male lung cancer patients. FIG. 4I is a graph comparing miR-486-5p relative expression levels in urine-derived exosome preparations based on the smoking habits of 11 female lung cancer patients. FIG. 5A is a graph comparing miR-21 relative expression levels in urine-derived exosome preparations in 40 healthy individuals and 35 lung cancer patients. FIG. 5B is a graph comparing miR-21 relative expression levels in urinary exosome preparations in 20 healthy and 24 lung cancer patients in males. FIG. 5C is a graph comparing miR-21 relative expression levels in urine-derived exosome preparations in 20 healthy and 11 lung cancer patients in women. FIG. 5D is a graph comparing miR-21 relative expression levels in urine-derived exosome preparations to healthy controls based on clinical stage of 35 lung cancer patients. FIG. 5E is a graph comparing miR-21 relative expression levels in urine-derived exosome preparations to healthy male subjects based on clinical stage of 24 male lung cancer patients. FIG. 5F is a graph comparing miR-21 relative expression levels in urine-derived exosome preparations to healthy female subjects based on clinical stage of 11 female lung cancer patients. FIG. 5G is a graph comparing miR-21p relative expression levels in urine-derived exosome preparations based on smoking habits of 35 lung cancer patients. FIG. 5H is a graph comparing miR-21 relative expression levels in urine-derived exosome preparations based on smoking habits of 24 male lung cancer patients. FIG. 5I is a graph comparing miR-21 relative expression levels in urine-derived exosome preparations based on smoking habits of 11 female lung cancer patients. FIG. 6A is an ROC curve for examining whether detection of lung cancer using MMP-1/CD63 is valid. "MMP-1" in the figure means MMP-1/CD63. FIG. 6B is an ROC curve examining the validity of lung cancer detection using miR-486-5p relative expression level in males. "mir-486" in the figure means miR-486-5p. FIG. 6C is an ROC curve examining whether detection of lung cancer using miR-486-5p relative expression level is appropriate in women. "mir-486" in the figure means miR-486-5p.

Next, the present invention will be specifically described.
The present invention is roughly divided into four aspects.

The first aspect comprises the step (A1) of measuring the expression level of microRNA-486-5p (miR-486-5p) contained in urinary exosomes of a subject, a lung cancer testing method. This examination method is referred to as lung cancer examination method (I).

The second aspect is the step of measuring the expression level of matrix metalloprotease-1 (MMP-1) contained in the urinary exosomes of the subject (B1), the expression level of the exosome-specific protein contained in the urinary exosomes A lung cancer test method comprising the step of measuring (B2) and the step of calculating the expression level of the MMP-1 / the expression level of the exosome-specific protein (B3). This examination method is referred to as lung cancer examination method (II).

A third aspect is a urine test kit for evaluating lung cancer, comprising an exosome preparation reagent and a microRNA-486-5p (miR-486-5p) measurement reagent. This urine test kit is called a urine test kit for lung cancer evaluation (I).

A fourth aspect includes an exosome preparation reagent, a matrix metalloprotease-1 (MMP-1) measurement reagent and an exosome-specific protein measurement reagent, a urine test kit for lung cancer evaluation. This urine test kit is called a urine test kit for lung cancer evaluation (II).

<subject>
Subjects in the present invention are generally, but not limited to, humans.

<urine>
Urine used in the present invention may be normal urine collected from a subject, and the time and timing of collection are not limited. In order to prevent bacterial contamination from the urethra and vulva, mid-stream urine is preferable, and since it excludes the effects of body movement and exercise, and because it is highly concentrated urine, early-morning urine collected first after waking up is preferred. preferable.

The collected urine may be immediately subjected to step (A1) or step (B1), or may be stored and then used. Urine is usually stored in an ultra-low temperature layer of -80°C class.
The collected urine is usually centrifuged before step (A1) or step (B1) to remove solids such as red blood cells, white blood cells, uric acid crystals, cells, and bacteria. In addition, before performing step (A1) or step (B1), pretreatment such as filter filtration, concentration, or dilution may be performed within a range that does not affect the measurement of the expression level of miR-486-5p or MMP-1. good.
The amount of urine to be subjected to step (A1) or step (B1) is not particularly limited as long as the expression level of miR-486-5p or MMP-1 can be measured, but is preferably 1.0 mL to 15 mL, and 2.0 mL to 10 mL. is more preferred.

〈Exosomes〉
Exosomes are membrane vesicles 20-200 nm in diameter that are secreted by cells. The diameter of exosomes is more preferably between 30 nm and 150 nm.
Step (A1) or step (B1), since the presence of exosomes can be confirmed, prepare an exosome preparation in which exosomes are separated and purified from urine, and miR-486-5p expression level or MMP in the exosome preparation -1 expression level is preferably measured.

When preparing exosome preparations from urine, the method is not particularly limited, for example, ultracentrifugation, ultrafiltration, gel filtration, HPLC, filter method, polymer precipitation method, antibody or lectin Examples include a method of adsorbing to beads and columns, and commercially available exosome isolation and purification spin columns such as Exosome Isolation Kit, Total Exosome Isolation series, ExoTrap ^™ , PureExo ^™ , DIAG Exo ^™, etc. kits and the like. In order to prepare exosome preparations in the present invention, it is preferable to use the bead method, and it is more preferable to use Myltenyi's Exosome Isolation Kit because the operation is simple and the purity of exosomes is high.

It is preferable to confirm that the exosomes are round in shape and size, and examples thereof include electron microscopy and dynamic light scattering methods. Electron microscopy is preferred because it allows visual confirmation of not only the size but also the shape of exosomes.

Exosomes preferably confirm the presence of exosome-specific proteins, and means thereof include, for example, Western blotting. Exosome-specific proteins are described below.

<measurement>
In the present invention, measuring or measuring means determining relative abundance or absolute abundance.

<lung cancer>
Lung cancer in the present invention refers to a malignant tumor that develops in any tissue of the lung. Lung cancer may be either primary lung cancer or metastatic lung cancer, preferably primary lung cancer. Lung cancer is mostly non-small cell cancer such as adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma and large cell carcinoma, followed by small cell lung cancer, pleomorphic carcinoma and sarcoma. Lung cancer in the present invention may be any of these. Among these, adenocarcinoma refers to cancer that develops in the secretory gland tissue of the lung.

Lung cancer in the present invention is clinical stage 0, IA1, IA2, IA3, IB, IIA, IIB, IIIA, IIIB, IIIC, IVA, IVB according to lung cancer TNM classification 8th edition. It can be at any stage of the period. Lung cancer with a mass of 2 cm or less, or clinical stage 0, IA1, IA2, IA3, or IB according to the 8th edition of the TNM classification of lung cancer, is an early stage of early lung cancer. It is lung cancer that is difficult to detect by conventional lung cancer screening methods, especially plain X-ray photography. The term “early lung cancer” generally refers to lung cancer without metastasis.

<Lung cancer test method>
The lung cancer testing method of the present invention is a method of testing using a sample (urine) collected from a subject such as a human body. method that includes the step of judging the physical or mental condition of a human being, such as a medical condition or health condition).
The method for testing lung cancer of the present invention includes "a method for testing lung cancer that provides data on lung cancer", "a method for determining the possibility that a subject has lung cancer", and "a method for determining the possibility that a subject has lung cancer". "Method for assessing sexuality", "Method for testing the possibility that a subject is afflicted with lung cancer", "Method for determining whether or not a subject is afflicted with lung cancer", or "Method for determining lung cancer", etc. can be paraphrased. In addition, since the method for examining lung cancer of the present invention provides examination results that serve as materials for a doctor to diagnose lung cancer of a target, "a method of collecting data for diagnosing lung cancer", " It can also be rephrased as "a method of analyzing diagnostic information for estimating that a subject is afflicted with lung cancer" or "a method of analyzing diagnostic information for assisting in estimating that a subject is afflicted with lung cancer". can.

Since the method for testing lung cancer of the present invention is useful for screening for early stage lung cancer, it is preferably used as a lung cancer screening test for people who appear to be healthy and have no symptoms. Since the lung cancer examination method of the present invention can be performed simply and inexpensively, it is preferably used as a preliminary step for chest X-ray examination, sputum cytology, chest CT examination, bronchoscopy, or biopsy. In the lung cancer examination method, when the lung cancer examination method indicates that the subject is likely to be suffering from lung cancer, interview by a specialist doctor, chest X-ray examination, sputum cytology, chest More preferably, it is used to recommend CT examination, bronchoscopy, or biopsy.

<Lung cancer test method (I)>
Lung cancer test method (I) includes a step (A1) of measuring the expression level of microRNA-486-5p (miR-486-5p) contained in urinary exosomes of a subject, a lung cancer test method.

Since the possibility of contracting lung cancer can be determined with high accuracy, lung cancer in lung cancer testing method (I) is clinical stage IA1, IA2, IA3, or IB.

Lung cancer in lung cancer testing method (I) is preferably lung cancer in non-smokers, more preferably lung cancer in female non-smokers, since the possibility of contracting lung cancer can be determined with high accuracy.

<Step (A1)>
In the step (A1), microRNA-486-5p contained in urinary exosomes of the subject (also referred to as miR-486-5p, microRNA-486-5p, miRNA-486-5p, hsa-miR-486-5p) is a step of measuring the expression level of

<MicroRNA-486-5p (miR-486-5p)>
miR-486-5p is the 5p form of microRNA-486 (miR-486) encoded by the MIR486-1 gene on chromosome 8 (8p11.21) of the human genome.
Pri-miR-486 transcribed from the MIR486-1 gene by RNA polymerase II is cleaved by Drosha in the nucleus to generate Pre-miR-486. Pre-miR-486 then undergoes an RNA-induced silencing complex (RISC) in the cytosol to generate single-stranded RNAs, miR-486-5p and miR-486-3p. In Pre-miR-486, miR-486 on the 5' side is called miR-486-5p, and miR-486 on the 3' side is called miR-486-3p type. The sequence of miR-486-5p (miRBase Accession: MIMAT0002177) is UCCUGUACUGAGCUGCCCCGAG (SEQ ID NO: 1).

The expression level of miR-486-5p can be either absolute expression level or relative relative expression level.
As the absolute expression level of miR-486-5p, the copy number or weight of miR-486-5p can be used.

The method for measuring the expression level of miR-486-5p is not particularly limited as long as the expression level of miR-486-5p can be measured, and known methods can be used. , RNA Sequencing (RNA-Seq), Multiplex miRNA profiling, and the like.
The expression level of miR-486-5p may be measured using a commercially available kit. Commercially available kits for quantitative RT-PCR include miRNA-486-5p assay kit (manufactured by Applied Biosystems).
As a method for measuring miR-486-5p, quantitative RT-PCR is preferable because the operation is simple and excellent in quantification, and quantitative RT-PCR using miRNA-486-5p assay kit (manufactured by Applied Biosystems) is more preferable. preferable.

When the expression level of miR-486-5p is measured by quantitative RT-PCR, it is preferably a relative expression level with respect to the expression level of healthy subjects, and individual miR-486 of lung cancer patients or healthy subjects in quantitative RT-PCR -5p CT (Threshold Cycle), 2ΔCT value obtained from ΔCT calculated by subtracting the average ^CT value of miR-486-5p in all healthy subjects (ΔCT power of 2) more preferable.
Since the number of cycles in which miR-486-5p is amplified in quantitative RT-PCR differs between healthy males and females, the average CT value of miR-486-5p in all healthy individuals is It is preferable to calculate ΔCT by subtracting the value according to the sex of the lung cancer patient or healthy person.

Since the expression level of miR-486-5p differs between healthy subjects and lung cancer patients, the lung cancer test method (I) can be used to determine the presence or absence of lung cancer.
Lung cancer test method (I) preferably compares the expression level of miR-486-5p obtained in step (A1) with a reference value obtained from the expression level of miR-486-5p in healthy subjects. Accordingly, it is determined that the subject is highly likely to be suffering from lung cancer.

Since the expression level of miR-486-5p in male lung cancer patients is greater than that in healthy male subjects, when the expression level of miR-486-5p obtained in step (A1) is greater than the reference value (M) , it can be determined that the subject is likely to be suffering from lung cancer.
Therefore, in the lung cancer test method (I), preferably, when the subject is male, the expression level of miR-486-5p obtained in step (A1) is greater than the reference value (M). It indicates that the subject is likely to be suffering from lung cancer.

The reference value (M) is not particularly limited, and the expression level of miR-486-5p contained in urinary exosomes of male lung cancer patients and the expression level of miR-486-5p contained in urinary exosomes of healthy male subjects can be determined as appropriate by comparing the .

The reference value (M) is preferably the expression level of miR-486-5p contained in urinary exosomes of a healthy male. The expression level of miR-486-5p contained in the urinary exosomes of healthy male subjects is preferably a method for measuring the expression level of miR-486-5p obtained from a group of healthy male subjects, preferably It is a value or numerical range calculated from multiple measurement results obtained by quantitative RT-PCR, and examples thereof include mean, median, mean±standard deviation, and the like.
The reference value (M) is preferably determined based on the ROC curve.

The expression level of miR-486-5p contained in urinary exosomes of a healthy male subject may be measured in the same manner as in the step (A1) using urine of a healthy male subject as a sample.
A healthy subject is one who is not suspected of having lung cancer on chest X-ray examination or who has not been diagnosed with lung cancer.

Since the expression level of miR-486-5p in female lung cancer patients is lower than that in healthy female subjects, when the expression level of miR-486-5p obtained in step (A1) is smaller than the reference value (F) , it can be determined that the subject is likely to be suffering from lung cancer.
Therefore, in the lung cancer testing method (I), preferably, when the subject is a woman, the expression level of miR-486-5p obtained in step (A1) is lower than the reference value (F). It indicates that the subject is likely to be suffering from lung cancer.

The reference value (F) is not particularly limited, and the expression level of miR-486-5p contained in urinary exosomes of female lung cancer patients and the expression level of miR-486-5p contained in urinary exosomes of healthy female subjects can be determined as appropriate by comparing the .

The reference value (F) is preferably the expression level of microRNA-486-5p (miR-486-5p) contained in urinary exosomes of healthy female subjects. The expression level of miR-486-5p contained in the urinary exosomes of healthy female subjects is preferably obtained from a group of healthy female subjects. Method for measuring the expression level of miR-486-5p, preferably It is a value or numerical range calculated from multiple measurement results obtained by quantitative RT-PCR, and examples thereof include mean, median, mean±standard deviation, and the like.
The reference value (F) is preferably determined based on the ROC curve.

The expression level of miR-486-5p contained in urinary exosomes of a healthy female subject may be measured in the same manner as in the step (A1) using urine of a healthy female subject as a sample.

<Step (A2), Step (A3)>
Lung cancer test method (I) includes, in addition to step (A1),
Step (A2) of measuring the expression level of miR-486-5p contained in urinary exosomes of healthy subjects, and comparing the results obtained in the step (A1) with the results obtained in the step (A2) and determining the possibility of suffering from lung cancer (A3)
may include

Lung cancer test method (I), when the subject is male, in addition to step (A1),
Step of measuring the expression level of miR-486-5p contained in urinary exosomes of healthy males (A2M1),
A step (A2M2) of calculating a reference value (M) from the result obtained in the step (A2M1), and comparing the result obtained in the step (A1) with the reference value (M), the step (A1 ) is greater than the reference value (M), the step of determining that the subject is likely to have lung cancer (A3M)
may include

In the lung cancer test method (I), when the subject is a woman, in addition to the step (A1),
Step of measuring the expression level of miR-486-5p contained in urinary exosomes of healthy female subjects (A2F1),
A step (A2F2) of calculating a reference value (F) from the result obtained in the step (A2M1), and comparing the result obtained in the step (A1) with the reference value (F), the step (A1 ) is smaller than the reference value (F), the step of determining that the subject is likely to have lung cancer (A3F)
may include

<Other processes>
Lung cancer test method (I), in order to improve the sensitivity and specificity of the determination of the possibility of lung cancer, preferably further contains matrix metalloprotease-1 (MMP-1) contained in urinary exosomes of the subject The step of measuring the expression level of (B1), the step of measuring the expression level of the exosome-specific protein contained in the urinary exosomes (B2), and the expression level of the MMP-1 / the expression level of the exosome-specific protein including a step (B3) of calculating
That is, it is preferable to combine the lung cancer examination method (I) with the lung cancer examination method (II). A lung cancer examination method combining the lung cancer examination method (I) and the lung cancer examination method (II) is referred to as a lung cancer examination method (III).
The details of the lung cancer examination method (II), step (B1), step (B2), and step (B3) will be described later.

Urine used in step (B1) in lung cancer test method (I) may be obtained from the same subject as the urine used in step (A1), and the time of collection is not limited. In order to facilitate the test, the urine used in step (B1) is preferably collected at the same time as the urine used in step (A1).
The order of performing step (A1) and step (B1) is not limited, and the two steps may be performed simultaneously.

<Lung cancer test method (II)>
Lung cancer test method (II) includes the step of measuring the expression level of matrix metalloprotease-1 (MMP-1) contained in the urinary exosomes of the subject (B1), the exosome-specific protein contained in the urinary exosomes A lung cancer test method comprising the step of measuring the expression level (B2) and the step of calculating the expression level of the MMP-1 / the expression level of the exosome-specific protein (B3).

Lung cancer in the lung cancer test method (II) is preferably clinical stage 0, IA1, IA2, IA3, IB, IIA, or IIB because the possibility of contracting lung cancer can be determined with high accuracy. any of lung cancer, more preferably clinical stage IA1, IA2, IA3, IB, IIA, or IIB lung cancer, more preferably clinical stage IA1, IA2, Lung cancer, either stage IA3 or stage IB.

Lung cancer in the lung cancer test method (II) is preferably adenocarcinoma or small cell carcinoma, more preferably adenocarcinoma, since the possibility of contracting lung cancer can be determined with high accuracy.

Lung cancer in lung cancer testing method (II) is preferably lung cancer in nonsmokers, more preferably adenocarcinoma in nonsmokers, still more preferably Adenocarcinoma in a nonsmoker woman.

<Step (B1)>
Step (B1) is a step of measuring the expression level of matrix metalloprotease-1 (MMP-1) contained in urinary exosomes of the subject.

Matrix metalloprotease-1 (MMP-1) is also referred to as MMP-1, mmp-1.
MMP-1, also called collagenase 1, is a protease that degrades collagen types I, II, and III, cleaving collagen molecules at sites 3:1 from the N-terminus. MMP-1 is said to create a space for cancer cells to proliferate and move by degrading collagen around cancer cells, and is an extracellular matrix (ECM) in cancer invasion. An enzyme that plays a central role in decomposition.

MMP-1 is first expressed as an inactive latent form of MMP-1 (ProMMP-1), and the propeptide portion of ProMMP-1 is cleaved to form the 54 kDa active form of MMP-1. The activity of MMP-1 is controlled by forming a complex between ProMMP-1, active MMP-1, and tissue inhibitors of metalloproteinases (TIMPs), which are MMP-1 inhibitors.

MMP-1 whose expression level is measured in the present invention is active MMP-1.
The expression level of MMP-1 may be either absolute expression level or relative expression level.
The method for measuring the expression level of MMP-1 is not particularly limited as long as it is a method capable of measuring the expression level of MMP-1 protein. Examples include methods using mass spectrometry such as graphy-tandem mass spectrometry (LC-MC/MC) and multiple reaction monitoring (MRM). Western blotting using an anti-MMP-1 antibody is preferable as a method for measuring the expression level of MMP-1 because the operation is simple and the quantification is excellent. A more preferable method is to measure from the density of the band.
A commercially available anti-MMP-1 antibody may be used, for example, an anti-MMP-1 rabbit polyclonal antibody, a rabbit-derived anti-MMP-1 antibody (manufactured by abcam, NO.ab134184).

<Step (B2)>
Step (B2) is a step of measuring the expression level of exosome-specific protein contained in the urinary exosomes.

Examples of exosome-specific proteins include proteins belonging to the tetraspanin family expressed on the surface of exosomes, proteins belonging to HSP70 and Rab family present in exosomes, and more specifically CD63, CD9, CD81, CD37, CD53, CD82, CD13, CD11, CD86, ICAM-1, Rab5, Annexin V, and LAMP1. Among these, the exosome-specific protein is preferably a protein belonging to the tetraspanin family, more preferably CD63, CD9, CD81, CD37, CD53, CD82, CD13, CD11, or CD86, still more preferably CD63, CD9, or CD81, particularly preferably CD63.

The expression level of the exosome-specific protein may be either absolute expression level or relative expression level.
The method for measuring the expression level of exosome-specific protein is not particularly limited as long as it is a method that can measure the expression level of exosome-specific protein, for example, Western blotting, ELISA, etc. A method using an antibody against exosome-specific protein, Methods using mass spectrometry such as liquid chromatography/tandem mass spectrometry (LC-MC/MC) and multiple reaction monitoring (MRM) can be mentioned. The method of measuring the expression level of exosome-specific proteins is preferably a method using an antibody against exosome-specific proteins because it is easy to operate and has excellent quantification, and Western blotting using antibodies against exosome-specific proteins is more preferable. More preferred is a method of measuring from the density of bands specific to exosome-specific proteins detected by Western blotting.

Antibodies against exosome-specific proteins are not particularly limited, and commercially available products may be used. Commercially available products include, for example, biotinylated anti-CD63 antibody (BioLegend, NO.353017), Purified Mouse Anti-Human CD63 (Nippon Becton Dickinson, clone: H5C6), Purified Mouse Anti-Human CD9 (Nippon Becton・ Dickinson, clone: M-L13), Purified Mouse Anti-Human CD81 (Nippon Becton Dickinson, clone: JS-81), Purified Mouse Anti-Human CD37 (Nippon Becton Dickinson, clone: M -B371), Purified Mouse Anti-Human CD53 (manufactured by Nippon Becton Dickinson, clone: HI29), Anti-CD82 antibody [C33] (manufactured by Abcam), Purified Mouse Anti-Human CD13 (manufactured by Nippon Becton Dickinson, Clone: WM15), Purified Mouse Anti-Human CD11a (Nippon Becton Dickinson, Clone: 27/CD11a), Purified Mouse Anti-Human CD11b/Mac-1 (Nippon Becton Dickinson, Clone: ICRF44), Purified Mouse Anti-Human CD11c (manufactured by Nippon Becton Dickinson, clone: 3.9), Purified Mouse Anti-Human CD86 (manufactured by Nippon Becton Dickinson, clone: 2331 (FUN-1)), Anti-ICAM1 antibody [HM1 ] (manufactured by Abcam), Purified Mouse Anti-Rab5 (manufactured by Nippon Becton Dickinson, clone: 1/Rab5), Anti-Annexin V antibody [EPR3979] (manufactured by Abcam), Purified Mouse Anti-Human Lamp-1 ( Nippon Becton Dickinson, Clone: 25/Lamp-1) and the like.

The urine used in step (B2) is the same as the urine used in step (B1).
The order of performing step (B1) and step (B2) is not limited, and the two steps may be performed simultaneously.

<Step (B3)>
Step (B3) is a step of calculating the expression level of the MMP-1 / expression level of the exosome-specific protein.
In step (B3), the expression level of MMP-1 is divided by the expression level of exosome-specific protein, which is the expression level ratio of MMP-1 and exosome-specific protein, MMP-1 / exosome-specific protein is calculated. do. For example, when using CD63 as an exosome-specific protein, a value obtained by dividing the expression level of MMP-1 protein by the expression level of CD63 protein, MMP-1/CD63 is calculated.

Since the expression level of exosome-specific proteins does not change depending on whether the patient is a lung cancer patient or a healthy individual, by dividing the expression level of MMP-1 protein by the expression level of exosome-specific protein, the amount of urinary exosomes and the variation due to sample preparation can be calculated. etc. can be eliminated and standardized.

The value obtained in step (B3), i.e., MMP-1 / exosome-specific protein, is different between healthy people and lung cancer patients, so the lung cancer test method (II) determines the possibility of affliction with lung cancer available for
Lung cancer test method (II) preferably compares the MMP-1/exosome-specific protein with a reference value obtained from the MMP-1/exosome-specific protein of a healthy subject, so that the subject is diagnosed with lung cancer It is determined that there is a high possibility that

MMP-1 / exosome-specific protein of lung cancer patients is higher than that of healthy subjects, so if the MMP-1 / exosome-specific protein obtained in step (B1) is greater than the reference value (T), the subject can be determined to have a high possibility of suffering from lung cancer.
Therefore, in the lung cancer testing method (II), preferably, the MMP-1 / exosome-specific protein obtained in step (B1) is greater than the reference value (T), the subject is suffering from lung cancer This indicates that there is a high possibility that

The reference value (T) is not particularly limited, and can be appropriately determined by comparing the MMP-1/exosome-specific protein of lung cancer patients and the MMP-1/exosome-specific protein of healthy subjects.
The reference value (T) is preferably the MMP-1/exosome-specific protein of healthy individuals. The MMP-1 / exosome-specific protein of healthy subjects is preferably a value or numerical range calculated from a plurality of measurement results obtained from a group of healthy subjects, such as the average value, median value, average Value ± standard deviation and the like.
The reference value (T) is preferably determined based on the ROC curve.

MMP-1 / exosome-specific protein of a healthy subject may be measured and calculated in the same manner as in the steps (B1), (B2), and (B3) using the urine of a healthy subject as a sample.
A healthy subject is one who is not suspected of having lung cancer on chest X-ray examination or who has not been diagnosed with lung cancer.

<Other processes>
In the lung cancer test method (II), in addition to the steps (B1), (B2), and (B3),
Step of measuring the expression level of MMP-1 contained in urinary exosomes of a healthy person (B4),
The step of measuring the expression level of the exosome-specific protein contained in the urinary exosomes of healthy subjects (B5),
The step of calculating the expression level of MMP-1 / the expression level of the exosome-specific protein (B6), and comparing the results obtained in the step (B3) with the results obtained in the step (B6) , the step of determining the possibility of suffering from lung cancer (B7-1)
may include

In the lung cancer test method (II), in addition to the steps (B1), (B2), and (B3),
Step of measuring the expression level of MMP-1 contained in urinary exosomes of a healthy person (B4),
Step (B5) of measuring the expression level of exosome-specific proteins contained in the urinary exosomes of healthy subjects, and calculating the expression level of MMP-1 / the expression level of exosome-specific proteins (B6),
A step (B6-2) of calculating a reference value (T) from the results obtained in the step (B6);
The result obtained in step (B3) is compared with a reference value (T), and if the result obtained in step (B3) is greater than the reference value (T), the subject has lung cancer. Step of determining that there is a high possibility that
may include

<Lung cancer test method (III)>
Lung cancer test method (III) is a combination of lung cancer test method (I) and lung cancer test method (II), so that lung cancer test method (I) alone or lung cancer test method (II) alone is more effective than lung cancer test method (II) alone. It is possible to determine the possibility of affliction with more accuracy.

If there is a change in the expression level of miR-486-5p, false positives and false negatives may be included, but by measuring the expression level of MMP-1 in addition to the miR-486-5p expression level, false positives and False negatives can be reduced. In addition, since the expression level of MMP-1 changes in breast cancer, prostate cancer, hepatocellular carcinoma, etc., if there is a change in the expression level of miR-486-5p and MMP-1, Suspect the presence of a primary tumor outside the lungs or that the cancer has metastasized beyond the lungs, based on complaints, physical findings, and examination data other than lung cancer examination method (III). becomes possible.

If there is a change in the expression level of MMP-1, diseases such as breast cancer, prostate cancer, and hepatocellular carcinoma are suspected based on existing information, but in addition to MMP-1 expression level, miR-486-5p expression level By measuring , it becomes possible to suspect lung cancer in preference to other diseases.

Lung cancer in the lung cancer test method (III) is preferably clinical stage 0, IA1, IA2, IA3, IB, IIA, or IIB, since the possibility of contracting lung cancer can be determined with high accuracy. any of lung cancer, more preferably clinical stage IA1, IA2, IA3, IB, IIA, or IIB lung cancer, more preferably clinical stage IA1, IA2, Lung cancer, either stage IA3 or stage IB.

Lung cancer in the lung cancer test method (III) is preferably adenocarcinoma or small cell carcinoma, more preferably adenocarcinoma, because the possibility of contracting lung cancer can be determined with high accuracy.

Lung cancer in lung cancer test method (III) is preferably lung cancer in non-smokers, more preferably adenocarcinoma in non-smokers or non-smoker women and more preferably adenocarcinoma in non-smoker women.

The expression level of miR-486-5p in male lung cancer patients is greater than in healthy male subjects, and the MMP-1/exosome-specific protein in lung cancer patients is higher than in healthy subjects. , In the lung cancer testing method (I), the expression level of miR-486-5p obtained in step (A1) is greater than the reference value (M), and in the lung cancer testing method (II), step (B1 ) is greater than the reference value (T), it can be determined that the subject is likely to have lung cancer.
Therefore, when the subject is male, the lung cancer testing method (III) is preferably performed in the lung cancer testing method (I), wherein the expression level of miR-486-5p obtained in step (A1) is the reference value ( M), and in the lung cancer test method (II), the MMP-1 / exosome-specific protein obtained in step (B1) is greater than the reference value (T), the subject is lung cancer It indicates that there is a high possibility of being affected.

The expression level of miR-486-5p in female lung cancer patients is lower than in healthy female subjects, and the MMP-1/exosome-specific protein in lung cancer patients is higher than in healthy subjects. , In the lung cancer testing method (I), the expression level of miR-486-5p obtained in step (A1) is smaller than the reference value (F), and in the lung cancer testing method (II), step (B1 ) is greater than the reference value (T), it can be determined that the subject is likely to have lung cancer.
Therefore, when the subject is a female, lung cancer testing method (III) is preferably performed in lung cancer testing method (I) in which the expression level of miR-486-5p obtained in step (A1) is the reference value ( F), and in the lung cancer test method (II), the MMP-1 / exosome-specific protein obtained in step (B1) is greater than the reference value (T), the subject has lung cancer It indicates that there is a high possibility of being affected.

<Urine test kit for lung cancer evaluation>
The urine test kit for evaluating lung cancer of the present invention is a kit for evaluating lung cancer using a sample (urine) collected from a subject.
Evaluating lung cancer includes diagnosing lung cancer, estimating the presence or absence of morbidity with lung cancer or the possibility of morbidity, or assisting them, such as the clinical stage of lung cancer or the degree of lung cancer Including estimating, determining or evaluating or assisting in classification.

The urine test kit for evaluating lung cancer of the present invention may be used by the subject to be tested, or may be used by medical personnel (doctors, nurses, pharmacists, clinical laboratory technologists, etc.). Preferably done by a doctor.

Since the urine test kit for lung cancer evaluation of the present invention can be performed simply and inexpensively, it can be used for chest X-ray examination, sputum cytology, chest CT examination, bronchoscopy, or pre-stage examination for biopsy. is preferred. The urine test kit for evaluating lung cancer of the present invention is used when the urine test kit for evaluating lung cancer of the present invention indicates the possibility that the subject is suffering from lung cancer. More preferably, it is used to recommend radiography, sputum cytology, chest CT, bronchoscopy, or biopsy.

<Urinalysis kit for lung cancer evaluation (I)>
Urine test kit for lung cancer evaluation (I) is a urine test kit for lung cancer evaluation, including an exosome preparation reagent and a microRNA-486-5p (miR-486-5p) measurement reagent.

Exosome preparation reagent is a reagent for separating and purifying exosomes from urine to prepare exosome preparations, and the preparation method is not particularly limited. For example, ultracentrifugation, ultrafiltration, gel filtration, HPLC, filter method, precipitation method using polymer, method of adsorbing to beads or columns using antibody or lectin, etc., and commercially available products applying these are available. Exosome Isolation Kit, Total Exosome Isolation series, ExoTrap ^™ , PureExo ^™ , DIAG Exo ^™ , and other commercially available exosome separation and purification spin columns, kits, and the like.

MicroRNA-486-5p (miR-486-5p) measurement reagent is a reagent for measuring the amount of miR-486-5p contained in urinary exosomes, the measurement method is not limited. As miR-486-5p measurement reagents, for example, miR-486-5p-specific primers used for quantitative RT-PCR, microRNA array, RNA sequencing (RNA-Seq), or Multiplex miRNA profiling, and miR -486-5p specific probes and the like.

Without preparing an exosome preparation from urine, when detecting exosomes directly from urine, urine test kit for lung cancer evaluation (I), instead of the exosome preparation reagent, may contain an exosome detection reagent. That is, the lung cancer evaluation urine test kit (I) may be a lung cancer evaluation urine test kit containing an exosome detection reagent and a microRNA-486-5p (miR-486-5p) measurement reagent.
Exosome detection reagent is a reagent for detecting exosomes directly from urine without separation and purification of exosomes, the detection method is not particularly limited. Examples include antibodies, aptamers, and the like that specifically recognize exosomes, which are used for on-instrument detection of exosome-containing fractions by flow cytometry, microarray, surface plasmon resonance, or the like.

Exosome preparation reagent, exosome detection reagent or miR-486-5p measurement reagent, as long as it does not interfere with the effects of the present invention, further stabilizers, pH adjusters and emulsifiers may contain known optional components.

Urine test kit (I) for lung cancer evaluation includes washing, concentration, dilution, fixation, drying, storage, staining, coloring, observation, etc., in addition to exosome preparation reagents, exosome detection reagents and miR-486-5p measurement reagents. Other reagents for the assay may be included, and labware and the like may be included as necessary.

<Urinalysis kit for lung cancer evaluation (II)>
Urine test kit for lung cancer evaluation (II) includes an exosome preparation reagent, a matrix metalloprotease-1 (MMP-1) measurement reagent and an exosome-specific protein measurement reagent, a urine test kit for lung cancer evaluation.

The exosome preparation reagent in the urine test kit for lung cancer evaluation (II) is the same as the exosome preparation reagent in the urine test kit for lung cancer evaluation (I).

Matrix metalloprotease-1 (MMP-1) measurement reagent is a reagent for measuring MMP-1 contained in urinary exosomes, the measurement method is not limited. Examples thereof include antibodies, aptamers, etc. that specifically recognize the MMP-1 molecule used in Western blotting and ELISA.

Exosome-specific protein measurement reagent is a reagent for measuring exosome-specific protein contained in urinary exosomes, the measurement method is not limited. Examples thereof include antibodies, aptamers, etc. that specifically recognize exosome-specific proteins used in Western blotting and ELISA.

Without preparing an exosome preparation from urine, if exosomes are detected directly, the urine test kit for lung cancer evaluation (II) can use an exosome detection reagent instead of an exosome preparation reagent. That is, the urine test kit for lung cancer evaluation (II) includes an exosome detection reagent, a matrix metalloprotease-1 (MMP-1) measurement reagent and an exosome-specific protein measurement reagent, and is a urine test kit for lung cancer evaluation. may
Exosome detection reagent is a reagent for detecting exosomes directly from urine without separation and purification of exosomes, the detection method is not particularly limited. Examples include antibodies, aptamers, and the like that specifically recognize exosomes, which are used for on-instrument detection of exosome-containing fractions by flow cytometry, microarray, surface plasmon resonance, or the like.

Exosome preparation reagents, exosome detection reagents, matrix metalloprotease-1 (MMP-1) measurement reagents, or exosome-specific protein measurement reagents, as long as they do not interfere with the effects of the present invention, are further stabilizers, pH adjusters, emulsifiers, etc. may contain known optional ingredients.

Urine test kit (II) for evaluating lung cancer is exosome preparation reagent, or exosome detection reagent, matrix metalloprotease-1 (MMP-1) measurement reagent and exosome-specific protein measurement reagent, washing, concentration, dilution, fixation , drying, storage, staining, color development, observation, and other reagents, and if necessary, laboratory utensils and the like.

EXAMPLES Next, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to these.

[Example 1] Relationship between miR-486-5p and MMP-1/CD63 contained in urinary exosomes and lung cancer [subject]
This study was approved by the Ethics Committee of International University of Health and Welfare Hospital and Kitasato University Medical Center, and was conducted after obtaining written informed consent from the subjects. The subjects were 35 lung cancer patients and 40 healthy individuals.
Thirty-five lung cancer patients (24 males, 11 females, mean age 71.0 ± 8.4 years old, 64.8 ± 9.5 years old, respectively) were screened for lung cancer using chest X-ray, chest CT, and chest MRI. was diagnosed, and a needle biopsy was performed before surgery if necessary. Final pathological diagnosis was made by surgical resection.

The test controls were 40 healthy people (20 men, 20 women) selected from among 533 people (351 men, 182 women) who visited the Department of Preventive Medicine, International University of Health and Welfare Hospital for a health checkup. did. Five or more people in their 40s, 50s, 60s, and 70s or older selected each sex (Table 3). All 40 healthy subjects had no complaints, and had abnormal physical findings such as obesity and blood-induced hypertension, abnormal peripheral blood tests and blood chemistry tests, abnormal electrocardiographic findings, chest X-ray and upper gastrointestinal endoscopy. , there were no abnormalities on abdominal echocardiography. They also had no history of chronic diseases such as cancer, signs of dysplasia, inflammatory disease, autoimmune disease, heart disease, liver disease, or kidney disease.

The height and weight of the subjects were measured, and their alcohol intake (g/day) and smoking were investigated in advance. Blood was collected from the subject, and according to a conventional method, tumor markers CEA (Carcinoembryonic antigen), creatinine CRNN (mg / dL), total protein (TP; total protein, g / dL), and ALT (alanine aminotransferase, IL / dL) ) was measured.
In addition, the pathological tissue of surgically resected lung cancer was immunostained with an anti-PD-L1 mouse monoclonal antibody (clone: 22C3) to measure the ratio of PDL-1 expression-positive cells in the main cells, and PDL1 (programmed cell Death 1-Ligand 1) (%).

[Collection of urine samples]
Early morning urine collected before ingesting breakfast was used as a sample and stored at -80 ° C. until exosomes were separated. All samples were taken before the patient underwent surgery, chemotherapy, or radiotherapy, or in the absence of evidence of distant metastasis.

[Clinical stage of lung cancer]
The clinical stage of lung cancer was classified according to the TNM classification of lung cancer, 8th edition. The outline of the criteria is as follows.

T: Primary tumor TX: Presence of primary tumor cannot be determined, or positive only in sputum or bronchial lavage fluid cytology and not observable by diagnostic imaging or bronchoscopy T0: No primary tumor observed Tis: carcinoma in situ : In the case of lung field type, solid component diameter 0 cm and total lesion diameter ≤ 3 cm
T1: Tumor solid component diameter ≤ 3 cm, covered by lung or visceral pleura, no central invasion from lobar bronchi observed bronchoscopy (i.e., does not extend to main bronchi)
T1mi: minimally invasive adenocarcinoma: partially solid type, solid component diameter ≤ 0.5 cm and overall lesion diameter ≤ 3 cm
T1a: solid component diameter ≤ 1 cm and does not correspond to Tis·T1mi T1b: solid component diameter > 1 cm and ≤ 2 cm
T1c: solid component diameter >2 cm and ≤3 cm

T2: Solid component diameter >3 cm and ≤5 cm, or solid component diameter ≤3 cm but any of the following: - Involves the main bronchi but not the carina - Involves the visceral pleura - Continues to the hilum T2a with partial or unilateral atelectasis or obstructive pneumonitis: solid component diameter >3 cm and ≤4 cm
T2b: solid component diameter >4 cm and ≤5 cm

T3: Solid component diameter >5 cm and ≤7 cm, or solid component diameter ≤5 cm but any of the following-parietal pleura, chest wall (including superior sulcus tumor), phrenic nerve, pericardium Direct invasion - discrete secondary tumor nodules within the same lobe

T4: Solid component diameter >7 cm, or involvement of any size in the diaphragm, mediastinum, heart, great vessels, trachea, recurrent laryngeal nerve, esophagus, vertebral body, carina, or in different ipsilateral lung lobes accessory tumor nodule of

N: Regional lymph nodes NX: Regional lymph nodes not evaluable N0: No regional lymph node metastases N1: Metastasis to ipsilateral peribronchial and/or ipsilateral hilar, intrapulmonary lymph nodes, including direct invasion of the primary tumor N2: Metastasis to ipsilateral mediastinum and/or subcarinal lymph nodes N3: metastasis to contralateral mediastinum, contralateral hilum, ipsilateral or contralateral anterior scalene muscle, supraclavicular lymph nodes

M: Distant metastasis M0: No distant metastasis M1: Distant metastasis M1a: Secondary tumor nodule in contralateral lung, pleural or pericardial nodule, malignant pleural effusion (ipsilateral/contralateral), malignant pericardial effusion M1b: Other than lung M1c with single distant metastasis to one organ: multiple distant metastases to one organ or multiple organs other than the lung

The three factors of the TNM classification are combined to divide the clinical stages into 0, IA1, IA2, IA3, IB, IIA, IIB, IIIA, according to the TNM clinical staging (UICC-8 edition). It was classified into stages IIIB, IIIC, IVA, and IVB.

[Histopathological diagnosis of lung cancer]
Tissues resected at the time of surgery from lung cancer patients were analyzed histopathologically according to standard methods.
AC: adenocarcinoma, SC: squamous cell carcinoma, squamous cell carcinoma SCLC: small cell lung carcinoma, LCC: large cell carcinoma, large cell carcinoma pleomorphic (Sarcoma), pleomorphic (sarcoma)

[Exosome preparation]
After dissolving the urine sample, 2 mL was centrifuged at 3000 g at 4° C. for 15 minutes, and the supernatant was filtered through a 0.22 μm nylon filter. Exosome preparations were obtained by separating and purifying the filtered supernatant using Exosome Isolation Kit (manufactured by Myltenyi).

The resulting exosome preparations were observed by electron microscopy. The exosome preparation was placed on a carbon/Formvar-coated TEM grid (manufactured by Okenshoji Co., Ltd.) and stained with 2% uranyl acetate for 2 minutes. Hitachi H-7600 was used as an electron microscope. As a result of observation, it was confirmed that there are spherical exosomes with a diameter of about 100 nm. A photograph is shown in FIG.

[Western blotting]
Western blotting using anti-MMP-1 antibody (abcam, NO.ab134184) for expression of MMP-1 in exosome preparations using 1/6 of exosome preparations obtained from 2 ml urine analyzed by MMP-1 was quantified by quantifying the intensity of the band detected around 54 kDa with an image analyzer (Image J 1.52a). Similarly, using a biotinylated anti-CD63 antibody (manufactured by BioLegend, NO.353017), the intensity of the band detected near 53 kDa was quantified to quantify CD63, an exosome-specific protein. Anti-MMP-1 antibody and biotinylated anti-CD63 antibody were used at 1:1000. MMP-1/CD63, which is the ratio of the expression level of MMP-1 to the expression level of CD63, was calculated by dividing the quantification result of MMP-1 by the quantification result of CD63. All experiments were performed in duplicate and mean or median values were used.
Images of bands detected by anti-MMP-1 antibody and anti-CD63 antibody are shown in FIG.

[RT-PCR]
RNA was extracted from the resulting exosome preparation using Total Exosome RNA & Protein Isolation Kit (manufactured by Thermo Fisher Scientific). Using the obtained RNA as a template, reverse transcription was performed using Taqman MicroRNA Reverse Transcription Kit (manufactured by Thermo Fisher Scientific) to synthesize cDNA. A reverse transcription reaction was performed using 5 ng of the collected miRNA to correct the amount of miRNA among many samples. Using this cDNA as a template, miR-486-5p quantitative RT-PCR was performed using miRNA-486-5p assay kit (manufactured by Applied Biosystems) according to the manufacturer's protocol. Quantitative RT-PCR of miR21 was performed using miR-21 Assay kit (manufactured by Applied Biosystems) according to the manufacturer's protocol. Duplicate reactions were performed per sample. As a quantitative RT-PCR system, Step One Plus ^™ (manufactured by Applied Biosystems) was used.

The expression level of miR-486-5p in 40 healthy subjects and the expression level of miR-486-5p in 35 lung cancer patients were calculated as relative values. ΔCT was calculated by subtracting the average CT value of miR-486-5p in all healthy subjects from the CT (Threshold Cycle) value of individual miR-486-5p in lung cancer patients or healthy subjects. However, the number of cycles of quantitative RT-PCR was different between healthy males and healthy females. Therefore, the average CT value of miR-486-5p in all healthy subjects was calculated for each sex, and the ΔCT was calculated by subtracting the value according to the sex of lung cancer patients or healthy subjects. Finally, ^2ΔCT (2 raised to the power of ΔCT) was calculated and used as the relative expression level of miR-486-5p. The value of 2Δ ^CT is hereinafter also referred to as miR-486-5p relative expression level.

The relative expression level of miR-21 in 40 healthy subjects and the relative expression level of miR-21 in 35 lung cancer patients were calculated in the same manner as the relative expression level of miR-486-5p.

〔Statistical analysis〕
Statistical analysis was performed using PRISM 7 for Mac OS X (manufactured by GraphPad Software, Inc.). Data were tested for normality and homoscedasticity to confirm the validity of parametric tests. Data following a normal distribution were subjected to Student's t-test. The Mann-Whitney U test, Wilcoxon/Kruskal-Wallis test and Bonferroni's post hoc test were used to assess differences between groups. A p-value of less than 0.05 was considered statistically significant. Data are presented as mean±standard deviation (SD) or median (95% confidence interval [CI]).

〔result〕
[Subject profile and miR-486-5p relative expression level, miR-21 relative expression level, and MMP-1 / CD63]
Lung cancer patient profile and TNM classification, clinical stage, histopathological diagnosis, MMP-1/CD63, miR-21 relative expression level (2Δ ^CT ), miR-486-5p relative expression level (2Δ ^CT ), family history Shown in Tables 1-1 and 1-2.

[Clinical characteristics and histopathological findings of lung cancer patients]
Most of the target lung cancer patients underwent health checkups, including lung cancer screening, and suspected lesions were examined using lung CT and MRI, so the cases were detected relatively early ( Tables 1-1 and 1-2).

Pathological findings of surgically resected tissue included 30 cases of non-small cell lung cancer (NSCLC), more specifically, 24 cases of adenocarcinoma (AC) (15 men, 9 women), and squamous cell carcinoma. (SC) in 5 cases (4 males, 1 female) and large cell carcinoma (LC) in 1 male. Small cell lung cancer (SCLC) was observed in 4 (3 males, 1 female) and pleomorphic (sarcoma) was observed in 1 male.

Of the 35 patients with lung cancer, 1 male had stage 0, 19 had stage I (10 males, 9 females), 5 had stage II, and 3 had stage III (2 males, 1 female). ), and 7 (6 males, 1 female) in stage IV.

Clinical data of lung cancer patients are shown in Tables 2-1 and 2-2.

In Tables 2-1 and 2-2, the number in the cigarette column indicates the current number of cigarettes smoked per day, and f (former) indicates the past number of cigarettes smoked per day. Current smokers were classified as active smokers (current), former smokers as former smokers, and non-smokers as never smokers.

Abbreviations of treatments in Tables 2-1 and 2-2 are as follows.
VATS: video-assisted thoracic surgery LUw: Left upper lobe wedge reduction RUw: Right upper lobe wedge removal RMw: Right mid dle lobe wedge reduction, right middle lobe wedge resection RLw : Right lower lobe wedge removal RUL: Right upper lobectomy LUL: Left upper lobectomy RLL: Right lower lobectomy LLL: Left lower lobectomy, left lower lobectomy R6seg : Right S6 segmentectomy, right S6 segmentectomy LPn: Left pneumonectomy, left lung resection Cx: Chest wall removal BSC: Best supportive care LLw: Left lower lobe wedge reconstruction on, left lower lobe wedge resection EGFR-TKI: EGFR-tyrosine kinase inhibitor (epidermal growth factor receptor-tyrosine kinase inhibitor), EGFR tyrosine kinase inhibitor CBDCA: carboplatin, carboplatin CPT11: irinotecan hydrochloride hyd rate, irinotecan VP16: etoposide, etoposide PEM: pemetrexed sodium hydrate, pemetrexed Pembro: pembrolizumab, pembrolizumab

Tables 3-1 and 3-2 show the profile of healthy subjects, MMP-1/CD63, miR-21 relative expression levels (2Δ ^CT ), and miR-486-5p relative expression levels (2Δ ^CT ).

MMP-1/CD63, miR-21 relative expression level (2Δ ^CT ), and miR-486-5p relative expression level (2Δ ^CT ) in lung cancer patients and healthy subjects by gender and age group (<60 years old and >60 years old) ) are shown in Table 4. Values are shown as medians [95% confidence interval (CD)].

Table 5 shows the results of comparing MMP-1/CD63 and miR-486-5p relative expression levels (2Δ ^CT ) in lung cancer patients based on smoking history and lung cancer type. Values are shown as medians [95% confidence interval (CD)].

Figure 3A shows the comparison of MMP-1/CD63 in urine-derived exosome preparations between 40 healthy subjects and 35 lung cancer patients, and Figures 3B and 3C show the results of comparison by gender. show.

The results of comparing MMP-1/CD63 in urine-derived exosome preparations based on the clinical stage of 35 lung cancer patients are shown in FIG. 3D, and the results of further comparison by gender are shown in FIGS. 3E and 3F.

The results of comparing MMP-1/CD63 in urine-derived exosome preparations based on the smoking habits of 35 lung cancer patients are shown in FIG. 3G, and the results of further comparison by gender are shown in FIGS.

The results of comparing the relative expression levels of miR-486-5p in urine-derived exosome preparations between 40 healthy subjects and 35 lung cancer patients are shown in Figure 4A, and the results of comparison by gender are shown in Figure 4B, Shown in FIG. 4C.

Figure 4D shows the results of comparing the relative expression levels of miR-486-5p in urine-derived exosome preparations based on the clinical stage of 35 lung cancer patients, and Figures 4E and 4F show the results of comparison by gender. shown in

Figure 4G shows the comparison of miR-486-5p relative expression levels in urinary exosome preparations based on the smoking history of 35 lung cancer patients, and Figures 4H and 4I show the results of comparison by gender. shown in

The results of comparing the relative expression levels of miR-21 in urine-derived exosome preparations between 40 healthy subjects and 35 lung cancer patients are shown in Figure 5A, and the results of comparison by gender are shown in Figures 5B and 5C. shown in

Figure 5D shows the comparison of miR-21 relative expression levels in urinary exosome preparations based on the clinical stage of 35 lung cancer patients, and Figures 5E and 5F show the results of comparison by gender. .

Figure 5G shows the comparison of miR-21 relative expression levels in urine-derived exosome preparations based on smoking habits of 35 lung cancer patients, and Figures 5H and 5I show the results of comparison by gender. .

[About MMP-1/CD63]
From Table 4A, MMP-1/CD63 in healthy males and females showed the same distribution tendency. In addition, MMP-1/CD63 was higher in lung cancer patients than in healthy subjects in the age groups of 60 years and under and over 60 years and in all groups of men and women. In particular, the MMP-1/CD63 levels of lung cancer patients were significantly higher than those of healthy subjects in both men and women under the age of 60.

MMP-1/CD63 was higher in lung cancer patients than in healthy subjects when comparing All (all subjects) (Fig. 3A). Median MMP-1/CD63 in lung cancer patients was 1.342 (95% CI: 0.890-1.974) and 0.600 (95% CI: 0.490-0.900) in healthy subjects. (p<0.0001). In males and females, MMP-1/CD63 was higher in lung cancer patients than in healthy subjects (FIGS. 3B and 3C), showing the same trend regardless of gender.
These results suggested that MMP-1/CD63 is useful as a biomarker for lung cancer screening.

MMP-1/CD63 was significantly higher in stage I and stage II lung cancer patients than in healthy subjects when compared All (all subjects) (Fig. 3D). MMP-1/CD63 in stage 0 and I lung cancer patients was 1.342 (95% CI: 0.888-2.319), significantly higher than in healthy subjects (p=0.0029). In addition, MMP-1/CD63 in stage II lung cancer patients was 1.795 (95% CI: 1.105-4.414), which was higher than that in healthy subjects (p=0.0077).
In addition, MMP-1/CD63 was significantly higher in stage II lung cancer patients than in healthy subjects among males (Fig. 3E). MMP-1/CD63 was significantly higher in Stage I lung cancer patients than in healthy controls among Females (FIG. 3F).
MMP-1/CD63 was found to be particularly high in stage 0, I, or II lung cancer.
These results suggested that MMP-1/CD63 is useful as a biomarker, especially for early stage lung cancer screening.

MMP-1/CD63 is significantly higher in never smokers than active smokers (current) and significantly higher than former smokers (former) when comparing All (all lung cancer patients) was high (Fig. 3G). There was no significant difference in MMP-1/CD63 by smoking history in lung cancer patients when classified as Male or Female (FIGS. 3H, 3I).

From Table 5A, MMP-1/CD63 (2.32, CI: 1.85-4.02) in adenocarcinoma (AC) patients who are nonsmokers (never) are active smokers (current) (0 .90, CI: 0.76-0.99) and former smokers (0.85, CI: 0.54-1.16).
Of the 35 lung cancer patients, 11 were never smokers (4 men, 7 women). MMP-1/CD63 was greater than 1.25 in 9 of 11 never smokers (3 men, 6 women). Interestingly, all 11 never smokers had adenocarcinoma (AC), of whom 64% (7/11) were female (Table 1). In addition, the ratio of MMP-1/CD63 was slightly higher in the AC group of never smokers than in the SC group (Table 5A). In addition, MMP-1/CD63 was elevated in small cell lung cancer (SCLC) (Table 5A).
These results revealed that MMP-1/CD63 tended to be high in adenocarcinoma (AC), especially in non-smokers, and this trend was more pronounced in women.
These results suggested that MMP-1/CD63 is useful as a biomarker for screening lung cancer (especially adenocarcinoma), especially in non-smokers (especially women).

[About miR-486-5p relative expression level]
From Table 4C, the relative expression level of miR-486-5p in males was lower than that in females in healthy subjects aged 60 years or younger (p<0.01), and in healthy subjects aged over 60 years, males miR-486-5p relative expression was higher in females than in females (p<0.05).
From Table 4C, the relative expression level of miR-486-5p was higher in lung cancer patients than in healthy subjects in total and in males in the age groups ≤60 and >60 years old, but in females, was lower in lung cancer patients than in In addition, it was revealed that the relative expression level of miR-486-5p in healthy subjects sometimes differs between sexes.

The relative expression level of miR-486-5p was higher in lung cancer patients than in healthy subjects when comparing All (all subjects) (Fig. 4A). The median value of miR-486-5p relative expression level in male lung cancer patients is 2.565 (95% CI: 1.800-4.420), and the median value in healthy males (1.254, 95% CI: 0.790-1.530) (p=0.0004, FIG. 4B). The median value of miR-486-5p relative expression level in female lung cancer patients is 0.460 (95% CI: 0.060-2.130), and the median value in healthy females (1.250, 95% CI : 0.470-2.510, p=0.1566) (Fig. 4C).
These results revealed that there may be a gender difference in the relative expression level of miR-486-5p between healthy subjects and lung cancer patients.
These results suggested that miR-486-5p relative expression level is useful as a biomarker for lung cancer screening according to gender.

The miR-486-5p relative expression level was significantly higher in stage I and stage IV male lung cancer patients than in healthy controls (Fig. 4E). The miR-486-5p relative expression level tended to be lower in stage I female lung cancer patients than in healthy subjects (Fig. 4F).
These results suggested that the relative expression level of miR-486-5p may be different in stage I lung cancer among lung cancer patients than in healthy subjects.
These results suggested that miR-486-5p relative expression level is useful as a biomarker, especially for screening of early stage lung cancer.

When the relative expression level of miR-486-5p in lung cancer patients was analyzed for all lung cancer patients, there was no significant difference depending on smoking history in both males and females (Fig. 4H, Fig. 4H). 4I).
However, looking at the data in more detail, all but two of the seven nonsmoker female lung cancer patients had miR-486-5p relative expression levels that were lower than the median of healthy females (1.250, 95% CI : 0.470-2.510, p = 0.1566) (Tables 1-1, 1-2). On the other hand, in 4 male lung cancer patients who are non-smokers, the relative expression level of miR-486-5p in 2 cases is higher than the average value of healthy male subjects (1.254, 95% CI: 0.790-1.530) was also large, and only two cases were smaller than the median of healthy male subjects. (Tables 1-1 and 1-2).
These results suggested the possibility that the relative expression level of miR-486-5p was different among lung cancer patients, especially non-smokers, than healthy subjects, and that this tendency was more pronounced in females.
These results suggest that miR-486-5p relative expression level is useful as a biomarker for lung cancer screening, especially in non-smokers (especially women).

[About miR-21 relative expression level]
From Table 4B, the relative expression level of miRNA-21 in healthy subjects was slightly higher in healthy subjects over 60 years old than in healthy subjects under 60 years old for both men and women, but there was no statistical difference. Ta. Healthy males, including those under 60 and older than 60, showed slightly higher values than healthy females, but there was no statistical difference (Table 2B).

From FIG. 5A, there was a slight difference in the relative expression level of miR-21 between lung cancer patients and healthy subjects, but the difference was not significant (p=0.4378). The same was true when the analysis was performed separately for males and females (Figs. 5B and 5C). This is because the relative expression level of miR-486-5p between lung cancer patients and healthy subjects was as low as p = 0.0004 for men and p = 0.1566 for women. It was a contrast.

From Figures 5D to 5F, no significant difference in miR-21 relative expression levels was observed depending on the clinical stage of lung cancer.
From Figures 5G to 5I, no significant difference in the relative expression level of miR-21 was observed depending on the smoking habits of lung cancer patients.

These results revealed that miR-21 relative expression level cannot determine the possibility of lung cancer. Numerous publications have reported that miR-21 is useful for the diagnosis/screening of lung cancer using circulating plasma exosomes. Contrary to expectations, miR21 contained in urinary exosomes of lung cancer patients was found to have no significant difference between that of healthy subjects.

[Relevant miR-486-5p expression level and adequacy of lung cancer determination using MMP-1/CD63]
The relative expression level of miR-486-5p and the validity of lung cancer testing using MMP-1/CD63 were examined using an ROC curve (Receiver Operating Characteristic curve). The ROC curve of MMP-1/CD63 is shown in FIG. 6A, the ROC curve of miR-486-5p relative expression level in males is shown in FIG. 6B, and the ROC curve of miR-486-5p relative expression level in females is shown in FIG. 6C.

AUROC (Area under ROC) of lung cancer test using MMP-1/CD63 was 0.755 (95% CI: 0.640-0.871) (Fig. 6A). Further, when the optimum cutoff value was 1.25, the lung cancer test using MMP-1/CD63 had a sensitivity of 0.925 and a specificity of 0.543.

Using miR-486-5p relative expression, the AUROC for lung cancer testing in men was 0.801 (95% CI: 0.669-0.939) (Fig. 6B). In addition, the sensitivity and specificity of lung cancer testing in men using miR-486-5p relative expression level were 0.850 and 0.708, respectively, when the optimal cutoff value was 2.14.

Using miR-486-5p relative expression, the AUROC for lung cancer testing in women was 0.627 (95% CI: 0.396-0.858) (Fig. 6C). In addition, the sensitivity and specificity of lung cancer testing in women using miR-486-5p relative expression level were 0.700 and 0.727, respectively, when the optimal cutoff value was 0.91.

In a lung cancer test using a combination of MMP-1/CD63 and miR-486-5p relative expression level, the optimal cutoff value for MMP-1/CD63 is 1.25, and the optimal cutoff value for miR-486-5p relative expression level is Calculating as 2.14 for males and 0.91 for females gave a sensitivity of 0.86 and a specificity of 0.85. Lung cancer tests using a combination of MMP-1/CD63 and miR-486-5p relative expression showed improved sensitivity and specificity compared to using MMP-1/CD63 or miR-486-5p relative expression alone. .
These results suggest that the combination of MMP-1/CD63 and miR-486-5p relative expression level is useful as a biomarker for lung cancer screening according to gender.

[Logistic regression analysis]
Logistic regression analysis was performed adjusting the presence or absence of lung cancer as a dependent variable, relative expression levels of MMP-1/CD63 and miR-486-5p as independent variables, and age, gender, and smoking habits as covariates. ROC analysis was applied to the prediction of the logistic regression model, and the cutoff value was calculated with the Youden index. Logistic regression analysis and its ROC analysis were performed by IBM SPSS ver 26.0.

As a result of the analysis, the relationship between MMP-1/CD63 and the presence or absence of lung cancer has an odds ratio of 31.70 (95% CI: 4.12-243.67), and the relationship between the relative expression level of miR-486-5p and the presence or absence of lung cancer. had an odds ratio of 1.56 (95% CI: 1.01-2.42), and both MMP-1/CD63 and miR-486-5p relative expression levels were significantly associated with the presence or absence of lung cancer. Ta. Based on this model, the ROC curve and AUROC of a lung cancer test using a combination of MMP-1/CD63 and miR-486-5p relative expression levels were calculated. 954 (95% CI: 0.908-1.000), sensitivity was 89% and specificity was 88%, demonstrating high prediction accuracy.

SEQ ID NO: 1: nucleic acid sequence of miR-486-5p

Claims (3)

Step of measuring the expression level of microRNA-486-5p (miR-486-5p) contained in urinary exosomes of interest (A1),
The step of measuring the expression level of matrix metalloprotease-1 (MMP-1) contained in urinary exosomes of the subject (B1),
The step of measuring the expression level of exosome-specific proteins contained in the urinary exosomes (B2), and
Step of calculating the expression level of the MMP-1 / the expression level of the exosome-specific protein (B3)
A method for testing lung cancer, comprising
When the subject is male, the expression level of miR-486-5p obtained in step (A1) is greater than the reference value (M), and the expression level of MMP-1 obtained in step (B3) / Exosome-specific protein expression level is greater than the reference value (T), the subject is likely to be suffering from lung cancer,
When the subject is female, the expression level of miR-486-5p obtained in step (A1) is lower than the reference value (F), and the expression level of MMP-1 obtained in step (B3) / Exosome-specific protein expression level is greater than the reference value (T), the subject is likely to be suffering from lung cancer,
The reference value (M) is the expression level of miR-486-5p contained in urinary exosomes of healthy male subjects,
The reference value (F) is the expression level of miR-486-5p contained in urinary exosomes of healthy female subjects,
The reference value (T) is the expression level of MMP-1 contained in urinary exosomes of healthy individuals / the expression level of exosome-specific proteins contained in the urinary exosomes, an inspection method. The test method according to claim 1 , wherein the exosome-specific protein is CD63. Includes exosome preparation reagents to isolate and purify exosomes from urine , microRNA-486-5p (miR-486-5p) measurement reagents, matrix metalloprotease-1 (MMP-1) measurement reagents, and exosome-specific protein measurement reagents , a urine test kit for lung cancer evaluation.