JP7311878B2 - Cytotoxicity inhibitor and HO-1 gene expression enhancer - Google Patents

Description

TECHNICAL FIELD The present invention relates to oral compositions, food and drink compositions, and cytotoxic agents. More particularly, the present invention relates to a composition and a cytotoxicity inhibitor that have an excellent cytotoxicity inhibitory effect and are safe.

The oral cavity is covered with a type of mucous membrane called oral mucosa, except for the teeth. Aphthous stomatitis, catarrhal stomatitis, ulcerative stomatitis, and the like are known as diseases that occur in the oral mucosa, and symptoms appear widely even in healthy people.

For example, aphthous stomatitis produces grayish-white spots with a diameter of several millimeters on the oral mucosa, accompanied by pain. When eating, the stimulus caused by food may cause severe pain, and in severe cases, it may be impossible to eat. This aphthous stomatitis is the most common type of stomatitis, and it is known that an increase in oxidative stress is involved in its onset.

In addition, stomatitis is said to be the most frequent side effect occurring in the mouth of patients undergoing chemotherapy with anticancer drugs or radiotherapy. One of the mechanisms of action of anticancer drugs is to release active oxygen to kill cancer cells. However, since anticancer drugs act on cells other than cancer cells, normal cells are also damaged by active oxygen, which manifests as stomatitis. Also, in radiation therapy, when radiation is irradiated into the oral cavity, the radiation reacts with moisture in that part to generate active oxygen. In this way, it is known that there is a relationship between active oxygen and stomatitis in chemotherapy and radiotherapy using anticancer drugs, and it is desirable to suppress active oxygen to prevent this. there is

Conventionally, drugs such as antibiotics, ethyl benzoate, xylocaine, and corticosteroids have been administered for the treatment of stomatitis. In recent years, drugs containing lafutidine and/or a salt thereof as an active ingredient have also been developed (see Patent Document 1).

JP 2009-29745 A

However, drugs conventionally used to treat stomatitis have side effects if abused, and must be used carefully under the guidance of a doctor. In addition, it was almost impossible to use these drugs continuously for prophylaxis. Therefore, there is a demand for the development of a new composition that is highly effective, has few side effects, and is safe even for long-term use.

Therefore, the main object of the present invention is to provide a safe composition and a cytotoxicity inhibitor having an excellent cytotoxicity-inhibiting effect.

The present invention provides a cytotoxicity suppressing agent comprising blueberry honey as an active ingredient, wherein the blueberry honey increases the expression level of HO (heme oxygenase)-1 gene and suppresses damage to intraoral cells. do .
The present invention also provides an agent for increasing the expression level of HO (heme oxygenase)-1 gene in oral cells containing blueberry honey as an active ingredient .
The cytotoxic agent according to the present invention or the expression level increasing agent according to the present invention may be used at a concentration of 0.6% (w/v) or higher.
Also, the blueberry honey may be from Canada.

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to provide a safe composition and a cytotoxicity inhibitor having an excellent cytotoxicity-suppressing effect.
Note that the effects described here are not necessarily limited, and may be any of the effects described in the present disclosure.

A and B are drawing-substituting graphs comparing the cytotoxic effects of blueberry honey and other honeys. A and B are drawing-substituting graphs comparing the cytotoxic effects of blueberry honey and other honeys. Fig. 10 is a drawing-substituting graph showing the evaluation results of the cytotoxicity inhibitory effect at each concentration of blueberry honey. Fig. 10 is a drawing-substituting graph showing the evaluation results of the cytotoxicity inhibitory effect when blueberry honey was added in advance. It is a drawing substitute graph which showed the examination result of an action mechanism.

Preferred embodiments for carrying out the present invention will be described below.
The embodiments described below are examples of representative embodiments of the present invention, and the scope of the present invention should not be construed narrowly.

1. Oral Composition The oral composition according to the present invention is characterized by containing blueberry honey as an active ingredient.

In the present invention, the blueberry honey may be blueberry honey as long as it uses blueberry as a nectar source plant, and the type and variety of blueberry are not particularly limited. Also, the place of production is not particularly limited, and for example, honey can be produced in Canada, and more specifically, it can be honey collected in Quebec or British Columbia.

The amount of blueberry honey blended in the composition for oral cavity according to the present invention is not particularly limited, and can be appropriately selected.

The use of the composition for oral cavity according to the present invention is not particularly limited, and it can be used for the prevention and/or treatment of various diseases occurring in the oral cavity based on its excellent cytotoxicity inhibitory effect. It is preferably used for therapy. In the present specification, "stomatitis" basically means inflammation that occurs in the oral mucosa. It is a broad concept that also includes

Moreover, in the present invention, it is more preferable to use for the prevention and/or treatment of stomatitis, which is considered to be related to oxidative stress and active oxygen among stomatitis. Specifically, it is used for the prevention and/or treatment of stomatitis occurring in the mouth of patients undergoing chemotherapy or radiotherapy with aphthous stomatitis or anticancer drugs.

The oral composition according to the present invention can be produced by a conventionally known method, and can be liquid, liquid, gel, paste, gum, solid, and the like. Specifically, for example, dentifrice (e.g., toothpaste, moisturizing dentifrice, liquid dentifrice, liquid dentifrice, mouthwash, etc.), paste composition (e.g., oral pasta, gingival massage cream, etc.), oral freshener ( For example, tablets, chewing gums, troches, candies, edible films, sprays, etc.).

The oral cavity composition according to the present invention may optionally contain known optional ingredients as long as the effects of the present invention are not impaired. Specifically, abrasives, binders, thickeners (wetting agents), surfactants, sweeteners, preservatives, fragrances, various active ingredients, solvents, pH adjusters and the like can be blended.

Specific examples of the optional ingredients are shown below, but the ingredients that can be blended in the oral composition according to the present invention are not limited to these.

Examples of abrasives include crystalline silica, amorphous silica, silica gel, silica-based abrasives such as aluminosilicate, zeolite, calcium hydrogen phosphate anhydrate, calcium hydrogen phosphate dihydrate, calcium pyrophosphate, calcium carbonate, Aluminum hydroxide, alumina, magnesium carbonate, magnesium tertiary phosphate, zirconium silicate, calcium tertiary phosphate, hydroxyapatite, quaternary calcium phosphate, synthetic resin abrasives, etc., may be used alone or in combination of two or more. can be used

Binders include, for example, pullulan, gelatin, methylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, sodium carboxymethylcellulose, carrageenan, sodium alginate, xanthan gum, sodium polyacrylate, gum arabic, guar gum, locust bean gum, polyvinyl alcohol, polyvinyl pyrrolidone, etc., and these can be used singly or in combination of two or more.

Examples of thickeners (wetting agents) include sugar alcohols such as sorbitol and arabitol, and polyhydric alcohols such as propylene glycol, butylene glycol, glycerin, and polyethylene glycol. can be used.

Surfactants such as anionic surfactants and nonionic surfactants can be used as the surfactant. Specifically, for example, anionic surfactants such as N-acyl amino acid salts, α-olefin sulfonates, N-acyl sulfonates, alkyl sulfates, sulfates of glycerin fatty acid esters, polyoxyethylene alkyl ethers, Nonionic surfactants such as polyoxyethylene-polyoxypropylene block copolymers, polyoxyethylene hydrogenated castor oil, polyoxyethylene ethers of glycerin esters, sucrose fatty acid esters, alkylolamides, etc., are listed. Or it can be used in combination of two or more.

Sweeteners include, for example, saccharides such as sugar, fructose, oligosaccharides and maltose, saccharin sodium, aspartame, stevioside, stevia extract, paramethoxycinnamic aldehyde, neohesperidyl dihydrochalcone, perillartine acesulfame potassium, sucralose, thaumatin, Disodium glycyrrhizinate, stevia extract, licorice extract, thaumatin, D-xylose, erythritol, sorbitol, maltitol, xylitol, etc., may be used alone or in combination of two or more.

Examples of the antiseptic include sodium benzoate, methylparaben, ethylparaben, paraoxybenzoic acid esters such as butylparaben, ethylenediaminetetraacetate, benzalkonium chloride and the like, which are used singly or in combination of two or more. be able to.

Flavors include peppermint oil, spearmint oil, anise oil, eucalyptus oil, wintergreen oil, cassia oil, clove oil, thyme oil, sage oil, lemon oil, orange oil, peppermint oil, cardamom oil, coriander oil, mandarin oil, Lime oil, lavender oil, rosemary oil, laurel oil, chamomile oil, caraway oil, marjoram oil, bay oil, lemongrass oil, origanum oil, pine needle oil, neroli oil, rose oil, jasmine oil, grapefruit oil, sweetie Natural fragrances such as oil, yuzu oil, iris concrete, absolute peppermint, absolute rose, orange flower, etc., and processing of these natural fragrances (e.g., pre-reservoir cut, post-reservoir cut, fractional distillation, liquid-liquid extraction, essence , powdered perfume, etc.), l-menthol, carvone, anethole, cineol, methyl salicylate, cinnamic aldehyde, eugenol, 3-l-menthoxypropane-1,2-diol, thymol, linalool, linalyl acetate, Limonene, menthone, menthyl acetate, N-substituted-paramenthane-3-carboxamide, pinene, octylaldehyde, citral, pulegone, carbyl acetate, anisaldehyde, ethyl acetate, ethyl butyrate, allyl cyclohexane propionate, methyl anthranilate , ethylmethylphenylglycidate, vanillin, undecalactone, hexanal, butanol, isoamyl alcohol, hexenol, dimethylsulfide, cyclotene, furfural, trimethylpyrazine, ethyllactate, ethylthioacetate, strawberry flavor, apple flavor, banana Flavors, pineapple flavors, grape flavors, mango flavors, butter flavors, milk flavors, mixed flavors such as fruit mix flavors, tropical fruit flavors, and other conventionally known flavor materials used in oral compositions can be used in combination.

Various active ingredients include, for example, bactericidal or antibacterial agents such as chlorhexidine, triclosan, isopropylmethylphenol, cetylpyridinium chloride, zinc gluconate and zinc citrate, and anticalculus agents such as condensed phosphate and ethanehydroxydiphosphonate. , tranexamic acid, anti-inflammatory agents such as glycyrrhizin dipotassium salt, coating agents such as hydroxyethyl cellulose dimethyldiallylammonium chloride, enzyme agents such as dextranase and mutanase, allantoin chlorohydroxyaluminum, ascorbic acid, lysozyme chloride, glycyrrhizic acid and its Examples include salts, astringents such as sodium chloride and aluminum lactate, and hypersensitivity inhibitors such as strontium chloride and potassium nitrate.

As the solvent, for example, ethanol, water, or the like can be blended.

pH adjusters include acetic acid, hydrochloric acid, sulfuric acid, nitric acid, citric acid, phosphoric acid, malic acid, gluconic acid, maleic acid, succinic acid, glutamic acid, sodium hydroxide, potassium hydroxide, sodium acetate, sodium carbonate, citric acid Acids and alkalis such as sodium, sodium hydrogen citrate, sodium phosphate and sodium hydrogen phosphate, buffers and the like.

2. Food and Beverage Composition The present invention also provides a food and beverage composition containing blueberry honey and used for the prevention and/or treatment of stomatitis.

The food and drink composition according to the present invention utilizes its excellent preventive and/or therapeutic effect on stomatitis, and is a health food and functional food for humans or animals with a concept of use such as prevention and/or treatment of stomatitis. As an active ingredient in sexual foods, foods for the sick, enteral nutrition foods, foods for special dietary uses, foods with health claims, foods for specified health uses, foods with function claims, foods with nutrient function claims, etc. It is possible to use it by blending with.

The food and drink provided using the food and drink composition according to the present invention can be in any form such as liquid, paste, solid, powder, etc. Examples include flour products, instant foods, processed agricultural products, processed marine products, processed livestock products, milk/dairy products, oils and fats, basic seasonings, compound seasonings/foods, frozen foods, confectionery, and beverages. It can be used as a commercially available food or the like.

Examples of dairy products include fermented milk, milk beverages, lactic acid beverages, sweetened condensed milk, skim milk powder, sweetened milk powder, modified milk powder, cream, cheese, butter, and ice creams. Wheat flour products include, for example, bread, macaroni, spaghetti, noodles, cake mixes, fried chicken flour, and bread crumbs. Examples of instant foods include instant noodles, cup noodles, retort/cooked foods, cooked canned foods, microwave oven foods, instant soups/stews, instant miso soups/soups, canned soups, freeze-dried foods, and other instant foods. be done. Examples of processed agricultural products include canned agricultural products, canned fruits, jams and marmalades, pickles, boiled beans, dried agricultural products, and cereals (processed grain products). Examples of processed marine products include canned marine products, fish hams and sausages, fish paste products, marine delicacies, boiled fish cakes, and the like. Examples of processed livestock products include canned livestock products, pastes, livestock hams, sausages, and the like. Fats and oils include, for example, butter, margarines, and vegetable oils. Examples of basic seasonings include soy sauce, miso, sauces, processed tomato seasonings, mirin, and vinegar. Complex seasonings/foods include, for example, cooking mixes, curry ingredients, sauces, dressings, noodle soups, spices, and other complex seasonings. Frozen food includes, for example, material frozen food, half-cooked frozen food, cooked frozen food, and the like.

Confectionery includes, for example, caramels, candies, chewing gums, chocolates, cookies, biscuits, cakes, pies, snacks, crackers, Japanese confections, rice confections, bean confections, dessert confections, and other confectionery. Examples of beverages include carbonated drinks, natural fruit juices, fruit juice drinks, soft drinks containing fruit juice, pulp drinks, fruit drinks containing fruit, vegetable drinks, soy milk, soy milk drinks, coffee drinks, tea drinks, powdered drinks, and concentrated drinks. , sports drinks, nutritional drinks, alcoholic beverages, and other beverages of choice. Examples of commercially available foods other than those described above include furikake (sprinkle) and dried laver.

3. Cytotoxicity inhibitor The present invention also provides a cytotoxicity inhibitor containing blueberry honey as an active ingredient.

The cytotoxicity inhibitor according to the present invention is useful for the prevention and/or treatment of various diseases associated with cytotoxicity by utilizing its excellent cytotoxicity inhibitory effect. In addition, the cytotoxicity inhibitor according to the present invention can be used in the form of pharmaceuticals, quasi-drugs, food and drink, feed, etc., based on its intended use.

The cytotoxicity suppressed by the cytotoxicity inhibitor according to the present invention is not particularly limited, but is preferably based on active oxygen, more preferably based on hydrogen peroxide.

Cells protected by the cytotoxicity inhibitor according to the present invention are not particularly limited, but are preferably intraoral cells, and more preferably buccal mucosa-derived cells.

The cytotoxicity inhibitor according to the present invention can be prepared by adding it to conventionally known pharmaceuticals, quasi-drugs, food and drink, feeds, etc., or by mixing the cytotoxicity inhibitor with the raw materials. pharmaceuticals, quasi-drugs, food and drink, feed, and the like. When the cytotoxicity inhibitor according to the present invention is used as a drug, quasi-drug, food or drink, feed, or the like, it may be used as it is, after concentration, or after being processed into a solid, granular, or powdered form. may be used. In addition, the cytotoxicity inhibitor according to the present invention can be used in combination with a conventionally known compound or a compound having a cytotoxicity inhibitory effect that will be discovered in the future.

The present invention will be described in more detail below based on examples.
It should be noted that the examples described below are examples of representative examples of the present invention, and the scope of the present invention should not be construed narrowly.

<<Experimental Example 1: Cell damage inhibition evaluation>>
In Experimental Example 1, the cytotoxicity inhibitory effect of various honeys was evaluated. A cell line derived from human buccal squamous cell carcinoma (HO-1-N-1 cells) in which cytotoxicity was induced by hydrogen peroxide is known as a stomatitis model cell (Jpn. J. Pharm. Health Care Sci. ., 35(4), pp.247-253, 2009).

[Experiment material]
・HO-1-N-1 cells (cell number JCRB0831): cell line derived from human buccal squamous cell carcinoma (Proc. Jpn. Cancer Assoc., 45, pp.242-242, 1986), National Research and Development Agency National Institute of Health Sciences・Purchased from JCRB Cell Bank, Institute of Health and Nutrition ・Dulbecco's Modified Eagle Medium/F12 [1:1] Medium: DMEM/F12 [1:1] (Fujifilm Wako Pure Chemical Industries, Ltd.)
・Fetal bovine serum: FETALBOVINE SERUM (PAN Biotech, hereinafter abbreviated as “FBS”)
・ Dulbecco's Phosphate-Buffered Saline (-): (Fujifilm Wako Pure Chemical Industries, Ltd., hereinafter abbreviated as "D-PBS (-)")
・Antibiotics: penicillin (10,000U/mL)/streptomycin (10,000μg/mL) mixture (Nacalai Tesque Co., Ltd.)
・Hydrogen peroxide: (Nacalai Tesque Co., Ltd., hereinafter abbreviated as “H ₂ O ₂ ”)
・Blueberry honey ・Manuka honey ・Hundred flower honey ・Clover honey ・Acacia honey ・Fir tree honey ・Cherry honey ・Jarra honey ・Chestnut honey ・Cell Counting Kit-8 (hereinafter abbreviated as “CCK-8”) Research Institute)
・96-well plate (Thermo Fisher Scientific Co., Ltd.)
・Filter (pore size 0.45 μm, Thermo Fisher Scientific Co., Ltd.)

[Preparation of each reagent]
- Inactivated FBS: FBS stored frozen was thawed at room temperature, treated at 56°C for 30 minutes, then dispensed and stored frozen at -20°C for use.
・Base medium: 40 mL of DMEM/F12 [1:1] was mixed with 4 mL of inactivated FBS (final concentration 9%) and 0.2 mL of antibiotic (final concentration 50 IU/mL penicillin-50 μg/mL streptomycin).
• H ₂ O ₂ : H ₂ O ₂ was diluted with D-PBS (-) to prepare a 20 mM H ₂ O ₂ solution (freshly prepared).
- A 25% (w/v) dilution was prepared by mixing each honey with the basal medium and filtered through a 0.45 µm filter. The 25% (w/v) dilution was further diluted with basal medium to prepare 0.16% to 5.00% (w/v) dilutions of honey.

[Evaluation method for cytotoxicity inhibitory effect]
HO-1-N-1 cells were seeded at 7500 cells/100 μL/well in a 96-well plate and cultured in a 37 °C, 5% CO ₂ incubator. After culturing for about 24 hours, the medium was removed from each well, and medium containing H ₂ O ₂ was added to control wells (final concentration 1 mM). Similarly, 95 μL of 0.63, 1.25 and 2.50% (w/v) honey dilutions (final concentrations of 0.60%, 1.19% and 2.38%) (blueberry honey only, plus 0.16 and 0.32%) were added to the test sample wells. (w/v) of honey dilution (0.15% and 0.30% final concentration)) and 5 μL of ₂₀ mM _H2O2 (final concentration 1 mM) were added. Wells to which neither H ₂ O ₂ nor the test sample was added were treated as the untreated group, and wells containing only the cell-free medium were treated as blanks. Three wells were treated the same on each plate (n=3). In addition, 6 wells were used for the control only. Cell viability was measured by CCK-8 assay 3 hours after addition of H ₂ O ₂ .

[CCK-8assay method]
After removing the culture medium from each well of the 96-well plate and washing twice with D-PBS (-), 110 μL each of 9% CCK-8 solution (91% is basal medium) was added to all wells. After reacting for 90 minutes in a 37°C, 5% CO ₂ incubator, absorbance at 450 nm was measured with a plate reader (Powerscan HT, DS Pharma Biomedical Co., Ltd.).

The cell viability (%) of each sample was calculated by the following formula.
Cell viability (%) = [(As-Ab)/(Ac-Ab)] x 100
As: absorbance _of test sample group (wells containing cells, test sample and _H2O2 )
Ac: Absorbance _of untreated group (wells containing cells but without test sample and _H2O2 )
Ab: blank absorbance (no cells, medium only wells)

〔Statistical analysis〕
After confirming that the variance of each group was equal variance by Bartlett's test, Dunnett's multiple comparison test was performed. A group treated with 1 mM H ₂ O ₂ without adding honey was used as a control for the cytotoxicity-inhibiting effect of each concentration of honey. Statistical significance was determined when the significance level was less than 5% (p<0.05).

<Test results>
Figures 1 and 2 show the results of comparing the cytotoxic effects of blueberry honey (final concentration 1.19%) and other honeys. Moreover, FIG. 3 shows the evaluation results of the cytotoxicity inhibitory effect at each concentration of blueberry honey.

<Discussion>
Nine different honeys were evaluated, and blueberry honey showed a protective effect against hydrogen peroxide-induced cytotoxicity at about 1% addition. On the other hand, manuka honey, which is known to have high antibacterial activity, and chestnut honey, which is known to have high antioxidant activity (J Food Biochem., 41(3), pp.1-12, 2017), hydrogen peroxide It showed no protective effect against induced cytotoxicity.

In addition, when the concentration of blueberry honey and its cytotoxicity inhibitory effect were examined, it was found that blueberry honey exhibits a significant cytotoxicity inhibitory effect even at a low concentration of 0.6%.

Furthermore, the inventors of the present invention also examined the cytotoxicity-suppressing effect of different blueberry honey lots and production areas.

<<Experimental Example 2: Cell damage suppression evaluation by prior addition of blueberry honey>>
In Experimental Example 2, the cytotoxicity inhibitory effect when blueberry honey was added in advance was evaluated.

Experimental materials, preparation of each reagent, CCK-8assay method, and statistical analysis conformed to Experimental Example 1 described above.

[Evaluation method for cytotoxicity inhibitory effect]
The seeding number and culture conditions of HO-1-N-1 cells conformed to Experimental Example 1. Media was removed from each well and 100 μL of 0.31%-2.50% (w/v) blueberry honey dilution was added. After culturing for 24 hours, the cells were washed twice with D-PBS(-), and 95 μL of basal medium and 5 μL of 20 mM H ₂ O ₂ (final concentration 1 mM) were added. Control wells were treated similarly using medium instead of honey. Cell viability was measured by CCK-8 assay 3 hours after addition of H ₂ O ₂ .

<Test results>
FIG. 4 shows the evaluation results of the cytotoxicity inhibitory effect when blueberry honey was added in advance.

<Discussion>
Even when blueberry honey was added in advance, a significant cytotoxicity inhibitory effect was confirmed. Therefore, it was suggested that even if blueberry honey is used prophylactically, a sufficient effect is exhibited. In addition, blueberry honey is highly safe, and even if it is used for a long period of time for the purpose of prevention, it is considered that there is no concern about side effects.

<<Experimental Example 3: Examination of mechanism of action>>
In Experimental Example 3, the action mechanism of the cytotoxicity inhibitory effect of blueberry honey was investigated.

[Experiment material]
・Isogen II (Nippon Gene Co., Ltd.)
・SuperScript (registered trademark) III First-Strand Synthesis SuperMix for qRT-PCR (Invitrogen Co., Ltd.)
・Platinum (registered trademark) SYBR (registered trademark) Green qPCR SuperMix-UDG (Invitrogen Co., Ltd.)
・96-well plate for quantitative PCR (BIO-BIK, Ina Optica Co., Ltd.)
・PCR primer [1] human heme oxygenase 1 (HO-1) gene primer for quantitative PCR ・h HO-1 forward primer; AAGACTGCGTTCCTGCTCAA (SEQ ID NO: 1)
・h HO-1 reverse primer; GGCAGAATCTTGCACTTTGTTG (SEQ ID NO: 2)
[2] Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH, internal standard) gene primer for quantitative PCR hGAPDH forward primer; AAGGTGAAGTCGGAG (SEQ ID NO: 3)
・ hGAPDH reverse primer; GGGGTCATTGATGGCA (SEQ ID NO: 4)

[Cell test]
The seeding number and culture conditions of HO-1-N-1 cells conformed to Experimental Example 1. Medium was removed from each well and medium containing H ₂ O ₂ (final concentration 1 mM) was added to control wells. Similarly, 95 μL of 1.25% (w/v) blueberry honey or acacia honey diluent (both final concentrations of 1.19% (w/v)) and 5 μL of 20 mM H ₂ O ₂ (final concentration) were added to the test sample wells. concentration 1 mM) was added. In addition, in wells to which D-PBS(-) was added instead of H ₂ O ₂ , the influence of each test sample alone was also evaluated. In order to secure the amount of RNA required for subsequent experiments, 16 wells on each plate were treated the same. Three hours after H ₂ O ₂ addition, medium was removed from all wells and Isogen II was added at 50 μL each. 16 wells were collectively collected and used for subsequent experiments. The same test was performed three times using cells of passage number 60, 62 and 64.

[Total RNA extraction]
RNA extraction from cells was performed according to the Isogen II protocol. That is, the cell lysate (800 μL) collected with Isogen II was vortexed, and 0.4 volumes of sterilized Milli-Q water was added. Vortex for 15 seconds and let sit at room temperature for 15 minutes. After centrifugation at 12000 rpm for 15 minutes, 800 μL of supernatant was transferred to a new tube. An equal amount (800 µL) of isopropanol was added, mixed by inversion, and allowed to stand at room temperature for 10 minutes. Centrifuge at 12000 rpm for 10 minutes and remove the supernatant. 1 mL of 75% ethanol was added to the precipitate, centrifuged at 11000 rpm for 3 minutes, and the supernatant was removed. After drying for 10 minutes at room temperature, 12 μL sterile Milli-Q water was added and vortexed to dissolve the precipitate. The RNA concentration was calculated from the absorbance of each sample and diluted to 0.05 μg/μL. It was confirmed from the ratio of 28S and 18S rRNA in agarose electrophoresis that RNA was not degraded.

[Reverse transcription PCR]
SuperScript (registered trademark) III First-Strand Synthesis SuperMix for qRT-PCR was used to synthesize cDNA from total RNA. Specifically, 4 μL (0.2 μg) of total RNA was mixed with 5 μL of 2×RT Reaction Mix and 1 μL of RT Enzyme Mix, placed in an 8-tube for PCR, and placed in a quantitative PCR device (7300 Real Time PCR system, Applied Biosystems). bottom. The mixture was reacted at 25°C for 10 minutes, 50°C for 30 minutes, and 85°C for 5 minutes, and allowed to stand at 4°C. 0.5 µL of RNaseH was added to each tube on ice, and the tubes were again set in the quantitative PCR apparatus and reacted at 37°C for 20 minutes to synthesize cDNA. A portion of the cDNA solution was pooled and used for the standard curve. Sterilized Milli-Q water was added to each individual tube to prepare a 5-fold diluted cDNA solution. Stored at -20°C until use.

[Quantitative PCR]
Quantitative PCR analysis was performed using Platinum® SYBR® Green qPCR SuperMix-UDG. That is, after mixing Super Mix, ROX, primers (concentration HO-1: 200 nM, GAPDH: 300 nM) and sterilized milli-Q water in a 5-fold diluted cDNA solution, quantitative PCR (7300 Real Time PCR system, Applied Biosystems) was performed. The PCR conditions were 50°C for 2 minutes, 95°C for 2 minutes, followed by <95°C for 15 seconds, 60°C for 1 minute> for 40 cycles. The standard curve cDNA mixture was serially diluted (2.5-fold, 5-fold and 10-fold) to create a standard curve for each gene. For data analysis, a threshold was set to obtain linearity of the calibration curve, and a relative quantification value was obtained from the Ct value of each sample (Qty). This was corrected by the relative quantified value of GAPDH, and the relative expression level was calculated with the average value of the control group being 1 (ratio). Quantitative PCR was performed once per gene.

〔Statistical analysis〕
After confirming that the variance of each group was equal by Bartlett's test, Dunnett's multiple comparison test was performed. To evaluate the effect of the test sample alone, the honey-added group was compared to the control group. To evaluate _{the effect of honey when H2O2 was added, the H2O2 + honey group was compared with the H2O2 added group as a control} . Statistical significance was determined when the significance level was less than 5% (p<0.05).

<Test results>
FIG. 5 shows the results of examination of the mechanism of action.

<Discussion>
In addition to degrading harmful free heme, HO (heme oxygenase)-1 reduces cells to oxidative stress by producing carbon monoxide (CO), which has anti-inflammatory properties, and bilirubin, which acts as an antioxidant. believed to protect against As a result of gene expression analysis, it was found that blueberry honey alone significantly increased HO-1 gene expression level, and co-treatment with H ₂ O ₂ significantly increased HO-1 gene expression level. . On the other hand, with acacia honey, which had no cytotoxicity inhibitory effect, no increase in HO-1 gene expression was observed in either case of acacia honey alone treatment or simultaneous treatment with H ₂ O ₂ .

The composition and cytotoxicity inhibitor according to the present invention have an excellent cytotoxicity inhibitory effect. In addition, since the active ingredient is blueberry honey, it is highly safe and has no side effects even when used for a long period of time. It is useful in a wide range of fields.

Claims (4)

A cytotoxicity suppressing agent comprising blueberry honey as an active ingredient, wherein the blueberry honey increases the expression level of HO (hemoxygenase)-1 gene and suppresses damage to intraoral cells . An agent for increasing the expression level of HO (heme oxygenase)-1 gene in intraoral cells , containing blueberry honey as an active ingredient . 3. The cytotoxicity inhibitor according to claim 1 or the expression level increasing agent according to claim 2 , which is used at a concentration of 0.6% (w/v) or higher. 3. The cytotoxicity suppressing agent according to claim 1 , or the expression level increasing agent according to claim 2 , wherein the blueberry honey is produced in Canada.